Embed Size (px)
Citation preview
Nitric Oxide 23 (2010) 51–59
Contents lists available at ScienceDirect
Nitric Oxide
journal homepage: www.elsevier .com/locate /yniox
Effect of paraquat exposure on nitric oxide-responsive genes in ratmesencephalic cells
José M. Morán 1,*, Miguel A. Ortiz-Ortiz 1, Luz M. Ruiz-Mesa, Mireia Niso-Santano, Jose M. Bravosanpedro,Rubén Gómez Sánchez, Rosa A. González-Polo, José M. Fuentes **
Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Departamento de Bioquímica y Biología Molecular y Genética,EU Enfermería y TO, Universidad de Extremadura, Avda Universidad s/n 10071 Cáceres, Spain
a r t i c l e i n f o
Article history:Received 3 August 2009Revised 24 February 2010Available online 11 April 2010
Keywords:Nitric oxideParaquatGene expressionNeurotoxicity
1089-8603/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.niox.2010.04.002
* Correspondence to: José M. Morán, Nursing DepUniversity of Extremadura, Avd. de Elvas s/n, 06006-257451.** Corresponding author. Fax: +34 927 257451.
E-mail addresses: [email protected] (J.M. MorFuentes).
1 These authors contributed equally to this work.
a b s t r a c t
When neural cells are exposed to paraquat, nitric oxide generation increases primarily due to an increasein the expression of the inducible isoform of nitric oxide synthase. The nitric oxide generated has contro-versial actions in paraquat exposure, as both protective and harmful effects have been described previ-ously. While the actions mediated by nitric oxide in neural cells have been well described, there isevidence that nitric oxide may also be an important modulator of the expression of several genes duringparaquat exposure. To better understand the actions of nitric oxide and its potential role in paraquat-induced gene expression, we examined changes in GCH1, ARG1, ARG2, NOS1, NOS2, NOS3, NOSTRIN,NOSIP, NOS1AP, RASD1, DYNLL1, GUCY1A3, DDAH1, DDAH2 and CYGB genes whose expression is con-trolled by or involved in signaling by the second messenger nitric oxide, in rat mesencephalic cells after3, 6, 12 and 24 h of paraquat exposure. A qPCR strategy targeting these genes was developed using a SYBRgreen I-based method. The mRNA levels of all the genes studied were differentially regulated duringexposure. These results demonstrate that nitric oxide-related genes are regulated following paraquatexposure of mesencephalic cells and provide the basis for further studies exploring the physiologicaland functional significance of nitric oxide-sensitive genes in paraquat-mediated neurotoxicity.
� 2010 Elsevier Inc. All rights reserved.
Introduction
Nitric oxide (NO) generation has been previously described fol-lowing paraquat (PQ) exposure both in vivo and in vitro [1,2], butthe specific role of nitric oxide in PQ-mediated toxicity has remainedelusive. Protective effects [3], toxic effects [1,2] and both [4] have allbeen described. The expression of human genes in human neuralcells can be modulated directly by NO [5–7] and also by NO derivatessuch peroxynitrite [8], which is robustly generated after PQ expo-sure [9]. Thus, NO or related species have been implicated in theregulation of many genes that participate in diverse biological func-tions, including programmed cell death or apoptosis.
While the mechanism by which NO regulates gene expression isnot completely understood, NO interferes with the activity of manyproteins via S-nitrosylation of cysteine thiol groups and subse-
ll rights reserved.
artment, School of Medicine,Badajoz, Spain. Fax: +34 927
án), [email protected] (J.M.
quent S-nitrosothiol formation [10,11]. The formation of S-nitroso-thiols and subsequent oxidation of thiol proteins act as a switch insignaling pathways [12]. Furthermore, S-nitrosylation can regulatemany thiol-containing enzymes and regulatory proteins, such asthe transcription factors nuclear factor kappa B (NF-jB) [13], AP-1 [14] and CREB [15], all of which are activated after PQ exposure[3,16–18].
NO is generated by nitric oxide synthases (NOSs), haemopro-teins that catalyse the oxidation of L-arginine to NO and L-citrulline[19]. NO synthesis requires tetrahydrobiopterin (BH4) as a cofactor,and one enzyme, GTP cyclohydrolase 1 (GCH1) (NM_000161), hasbeen characterised as the rate-limiting enzyme in BH4 biosynthesis[20]. L-arginine may be used as a substrate by another group ofenzymes, the arginases; thus, interest in arginases has increasedbecause they are involved in the metabolism of the multifacetedmolecule NO. The arginases catalyse the divalent cation-dependenthydrolysis of L-arginine to produce L-ornithine and urea. Althoughtraditionally considered in terms of their role as the final enzymesof the urea cycle, these enzymes are found in a variety of non-he-patic tissues [21]. Two isoforms of arginase have been previouslydescribed: arginase I (ARG1) (NM_000045), which is a cytosolic en-zyme, and arginase II (ARG2) (NM_001172), which is located in themitochondria and has a poorly understood physiologic role.
52 J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59
Arginases share substrates with the three isoforms of NOS that areregulated by distinct genes (see review in Ref. [23] by Davis et al.).Neuronal NOS (nNOS) (NM_000620), also known as NOS1, is foundin neuronal and some non-neuronal tissues. Inducible NOS (iNOSor NOS2) (NM_000625) was initially found in macrophages buthas since been identified in other cell types (e.g., hepatocytes),while endothelial NOS (eNOS or NOS3) (NM_000603) was firstidentified as the enzyme that produces endothelium-derivedrelaxing factor [22]. While both nNOS and eNOS are constitutivelyexpressed, iNOS expression can be induced by stimuli such aslipopolysaccharide or proinflammatory cytokines (e.g., tumournecrosis factor (TNF)-alpha, interleukin-1, and interferon-c) [23].These stimuli induce iNOS by activating the transcription factornuclear factor-jB (NF-jB) [24]. Recently, it has been proposedthat the production of NO by eNOS may be inhibited by intracellu-lar translocation of eNOS, which reduces NO generation. Thistranslocation is triggered by the nitric oxide synthase trafficker(NOSTRIN) (NM_052946) from the plasma membrane to vesicle-like subcellular structures, thereby attenuating eNOS-dependentNO production [25]. Furthermore, eNOS may interact withanother protein that binds to the carboxy-terminal region of theeNOS oxygenase domain, called NOSIP (NM_015953). The interac-tion of NOSIP with eNOS leads to a significant reduction ineNOS-produced NO. NOSIP and NOSTRIN promote the transloca-tion of eNOS from the plasma membrane to intracellular sites,thereby uncoupling eNOS from the plasma membrane caveolaeand inhibiting NO synthesis [26]. nNOS interacts with a cytosolicprotein called nitric oxide synthase 1 adaptor protein (NOS1AP)(NM_014697), and the complex formed may interact withother proteins, such as RAS dexamethasone-induced 1 (RASD1)(NM_016084). RASD1 activity is augmented by NO via an S-nitro-sylation mechanism, and RASD1 functions as a novel physiologicNO effector [27,31]. RASD1 exerts its actions by forming a complexwith NOS1AP, which functions as an adapter protein linking nNOSto specific targets such as RASD1 [28]. Furthermore, nNOS may beinhibited by interacting with the dynein light chain (DYNLL1)(NM_003746), which is a light chain that forms part of a large cyto-plasmic complex termed dynein. Binding of DYNLL1 destabilisesthe neuronal nitric oxide synthase dimer, a conformation neces-sary for activity, which uncoupling it and, thus, regulates numer-ous biologic processes via effects on nNOS activity [29].
