Comparative Biochemistry and Physiology, Part B xxx (2012) xxx–xxx

CBB-09603; No of Pages 6

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part B

j ourna l homepage: www.e lsev ie r .com/ locate /cbpb

Cytosolic manganese superoxide dismutase genes from the white shrimp Litopenaeusvannamei are differentially expressed in response to lipopolysaccharides, white spotvirus and during ontogeny☆

Gracia A. Gómez-Anduro a, Felipe Ascencio-Valle a, Alma Beatriz Peregrino-Uriarte b,Angel Cámpa-Córdova a, Gloria Yepiz-Plascencia b,⁎a Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Mar Bermejo No. 195, Col. Playa Palo de Santa Rita P.O Box 128; 23090 La Paz, Mexicob Aquatic Molecular Biology Laboratory, Centro de Investigación en Alimentación y Desarrollo, PO Box 1735; Hermosillo Son, 83000, Mexico

☆ This article is dedicated to the memory of Roberto⁎ Corresponding author at: Centro de Investigación en

PO Box 1735, Hermosillo, Son, 83000, Mexico. Tel.: +52280 04 21.

E-mail address: gyepiz@ciad.mx (G. Yepiz-Plascenci

1096-4959/$ – see front matter © 2012 Elsevier Inc. Alldoi:10.1016/j.cbpb.2012.03.003

Please cite this article as: Gómez-Anduro, Gvannamei are differentially expressed in res

a b s t r a c t

a r t i c l e i n f o

Article history:Received 16 January 2012Received in revised form 23 March 2012Accepted 28 March 2012Available online xxxx

Keywords:ShrimpcMnSOD genesLPSOntogeny

Manganese superoxide dismutase (MnSOD) is an antioxidant enzyme usually located in mitochondria. Thereare only a few examples of cytosolic MnSOD (cMnSOD). In the shrimp Litopenaeus vannamei, we have previouslycharacterized three cMnSOD cDNAs and their differential tissue-specific expression. To obtain insights abouttheir genomic organization, we characterized the three corresponding cMnSOD genes, named them cMnsod1,cMnsod2, and cMnsod3 and studied their specific expression during ontogeny, response to lipopolysaccharides(LPS) and white spot virus infection (WSSV) in hemocytes from shrimp. The first two genes contain five intronsflanked by canonical 5′-GT-AG-3′ intron splice-site junctions, while the third one is intron-less. We analyzed995 nucleotides upstream cMnsod2, but no classical promoter sequences were found. The deduced productsof the three cMnSOD genes differ in two amino acids and there are four silent changes. cMnsod3 expression ismodulated by WSSV and cMnsod2 by LPS. cMnsod2 is expressed from eggs to post larval stage during ontogeny.This is the first report of crustacean cMnSOD multigenes that are differently induced during the defenseresponse and ontogeny.

© 2012 Elsevier Inc. All rights reserved.

1. Introduction

The antioxidant effect of superoxide dismutase (EC 1.15.1.1) occursthrough dismutation of the superoxide radical to hydrogen peroxideand molecular oxygen (Pipe et al., 1993). There are three main typesof SODs in eukaryotic cells; they are characterized by the metal presentin the catalytic sites: copper and zinc (CuZnSOD),manganese (MnSOD),and iron (FeSOD) (Fridovich, 1986). CuZnSOD is located mainly inthe cytosol (Weisiger and Fridovich, 1973) and also extracellularly(Marklund, 1982), MnSOD is mostly present in mitochondrial matrix(Kawaguchi et al., 1989) and FeSOD can be found in a few plants(Asada et al., 1980). The white shrimp (Litopenaeus vannamei) has anextracellular CuZnSOD (Tian et al., 2011), the typical mitochondrialMnSOD (mMnSOD, GenBank accession no. BF023843) and an additionalcytoplasmic MnSOD (cMnSOD) (Gómez-Anduro et al., 2006). ThecMnSOD was proposed to replace the intracellular cytosolic CuZnSODin the blue crab Callinectes sapidus as an adaptation during molting,for the need of unusual copper levels in blood due to the presence of

Carlos Vázquez-Juárez.Alimentación y Desarrollo, A.C.,662 289 24 00; fax: +52 662

a).

rights reserved.

.A., et al., Cytosolic manganponse to..., Comp. Biochem.

hemocyanin, a Cu-based respiratory carrier in crustaceans (Brouweret al., 1997), although recently, an extracellular CuZnSOD was isolatedin C. sapidus (Chung et al., 2012). There are only a few examples ofcytosolic MnSOD (cMnSOD): Yeast Candida albicans (Lamarre et al.,2001), giant freshwater prawn Macrobrachium rosenbergii (Cheng etal., 2006), red swamp crawfish Procambarus clarkii (Zhu and Doumen,2009), swimming crab Portunus trituberculatus (Li et al., 2010a,2010b), black tiger shrim Penaeus monodon (GenBank accession no.AY726542, BI784454), kuruma shrimp Marsupenaeus japonicus (Linet al., 2010) homologs are known. The molecular weight of the imma-ture cMnSOD protein is around 31.2–31.5 kDa with estimated pIsfrom 5.42 to 7.33 and has a conserved N-terminal responsible for theirretention in the cytosol. cMnSOD expression is highly induced by bacte-ria, β-glucan (Lin et al., 2010), immunoestimulants (Liu et al., 2011),pathogen-associated molecular patterns (PAMPs) including laminarin,LPS and poly I:C (Ji et al., 2009). We have previously reported thatthe cMnSOD mRNA levels in shrimp hemocytes increased after WSSVinfection to reduce the cellular superoxide burst during the defenseagainst virus infection and to protect the shrimp cells from damage.Three different cMnSOD cDNAs sequences that are expressed in atissue-specific manner are known in L. vannamei. They differ only inseven positions that result in three amino acid changes, while four aresilent (Gómez-Anduro et al., 2007). In this study, we report the charac-terization of these three cMnSOD genes in the shrimp L. vannamei,

ese superoxide dismutase genes from the white shrimp LitopenaeusPhysiol., B (2012), doi:10.1016/j.cbpb.2012.03.003

2 G.A. Gómez-Anduro et al. / Comparative Biochemistry and Physiology, Part B xxx (2012) xxx–xxx

describe their differences, genomic organization, expression duringshrimp ontogeny, and in subadult shrimp hemocytes in response toLPS and WSSV infection.

