Cloning and Expression of Two Chitin Deacetylase Genes ofSaccharomyces cerevisiae

. 13: 327–336 (1997)

Cloning and Expression of Two Chitin DeacetylaseGenes of Saccharomyces cerevisiae

CHITRA MISHRA1, CARLOS E. SEMINO1, KENNETH J. MCCREATH2, HUMBERTO DE LA VEGA1,BEVERLY J. JONES1, CHARLES A. SPECHT1* AND PHILLIPS W. ROBBINS1

1Center for Cancer Research, Bldg E-17, Rm 235, Massachusetts Institute of Technology, Cambridge,MA 02139, U.S.A.2Present address: Department of Molecular and Cell Biology, University of Aberdeen, Marischal College,Aberdeen AB9 1AS, U.K.

Received 13 May 1996; accepted 13 September 1996

Chitin deacetylase (EC 3.5.1.41), which hydrolyses the N-acetamido groups of N-acetyl--glucosamine residues inchitin, has been demonstrated in crude extracts from sporulating Saccharomyces cerevisiae. Two S. cerevisiae openreading frames (ORFs), identified by the Yeast Genome Project, have protein sequence homology to a chitindeacetylase from Mucor rouxii. Northern blot hybridizations show each ORF was transcribed in diploid cells aftertransfer to sporulation medium and prior to formation of asci. Each ORF was cloned in a vector undertranscriptional control of the GAL 1, 10 promoter and introduced back into haploid strains of S. cerevisiae. Chitindeacetylase activity was detected by in vitro assays from vegetative cells grown in galactose. Chemical analysis ofthese cells also demonstrated the synthesis of chitosam in vivo. Both recombinant chitin deacetylases showed similarqualitative and quantitative activities toward chitooligosaccharides in vitro. A diploid strain deleted of both ORFs,when sporulated, did not show deacetylase activity. The mutant spores were hypersensitive to lytic enzymes(Glusulase or Zymolyase). (? 1997 by John Wiley & Sons, Ltd.)

Yeast 13: 327–336, 1997.No. of Figures: 5. No. of Tables: 3. No. of References: 28.

— chitin deacetylase; chitinase; chitin; CDA1 gene; CDA2 gene; Saccharomyces cerevisiae

INTRODUCTION

Chitosan is the product of deacetylation ofchitin, the â-1,4-linked hompolymer ofN-acetylglucosamine (GlcNAc). In the yeast,Saccharomyces cerevisiae chitin is essential forviability (Shaw et al., 1991). It is a structuralcomponent of the cell wall and required for septumformation and repair during vegetative growth (fora review see Bulawa, 1993; Cid et al., 1995). Theascospore cell wall, which is structurally distinctfrom the vegetative cell wall, contains chitosan, thesecond layered structure of the spore wall next tothe outer dityrosine layer (Briza et al., 1986, 1988).While chitosan is not essential for spore viability,

an interaction between the polyanion, dityrosineand polycation, chitosan could be responsiblefor the chemical resistance and the resistance toenzymatic hydrolysis by Glusulase, chitinase, andZymolyase of the spore cell wall (Briza et al.,1990).Some fungi classified as zygomycetes synthesize

chitosan as a major fraction of the vegetative cellwall. In Mucor rouxii chitosan biosynthesis hasbeen well characterized and proceeds by the co-ordinate action of chitin synthase (EC 2.4.1.16)and chitin deacetylase (EC 3.5.1.41). The formersynthesizes chitin by polymerization of GlcNAcresidues from the sugar donor UDP-GlcNAc,whereas the latter hydrolyses the N-acetamidogroups on the nascent chitin chains (Araki and Ito,1975; Davis and Bartnicki-Garcia, 1984). There is

*Correspondence to: Charles A. Specht.Contract grant sponsor: National Institutes of Health.

CCC 0749–503X/97/040327–10 $17.50? 1997 by John Wiley & Sons Ltd

no evidence for de novo synthesis of chitosan fromthe sugar donor UDP-glucosamine (Farkas, 1979;Davis and Bartnicki-Garcia, 1984).In yeast, chitin synthase 3 (CHS3) synthesizes

the chitin fraction that is deacetylated in theascospore wall (Pammer et al., 1992); however,little is known about the deacetylase. Recently,a chitin deacetylase gene was sequenced fromM. rouxii (Kafetzopoulos et al., 1993). A searchof the non-redundant protein database of theNational Center for Biotechnology Information(NCBI) with the M. rouxii deacetylase proteinsequence identified two homologous open readingframes (ORFs) of S. cerevisiae. The two ORFs(L2142.1 and L2142.2) were sequenced fromcosmid clone L2142, isolated from chromosomeXII, as part of the Yeast Genome Project. We havecloned and expressed both ORFs which we havedesignated CDA1 and CDA2 and found each toencode a chitin deacetylase. Transcription of bothgenes could only be detected following the induc-

tion of sporulation and prior to the formationof asci.