NO also interacts with proteins whose activity is regulated byguanylate cyclase 1, soluble, alpha 3 (GUCY1A3) (NM_000856),which catalyses the conversion of GTP to the second messengercGMP and functions as the main receptor for NO [30].
The global amount of NO produced may be controlled by theexpression of proteins that regulate NO levels by acting as scaveng-ers. Dimethylarginine dimethylaminohydrolase 1 (DDAH1) (NM_012137), dimethylarginine dimethylaminohydrolase 2 (DDAH2)(NM_013974) and cytoglobin (CYGB) (NM_134268) are enzymesthat belong to the dimethylarginine dimethylaminohydrolase(DDAH) gene family and the haemoglobin family. DDAH1 andDDAH2 inhibit NOS activity by regulating cellular concentrationsof methylarginines, which are competitive inhibitors of L-arginine[31,32]. Meanwhile, CYGB scavenges NO and other reactive oxygenspecies [33,34].
In the present study, we evaluated the expression of genesinvolved in NO biosynthesis (GCH1, eNOS, iNOS and nNOS), genesinvolved in L-arginine metabolism (ARG1 and ARG2), genes thatencode proteins that interact with either eNOS (NOSTRIN and NO-SIP) or nNOS (NOS1AP, RASD1 and DYNLL1), and genes involved inthe response to oxidative stress (DDAH1, DDAH2 and CYGB). Wealso evaluated the expression of GUCY1A3, which is a major NOacceptor. Using real-time PCR, we analysed the expression of afocused panel of genes related to NO expression in PQ-exposedrat mesencephalic cells.
Experimental procedures
Cell line and cultures
Immortalised rat mesencephalic cells (1RB3AN27; hereafter re-ferred to as N27 cells) were grown in RPMI 1640 medium supple-mented with 10% foetal bovine serum (FBS, Hyclone, Brevieres,France), 1% L-glutamine, penicillin (100 U/ml), and streptomycin(100 U/ml). Cells were seeded and maintained at a density of1 � 106/cm2 in 75-cm2 tissue culture flasks (Corning, New York,NY) and incubated at 37 �C under saturating humidity in 5% CO2/95% air [35].
Confluent cells (’80%) in 75-cm2 tissue culture flasks weretrypsinised and seeded in 6-well cell culture plates for RNA extrac-tion at a concentration of 2.5–3.5 � 104 cells/ml. The N27 cellswere preincubated with PQ at 250 lM for 3, 6, 12 and 24 h, andunexposed cells were used as controls at each time point.
Primer design and synthesis
Optimal primer design is essential to ensure that only a singlePCR product is amplified when using real-time PCR-based SYBRgreen methodology. Primers and probes for mRNA quantificationwere designed using Primer Express (Applied Biosystems). All prim-ers spanned exon splice junctions. BLAST searches (www.ncbi.nlm.nih.gov/BLAST) revealed no significant similarity to other se-quences. The forward primer (F), reverse primer (R), and source ofthe sequence are indicated in Table 1.
RT-qPCR and data analysis
RNA was extracted using the TRIzol method, according to themanufacturer’s instructions (Ambion), followed by DNase diges-tion to minimise genomic contamination. Real-time PCR amplifica-tions were carried out using the Power SYBR� Green RNA-to-CT™1-Step kit (Power SYBR� Green RNA-to-CT™ 1-Step kit; P/N#4389986) on an ABI 7500 thermocycler, according to the manu-facturers’ instructions. In brief, for RNA-to-CT™ 1-Step, real-timePCR was performed using the following cycles: 48 �C for 30 min(for cDNA synthesis) and 95 �C for 10 min (transcriptase inactiva-tion), followed by the following cycling parameters: 95 �C for15 s and 60 �C for 1 min for 40 cycles. The resulting cDNA reactions(5 ll) were used to perform the real-time PCR. At the conclusiondissociation curve (melting curve) analyses were performed usingthe following protocol: hot start at 60 �C for 15 s followed by mea-surement of the fluorescence every 0.5 �C until 95 �C to confirmspecific amplification. SDS 2.0 software (Applied Biosystems) wasused to analyse the qPCR data.
Immunofluorescence microscopy
N27 cells were cultured on coverslips pretreated with poly-L-ly-sine. After the experimental period, the cells were first fixed withparaformaldehyde (4% w:v), then permeabilised with Triton X-100 solution (Triton 0.2% in PBS) for 10 min. After blocking for20 min with bovine serum albumin (BSA) (1 mg/ml in PBS), cellswere incubated with primary antibodies for 1.5 h at room temper-ature using antibodies directed against nNOS, iNOS and eNOS (CellSignaling Technology). Immunostaining was detected with anti-mouse and anti-rabbit immunoglobulin Alexa�fluor conjugate(Molecular Probes, Eugene, OR), and cells were finally counter-stained with Hoechst 33342 (2 lM; Sigma) before mounting. Fluo-rescence was analysed using an Olympus IX51 microscopeequipped with a DC300F camera. Quantitative measurement of
Table 1Primers designed from rat sequences for qPCR.