2. Materials and methods

2.1. Amplification and cloning of cMnSOD genes

High-quality genomic DNA was isolated from 2 g of muscle usingproteinase K digestion, repeated phenol-chloroform extraction andprecipitation with cold ethanol (Bradfield and Wyatt, 1983). TheDNA fibers were collected using a glass road and resuspended in10 mM Tris–HCl, pH 8, 1 mM EDTA (Bradfield and Wyatt, 1983) andused for PCR. The forward cMnSODF (5′-ATGGCTGAGGCAAAG-GAAGCTTAC-3′) and reverse cMnSODR (5′-CAATGACCTGCATTCTTAC-GAG-3′) primers were designed based on the cMnSOD cDNA fromwhite shrimp (Gómez-Anduro et al., 2007). The PCR was done in a25 μL reaction containing 100 ng of genomic DNA, 0.5 μM each primerand 21 μL of Platinum PCR Supermix (Invitrogen, Carlsbad, CA, USA).The PCR cycling conditions were: 95 °C, 1 min (one time), 95 °C,30 s, 63 °C, 1 min, 68 °C, 3 min (one cycle); 95 °C, 30 s, 60 °C, 1 min,68 °C, 3 min (34 cycles); 72 °C, 10 min in a DNA Thermal Cycler(PTC-200 DNA Engine, MJ Research) and kept at 4 °C until used.DNA fragments were cloned into the PCR 2.1 TOPO vector (Invitrogen,Carlsbad, CA, USA) using TOP 10 E. coli cells. All the clones were thor-oughly sequenced in both strands at the GATC facility (Genomic Anal-ysis and Technology Core) at the University of Arizona. To obtaininformation about the 5′UTR gene region, a ligation mediated poly-merase chain reaction (LMPCR) was done (Ochman et al., 1988). Atotal of 5 μg of genomic DNA were heated 15 min, 75 °C, placed onice and digested with 20 U of HindIII overnight at 37 °C. DigestedDNA was ligated using 500 ng, 2 U of T4 DNA ligase, and 10 μL of10X ligation buffer in a 100 μL reaction volume at 16 °C overnight.The PCR reaction was done using 7 μL of the ligation reaction, 1.5 μLof 20 μM cMnSODinvF (5′-CTCGTAAGAATGCAGGTCATTG-3′, 1.5 μLof 20 μM cMnSODinvR (5′-AGTGTAAGCTTCCTTTGCCTCAGC-3′) and25 μL Platinum PCR Supermix (Invitrogen). The following conditionswere used: 75 °C, 3 min; 94 °C, 4 min; followed by 3 cycles of 94 °C,1 min; 60 °C, 1 min; 68 °C, 4 min; and 37 cycles of 94 °C, 1 min; 55 °C,1 min; 68 °C, 4 min and extension of 68 °C, 10 min. A reamplificationwas done using 1 μL of the previous PCR reaction, 1.5 μL of each primer(20 μM) and 25 μL Platinum PCR Supermix (Invitrogen) in 35 μL of finalreaction, using the conditions previously mentioned. The PCR productswere cloned and sequenced.

2.2. Probes and southern blot hybridization analysis

Two probes were prepared using the clone from cMnSOD1 andspecific primers for each probe (probe 1: AbcMnSODF′-ATGGCTGAGGCAAAGGAAGCTTAC-3′ and RcMnSODr 5′-ATGTTGGGTCCAGAAGATGGTGT-3′; probe 2: cMnSODF4 5′- CACAGAAAGCCCTAAGCTAGATG-3′and cMnSODR4 5′-CAGCTGGCTCAGTCTTTTCTG-3′) and labeled withdigoxigenin (DIG-dUTP) in polymerase chain reaction (Boehringer–Mannheim–Roche, Indianapolis, IN, USA). Probe 1 corresponds to themost 5’ region or N-terminal section and specific to cMnSODs, probe 2is located in intron 3 and is specific to cMnsod1 and cMnsod2 (Fig. 1,panel b and c). For the Southern blot, the genomic DNA (40 μg) waspre-heated (75 °C, 15 min), digested with EcoRI, DraI, HindIII, HinfI andRsaI (5 U enzyme/μg DNA) and separated using 0.7% agarose gel. Thesamples were loaded in duplicate set to have two membranes withthe same digested DNA. After hydrolysis in 0.2 N HCl, denaturation in1.5 M NaOH, 0.5 M NaCl, and neutralization in 1 M Tris–HCl, 1.5 MNaCl pH, 7.4, the gels were blotted onto positive charged nylon mem-branes (Hybond N+, Amersham, Pharmacia Biotech) in 0.4 N NaOH.Membranes were crosslinked by UV treatment (120 000 μJ, 30 s) andpre-hybridized for 1 h at 68 °C in 5X SSC, 0.1% N-laurylsarcosine, 0.03%

Please cite this article as: Gómez-Anduro, G.A., et al., Cytosolic manganvannamei are differentially expressed in response to..., Comp. Biochem.

SDS and 1% blocking reagent herring sperm DNA (Sambrook et al.,1989). Hybridization was performed overnight (16 h) at 65 °C in 10 XSSC, separately with probe 1 and probe 2 labeled with dig-dUTP(Roche). Membranes were washed twice with 2X SSC, 0.5% SDS atroom temperature for 5 min, and twice with 1X SSC, 0.1% SDS at 65 °Cfor 15 min under constant agitation. Membranes were rinsed brieflywith washing buffer (maleic acid buffer (0.1 M maleic acid, 0.15 MNaCl; pH 7.5), 0.3% Tween 20 (v/v)) and incubated with 1X blocking so-lution (Boehringer–Mannheim) for 30 min, then incubated with anti-DIG-AP conjugate (150 mU/mL) in blocking solution, washed twicewith washing buffer, and detected using chemiluminescent substratefor alkaline phosphatase CDP-Star (Roche-Applied) and BIOMAX films(Kodak).