MATERIALS AND METHODS

Strains

The S. cerevisiae strains used in this paper arelisted in Table 1. Two haploid strains that hadmost of the chitinase gene CTS1 (Kuranda andRobbins, 1991) deleted were constructed by stan-dard methods (Rothstein, 1991). A 1·655 kb BglII-BsmI fragment was removed from plasmid pCT20and replaced with a 0·85 kb BglII-EcoRI fragmentof TRP1. This construction was linearized withBamHI and the digested DNA used in transform-ation to generate strains CSY3 and CSY4. Diploidstrains of S. cerevisiae (PRY229 and PRY490)were used for sporulation experiments, andPRY225 for Northern blot analysis.

Table 1. Strains.

Strain Genotype Reference

SHY2 MATá ste-VC9, ura3-52, his3-Ä1, leu2-3, leu2-112, trp1-289, can1-100 ATCC 44770

PRY225 MATa/á, ura3-52/ura3-52, lys2-801am/ys2-801am, ade1-101oc/ade2-101oc,trp1-1Ä1/trp1-1Ä1, his3-Ä200/his3-Ä200, leu2-Ä1/leu2-Ä1

Sikorski andHeiter (1989)

PRY229 MATa/á, his4-619/+, +/ade2-101 This work

PRY242 MATa, his3-Ä200, leu2-3, 112, trp1-Ä1, ura3-52, GAL+ Kuranda andRobbins (1991)

PRY243 MATá, his3-Ä200, leu2-3, 112, trp1-Ä1, ura3–51, GAL+ Kuranda andRobbins (1991)

CSY3 MATa, his3-Ä200, leu2-3, 112, trp1-Ä1, ura3-52, GAL+, cts1::TRP1 This work

CSY4 MATá, his3-Ä200, leu2-3, 112, trp1-Ä1, ura3-52, GAL+, cts1::TRP1 This work

PRY490 MATa/á, his3-Ä200/his3-Ä200, leu2-3, 112/leu2-3, 112, trp1-Ä1/trp1-Ä1,ura3-52/ura3-52, GAL+/GAL+, cts1::TRP1/cts1::TRP1

This work

BJY1 MATa, his3-Ä200, leu2-3, 112, trp1-Ä1, ura3-52, GAL+, cda2::HIS3::cda1 This work

BJY2 MATá, his3-Ä200, leu2-3, 112, trp1-Ä1, ura3-52, GAL+, cda2::HIS3::cda1 This work

PRY498 MATa/á, his3-Ä200/his3-Ä200, leu2-3, 112/leu2-3, 112, trp1-Ä1/trp1-Ä1,ura3-52/ura3-52, GAL+/GAL+, cda2::HIS3::cda1

This work

328 . .

? 1997 by John Wiley & Sons, Ltd . 13: 327–336 (1997)

Sporulation of diploid strains of S. cerevisiae forchitin deacetylase activity

Cells were grown at 30)C overnight in YPDmedium. Diploids were sporulated in 0·3% potass-ium acetate at 30)C without shaking. Samples wereremoved at intervals for the microscopic examin-ation of spores and for the estimation of chitindeacetylase activity. Cell pellets were suspendedin 50 m-Tris–HCl (pH 7·5) containing 1 m-phenylmethylsulfonyl fluoride (PMSF). Glassbeads were added and the cells were broken byvortexing. Homogenates were centrifuged at10 000#g for 10 min at 4)C and the supernatantwas analysed for chitin deacetylase activity.

