Biochem. J. (2014) 461, 403–412 (Printed in Great Britain) doi:10.1042/BJ20131618 403

Characterization of human variants in obesity-related SIM1 proteinidentifies a hot-spot for dimerization with the partner protein ARNT2Adrienne E. SULLIVAN*, Anne RAIMONDO*1, Tanja A. SCHWAB*, John B. BRUNING*, Philippe FROGUEL†‡§,I. Sadaf FAROOQI‖, Daniel J. PEET* and Murray L. WHITELAW*2

*School of Molecular and Biomedical Science (Biochemistry) and Centre for Molecular Pathology, University of Adelaide, Adelaide 5005, South Australia, Australia†CNRS-UMR8199, Lille Pasteur Institute, 59010 Lille, France‡Lille Nord de France University, 59044 Lille, France§Department of Genomics of Common Disease, School of Public Health, Imperial College London, Hammersmith Hospital, London W12 ONN, U.K.‖University of Cambridge Metabolic Research Laboratories, Wellcome Trust-MRC Institute of Metabolic Science, Addenbrooke’s Hospital, Cambridge CB2 0QQ, U.K.

The bHLH (basic helix–loop–helix) PAS (Per/Arnt/Sim)transcription factor SIM1 (single-minded 1) is important fordevelopment and function of regions of the hypothalamus thatregulate energy homoeostasis and the feeding response. Low-activity SIM1 variants have been identified in individuals withsevere early-onset obesity, but the underlying molecular causesof impaired function are unknown. In the present study weassess a number of human SIM1 variants with reduced activityand determine that impaired function is frequently due todefects in dimerization with the essential partner protein ARNT2(aryl hydrocarbon nuclear translocator 2). Equivalent variantsgenerated in the highly related protein SIM2 (single-minded2) produce near-identical impaired function and dimerization

defects, indicating that these effects are not unique to the structureof SIM1. On the basis of these data, we predict that other selectSIM1 and SIM2 variants reported in human genomic databaseswill also be deficient in activity, and identify two new low-activitySIM1 variants (V290E and V326F) present in the population. Thecumulative data is used in homology modelling to make novelobservations about the dimerization interface between the PASdomains of SIM1 and ARNT2, and to define a mutational ‘hot-spot’ in SIM1 that is critical for protein function.

Key words: aryl hydrocarbon nuclear translocator 2 (ARNT2),obesity, Per/Arnt/Sim (PAS), single-minded (SIM), singlenucleotide variant (SNV).

INTRODUCTION

SIM1 (single-minded 1) is a transcription factor of thebHLH (basic helix–loop–helix) PAS (Per/Arnt/Sim) family,a set of mammalian proteins which typically function inearly development and stress-response pathways [1]. SIM1 isexpressed most prominently in neurons of distinct regions in thehypothalamus, including the SON (supraoptic nucleus) and thePVN (paraventricular nucleus). Sim1− / − mice die perinatally,presumably due to hypodevelopment of these nuclei as aresult of impaired neuronal migration and differentiation [2].SIM1 haploinsufficient mice (Sim1− / + ) demonstrate hyperphagiaand develop diet-related obesity without a change in energyexpenditure, which is consistent with the role of the PVN in theregulation of energy homoeostasis and the feeding response [3,4].Obesity is also observed in mice with a postnatally conditionalknockout allele of Sim1 [5], whereas Agouti yellow (Ay) mice,which are an established mouse obesity model, show a decrease infood intake when overexpressing ectopic SIM1 [6]. This indicatesthat SIM1 is also critical for post-developmental function of thePVN.

SIM1 is also strongly associated with obesity in humans: achromosomal translocation affecting the SIM1 gene was observedin a patient with juvenile-onset obesity and hyperphagia [7]. Inaddition, two recent studies have identified multiple cases of rarenon-synonymous SNVs (single nucleotide variants) occurring

within the SIM1 coding region in individuals with severe early-onset obesity. Many of these variants cause a decrease in SIM1protein activity [8,9]. However, the molecular mechanisms bywhich SIM1 variants impair function have not been explored todate.