2.3. Gene specific expression in response to LPS, WSSV and ontogeny

Separate bioassays were conducted to evaluate expression in re-sponse to LPS, WSSV, and during ontogeny in shrimp. Hemocyteswere recovered by centrifugation (800 g, 10 min, 10 °C). Total RNAwas isolated from hemocytes using TRIzol (Invitrogen) and its inte-grity was confirmed by 1% agarose-formaldehyde gel electrophoresis(Sambrook et al., 1989). The RNAwas treatedwith DNase I (Invitrogen)to remove any potential contamination with genomic DNA.

2.3.1. LPS assays and cMnSOD mRNA levelsJuvenile L. vannamei shrimp (9 to 10 g) were obtained from culture

ponds at CIBNOR (La Paz, Baja California Sur, Mexico) and reared15 days under controlled laboratory conditions. The shrimp wereplaced in 20 L plastic tanks in filtered marine water at 28 °C, 34 ppt sa-linity and were fed ad libitum twice daily with commercial shrimp feedCamaronina 35® (Agribrands Purina, Mexico). Uneaten food and solidexcreta were removed daily. All shrimp used in the assays were previ-ously selected at intermolt stage by setogenesis, by observing thechanges in the seta of the inner margin of uropods (Chan et al., 1988).Each individual shrimp was injected with 100 μL of LPS (Sigma, E. coliserotype 0111:B4,15 μg/mL, 1.5 μg per shrimp) in commercial sterile sa-line solution (0.15 M NaCl) into the pericardial cavity of the shrimp.Control shrimp were injected only with saline solution. A total of nineshrimp per treatment were sampled after 1, 4, and 6 h after injectionof the LPS. Hemocytes from three shrimp were pooled, and for eachtime point, three independent pools, representing nine shrimp in totalwere prepared and analyzed separately. For cDNA synthesis, 50 ng oftotal RNA from hemocytes were reversely transcribed using oligodT(12–18) and SuperScript II reverse transcriptase (Invitrogen) and 1μL of cDNA was used for qPCR. cMnSODs mRNA relative levels weredetermined by real time qPCR in a iQ5 Real-Time PCR Detection System(Bio-Rad) using the synthesized cDNAs, the primers FcMnSOD 5′-GGGCTACATTAACAACCTAATTGC-3′ and RcMnSOD 5′-ATGTTGGTCCAGAA-GATGGTGT-3′ and as a constitutive gene control, the L8 ribosomalprotein primers L8F2 (TAGGCAATGTCATCCCCATT) and L8R2 (TCCTGAAGGAAGCTTTACACG) (Gómez-Anduro et al., 2006).

2.3.2. WSSV bio-assayTo investigate the effect ofWSSV on specific expression of cMnSODs,

we selected samples to evaluate short time response (1, 3, and 6 h post-virus infection). The cDNA was obtained by reverse transcription usingtotal RNA (500 ng) from hemocytes isolated from healthy and WSSV-infected shrimp, previously reported (Gómez-Anduro et al., 2006). Atotal of nine shrimp by time were used to obtain hemocytes and werepooled to get three independent pools analyzed separately by RT-qPCR.

2.3.3. Shrimp ontogeny bio-assaysThe samples of L. vannamei larvae used in the present study, were

obtained from a local shrimp-farm Acuacultura Mahr, S.A. de C.V (LaPaz, B.C.S, Mexico) reared under controlled laboratory conditions intanks with filtered marine water at 33±0.26 °C, 36.62±0.76% salinity,

ese superoxide dismutase genes from the white shrimp LitopenaeusPhysiol., B (2012), doi:10.1016/j.cbpb.2012.03.003

Fig. 1. The cMnSOD genes from the shrimp (L. vannamei). Panel a) PCR amplification of three genes and electrophoresis in 1% agarose gel. Panel b) Gene organization of the threecMnSOD, the grey boxes indicate the exons, white boxes designate the introns, probes 1 and 2 used to Southern hybridization are show in black box and white with black spot box.Panel c) Southern blot analysis using two probes and five restriction enzymes, the main bands are shown with black arrows.

3G.A. Gómez-Anduro et al. / Comparative Biochemistry and Physiology, Part B xxx (2012) xxx–xxx

oxygen 5.53±0.12 mg/L and were fed ad libitum. The eggs are releasedand fertilized externally in the water; viable eggs were obtained usinga brass sieve of appropriate mesh size. Within 24 h, the tiny eggs hatchintomicroscopic nauplius larvae, followed by zoea, mysis, and postlarvalstages. Passage from the nauplius to the postlarval stage takes severalweeks. The developmental stages were identified according to morpho-logical criteria (Hudinaga, 1942). Pools of individuals were selectedthroughout ontogenetic development, a homogeneous sample wasdefined when >80% of individuals belonged to the same stage; theremaining individuals differed by a single stage. The samples were:eggs (E), nauplius (N), zoea (Z) and post-larva (PL). Specimenswere iso-lated in a sieve, blotted dry, weighed, and transferred to liquid nitrogenuntil assays were conducted.