Cloning of the chitin deacetylase genes

Primers were designed based on the DNAsequences of ORFs L2142.1 and L2142.2 (Gen-Bank accession number U17247) such that whenused in the polymerase chain reaction (PCR) eachORF, with start and termination codons, would beamplified. The primers contained restriction sitesto simplify cloning into a derivative of pRS305which has the GAL1,10 promoter (constructed byDr David Miller, unpublished). Primers to amplifyORF L2142.1 were: P1, GCGGGATCCAATGAGAATACAACT and P2, CCCAAGCTTCCCTGAAAATTAGGACAA, 5* and 3*, respectively.Primers to amplify ORF L2142.2 were: P1,GGGGGATCCAATGAAAATTTTCAA and P2,GTGAAGCTTCTAGTCGTAAGCGTTCGAT,5* and 3*, respectively. PCR reactions (100 ìl)contained PCRII buffer (Perkin Elmer),2·5 m-MgCl2, 200 n each dNTP, 1 m eachprimer, ca. 1 ìg genomic DNA (strain SHY2), and2·5 units Taq Polymerase. Samples were cycled30 times (94)C, 1 min; 55)C, 1 min; 72)C, 1·5 min).The products (ca. 900 bp) were first cloned intoplasmid pSK (Stratagene) that had been digestedwith EcoRV and modified by addition of adideoxythymidine using TAQ polymerase (Holtonand Graham, 1990). Next, the plasmids weredigested with BamHI and HindIII and the insertswere purified following electrophoresis. Each PCRproduct was finally ligated to pRS3052ìGALdigested with BglII and HindIII. Standard proce-dures were used for making plasmid constructionsand maintaining plasmids in Escherichia coli(Sambrook et al., 1989). Plasmids were sequencedby cycle sequencing (Epicentre Technologies) usingT3 and T7 primers.

Expression of recombinant ORFs in yeastYeast cells were transformed (Soni et al., 1993)

and leu2 prototrophs were selected. Transformantswere grown in liquid 2% glucose-based SDmedium plus supplements overnight at 30)C, thentransferred to 2% galactose-based SD mediumplus supplements to an OD650 of about 1·8. Cellswere harvested by centrifugation. Cells wereresuspended in 50 m-Tris–HCl (pH 7·5) and1 m-PMSF, homogenized with glass beads andcentrifuged, as above. The supernatant was usedfor chitin deacetylase activity measurements.

Construction of mutant strains deleted ofboth ORFsA fragment of DNA was made by double fusion

PCR essentially as described by Amberg et al.(1995). It included the HIS3 gene flanked byfragments 5* of ORF L2142.2 and 3* of ORFL2142.1. The left flank fragment was made withprimers: ACATACTAGGCGAGTTGTCGCCTT(CDA2-5*) and CGTGTCATTCTGAACGAAAATGCTGCGAACAGCAC (CDA2-3* : HIS3–3*);the HIS3 fragment with primers: TCGTTCAGAATGACACG (HIS3-3*) and CTCTTGGCCTCCTCTAG (HIS3-5*); and the right flank fragmentwith primers: CTAGAGGAGGCCAAGAGGTTTCTCATTGTGTCGGC (HIS3-5* : CDA1-5*)and GGTACTCTAGCTAACGCGAA (CDA1-3*). The underlined sequences overlap with theHIS3 primers for fragment fusions. The final PCRproduct was used to transform haploid strainsPRY242 and PRY243 and selected transformantswere examined by Southern blot hybridization forthe expected deletion. Diploids of transformantswere made and sporulated on SPO medium,plus supplements and agar (Kassir and Simchen,1991). Samples of spores were incubated over-night at room temperature in phosphate-bufferedGlusulase (DuPont) or Zymolyase-100T (ICNImmunoBiologicals) as described (Briza et al.,1990) and examined microscopically for lysis.

Chitin deacetylase activity towardschitooligosaccharidesChitin deacetylase activity was determined using

radiolabelled chitooligosaccharides. The substrateswere prepared by reacetylation of chitosan oligo-saccharides (Seikayaku) in the presence of[1-14C]acetic anhydride (112 mCi, 4·14 Gbq/mmol;Amersham). The chitosan oligosaccharide to belabelled was resuspended in 50 ìl of 10% acetic

329


acid at a concentration of 1 m, mixed with 500 ìlof ethanol, and then 100 ìCi of [1-14C]aceticanhydride and incubated at room temperature for4–5 h. Unlabelled acetic anhydride (100 ìl) wasadded and incubation continued at room tempera-ture, overnight. Each sample was dried undernitrogen and the product purified by chromat-ography (P2, BioRad) in 0·1 -pyridinium acetate,pH 5·5. The solvent was removed by evaporationwith nitrogen and each sample was resuspended inwater and stored at "20)C.To 5–10 ìl of spore or vegetative cell extract,

containing approximately 1 mg of protein, wasadded a radiolabelled (N-acetyl-[14C])-chito-oligosaccharide (20 000 cpm) in a total volume of20 ìl of 50 m-Tris–HCl (pH 7·5); incubation wasat 37)C for 24 h. The deacetylated products wereanalysed as described by Semino and Robbins(1995) by thin-layer chromatography (TLC) usingsilica gel 60 (EM Science) and a solvent systemconsisting of n-butanol : ethanol : water : aceticacid (5 : 4 :3 : 1). Deacetylated chitooligosac-charides were visualized by exposing TLC plates toX-ray films at room temperature or "70)C.