Gene NCBI reference sequences (RefSeq) Forward primer 50–30 Reverse primer 50–30 Predicted product size, (bp)
ACTB actin, beta NM_031144.2 CTTGCAGCTCCTCCGTCGCC GGGGCCACACGCAGCTCATT 338RASD1 XM_001077321.1 TCCTCACAGGAGACGTTTTCATA CTTTCTCATTGGTTTTGTTCTTG 421NOSTRIN NM_001024260.1 GGAGCAACGGCCAAAGCCCT TGCAAGGCCACTGGTGCGTC 197NOSIP NM_001106260.1 AGCTGGAAAAGCCGTCCCGC TGTCCCGCTCCGTCAGCGTA 294NOS1AP NM_138922.1 AGTTGGCTGCTGAGGCTGCG CAGGCAGGGCACCTGAACGG 201GUCY1A3 NM_017090.2 GAGCTGCCAGGCCACTCTGC CCTCTCCGCCTCCTGGCAGT 427GCH1 NM_024356.1 GGCCACCGCCATGCAGTTCT GGGTCTGCAAACCGGGGCTC 492DYNLL1 NM_053319.2 GCTTCGGTAGCGACCGGCTG CGATGCAGTGCCAGGTGGGG 269DDAH1 NM_022297.2 CTCTCGGGAAGACCCGGCCA GTCTCCTCGCACACCACGGC 317DDAH1 NM_212532.1 CCGTCAGGGCAATGGCAGCA CTCAGCAGTGGGGGCGTGTG 276CYGB NM_130744.2 TGCAACAGCACGAGAGGGCG GGTGTGCCCCTTTCCGGAGC 355ARG1 NM_017134.2 GGGACAGCCTCGAGGAGGGG CACCGGTTGCCCGTGCAGAT 385ARG2 NM_019168.1 CCATGCCCGACACCACCCAG GCCGACAGCAACCCTGTGCT 486NOS1 NM_052799.1 CAAGGCCATGGGCAGGGAGC CCCAGGGGCGGAGCTTTGTG 263NOS2 NM_012611.3 CCAGCTTGCCCCAACCGGAG GGGTGGTGCGGCTGGACTTC 305NOS3 NM_021838.2 TCCGCTACCAGCCTGACCCC CCGGGGGTCAAACGCCTTCC 230
J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59 53
the fluorescence signal was performed as described by Kirkeby andThomsen [36].
Nitrite Measurement
Nitrite was quantified using the Griess reaction. HCl (4 M) wasadded to the supernatant and left to stand for 10 min; then, 2 mg/ml sulphanilic acid and 1 mg/ml N-(1-naphthyl)ethylenediaminewere added. After incubation for 30 min, the absorbance was mea-sured using a spectrophotometer at a wavelength of 550 nm. Theabsorbance of each sample was compared with that of standardsodium nitrite solutions.
Statistical analysis
All experiments were repeated at least twice independently,and the measurements in each experiment were run in triplicate.Statistical analysis and the significance of the data were deter-mined using SPSS, UK software (Surry, UK), version 12.0. Resultsare presented as means ± SD. Statistical significance was deter-mined using one-way ANOVA with multiple post hoc analyses.Results were considered statistically significant with P < 0.05compared to unstimulated cells.
Results
NOS expression in PQ-exposed N27 cells
RT-qPCR analysis was performed to analyse eNOS, iNOS andnNOS mRNA levels in N27 cells exposed to 250 lM PQ (Fig. 1A).The relative expression of eNOS, iNOS and nNOS mRNA was nor-malised to actin, an endogenous non-NO-regulated gene.
eNOS mRNA levels were significantly increased in PQ-exposedcells between 6 and 12 h (6.2- and 10.7-fold with respect to con-trol) (Fig. 1A). Exposure to PQ induced a gradually upregulated re-sponse of iNOS expression, starting at 6 h (3.6-fold compared to thecontrol group) and increasing gradually until 24 h, when the high-est levels of expression (28.7-fold) were observed (Fig. 1A). After250 lM PQ exposure, N27 cells show constitutive transcription ofnNOS. PQ exposure did not affect the levels over the 24 h period(Fig. 1A).
The immunocytochemical localisation of eNOS, iNOS and nNOSprotein in N27 cells exposed to 250 lM PQ is shown in Fig. 1B. PQ-exposed cells showed a significant increase in eNOS immuno-posi-tive cells at 6 h compared with control cells (Fig. 1B). Detection ofiNOS by immunocytochemistry in control and PQ-exposed N27
cells is shown in Fig. 1B. iNOS immuno-positive cells were signifi-cantly increased between 3 and 24 h compared with control cells,showing the greatest increase at 12 h and a cytoplasmic localisa-tion of the isoenzyme. nNOS immuno-positive cells did not changein response to PQ between 3 and 24 h compared with control(Fig. 1B), and nNOS protein exhibited strong nuclear staining inPQ-exposed cells.
To determine the time-dependent generation of �NO (measuredas NO2
�), N27 cells were cultured in the presence of 250 lM PQ for0–24 h. As shown in Fig. 2, negligible amounts of NO2
� were pro-duced after 3 h of PQ exposure. Thereafter, the amount of NO2
� de-tected in PQ-exposed N27 cells increased progressively, reachingpeak levels after 24 h.
Because NO2 can be generated from sources other than �NO [37],the specificity of the �NO-derived reaction product in PQ-exposedN27 cells was determined through the use of the selective NOprobe DAF-FM, which is an important reagent for quantifyinglow concentrations of nitric oxide in solution. DAF-FM is virtuallynonfluorescent until it reacts with NO to form a fluorescent ben-zotrizole. Fluorescence produced using DAF-FM was measured byflow cytometry. Experiments with the DAF-FM probe were donein parallel, and cells were cultured with 250 lM PQ from 0 to24 h. The results are illustrated in Fig. 3 and show that PQ exposuresignificantly increased the production of NO after 6 h of incubation(Fig. 3). These findings indicate that N27 cells exposed to 250 lMPQ generate NO in a time-dependent fashion and that the NO2
�
generated was due to the induction of NOS isoforms in rat mesen-cephalic cells.
Expression of NO biosynthesis-related genes after PQ exposure in N27cells
Because we first observed that PQ exposure induces the produc-tion of NO in N27 cells and BH4 is a cofactor of this synthesis, weanalysed how PQ could affect the expression of the rate-limitingenzyme in BH4 biosynthesis, GCH1. GCH1 mRNA levels were signif-icantly increased in PQ-exposed cells between 12 and 24 h (2.5-and 7.1-fold, respectively, with respect to the control) (Fig. 4).