To identify the specific expression of each cMnSOD gene in responseto LPS, WSSV, and ontogeny, the RNA was extracted using TRIzol(Invitrogen), and the cDNA synthesiswas done using reverse transcrip-tion IMPROM II (Promega). The PCR reactions to evaluate response toLPS, WSSV, and ontogeny were done using specific primers designedto distinguish cMnsod1(cMnSODF1: 5′- CTCATGCTTTGCCACCC-3′;cMnSODR1: 5′- CATGACGCTCATTCACGTTCT-3), cMnsod2 (cMnSODF2:5′- TAACAACCTAATTGCCGCTACA-3′; cMnSODR2: 5′-CTCATAACGCT-CATTCACGTTCT-3), and cMnsod3 (cMnSODF3: 5′-TGCTCATGCTTTGC-CACCT-3′; cMnSODR3: 5′-CATAACGCTCATTCACGTTCC-3), that werevalidated with specific individual clones (Gómez-Anduro et al., 2007).PCR conditions were published by Gómez-Anduro et al., (2007) exceptfor the samples for LPS. In this case, the PCR programwasmodified to 29cycles for semi quantitative expression. PCR products were analyzed inagarose gels.

2.4. Molecular analysis of cMnSOD genes and statistical analysis

The sequences were analyzed using DNASIS v 2.5 (Hitachi SoftwareEngineering America). The nucleotide and deduced protein sequenceswere compared to non-redundant nucleotide and protein databasesusing the BLAST algorithm (Altschul et al., 1990). The analysis of promo-tor region was done using Promoter 2.0 program for the recognition ofPolII promoter sequences (Knudsen, 1999). The GT-AG intron-exonssplice sites were identified by direct comparison with the cDNAsequence and the branch point predicted region was found using thetool available in (http://www.cbs.dtu.dk/services/NetPGene/). Thedata for RT-qPCR was obtained from three independent replicates pertime point and subjected to one-way ANOVA using the software Statis-tica 6.0 or StatSoft. Tukey's test was used to compare means when theF-test was significant at Pb0.05.

Please cite this article as: Gómez-Anduro, G.A., et al., Cytosolic manganvannamei are differentially expressed in response to..., Comp. Biochem.

3. Results and discussion

3.1. Characterization of the cMnSOD genes

Three genes encoding cMnSODwere identified by comparison to thecDNA sequences previously reported (Gómez-Anduro et al., 2007). Theywere named cMnsod1, cMnsod2, and cMnsod3 and are 2,626, 2,285, and864 bp long (Fig. 1, panel a), respectively (GenBank accession no.DQ298206, DQ298207, DQ298208). The complete sequence of thethree genes is found in the Supplementary material (S1). cMnsod3 has99% identity (861 bp/864 bp) with cMnsod1and 99% (859/864) withcMnsod2 only in the coding regions. All the fragments were obtainedby PCR using genomic DNA and thoroughly sequenced from the sameanimal. The cMnsod1 and cMnsod2 sequences were obtained from over-lapping and alignment of four and two clones respectively, each of themwere sequenced 7 times in both strands using M13 and T7 universalplasmid vector primers and also, specific primers for each one; cMnsod3sequence was obtained from two independent clones . The intron-exonsplice sites were deduced by direct comparison between the genomicand cDNA sequences, and by branch point prediction. cMnsod1 andcMnsod2 are interrupted by five introns located in the same positions(Fig. 1, panel b). Two glycine codons are split by introns two and five.The intron/exon boundaries are flanked by the 5′-GT-AG-3′ intronsplice-site junctions (Henkle et al., 1995), as was reported for theMnSOD gene from the parasite Onchocerca volvulus (Henkle et al.,1995); for cMnSOD from Yeast Candida albicans (Lamarre et al., 2001)and the FeSOD gen from the protist Perkinsus marinus (Schott et al.,2003). A thymine, involved in splicing, was present in the sixth positiondownstream from the 5′ splice junction and at the fifth position up-stream from the 3′ splice junction of all the introns, except in intron 3,when there is a C, similar to the report of the O. volvulus MnSOD(Henkle et al., 1995). Intron three is the largest intron (1015 and829 bp, respectively for cMnsod1 and cMnsod2) and contains homopol-ymeric sequences; if this represents a special feature of the shrimpcMnSOD, it is currently unknown. Diverse functions in transcriptionalregulation have been attributed to this type of sequences, for examplein the formation of small RNAs and different product by alternativesplicing (Maniatis and Tasic, 2002). There is no bias in synonymouscodon usage among the 3 genes, that might indicate preferential ex-pression, as proposed by (Stenico et al., 1994; Gupta et al., 2005; Jiaand Li, 2005). In all the cases, the deduced polypeptide was 287 aminoacid-long with the same predicted molecular weight of 24.5 kDafor the mature protein. Slight pI differences (6.09, 6.04 and 6.17, forproteins from the genes cMnsod1, cMnsod2, and cMnsod3, respectively)were found due to differences in amino acid charges. The deduced

ese superoxide dismutase genes from the white shrimp LitopenaeusPhysiol., B (2012), doi:10.1016/j.cbpb.2012.03.003

Table 1Comparison of exons and introns from the L. vannamei cMnsod1 and cMnsod2 genes.

Size (Bp) % GC

cMnsod1 cMnsod2 cMnsod1 cMnsod2

Exon 1 93 93 45 45Exon 2 148 148 51 51Exon 3 146 146 50 49Exon 4 192 192 54 54Exon 5 127 127 54 54Exon 6 158 158 48 48Intron 1 124 122 30 30Intron 2 257 261 34 35Intron 3 1015 829 34 34Intron 4 211 216 36 32Intron 5 158 107 30 22

4 G.A. Gómez-Anduro et al. / Comparative Biochemistry and Physiology, Part B xxx (2012) xxx–xxx

amino acid sequence has 96% identity to the cMnSOD from the shrimpPenaeus monodon (GenBank accession no. AAW50395), 79% to theMacrobrachium rosenbergii (AAY79405), 78% to the blue crab C. sapidus(AAF74771).