Reacetylation of chitooligosaccharidesThe deacetylated chitooligosaccharides were

resuspended in 10 ìl of 10% acetic acid and then100 ìl of methanol was added and mixed. At thesame time 10 ìl of acetic anhydride was added.The tubes were incubated at 30)C for 1 h. Finally,the sample was dried and analysed by TLCor high-performance liquid chromatography(HPLC). HPLC was carried out as previouslydescribed (Semino et al., 1996).

Deacetylase activity during in vitro chitinsynthesisYeast cell extracts (50 ìl) were incubated with

UDP[glucosamine-14C]GlcNAc, 0·1 ìCi (300 mCi/mmol) or UDP[acetyl-14C]GlcNAc, 0·5 ìCi(50 mCi/mmol) in 50 m-Tris–HCl (pH 7·5),20 m-MgCl2, 10 m-GlcNAc, at 30)C for 1 h.After the incubation the tubes were boiled for2 min and the samples resuspended in 6% KOHand heated for 2 h at 80)C. The insoluble materialwas washed three times with water and counted forradioactivity.

Analysis of chitosan S. cerevisiae cellsS. cerevisiae cells were grown overnight at 30)C

in 2% glucose-based SD medium plus supplements.

Cells were collected and transferred to 2%galactose-based SD medium plus supplements.After 48 h cells were harvested by centrifugation.Chitosan was extracted from cells following thepublished procedure (Miyoshi et al., 1992), exceptthat wet cells were used. Chitosan was analysed bythe modified colorimetric method proposed byRide and Drysale (1972) for the estimation ofchitin content in fungi. Commercial chitosan(Sigma) was used as control. The chitin content ofcells was analysed by the Morgan-Elson methodafter digestion with chitinase and â-glucuronidase(Bulawa et al., 1986).

Northern and Southern blot hybridizationsS. cerevisiae strain PRY225 was grown at 30)C

in liquid YPD medium, PSP2 medium, and sporu-lation (SPO) medium as described by Kassir andSimchen (1991). Asci formation was monitoredmicroscopically. Total RNA was extracted asdescribed by Kohrer and Domdey (1991). ForNorthern blotting, samples of RNA were separ-ated by electrophoresis in formaldehyde agarosegel and transferred to Hybond N+ (Amersham) in20#SSC. The membrane was washed in 2#SSCfor 15 min and crosslinked by exposure to UVlight. Standard methods were used for preparingtotal genomic DNA (Strathern and Higgins, 1991)and Southern blots (Sambrook et al., 1989).DNA used as each probe was labelled with

[á-32P]dCTP (NEN) by random oligonucleotidepriming according to the manufacturer’s instruc-tions (Boehringer, Mannheim). Membranes werehybridized overnight at 60)C in a solution con-taining 50 m-Tris–HCl (pH 7·5), 1 -NaCl, 7%SDS, denatured salmon sperm DNA at 50 ìg/ml,and 32P-labelled PCR product (1#106 cpm/ml).Washes were at 65)C with 2#SSC/1% SDS for10 min (twice) followed with 0·1#SSC/0·1% SDSfor 10 min. Membranes were exposed to X-rayfilm at "70)C. The blot was stripped of probe in0·1#SSC, 0·1% SDS at 100)C and reused forhybridization with another probe.

RESULTS

Identification of chitin deacetylase activity in sporeextracts of S. cerevisiaeChitin deacetylases have typically been assayed

with radiolabelled glycol chitin or chitooligo-saccharides (Tsigos and Bouriotis, 1995; Gaoet al., 1995). These methods are based on acetic

330 . .


acid release from substrates. However, littlestructural information is available regardingproducts of hydrolysis of chitooligosaccharides.We have developed an assay method to identifychitin deacetylase activity utilizing radiolabelledchitooligosaccharides followed by a simple,rapid TLC technique. Extracts of sporulatingS. cerevisiae were incubated with radiolabelledchitotetraose, chitopentaose, or chitohexaose for24 h at 37)C. Following TLC, chitooligosac-charides migrated upwards with the mobile phaseand their deacetylated products, depending ondegree of deacetylation, moved more slowly. Sporeextracts from a wild-type strain and a mutantstrain lacking chitinase (data not shown) gavesimilar results and little evidence for chitooligo-saccharide degradation by the wild-type extract(Figure 1A). The number of products was sub-strate dependent with one product discerniblefrom chitotetraose (Tetrasaccharide 1 or T1), twofrom chitopentaose (Pentasaccharide 1 and 2 or P1and P2), and three from chitohexaose (Hexa-saccharide 1, 2 and 3 or H1, H2 and H3). Todemonstrate that each product resulted fromdeacetylation, they were reacetylated with un-labelled acetic anhydride (see Materials andMethods). HPLC analysis showed that eachproduct could be reacetylated as evident by elutioncoincident with chitotetraose, chitopentaose, andchitohexaose internal standards (Figure 1B).