L-arginine is used as a substrate by NOS and arginases to pro-duce NO and urea, respectively. Because the availability of L-argi-nine is a major determinant of NO synthesis in the cell, wefurther analysed the expression of arginase mRNA in N27 mesen-cephalic cells following 250 lM PQ exposure. ARG1 mRNA levelswere significantly increased after PQ exposure for 6–24 h, rangingfrom 41.8-fold increase at 6 h to 8.4-fold increase at 24 h (Fig. 5).ARG2 mRNA was also increased after PQ exposure, with a signifi-cant increase seen after 12 h of exposure (30.3-fold) (Fig. 5).
Fig. 1. (A) eNOS, iNOS and nNOS mRNA (A) and protein (B) expression after time-dependent PQ exposure. Values are means ± SEM. *,**Significantly different (P < 0.05,
P < 0.01); n.s. not significant, from unstimulated cells.
Fig. 2. Effects of PQ on NO2� levels after time-dependent exposure. Values are
means ± SEM. *,**Significantly different (P < 0.05, P < 0.01); n.s. not significant, from
unstimulated cells.
54 J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59
Expression of the eNOS-related genes NOSIP and NOSTRIN after PQexposure in N27 cells
We exposed the N27 cells to 250 lM PQ for 3, 6, 12 and 24 h.The expression of NOSTRIN and NOSIP mRNA was assessed using
qPCR. NOSTRIN mRNA expression was increased (8.3-fold) aftertreatment with PQ for 12 h; NOSIP mRNA was also increased afterexposure to PQ. NOSIP expression was upregulated in treated cellsafter 6 and 12 h of PQ exposure (11.3- and 26.4-fold, respectively),and the levels returned to baseline after 24 h of exposure (Fig. 6).
Expression of nNOS-related genes NOS1AP, RASD1 and DYNLL1 afterPQ exposure in N27 cells
PQ induces significant changes in the expression of NOS1AP,RASD1 and DYNLL1. In the presence of 250 lM PQ, NOS1AP expres-sion was very significantly increased (12.2-fold) in N27 cells (Fig. 7).This increase was produced after 24 h of PQ exposure, but non-sig-nificant modulation of NOS1AP expression was observed at earlytimes. In contrast, PQ had a different effect on RASD1 expression.PQ exposure led to a significant increase in RASD1 expression after6 h of exposure (9.8-fold), with the highest increase after 12 h(16.1-fold), and returned to basal levels after 24 h of PQ exposurein N27 cells. Incubation of N27 with 250 lM PQ led to a rapid in-crease in DYNLL1 expression after 3 h of exposure (11.9-fold)(Fig. 7). Subsequently, DYNLL1 expression was significantly re-duced and reached basal levels after 12 h of PQ exposure.
Fig. 3. PQ stimulated N27 NO production as detected by DAF-FM. Intracellular NOwas measured by flow cytometry of DAF-FM diacetate fluorescence after 0, 3, 6, 12and 24 h of incubation of cells without or with PQ (250 lM).
Fig. 4. GCH1 mRNA expression after time-dependent PQ exposure. Values aremeans ± SEM. **Significantly different (P < 0.01); n.s. not significant, from unstim-ulated cells.
J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59 55
PQ exposure increases GUCY1A3 expression in N27 cells
To determine if GUCY1A3 mRNA was regulated in neural cells,N27 cells were exposed to 250 lM PQ for 3, 6, 12 and 24 h. Expo-sure to PQ significantly increased the levels of GUCY1A3 after 6 h ofPQ exposure, and this increase was time-dependent, as shown inFig. 8. The trend toward an increase observed after 3 h of exposurewas not statistically significant.
Genes related to the regulation of NO levels (DDAH1, DDAH2 andCYGB) upregulate after PQ exposure in N27 cells
DDAH1 and DDAH2 regulate NO generation by the synthesis ofmethylarginines, which act as competitive inhibitors of L-arginine.The expression of both enzymes was significantly increased after12 h of PQ exposure (4.7- and 4.2-fold, respectively) in N27 cells(Fig. 9). CYGB scavenges nitric oxide, and its expression was also
significantly increased after 6 h of exposure (4.4-fold), reachingpeak levels after 12 h of exposure (22.4-fold) and then reducingits expression after 24 h of exposure (6.3-fold) (Fig. 9).
Discussion
Based on observations that NO plays an important role in PQ-mediated neurotoxicity, we investigated the genes involved inNO and free radical metabolism in rat mesencephalic cells. In thisstudy, we determined the effect of PQ on NO-related gene expres-sion in N27 cells at various time points. Using a time series of expo-sure to PQ allowed us to identify early response genes and geneexpression changes over time. Data from our study indicate thatPQ has differential effects on the expression of genes related toNO and that these effects are dependent not only on the PQ expo-sure but also on the period of exposure.
In N27 cells eNOS and iNOS were significantly upregulated,whereas nNOS expression was unaffected after PQ exposure for24 h. These results are consistent with the protein expression mea-sured by immunofluorescence after PQ exposure. The expression ofiNOS after PQ exposure has been widely described in several mod-els at both the mRNA and protein levels [1,4,38]; however, this isthe first time that modulation of eNOS expression has been de-scribed following PQ exposure at both the mRNA and protein lev-els. It has been previously reported that acute stimulation of eNOSmRNA transcription depends on NF-jB, which is activated after PQexposure in neural cells [39]. In addition, p300 histone acetyltrans-ferase activity increases the acetylation of the p65 subunit of NF-jB [40]. We observed that PQ exposure leads to both the activationof NF-jB and an increase in p300 expression in the nucleus of N27cells exposed to PQ, which could explain the increase in eNOSexpression described (Fig. 1) (manuscript in preparation).
PQ exposure does not affect nNOS expression. This result sup-ports the widely held assumption that nNOS is mostly a constitu-tive isoform and that its expression cannot be easily affected bydifferent agonists. Chiueh et al. have previously described, how-ever, that nNOS expression is upregulated in vitro after exposureto the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine(MPTP), which shares structural homology with PQ [41].
We have observed that NO production in N27 cells increasedsignificantly after 6 h of exposure, reaching peak levels after 24 hof exposure. This increase starting at 6 h correlates with the in-crease in eNOS and iNOS mRNA expression and with the significantincrease observed for the protein level of both isoenzymes.