A total of 995nucleotideswere sequencedupstream (before theme-thionine codon) using inverse PCR, but no classical promoter sequenceswere found (S1). Sequence analysis allowed us to detect 14 bp beforethe initial codon that corresponds to the 5′UTR; after this sequence itwas impossible to identify the remaining 40 bp to complete the 5′UTRfrom the previously known cDNA sequence. In position −15 and −16(adenine fromATG is numbered as one), an AG sequence, characteristicof the 3′ intron donor site necessary for intron splicing junctions wasfound (Henkle et al., 1995; Schott et al., 2003). This result suggeststhat an intron is located in the 5′UTR region (position −15 bp) andthe promoter region is further upstream the coding sequence. Intronsin the 5′-UTR region might contribute to regulation of gene expression(Jeong et al., 2006), but the upstream splice site remains to be found.Introns have lower G+C content (from 30 to 36%) compared to theexons (from 45 to 54%) (Table 1). The low G+C content and high A+Trich regions of the introns are not under strong selective pressure, evolvefaster and tend to accumulate more AT-rich mutations (Papanikolaou etal., 2009). In the human genome the high GC content regions (62-68%)have higher relative gene density than the ones with lower GC content;

Fig. 2. cMnSOD transcript levels. Panel a) RT-quantitative PCR, cMnSODmRNA levels normalizeThe asterisks indicate significant differences (ANOVA pb0.05). Panel b)Hemocytes gene specific

Please cite this article as: Gómez-Anduro, G.A., et al., Cytosolic manganvannamei are differentially expressed in response to..., Comp. Biochem.

exon length is relatively uniform with respect to the GC content, butintrons length decreases dramatically in regions of high GC content(MacKinnon, 2007). Also the GC content around splice sites is relatedto the splice site usage inmultiple species. In humans, some results indi-cate that the GC content is related to splice site usage and itmaymediatethe splicing process through RNA secondary structures (Zhang et al.,2011).

3.2. Detection of cMnSOD in L. vannamei genomeby Southern blot

Southern blot hybridization was carried out to detect the cMnsodgenes in the shrimp genome using five different restriction enzymesand two probes. Probe one corresponding to exon number one presentin the three genes and probe two, corresponding to intron two, presentin two of the three genes. Several bandswere detectedwith both probes(Fig. 1, panel c), confirming the presence of multiple copies of thesegenes. There are no internal EcoRI sites in the three genes and threeclear bands were detected with probe 1 corresponding to cMnsod.Probe 2 is specific for cMnsod1 and cMnsod2 andweused four enzymesto identify restriction patterns specific to each gene, based on internalfragment restriction.DraI cut in half cMnsod1 and cMnsod2, this enzymeproduces 2 bands in the Southern blot (Fig. 1, panel c), HindIII produces5 bands from 3 internal sites in each gene (cMnsod1: 1021 bp, 1221 bp,2242 bp; cMnsod2: 896, 1005, 1901), the sizes (1021 and 1005 bp) arevery close and could be just one band. HinfI produces 7 bands in theSouthern blot, 3 internal fragment for cMnsod1 (2325 bp, 1804 bp,1588 bp) and 7 internal fragment for cMnsod2 (1088 bp, 1245 bp,1461 bp, 1984 bp, 157 bp, 373 bp, 896 bp) some bands are very close(1588 and 1461 bp) and small (157 and 373 bp). And finally, RsaI pro-duced 6 bands in the Southern blot analysis due to an internal fragmentin cMnsod1 (2237 bp, 2003 bp, 1957 bp, 1236 bp, 1002 bp, 956 bp) and 4internal fragment in cMnsod2 (1893 bp, 1705 bp, 1472 bp, 660 bp).

3.3. Differential expression of the cMnSOD genes in response to LPS,WSSV and during ontogeny

Hemocytes play a fundamental role in the invertebrate innate im-mune system against microbial infections (Koshiba et al., 2007). Oneof these protective defenses is the generation of microbicidal reactive

d with L8 detected in hemocytes after LPS injection. The bars represent mean±SD (n=9).expression of cMnsod1, cMnsod2, and cMnsod3 at 1, 4 and6 hpost-LPS injection; C=control.

ese superoxide dismutase genes from the white shrimp LitopenaeusPhysiol., B (2012), doi:10.1016/j.cbpb.2012.03.003

Fig. 4. Ontogeny cMnSOD gene expression by RT-PCR. The samples are: eggs (E), nauplius(N), protozoeal (Z), and postlarval (PL) stages. The genes are cMnsod1, cMnsod2, cMnsod3,and the constitutive ribosomal protein L8.

5G.A. Gómez-Anduro et al. / Comparative Biochemistry and Physiology, Part B xxx (2012) xxx–xxx

oxygen species (ROS), but the elimination of ROS on time is critical forthe host to protect itself from damage (Holmblad and Söderhäll,1999). The antioxidant enzymatic system is essential to protect thehost from the toxic effects by the activated oxygen species. The rela-tionship between the antioxidant enzymes and immune reactions toLPS was published in crab (Scylla paramamosain), and ROS productionwas positively correlated with immediate response of antioxidant de-fense to the oxyradicals generated (Gopalakrishnan et al., 2011). Wefound a slight decrease (1.27 fold) in the cMnSOD mRNA levels inhemocytes of L. vannamei 1 h post-inoculation with LPS and after 6 hwe detected a significant increase (1.3 fold) respect the control (Fig. 2,panel a). Ji and cols. in 2009 using three types of pathogen-associatedmolecular patterns (PAMPs: laminarin, LPS and poly I:C) found thatthe transcript levels of cMnSOD in hemocytes from L. vannamei in-creased 12 h post-inoculation with 200 μg/mL of LPS. Their results alsoshow a slight decrease in cMnSOD levels after 3 h treatment, similarto the results herein presented and close to the control at 6 h (Ji et al.,2009). Previously, we reported two cMnsod genes (cMnsod2 andcMnsod3) expressed in hemocytes of L. vannamei (Gómez-Anduro etal., 2007). Based on this information we used gene specific primers forcMnSOD to determine the specific gene involved in the cMnSOD in-crease (Fig. 2, panel b), and we found that cMnsod2 is responsible forthe changes of cMnSOD by LPS. We could not see cMnSOD3 gene ex-pression in control cDNA sample because we used different conditionsfor the qPCR, since we used in this experiment 29 cycles, instead ofthe 35 previously used in Gómez-Anduro et al., 2007 to have a semi-quantitative detection.