Cloning and expression of chitin deacetylase genesof S. cerevisiaeThe S. cerevisiae gene sequences for chitin

deacetylases CDA1 and CDA2 were obtainedfrom the data bank of NCBI (see Figure 2). PCRwas used to amplify each ORF of approximately900 bp from genomic DNA of S. cerevisiae. The

PCR products were cloned into the plasmid pSKand sequenced. The cloned DNAs were incomplete accord with the published S. cerevisiaesequences. Next, the ORFs were recloned into aderivative of pRS305 containing the GAL 1,10promoter sequence to generate plasmids pYCDA1and pYCDA2. Yeast cells were transformed andleu2 prototrophs selected.Induction of CDA1 and CDA2 expression was

achieved by growing transformants to mid-exponential phase in non-inducing medium (liquidSD plus supplements with 2% glucose) at 30)C,and then resuspending cells in inducing medium(liquid SD plus supplements with 2% galactose) at30)C. Yeast cells were harvested after about 2 daysand cell extracts were analysed by TLC for chitindeacetylase activity. Incubation of cell extractswith [14C]acetyl-labelled chitooligosaccharidesrevealed that both CDA1 and CDA2 candeacetylate chitotetraose and chitohexaose withsimilar efficiency (Figure 3A,B). Each productwhen reacetylated with acetic anhydride had thesame mobility by TLC as the original substrate.In addition, a sample of deacetylated chitotetra-

ose (T1) from Figure 3C was reacetylated withacetic anhydride, reduced with sodium borohy-dride, digested with chitinase, and then analysedby TLC. Only two products were obtained, thedisaccharides chitobiose and chitobiositol (datanot shown). Considering that the original acetyl-[14C]chitotetraose was homogeneously labelledand that the non-reduced disaccharide (chitobiose)had only about half the radioactivity of thereduced disaccharide (chitobiositol), it seems prob-

Figure 2. Comparison of deduced amino acid sequence of ORFs L2142.1 and L2142.2 from S. cerevisiae (CDA1and CDA2, respectively) and the chitin deacetylase of M. rouxii. The alignment was generated using MegAlign(DNASTAR).

331


Figure 1. Deacetylation of chitooligosaccharides by extracts from sporulating S. cerevisiae cells (strain PRY229); samplesseparated by TLC (A). Chitotetraose, chitopentaose and chitohexaose standards (substrates) are in lanes 1–3, respectively. Productsgenerated from chitotetraose, chitopentaose and chitohexaose substrates (lanes 4–6), respectively. Samples removed from lanes 4–6are indicated by bars (T1 from lane 4, P1 and P2 from lane 5, and H1–H3 from lane 6). Each sample was reacetylated with aceticanhydride and chromatographed by HPLC (B). Position of chitooligosaccharide standards are indicated numerically above verticalarrows in each chromatograph: 3, chitotriose; 4, chitotetraose; etc.


able that deacetylation takes place preferentially atthe non-reducing end of the oligosaccharide (datanot shown).

Analysis of chitosan in vegetative cells expressinga deacetylase gene

The chitosan content of vegetative cells ofS. cerevisiae having a cloned chitin deacetylasegene was analysed using the modified Morgan-Elson procedure described in Material and Meth-ods. Commercial chitosan was used as a standard.The chitin content of yeast cells was also analysed.Table 2 shows that 14% and 22% of the chitinwas deacetylated in vegetative cells expressingthe galactose-induced CDA1 and CDA2 genes,respectively. Little or no chitosan was detected

from cells that were non-induced, i.e. glucose asthe carbon source.

Activity of deacetylase in an in vitro chitinsynthase systemThe activity of the deacetylase on nascent chitin

chains was evaluated by carrying out parallelchitin synthase assays with UDP-GlcNAc labelledin either the glucosamine or the N-acetyl moieties(see Materials and Methods). The results of theseexperiments (Table 3) show clearly that deacetyl-ase expressed from the cloned genes in vegetativecells is able to bring about deacetylation of thechitin made in an in vitro assay system.