First, we analysed the levels of GCH1, the rate-limiting enzymein BH4 biosynthesis. NO enhances the BH4 synthesis through amechanism dependent upon an increase in the synthesis of GCH1both in vivo and in vitro [42]. Our results support this hypothesis,as we observed that GCH1 mRNA significantly increases after12 h of PQ exposure, when NO levels are significantly elevated.Moreover, an increase in BH4 synthesis leads to upregulation ofeNOS at both the mRNA and protein levels [43]. Because we ob-served that eNOS levels after PQ exposure increase significantly be-tween 6 and 12 h of PQ exposure, this increase could correlate withthe increase in the GCH1 mRNA levels, which probably leads to anincrease in BH4 synthesis.
L-arginine is a substrate for both NOS and arginase. We foundthat both ARG1 and ARG2 mRNA were significantly expressed afterPQ exposure in N27 cells. Because NOS and arginase compete forthe same substrate, arginase expression may protect against thetoxicity generated by NO and NO-derived radicals [44,45]. Giventhat NOS and arginase are co-expressed in N27 cells, this co-expres-sion could guarantee efficient production of NO. We observed thatARG1 was significantly expressed after 6 h of PQ exposure, whileARG2 expression increased after 12 h of exposure and then de-
Fig. 6. NOSTRIN and NOSIP mRNA expression after time-dependent PQ exposure. Values are means ± SEM. **Significantly different (P < 0.01); n.s. not significant, fromunstimulated cells.
Fig. 7. NOS1AP, RASD1 and DYNLL1 mRNA expression after time-dependent PQ exposure. Values are means ± SEM. **Significantly different (P < 0.01); n.s. not significant,from unstimulated cells.
Fig. 5. ARG1 and ARG2 mRNA expression after time-dependent PQ exposure. Values are means ± SEM. **Significantly different (P < 0.01); n.s. not significant, fromunstimulated cells.
56 J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59
creased. Because both isoenzymes are co-expressed with NOS,these results indicate that NO production is modulated by the deg-radation of L-arginine.
Both NOSTRIN and NOSIP proteins are expressed in N27 cells,thereby attenuating eNOS-dependent NO production. We observed
that the NOSTRIN mRNA level was significantly increased after12 h of PQ exposure. Similarly, NOSIP mRNA reached peak levelsof expression between 6 and 12 h of PQ exposure. Both NOSTRINand NOSIP mRNA were increased, coinciding with the increase ineNOS expression. NOSTRIN mRNA is abundant in highly vascular-
Fig. 8. GUCY1A mRNA expression after time-dependent PQ exposure. Values aremeans ± SEM. *
,**Significantly different (P < 0.05, P < 0.01); n.s. not significant, from
unstimulated cells.
J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59 57
ised tissues such as placenta, kidney, lung, and heart, inducing aprofound redistribution of eNOS from the plasma membrane tovesicle-like structures and leading to a significant inhibition ofNO release from eNOS [46]. NOSTRIN mRNA is almost absent, how-ever, from tissue samples derived from the human central nervoussystem, where the neuronal nNOS isoform is the major NO-produc-ing enzyme [47]. In a similar manner, NOSIP triggers eNOS redistri-bution from the plasma membrane, thereby modulating eNOSactivity [26]. Although both proteins take part in the intracellularreshuffling of eNOS (not uselessly NOSIP and NOSTRIN share somefunctional features) they clearly differ in many other respects. Inparticular, NOSIP interacts with nNOS, and NOSIP is itself regulatedby neuronal activity in terms of both localisation and expressionlevels [48]. Thus, the interaction between either nNOS and NOSIPor eNOS and NOSIP/NOSTRIN may constitute a mechanism bywhich neuronal activity regulates the activity of nNOS and eNOS.
NOS1AP was first identified in the rat as an nNOS binding pro-tein [49]. NOS1AP mRNA was significantly expressed after 24 h ofexposure to PQ in N27 cells. NO signals within cells through post-translational covalent modification of proteins, and one of the moststudied examples is the direct modification of cysteine residues inproteins by NO, leading to the formation of a nitrosothiol adduct.RASD1, which was expressed between 6 and 12 h following PQexposure, can be S-nitrosylated by NO, forming a ternary complexbetween nNOS, NOS1AP and RASD1 [50]. Because we observed thatRASD1, NOS1AP and nNOS can form a complex, this observationplaces RASD1 in proximity to NOS1AP. The most likely mechanismof RASD1 activation is S-nitrosylation, which is probably highlyefficient due to the juxtaposition of nNOS and RASD1. Jaffrey and
Fig. 9. DDAH1, DDAH2 and CYGB mRNA expression after time-dependent PQ exposusignificant, from unstimulated cells.
Snyder [50] proposed that by analogy with kinase signaling, nNOSmay rely on NOS1AP and other nNOS-associated proteins to facili-tate reactions of NO with its targets [28].
Highly conserved DYNLL proteins promote the dimerisation of abroad range of targets and are essential for the integrity, activity orboth of other multimeric protein complexes such nNOS [51]. Ourresults showed marked downregulation of DYNLL1 expressionafter PQ treatment. DYNLL proteins are downregulated after expo-sure to MPTP, and this effect correlates with an accumulation ofautophagic vacuoles [51]. The phenomenon of autophagy has beenobserved in neurons from patients with Parkinson’s disease, sug-gesting a functional role for autophagy in neuronal cell death,and we have observed it previously following PQ exposure in neu-ral cells [52–54]. DYNLL proteins have an important role in theclearance of misfolded proteins by autophagy and downregulation.Some proteins such as synuclein are overexpressed and aggregatedin PD, and decreased expression of DYNLL prevents the autophagicclearance of aggregate-prone proteins [51].
Our results indicate that the expression of the NO-modulatedenzyme GUCY1A is upregulated following PQ exposure in N27cells. PQ promotes deactivation of GUCY1A [55,56], and exposureto MPTP increases the expression of GUCY1A in vivo [57–59]. Wehave previously observed that NO plays an important role in theneurotoxicity of PQ [39], and one of the mechanism by which NOacts in the central nervous system is activation of soluble guanylylcyclase (sGC), given that NO binds to the prosthetic haem group ofthe sGC, which in turn leads to about a 200-fold increase in sGCactivity [60,61].
The global amount of NO may be controlled by the expression ofproteins that regulate NO levels. We observed that three of theseenzymes, DDAH1, DDAH2 and CYGB, were significantly upregu-lated after 12 h of exposure to PQ. The increase in the expressionof these proteins correlated with the increase in NO production,indicating a kind of self-defence mechanism. DDAH1 is widelyexpressed, especially in the liver and kidney, at sites of NOS expres-sion [62–65], and DDAH2 predominates in the vascular endothe-lium, which is the site of eNOS expression as well as in immunetissues that express iNOS [32]. CYGB overexpression protectshuman SH-SY5Y neuroblastoma cells against the oxidative stressgenerated by PQ exposure [66]. Although the precise role ofthese molecules is still unclear, one of the putative mechanisms isthat they could scavenge NO, and they may have a role in the detox-ification of reactive oxygen species.