The White Spot Syndrome Virus (WSSV) is a serious disease prob-lem in aquaculture, Reactive Oxygen Species (ROS) are produced dur-ing infection and the concentration is balanced by antioxidantenzymes. The antioxidant system can be modulated by immunosti-mulants as β carotene, β-1,3-glucans and vitamin E (Madhumathi,2011; Pacheco-Marges et al., 2011). We reported that the cMnSODtranscript levels changes rapidly and dynamically in response toWSSV infection (Gómez-Anduro et al., 2006); one hour after virus infec-tion, the cMnSOD levels increase 3.6-fold compared to non-infectedcontrol shrimp. Using hemocytes cDNA samples after 1, 3, 6 h post in-fection with WSSV, we wanted to determine if a specific gene was up-regulated and found that cMnsod3 is responsible for the change in thecMnSOD mRNA levels (Fig. 3). Differential expression of the cMnSODgene was reported in yeast in response to oxidative stress (Wu et al.,2009). The amplification products were evaluated the first time at 29cycles for the LPS experiment (data not shown) but no cMnSOD3 ampli-fication was detected; then the reaction was evaluated at 35 cycles. Wedetected a cMnsod3 decrease 1 h after WSSV infection; the alignmenttemperature (70 °C) necessary for specific detection using cMnSODprimers can affect the PCR reaction efficiency. After 3 and 6 h post infec-tion, cMnSOD3 increased (Fig. 3). These results can be the initial evi-dence of specific regulation of the cMnSOD genes by treatment andfail to see the antioxidant system as an unspecific system that is turnedon by any stimulus.

Shrimp have sequential changes in habit, morphology, and in gutstructure during ontogeny; those changes are related to specific ex-pressions and proteins activation (Lovett and Felder, 1990). The firstlarval stage, called nauplius, drifts in the open sea as part of the phy-toplankton and zooplankton (Gamboa-Delgado, 2010). After fifteento twenty days, larval shrimp enter the postlarval stage and migrate

Fig. 3. cMnSOD gene specific expression in response to WSSV infection. cMnsod1 (1),cMnsod2 (2) and cMnsod3 (3) and positive control (+) using general cMnSOD primers.

Please cite this article as: Gómez-Anduro, G.A., et al., Cytosolic manganvannamei are differentially expressed in response to..., Comp. Biochem.

into the sounds and brackish marshes. Migration from offshore wa-ters to coastal bays is accompanied by changes in salinity concentra-tion and temperature and also in food availability (Galindo-Bect et al.,2010). Temperature, salinity, pH, and oxygen concentration affectSOD activity (Cheng et al., 2005; Li and Chen, 2008; García-Triana etal., 2010; Li et al., 2010a, 2010b). Specifically, cMnSOD transcripts inhepatopancreas and gills decrease in shrimp subjected to hypoxia,and reoxygenation reverts the effect of hypoxia increasing the levelsof cMnSOD transcripts and SOD activity (García-Triana et al., 2010).We found differential cMnSOD gene expression during ontogeny;cMnsod2 is expressed in all first stages in ontogeny (Fig. 4). Afterthat, in juvenile intermolt shrimp, cMnsod1, cMnsod2, and cMnsod3are differentially expressed by tissues (Gómez-Anduro et al., 2007).The exact reason for cMnsod2 expression in the first stages is still un-known, but is likely derived from hepatopancreas which is the mostabundant organ from nauplii to post larval stage (Lovett and Felder,1990). We cannot rule out that cMnsod2 might be expressed in twotissues (hepatopancreas and hemocytes) compared to cMnsod1 andcMnsod3 that are expressed only in the nervous system and hemo-cytes, respectively (Gómez-Anduro et al., 2007).

In summary, this is the first report of crustacean cMnSOD genes.The cMnSOD is encoded by at least three genes, one intron-less andthe other two interrupted by multiple introns. cMnsod2 is inducedby LPS and is also responsible for part of the antioxidant responsefrom eggs to post larval stage during ontogeny. The cMnsod3expression is modulated by WSSV. This novel gene organization sug-gests that a more thorough dissection of the regulation of antioxidantprotection is necessary to understand the response to diverse stimu-lus and is important in Crustaceans, since they rely on these mecha-nisms as part of their innate immune system.

Supplementary data to this article can be found online at doi:10.1016/j.cbpb.2012.03.003.

Acknowledgements

The authors thank Julio Hernández Gonzalez, and Ernesto GoytortúaBores for technical assistance; Beatriz Gisela Trasviña for the ontogenyanalysis performed during her scientific summer training and DianaDorantes for detailed editing. This study was partly funded by CONACyTgrant 45967.

References

Altschul, S.F., Gish, W., Miller, W., Meyers, E.W., Lipman, D.J., 1990. Basic local align-ment search tool. J. Mol. Biol. 215, 403–410.

ese superoxide dismutase genes from the white shrimp LitopenaeusPhysiol., B (2012), doi:10.1016/j.cbpb.2012.03.003

6 G.A. Gómez-Anduro et al. / Comparative Biochemistry and Physiology, Part B xxx (2012) xxx–xxx

Asada, K., Kanematsu, S., Okada, S., Hayakawa, T., 1980. Phylogenic distribution of threetypes of superoxide dismutase in organisms and in cell organelles. In: Bannister,J.V., Hill, H.A.O. (Eds.), Chemical andBiological Aspects of Superoxide and SuperoxideDismutase. Elsevier, Amsterdam, pp. 136–153.

Bradfield, J., Wyatt, G., 1983. X-linkage of a vitellogenin gene in Locusta migratoria.Chromosoma 88, 190–193.