Chitin deacetylase transcription during sporulationRNA from strain PRY225 was probed with

Figure 3. Deacetylation of chitooligosaccharides by extracts fromhaploid strains of S. cerevisiae bearing recombinant chitin deacetylases.Products from incubation with chitotetraose (A) or chitohexaose (B) asseparated by TLC. In both (A) and (B), lane 1 samples were incubatedwith extracts expressing CDA1 and lane 2 samples were incubated withextracts expressing CDA2. Bars indicate position of samples combinedfrom lanes 1 and 2. Each sample was reacetylated with acetic anhydrideand products were separated by TLC (C). [14C]Chitooligosaccharidestandards are shown in lane 1. Product with [14C]chitotetraose assubstrate is shown before and after reacetylation in lanes 2 and 3,respectively. Product with [14C]chitohexaose as substrate is shownbefore and after reacetylation in lanes 4 and 5, respectively.

333


DNA from the coding region of CDA1 and CDA2.The same size transcript (1·6 kb) and amountof transcript was detected for each gene(Figure 4A,B). Spore extracts showed maximumexpression of message at the time when few cellshad formed asci. No evidence for either transcriptwas observed in cells growing vegetatively, evenupon exposure to X-ray film longer than thoseshown. Two control hybridizations using probesfor chitinase (CTS1) and actin (ACT1) were made(Figure 4C and D, respectively). CTS1 transcrip-tion was elevated upon transfer from YPDmedium to PSP2 medium and a second, largertranscript of CTS1 was evident as more cellsformed asci.

Chitin deacetylase mutants

Because of the apparently redundant propertiesof the two chitin deacetylase genes and their geneproducts, we thought both CDA1 and CDA2needed to be disrupted in order to observe amutant phenotype. A deletion of 3160 bp wasmade that removed all but 45 bp from the codingregion of CDA2 and 50 bp from that of CDA1 asshown in Figure 5. Southern blot hybridizations ofgenomic DNA of strains PRY242 and PRY243

Figure 4. Northern blot analysis. Transcription of (A) CDA1,(B) CDA2, (C) CTS1 and (D) ACT1. Probes were 0·9 kb PCRproducts of CDA1 and CDA2, a 1·655 kb BglII-BsmI fragmentof CTS1 from plasmid pCT20 (Kuranda and Robbins, 1991)and a 1·4 kb cDNA fragment of ACT1 from plasmid pLV4 (L.Vega, unpublished). RNA was extracted from diploid strainPRY225 grown in YPD medium (YPD), PSP2 medium (PSP2),or sporulation medium for the times indicated (in h). Thepercentage of cells having formed asci were: 5% at 16 h, 30% at20 h, 30% at 24 h, and 40% at 48 h. Positions of rRNA andRNA ladder size standards (BRL) are indicated.

Table 2. Quantitation of chitosan and chitin in haploid strains transformed withrecombinant CDA plasmids.

Strain Carbon source Chitosana Chitina Chitosan (%)

CYS3 (pYCDA1) Galactose 4·6 27·5 14CYS3 (pYCDA1) Glucose ND 30·3 —CYS4 (pYCDA2) Galactose 6·2 22·0 22CYS4 (pYCDA2) Glucose 1·2 34·6 3

aWeight of chitosan and chitin in ìg per 100 g of wet cells. ND, Not detected.

Table 3. In vitro synthesis of chitosan-like polymer.

StrainaUDP[acetyl-14C]

GlcNAcUDP[glucosamine-14C]

GlcNAcIncorporation

(cpm)

CSY4 + " 12 000CYS3 (pYCDA1) + " 3660CYS4 " + 2000CYS3 (pYCDA1) " + 1800

aCells were grown using galactose as the carbon source.

334 . .


gave the hybridization patterns of EcoRI re-striction fragments with two probes as predictedby the DNA sequence. Likewise, genomic DNA oftransformants BJY1 and BJY2 gave the predictedEcoRI fragment(s) for the replacement of wild-type sequence by the double fusion PCR fragment(data not shown). The homozygous, mutantdiploid (strain PRY498) and strain PRY491 weresporulated. Three discernible phenotypes werefound for the mutant (data not shown): one, lossof deacetylase activity using labelled chitopentaoseas substrate and analysis of products by TLC; two,a less well defined spore wall and lobed ascus asexamined by light microscopy; and three, lysis ofthe spores upon incubation with Glusulase orZymolyase.