Overall, our data clearly indicate that the expression of all of thegenes studied is affected in N27 cells exposed to PQ. This conclu-sion fits well with the general notion that NO plays an importantrole in the neurotoxicity of PQ. Besides NO properties as a reactive
re. Values are means ± SEM. *,**Significantly different (P < 0.05, P < 0.01); n.s. not
58 J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59
species, it is related to the ability of NO to directly or indirectlymodulate the expression of several genes. While the findings areintriguing, however, there is a need for further studies to demon-strate the physiological significance and functional importance ofparaquat toxicity on nitric oxide-sensitive genes.
Acknowledgments
This research was supported by Grants PRI08A016, PR06B124and GRU09A017 from the Junta de Extremadura, Spain; PI070400(Fondo de Investigación Sanitaria, Ministerio de Ciencia e Innova-ción, Spain). J.M.M. was supported by a postdoctoral contract fromCIBERNED; M.A.O. and J.M.B were supported by Junta of Extrema-dura fellowships; R.A.G.P. was supported by a Miguel Servet (Fon-do de Investigación Sanitaria, Ministerio de Sanidad y Consumo,Spain) contract; and M.N.S. and L.M.R.M were supported by con-tracts from CIBERNED. The authors thank P. Delgado for technicalassistance. The authors thank FUNDESALUD for excellent researchassistance.
References
[1] I. Ahmad, A. Kumar, S. Shukla, P.H. Prasad, C. Singh, The involvement of nitricoxide in maneb- and paraquat-induced oxidative stress in rat polymor-phonuclear leukocytes, Free Radic. Res. 42 (2008) 849–862.
[2] M. Djukic, M.C. Jovanovic, M. Ninkovic, I. Vasiljevic, M. Jovanovic, The role ofnitric oxide in paraquat-induced oxidative stress in rat striatum, Ann. Agric.Environ. Med. 14 (2007) 247–252.
[3] J.H. Cho, D.K. Yang, L. Kim, J.S. Ryu, H.L. Lee, C.M. Lim, Y.S. Koh, Inhaled nitricoxide improves the survival of the paraquat-injured rats, Vascul. Pharmacol. 42(2005) 171–178.
[4] M. Tomita, T. Okuyama, T. Ishikawa, K. Hidaka, T. Nohno, The role of nitricoxide in paraquat-induced cytotoxicity in the human A549 lung carcinoma cellline, Free Radic. Res. 34 (2001) 193–202.
[5] E.H. Jang, C.S. Park, S.K. Lee, J.E. Pie, J.H. Kang, Excessive nitric oxide attenuatesleptin-mediated signal transducer and activator of transcription 3 activation,Life Sci. 80 (2007) 609–617.
[6] T. Pak, P. Cadet, K.J. Mantione, G.B. Stefano, Morphine via nitric oxidemodulates beta-amyloid metabolism: a novel protective mechanism forAlzheimer’s disease, Med. Sci. Monit. 11 (2005) BR357–BR366.
[7] Y. Kitamura, W. Kamoshima, S. Shimohama, Y. Nomura, T. Taniguchi, Nitricoxide donor-induced p53-sensitive cell death is enhanced by Bcl-2 reductionin human neuroblastoma cells, Neurochem. Int. 32 (1998) 93–102.
[8] K. Oh-Hashi, W. Maruyama, K. Isobe, Peroxynitrite induces GADD34, 45, and153 VIA p38 MAPK in human neuroblastoma SH-SY5Y cells, Free Radic. Biol.Med. 30 (2001) 213–221.
[9] A. Denicola, R. Radi, Peroxynitrite and drug-dependent toxicity, Toxicology 208(2005) 273–288.
[10] D. Berendji, V. Kolb-Bachofen, P.F. Zipfel, C. Skerka, C. Carlberg, K.D. Kroncke,Zinc finger transcription factors as molecular targets for nitric oxide-mediatedimmunosuppression: inhibition of IL-2 gene expression in murinelymphocytes, Mol. Med. 5 (1999) 721–730.
[11] K.D. Kroncke, C. Carlberg, Inactivation of zinc finger transcription factorsprovides a mechanism for a gene regulatory role of nitric oxide, FASEB J. 14(2000) 166–173.
[12] J.S. Stamler, A. Hausladen, Oxidative modifications in nitrosative stress, Nat.Struct. Biol. 5 (1998) 247–249.
[13] H.B. Peng, T.B. Rajavashisth, P. Libby, J.K. Liao, Nitric oxide inhibitsmacrophage-colony stimulating factor gene transcription in vascularendothelial cells, J. Biol. Chem. 270 (1995) 17050–17055.
[14] A. Tabuchi, K. Sano, E. Oh, T. Tsuchiya, M. Tsuda, Modulation of AP-1 activity bynitric oxide (NO) in vitro: NO-mediated modulation of AP-1, FEBS Lett. 351(1994) 123–127.
[15] N. Peunova, G. Enikolopov, Amplification of calcium-induced genetranscription by nitric oxide in neuronal cells, Nature 364 (1993) 450–453.
[16] L.Z. Zhou, A.P. Johnson, T.A. Rando, NF kappa B and AP-1 mediatetranscriptional responses to oxidative stress in skeletal muscle cells, FreeRadic. Biol. Med. 31 (2001) 1405–1416.
[17] M.J. Rio, C. Velez-Pardo, Paraquat induces apoptosis in human lymphocytes:protective and rescue effects of glucose, cannabinoids and insulin-like growthfactor-1, Growth Factors 26 (2008) 49–60.
[18] N. Dragin, M. Smani, S. Arnaud-Dabernat, C. Dubost, I. Moranvillier, P. Costet,J.Y. Daniel, E. Peuchant, Acute oxidative stress is associated with cellproliferation in the mouse liver, FEBS Lett. 580 (2006) 3845–3852.
[19] M.A. Marletta, Nitric oxide synthase: aspects concerning structure andcatalysis, Cell 78 (1994) 927–930.