Brouwer, M., Brouwer, T.H., Grater, W., Enghild, J.J., Thogersen, I.B., 1997. The paradigmthat all oxygen-respiring eukaryotes have cytosolic CuZn-superoxide dismutaseand that Mn-superoxide dismutase is localized to the mitochondria does notapply to a large group of marine arthropods. Biochemistry 36, 13381–13388.

Chan, S.M., Rankin, S.M., Keeley, L.L., 1988. Characterization of the molt stages inPenaeus vannamei: setogenesis and haemolymph levels of total protein, ecdysteroidsand glucose. Biol. Bull. 175, 185–192.

Cheng, W.T., Wang, L.U., Chen, J.C., 2005. Effect of water temperature on the immuneresponse of white shrimp Litopenaeus vannamei to Vibrio alginolyticus. Aquaculture250, 592–601.

Cheng, W., Tung, Y.S., Liu, C.H., Chen, J.C., 2006. Molecular cloning and characterisationof cytosolic manganese superoxide dismutase (cytmn-sod) from the giant fresh-water prawn Macrobrachium rosenbergii. Fish Shellfish Immunol. 20, 438–449.

Chung, S.J., Bachvaroff, T.R., Trant, J., Place, A., 2012. A second copper zinc superoxidedismutase (CuZnSOD) in the blue crab Callinectes sapidus: Cloning and up-regulatedexpression in the hemocytes after immune challenge. Fish Shellfish Immunol. 32,16–25.

Fridovich, I., 1986. Superoxide dismutases. Adv. Enzymol. Relat. Areas Mol. Biol. 58,61–97.

Galindo-Bect, S., Aragón-Noriega, A., Hernández-Ayón, M., Lavín, M., Huerta-Diaz, M.,Delgadillo-Hinojosa, F., Segovia-Zavala, J., 2010. Distribution of penaeid shrimp larvaeand postlarvae in the upper Gulf of California. Crustaceana 83, 809–819.

Gamboa-Delgado, J., 2010. Isótopos estables como trazadores nutricionales naturalesen larvas y juveniles de Litopenaeus vannamei y Solea senegalensis. In: Cruz-Suarez,L.E., Ricque-Marie, D., Tapia-Salazar, Nieto-López, M.G., Villarreal-Cavazos, D.A.,Gamboa-Delgado, J. (Eds.), Avances en Nutrición Acuícola X -Memorias del X SimposioInternacional de Nutrición Acuícola, November 8–10, San Nicolás de las Garza, N. L.,México. Monterrey, México. ISBN: 978-607-433-546-0, pp. 620–667.

García-Triana, A., Zenteno-Savín, T., Peregrino-Uriarte, A.B., Yepiz-Plascencia, G., 2010.Hypoxia, reoxygenation and cytosolic manganese superoxide dismutase (cMnSOD)silencing in Litopenaeus vannamei: Effects on cMnSOD transcripts, superoxide dismu-tase activity and superoxide anion production capacity. Dev. Comp. Immunol. 34,1230–1235.

Gómez-Anduro, G.A., Barillas-Mury, C.V., Peregrino-Uriarte, A.B., Hernandez-López, J.,Gollas-Galvan, T., Yepiz-Plascencia, G., 2006. The cytosolic manganese superoxidedismutase from the white shrimp Litopenaeus vannamei: Molecular cloning and ex-pression. Dev. Comp. Immunol. 30, 893–900.

Gómez-Anduro, G.A., Sotelo-Mundo, R., Muhlia-Almazan, A., Yepiz-Plascencia, G., 2007.Tissue-specific expression and molecular modeling of cytosolic manganese super-oxide dismutases from thewhite shrimp Litopenaeus vannamei. Dev. Comp. Immunol.31, 783–789.

Gopalakrishnan, S., Chen, F.Y., Thilagam, H., Qiao, K., Xu, W.F., Wang, K.J., 2011. Modu-lation and Interaction of Immune-Associated Parameters with Antioxidant in theImmunocytes of Crab Scylla paramamosain Challenged with Lipopolysaccharides.Evid. Based Complement. Altern. Med. 8. doi:10.1155/2011/824962 ID 824962.

Gupta, S.K., Banerjee, T., Basak, S., Sahu, K., Sau, S., Ghosh, T.C., 2005. Studies on codonusage in Thermoplasma acidophilum and its possible implications on the occur-rences of lateral gene transfer. J. Basic Microbiol. 45, 344–354.

Henkle, D.K., Tawe, W., Warnecke, C., Walter, R.D., 1995. Characterization of the man-ganese superoxide dismutase cDNA and gene from the human parasite Onchocercavolvulus. Biochem. J. 308, 441–446.

Holmblad, T., Söderhäll, K., 1999. Cell adhesion molecules and antioxidative enzymesin a crustacean, possible role in immunity. Aquaculture 172, 111–123.

Hudinaga, M., 1942. Reproduction, development and rearing of Penaeus japonicus Bate.Jpn. J. Zool. 10, 305–353.

Jeong, Y.M., Mun, J.H., Lee, I., Woo, J.C., Hong, C.H., Kim, S.G., 2006. Distinct roles of thefirst introns on the expression of Arabidopsis profiling gene family members. PlantPhysiol. 140, 196–209.

Ji, P.F., Yao, C.L., Wang, Z.Y., 2009. Immune response and gene expression in shrimp(Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-associated molecular patterns. Fish Shellfish Immunol. 27, 563–570.

Jia, M., Li, Y., 2005. The relationship among gene expression, folding free energy andcodon usage bias in Escherichia coli. FEBS Lett. 579, 5333–5337.

Please cite this article as: Gómez-Anduro, G.A., et al., Cytosolic manganvannamei are differentially expressed in response to..., Comp. Biochem.

Kawaguchi, T., Noji, S., Uda, T., Nakashima, Y., Takeyasu, A., Kawai, Y., Takagi, H.,Tohyama, M., Taniguchi, N., 1989. A monoclonal antibody against COOH-terminalpeptide of human liver manganese superoxide dismutase. J. Biol. Chem. 264,5762–5767.