DISCUSSION

It is well known that the cell wall of S. cerevisiaecontains chitin while spore walls, in contrast,contain chitosan. Since chitosan formation inM. rouxii has been shown to proceed by way ofchitin formation followed by deacetylation (Arakiand Ito, 1975; Davis and Bartnicki-Garcia, 1984),we anticipated, and indeed have demonstrated,that the Saccharomyces chitin deacetylases CDA1and CDA2 are expressed exclusively during sporu-lation. The exact timing of chitosan depositionis not known, but it must obviously be coordi-nated with formation of the adjacent ditryosinelayer (Briza et al., 1986), which ultimatelyprotects mature spores from lytic enzymes andchemical and environmental challenges. Sporesof a cda1, cda2 double mutant do not expresschitin deacetylase. And, with the loss to chitosan,

the sensitivity of the mutant spores to lyticenzymes is consistent with chitosan interactingwith dityrosine. In addition, the genes DIT1 andDIT2 (Briza et al., 1990), which encode enzymesthat catalyse the synthesis of a dityrosine precursor(Briza et al., 1994) and the deacetylase genesCDA1 and CDA2 have similar patterns oftranscription.The deacetylases must act rapidly and efficiently

on nascent chitin chains as soon as they areformed, since fibrous hydrogen-bonded chitin isrefractory to deacetylase action. That they do, infact, act rapidly and efficiently is demonstratedboth by the formation of chitosan in vegetativecells expressing deacetylase activity (Table 2), andby the in vitro chitin synthase assay results pre-sented above which show strikingly high levelsof chitosan formation in vegetative cell extractscontaining deacetylase (Table 3). It seems likely,therefore, that the deacetylase becomes physicallyassociated with the chitin synthase complex. Thisassociation is currently under investigation.Whether proteins that affect chitin synthesis, suchas SHC1 (CSD4 homolog) which functions onlyduring sporulation (Bulawa, 1993) might, forexample, interact in a specific fashion with thedeacetylases also deserves consideration. However,it seems possible that the deacetylases might havesimpler, more general requirements. As shownhere, they function well even when present in

Figure 5. Physical maps of the relevant region of chromosome XII of S. cerevisiae wild-type strain(upper map) and mutant strain deleted of both ORFs (lower map). Large arrows indicate directionof transcription and small arrows indicate DNA used as probes to confirm the deletion. EcoRI (E)restriction sites are indicated.

335


vegetative cells which do not normally makechitosan. The deacetylases may simply have highaffinity for nascent chitin chains.

ACKNOWLEDGEMENTS

We thank Christine Bulawa for providing theNorthern blot, Barbara Osmond for constructingdiploid strains and David Miller and Leticia Vegafor providing plasmids pRS3052ìGAL and pLV4.Support was provided by grants from the NationalInstitutes of Health (GM31318 to P.W.R. andCA14051 to R. Hynes) and a doctoral fellowshipfrom the National Council for Science and Tech-nology (Mexico) and CINVESTAV to H. de la V.

REFERENCES

Amberg, D. C., Botstein, D. and Beasley, E. M. (1995).Precise gene disruption in Saccharomyces cerevisiae bydouble fusion polymerase chain reaction. Yeast 11,1275–1280.

Araki, Y. and Ito, F. (1975). A pathway of chitosanformation in Mucor rouxii. Enzymatic deacetylationof chitin. Eur. J. Biochem. 55, 71–78.

Briza, P., Winkler, G., Kalchhauser, H. andBreitenbach, M. (1986). Dityrosine is a prominentcomponent of the yeast ascospore wall. A proof of itsstructure. J. Biol. Chem. 261, 4288–4294.

Briza, P., Ellinger, A., Winkler, G. and Breitenbach, M.(1988). Chemical composition of the yeast ascosporewall. The second outer layer consists of chitosan.J. Biol. Chem. 263, 11569–11574.

Briza, P., Breitenbach, M., Ellinger, A. and Segall, J.(1990). Isolation of two developmentally regu-lated genes involved in spore wall maturation inSaccharomyces cerevisiae. Genes Dev. 4, 1775–1789.

Briza, P., Eckerstorfer, M. and Breitenbach, M. (1994).The sporulation-specific enzymes encoded by theDIT1 and DIT2 genes catalyze a two-step reactionleading to a soluble LL-tyrosine-containing precursorof the yeast spore wall. Proc. Natl. Acad. Sci. USA 91,4524–4528.