[20] G. Auerbach, H. Nar, The pathway from GTP to tetrahydrobiopterin: three-dimensional structures of GTP cyclohydrolase I and 6-pyruvoyltetrahydropterin synthase, Biol. Chem. 378 (1997) 185–192.
[21] C.P. Jenkinson, W.W. Grody, S.D. Cederbaum, Comparative properties ofarginases, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 114 (1996) 107–132.
[22] R.M. Palmer, A.G. Ferrige, S. Moncada, Nitric oxide release accounts for thebiological activity of endothelium-derived relaxing factor, Nature 327 (1987)524–526.
[23] K.L. Davis, E. Martin, I.V. Turko, F. Murad, Novel effects of nitric oxide, Annu.Rev. Pharmacol. Toxicol. 41 (2001) 203–236.
[24] A.J. Hobbs, A. Higgs, S. Moncada, Inhibition of nitric oxide synthase as apotential therapeutic target, Annu. Rev. Pharmacol. Toxicol. 39 (1999) 191–220.
[25] K. Zimmermann, N. Opitz, J. Dedio, C. Renne, W. Muller-Esterl, S. Oess,NOSTRIN: a protein modulating nitric oxide release and subcellulardistribution of endothelial nitric oxide synthase, Proc. Natl. Acad. Sci. USA 99(2002) (2002) 17167–17172.
[26] J. Dedio, P. Konig, P. Wohlfart, C. Schroeder, W. Kummer, W. Muller-Esterl,NOSIP, a novel modulator of endothelial nitric oxide synthase activity, FASEB J.15 (2001) 79–89.
[27] S.R. Jaffrey, M. Fang, S.H. Snyder, Nitrosopeptide mapping: a novelmethodology reveals S-nitrosylation of dexras1 on a single cysteine residue,Chem. Biol. 9 (2002) 1329–1335.
[28] M. Fang, S.R. Jaffrey, A. Sawa, K. Ye, X. Luo, S.H. Snyder, Dexras1: a G proteinspecifically coupled to neuronal nitric oxide synthase via CAPON, Neuron 28(2000) 183–193.
[29] S.M. King, Dynein-independent functions of DYNLL1/LC8: redox state sensingand transcriptional control, Sci. Signal. 1 (2008) e51.
[30] U. Zabel, M. Weeger, M. La, H.H. Schmidt, Human soluble guanylate cyclase:functional expression and revised isoenzyme family, Biochem. J. 335 (Pt 1)(1998) 51–57.
[31] C.T. Tran, J.M. Leiper, P. Vallance, The DDAH/ADMA/NOS pathway, Atheroscler.Suppl. 4 (2003) 33–40.
[32] C.T. Tran, M.F. Fox, P. Vallance, J.M. Leiper, Chromosomal localization, genestructure, and expression pattern of DDAH1: comparison with DDAH2 andimplications for evolutionary origins, Genomics 68 (2000) 101–105.
[33] J.T. Trent III, M.S. Hargrove, A ubiquitously expressed human hexacoordinatehemoglobin, J. Biol. Chem. 277 (2002) 19538–19545.
[34] X. Guo, S. Philipsen, K.C. Tan-Un, Study of the hypoxia-dependent regulation ofhuman CYGB gene, Biochem. Biophys. Res. Commun. 364 (2007) 145–150.
[35] K.N. Prasad, E.D. Clarkson, F.G. La Rosa, J. Edwards-Prasad, C.R. Freed, Efficacyof grafted immortalized dopamine neurons in an animal model ofparkinsonism: a review, Mol. Genet. Metab. 65 (1998) 1–9.
[36] S. Kirkeby, C.E. Thomsen, Quantitative immunohistochemistry of fluorescencelabelled probes using low-cost software, J. Immunol. Methods 301 (2005) 102–113.
[37] G. Thomas, P.W. Ramwell, Vascular relaxation mediated by hydroxylaminesand oximes: their conversion to nitrites and mechanism of endotheliumdependent vascular relaxation, Biochem. Biophys. Res. Commun. 164 (1989)889–893.
[38] M. Tomita, T. Okuyama, K. Hidaka, Changes in mRNAs of inducible nitric oxidesynthase and interleukin-1 beta in the liver, kidney and lung tissues of ratsacutely exposed to paraquat, Leg. Med. (Tokyo) 1 (1999) 127–134.
[39] M.A. Ortiz-Ortiz, J.M. Moran, R.A. Gonzalez-Polo, M. Niso-Santano, G. Soler, J.M.Bravo-San Pedro, J.M. Fuentes, Nitric oxide-mediated toxicity in paraquat-exposed SH-SY5Y cells: a protective role of 7-nitroindazole, Neurotox. Res. 16(2009) 160–173.
[40] W. Chen, M. Bacanamwo, D.G. Harrison, Activation of p300 histoneacetyltransferase activity is an early endothelial response to laminar shearstress and is essential for stimulation of endothelial nitric-oxide synthasemRNA transcription, J. Biol. Chem. 283 (2008) 16293–16298.
[41] C.C. Chiueh, T. Andoh, P.B. Chock, Roles of thioredoxin in nitric oxide-dependent preconditioning-induced tolerance against MPTP neurotoxin,Toxicol. Appl. Pharmacol. 207 (2005) 96–102.
[42] S. Kumar, X. Sun, S. Sharma, S. Aggarwal, K. Ravi, J.R. Fineman, S.M. Black, GTPcyclohydrolase I expression is regulated by nitric oxide: role of cyclic amp, Am.J. Physiol. Lung Cell. Mol. Physiol. 297 (2009) 309–317.
[43] S. Cai, N.J. Alp, D. McDonald, I. Smith, J. Kay, L. Canevari, S. Heales, K.M.Channon, GTP cyclohydrolase I gene transfer augments intracellulartetrahydrobiopterin in human endothelial cells: effects on nitric oxidesynthase activity, protein levels and dimerisation, Cardiovasc. Res. 55 (2002)838–849.
[44] V.L. Dawson, T.M. Dawson, E.D. London, D.S. Bredt, S.H. Snyder, Nitric oxidemediates glutamate neurotoxicity in primary cortical cultures, Proc. Natl.Acad. Sci. USA 88 (1991) 6368–6371.
[45] T. Gotoh, M. Mori, Arginase II downregulates nitric oxide (NO) production andprevents NO-mediated apoptosis in murine macrophage-derived RAW 264.7cells, J. Cell Biol. 144 (1999) 427–434.