Knudsen, S., 1999. Promoter 2.0: for the recognition of PolII promoter sequences. Bio-informatics 15, 356–361.

Koshiba, T., Hashii, T., Kawabata, S., 2007. A structural perspective on the interactionbetween lipopolysaccharide and factor C, a receptor involved in recognition ofgram-negative bacteria. J. Biol. Chem. 282, 3962–3967.

Lamarre, C., LeMay, J.D., Deslauriers, N., Bourbonnais, Y., 2001. Candida albicans ex-presses an unusual cytoplasmic manganese containing superoxide dismutase(SOD3 Gene Product) upon the entry and during the stationary phase. J. Biol. Chem.276, 43784–43791.

Li, C.C., Chen, J.C., 2008. The immune response of white shrimp Litopenaeus vannameiand its susceptibility to Vibrio alginolyticus under low and high pH stress. FishShellfish Immunol. 25, 701–709.

Li, J., Chen, P., Liu, P., Gao, B., Wang, Q., Li, J., 2010a. The cytosolic manganese superoxidedismutase cDNA in swimming crab Portunus trituberculatus: Molecular cloning,characterization and expression. Aquaculture 309, 31–37.

Li, C.C., Yeh, S.T., Chen, J.C., 2010b. Innate immunity of the white shrimp Litopenaeusvannamei weakened by the combination of a Vibrio alginolyticus injection andlow-salinity stress. Fish Shellfish Immunol. 28, 121–127.

Lin, Y.C., Lee, F.F., Wu, C.L., Chen, J.C., 2010. Molecular cloning and characterization of acytosolic manganese superoxide dismutase (cytMnSOD) and mitochondrial man-ganese superoxide dismutase (mtMnSOD) from the kuruma shrimp Marsupenaeusjaponicus. Fish Shellfish Immunol. 28, 143–150.

Liu, X.L., Xi, Q.Y., Yang, L., Li, H.Y., Jiang, Q.Y., Shu, G., Wang, S.B., Gao, P., Zhu, X.T.,Zhang, Y.L., 2011. The effect of dietary Panax ginseng polysaccharide extract onthe immune responses in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol.30, 495–500.

Lovett, D.L., Felder, D.L., 1990. Ontogeny of kinematics in the gut of the white shrimpPenaeus setiferus (Decapoda, Penaeidae). J. Crust. Biol. 10, 53–68.

MacKinnon, L., 2007. Characteristics of the Human Genome. CSE 527 notes (November19). Gene Finding.

Madhumathi, M., 2011. Antioxidant status of Penaeus monodon fed with Dunaliella salinasupplemented diet and resistance against WSSV. Int. J. Eng. Sci. Technol. 3, 7249–7259.

Maniatis, T., Tasic, B., 2002. Alternative pre-mRNA splicing and proteome expansion inmetazoans. Nature 418, 236–243.

Marklund, S.L., 1982. Human copper-containing superoxide dismutase of high molecu-lar weight. Proc. Natl. Acad. Sci. U. S. A. 79, 7634–7638.

Ochman, H., Gerber, A.S., Hartl, D.L., 1988. Genetic applications of an inverse polymerasechain reaction. Genetics 120, 621–623.

Pacheco-Marges, R., Ascencio, F., Zarain, M., Gómez-Anduro, G., Campa, A., 2011.Enhancement of superoxide dismutase and catalase activity in juvenile brown shrimp,Farfantepenaeus californiensis (Holmes, 1900), fed β-1,3 glucan, vitamin E, and β-carotene and infected with white spot syndrome virus. Lat. Am. J. Aquat. Res. 39,534–543.

Papanikolaou, N., Kalliopi, T., Theodosios, T., Vasilis, J.P., Ioannis, I., 2009. Gene socialization:gene order, GC content and gene silencing in Salmonella. BMC Genomics 10, 597.

Pipe, R., Porte, C., Livingstone, D., 1993. Antioxidant enzymes associated with the blood cellsand haemolymph of the mussel Mytilus edulis. Fish Shellfish Immunol. 3, 221–233.

Sambrook, J., Fritsch, E., Maniatis, T., 1989. Molecular cloning: A laboratory manual.New York, NY, USA.

Schott, E.J., Robledo, J.A., Wright, A.C., Silva, A.M., Vasta, G.R., 2003. Gene organizationand homology modeling of two iron superoxide dismutases of the early branchingprotist Perkinsus marinus. Gene 309, 1–9.

Stenico, M., Lloyd, A., Sharp, P., 1994. Codon usage in Caenorhabditis elegans: delineationof translational selection and mutational biases. Nucleic Acids Res. 22, 2437–2446.

Tian, J., Chen, J., Jiang, D., Liao, S., Wang, A., 2011. Transcriptional regulation of extracellu-lar copper zinc superoxide dismutase from white shrimp Litopenaeus vannamei fol-lowing Vibrio alginolyticus and WSSV infection. Fish Shellfish Immunol. 30, 234–240.

Weisiger, R.A., Fridovich, I., 1973. Superoxide dismutase. J. Biol. Chem. 248, 3582–3592.Wu, C.Y., Steffen, J., Eide, D.J., 2009. Cytosolic superoxide dismutase (SOD1) is critical

for tolerating the oxidative stress of zinc deficiency in yeast. PLoS One 4, E7061.Zhang, J., Jay-Kuo, C.C., Chen, L., 2011. GC content around splice sites affects splicing

through pre-mRNA secondary structures. BMC Genomics 12, 90–101.Zhu, H., Doumen, C., 2009. Identification of a cytoplasmic manganese superoxide dis-

mutase (cMnSOD) in the red swamp crawfish, Procambarus clarkii: cDNA cloningand tissue expression. Zool. Sci. 26, 284–288.

ese superoxide dismutase genes from the white shrimp LitopenaeusPhysiol., B (2012), doi:10.1016/j.cbpb.2012.03.003