Bulawa, C. E., Slater, M., Cabib, E., et al. (1986). TheS. cerevisiae structural gene for chitin synthase is notrequired for chitin synthesis in vivo. Cell 46, 213–225.

Bulawa, C. E. (1993). Genetics and molecular biology ofchitin synthesis in fungi. Ann. Rev. Microbiol. 47,505–534.

Cid, V. J., Duran, A., Del Ray, F., Snyder, M. P.,Nombela, C. and Sanchez, M. (1995). Molecular basisof cell integrity and morphogenesis in Saccharomycescerevisiae. Microbiol. Rev. 59, 345–386.

Davis, L. L. and Bartnicki-Garcia, S. (1984). Chitosansynthesis by the tandem action of chitin syn-thetase and chitin deacetylase from Mucor rouxii.Biochemistry 23, 1065–1073.

Farkas, V. (1979). Biosynthesis of cell walls in fungi.Microbiol. Rev. 43, 117–144.

Gao, X.-D., Katsumoto, T. and Onodera, K. (1995).Purification and characterization of chitin deacetylasefrom Absidia coerulea. J. Biochem. 117, 257–263.

Holton, T. A. and Graham, M. W. (1990). A simple andefficient method for direct cloning of PCR productsusing ddT-tailed vectors. Nucl. Acids Res. 19, 1156.

Kafetzopoulos, D., Thireos, G., Vournakis, J. N. andBouriotis, V. (1993). The primary structure of afungal chitin deacetylase reveals the function for twobacterial gene products. Proc. Natl. Acad. Sci. USA90, 8005–8008.

Kassir, Y. and Simchen, G. (1991). Monitoring meiosisand sporulation in Saccharomyces cerevisiae. Methodsin Enzymol. 194, 94–110.

Kohrer, K. and Domdey, H. (1991). Preparation of highmolecular weight RNA. Methods in Enzymol 194,398–405.

Kuranda, M. J. and Robbins, P. W. (1991). Chitinaseis required for cell separation during growth ofSaccharomyces cerevisiae. J. Biol. Chem. 266, 19758–19767.

Miyoshi, H., Shimura, K., Watanabe, K. and Onodera,K. (1992). Characterization of some fungal chitosans.Biosci. Biotech. Biochem. 56, 1901–1905.

Pammer, M., Briza, P., Ellinger, A., et al. (1992).DIT101 (CSD2, CAL1), a cell cycle-regulated yeastgene required for synthesis of chitin in cell walls andchitosan in spore walls. Yeast 8, 1089–1099.

Ride, J. P. and Drysdale, R. B. (1972). A rapid methodfor the chemical estimation of filamentous fungi inplant tissue. Physiol. Plant Pathol. 2, 7–15.

Rothstein, R. (1991). Targeting, disruption, replace-ment, and allele rescue: Integrative DNA transfor-mation in yeast. Methods in Enzymol. 194, 281–318.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989).Molecular Cloning: A Laboratory Manual. ColdSpring Harbor Laboratory Press, Cold SpringHarbor, NY.

Semino, C. E. and Robbins, P. W. (1995). Synthesis of‘‘Nod’’-like chitin oligosaccharides by the Xenopusdevelopmental protein DG42. Proc. Natl. Acad. Sci.USA 92, 3498–3501.

Semino, C. E., Specht, C. A., Raimondi, A. andRobbins, P. W. (1996). Homologs of the Xenopusdevelopmental gene DG42 are present in zebrafishand mouse and are involved in the synthesis of aNod-like chitin oligosaccharide during early embryo-genesis. Proc. Natl. Acad. Sci. USA 93, 4548–4553.

Shaw, J. A., Mol, P. C., Bowers, B., et al. (1991).The function of chitin synthases 2 and 3 in theSaccharomyces cerevisiae cell cycle. J. Cell. Biol. 114,111–123.

Soni, R., Cormichael, J. P. and Murry, J. A. H. (1993).Parameters affecting lithium acetate-mediated trans-formation of Saccharomyces cerevisiae and develop-

336 . .


ment of a rapid and simplified procedure. Curr. Genet.24, 455–459.

Strathern, J. N. and Higgins, D. R. (1991). Recovery ofplasmids from yeast into Escherichia coli: Shuttlevectors. Methods in Enzymol. 194, 319–329.

Tsigos, I. and Bouriotis, V. (1995). Purification andcharacterization of chitin deacetylase from Colleto-trichum lindemuthianum. J. Biol. Chem. 270, 26286–26291.

337


Documents

Cloning and Expression of Two Chitin Deacetylase Genes ofSaccharomyces cerevisiae