[46] K. Zimmermann, N. Opitz, J. Dedio, C. Renne, W. Muller-Esterl, S. Oess,NOSTRIN: a protein modulating nitric oxide release and subcellulardistribution of endothelial nitric oxide synthase, Proc. Natl. Acad. Sci. USA 99(2002) 17167–17172.
[47] U. Forstermann, J.P. Boissel, H. Kleinert, Expressional control of the‘constitutive’ isoforms of nitric oxide synthase (NOS I and NOS III), FASEB J.12 (1998) 773–790.
[48] J. Dreyer, M. Schleicher, A. Tappe, K. Schilling, T. Kuner, G. Kusumawidijaja, W.Muller-Esterl, S. Oess, R. Kuner, Nitric oxide synthase (NOS)-interactingprotein interacts with neuronal NOS and regulates its distribution andactivity, J. Neurosci. 24 (2004) 10454–10465.
J.M. Morán et al. / Nitric Oxide 23 (2010) 51–59 59
[49] S.R. Jaffrey, A.M. Snowman, M.J. Eliasson, N.A. Cohen, S.H. Snyder, CAPON: aprotein associated with neuronal nitric oxide synthase that regulates itsinteractions with PSD95, Neuron 20 (1998) 115–124.
[50] S.R. Jaffrey, S.H. Snyder, PIN: an associated protein inhibitor of neuronal nitricoxide synthase, Science 274 (1996) 774–777.
[51] Z.L. Cai, J.J. Shi, Y.P. Yang, B.Y. Cao, F. Wang, J.Z. Huang, F. Yang, P. Zhang, C.F.Liu, MPP+ impairs autophagic clearance of alpha-synuclein by impairing theactivity of dynein, Neuroreport 20 (2009) 569–573.
[52] R. Gonzalez-Polo, M. Niso-Santano, J.M. Moran, M.A. Ortiz-Ortiz, J.M.Bravo-San Pedro, G. Soler, J.M. Fuentes, Silencing DJ-1 reveals itscontribution in paraquat-induced autophagy, J. Neurochem. 109 (2009)889–898.
[53] R.A. Gonzalez-Polo, M. Niso-Santano, M.A. Ortiz-Ortiz, A. Gomez-Martin, J.M.Moran, L. Garcia-Rubio, J. Francisco-Morcillo, C. Zaragoza, G. Soler, J.M.Fuentes, Relationship between autophagy and apoptotic cell death in humanneuroblastoma cells treated with paraquat: could autophagy be a ‘‘brake” inparaquat-induced apoptotic death?, Autophagy 3 (2007) 366–367
[54] R.A. Gonzalez-Polo, M. Niso-Santano, M.A. Ortiz-Ortiz, A. Gomez-Martin, J.M.Moran, L. Garcia-Rubio, J. Francisco-Morcillo, C. Zaragoza, G. Soler, J.M.Fuentes, Inhibition of paraquat-induced autophagy accelerates the apoptoticcell death in neuroblastoma SH-SY5Y cells, Toxicol. Sci. 97 (2007) 448–458.
[55] C.N. White, E.J. Hamilton, A. Garcia, D. Wang, K.K. Chia, G.A. Figtree, H.H.Rasmussen, Opposing effects of coupled and uncoupled NOS activity on theNa+ � K+ pump in cardiac myocytes, Am. J. Physiol. Cell Physiol. 294 (2008)C572–C578.
[56] D.L. Vesely, B. Watson, G.S. Levey, Activation of liver guanylate cyclase byparaquat: possible role of superoxide anion, J. Pharmacol. Exp. Ther. 209(1979) 162–164.
[57] M. Chalimoniuk, J. Langfort, The effect of subchronic, intermittent L-DOPAtreatment on neuronal nitric oxide synthase and soluble guanylyl cyclaseexpression and activity in the striatum and midbrain of normal and MPTP-treated mice, Neurochem. Int. 50 (2007) 821–833.
[58] M. Chalimoniuk, N. Lukacova, J. Marsala, J. Langfort, Alterations of theexpression and activity of midbrain nitric oxide synthase and solubleguanylyl cyclase in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-inducedParkinsonism in mice, Neuroscience 141 (2006) 1033–1046.
[59] M. Chalimoniuk, J. Langfort, N. Lukacova, J. Marsala, Upregulation of guanylylcyclase expression and activity in striatum of MPTP-induced parkinsonism inmice, Biochem. Biophys. Res. Commun. 324 (2004) 118–126.
[60] G. Garthwaite, D.A. Goodwin, J. Garthwaite, Nitric oxide stimulates cGMPformation in rat optic nerve axons, providing a specific marker of axonviability, Eur. J. Neurosci. 11 (1999) 4367–4372.
[61] J. Garthwaite, C.L. Boulton, Nitric oxide signaling in the central nervoussystem, Annu. Rev. Physiol 57 (1995) 683–706.
[62] R.J. Nijveldt, T. Teerlink, G.C. van, H.A. Prins, A.A. van Lambalgen, C.D.Stehouwer, J.A. Rauwerda, P.A. van Leeuwen, Handling of asymmetricaldimethylarginine and symmetrical dimethylarginine by the rat kidney underbasal conditions and during endotoxaemia, Nephrol. Dial. Transplant. 18(2003) 2542–2550.
[63] R.J. Nijveldt, T. Teerlink, M.P. Siroen, A.A. van Lambalgen, J.A. Rauwerda, P.A.van Leeuwen, The liver is an important organ in the metabolism ofasymmetrical dimethylarginine (ADMA), Clin. Nutr. 22 (2003) 17–22.
[64] M.L. Onozato, A. Tojo, J. Leiper, T. Fujita, F. Palm, C.S. Wilcox, Expression of NG,NG-dimethylarginine dimethylaminohydrolase and protein arginine N-methyltransferase isoforms in diabetic rat kidney: effects of angiotensin IIreceptor blockers, Diabetes 57 (2008) 172–180.
[65] A. Tojo, W.J. Welch, V. Bremer, M. Kimoto, K. Kimura, M. Omata, T. Ogawa, P.Vallance, C.S. Wilcox, Colocalization of demethylating enzymes and NOS andfunctional effects of methylarginines in rat kidney, Kidney Int. 52 (1997)1593–1601.
[66] E. Fordel, L. Thijs, W. Martinet, M. Lenjou, T. Laufs, B.D. Van, L. Moens, S.Dewilde, Neuroglobin and cytoglobin overexpression protects human SH-SY5Yneuroblastoma cells against oxidative stress-induced cell death, Neurosci. Lett.410 (2006) 146–151.