SIM1 forms a functional transcription factor by dimerizing witha partner bHLH PAS protein, specifically one of either ARNT (arylhydrocarbon nuclear translocator) or ARNT2, via the bHLH andPAS repeat domains. Although SIM1–ARNT and SIM1–ARNT2dimers behave similarly in cell-based assays [10], ARNT2 is likelyto be the obligate partner of SIM1 in vivo as ARNT2 expressionis mostly restricted to neurons and Arnt2-null mice appear tophenocopy Sim1-null mice [11].

In the present study we characterize the molecular basis ofimpaired function in selected human SIM1 variants, focusingon poor dimerization with ARNT2 and anomalous intracellularlocalization. To determine whether the effects of mutation areunique to the function and dimerization interface of SIM1,comparison is made with a series of equivalent variants in thecoding region of the highly conserved paralogue SIM2 (single-minded 2). These data are then used to predict that specificSNVs listed in the 1000 Genomes and dbSNP human genomicdatabases will also be deficient in activity. Finally, the cumulativedata is used to make observations about the specific interfacingof SIM1 and ARNT2 PAS domains, and define a ‘hot-spot’ inSIM1 and SIM2 which spans protein residues 290–326 and is

Abbreviations: AhR, aryl hydrocarbon receptor; ARNT, aryl hydrocarbon nuclear translocator; bHLH, basic helix–loop–helix; BMAL1, brain and muscleARNT-like 1; CLOCK, circadian locomotor output cycles kaput; CME, central midline element; DMOG, dimethyloxalylglycine; HEK, human embryonickidney; HIF, hypoxia-inducible factor; HRE, hypoxic-response element; NLS, nuclear localization sequence; PAS, Per/Arnt/Sim; PVN, paraventricularnucleus; SIM, single-minded; SNV, single nucleotide variant; Trh, Trachealess; WT, wild-type.

1 Present address: Oxford Centre for Diabetes, Endocrinology and Metabolism, University of Oxford, Churchill Hospital, Headington, Oxford OX37LE, U.K.

2 To whom correspondence should be addressed (email murray.whitelaw@adelaide.edu.au).

c© The Authors Journal compilation c© 2014 Biochemical Society

404 A.E. Sullivan and others

critical for function. The work described in the present study isof particular interest when considering the contributions of SIM1and SIM2 activity to the development of obesity and select cancersrespectively in human patients.

MATERIALS AND METHODS

Plasmid construction

pcDNA5-FRT/TO-hSIM1-2Myc has been described previously[9]. V290E and V326F mutations were introduced via GibsonAssembly using Phusion High-Fidelity DNA Polymerase to pEF-hSIM1-2Myc-IRES-Puro, and then subcloned into pcDNA5-FRT/TO-hSIM1-2Myc. The SIM2s-2myc cassette from pEF-hSIM2s-2Myc-IRES-Puro (described previously [12]) wasremoved with NotI/PmeI, and ligated into pENTR1A (Invitrogen)cut with DraI/NotI. The 2Myc sequence was removed andreplaced with a 3FLAG tag sequence. Mutations and diagnosticsilent restriction enzyme digestion sites were introduced topENTR1A-hSIM2s-3FLAG using overlap extension PCR. TheSIM2s-3FLAG cassette was then subcloned into pcDNA5-FRT/TO-Gateway using LR recombination (Invitrogen). SIM2struncation constructs were generated by PCR amplification andsubcloning into pEF-2Myc-IRES-Puro cut with NheI/EcoRV. Thedetails of all primers used are available in Supplementary TableS1 (at http://www.biochemj.org/bj/461/bj4610403add.htm). Plas-mids pEF-hARNT-IRES-Neo and pEF-hARNT2-IRES-Neo [9]have been described previously. pML-6CME was a gift fromDr J. Pelletier (Department of Biochemistry, McGill University,Montreal, Canada).

Generation and maintenance of cell lines

Doxycycline-inducible stable cell lines were generated usingpcDNA5-FRT/TO-based plasmids and the 293 Flp-In TRexsystem (Invitrogen) according to the manufacturer’s instructions.All 293 Flp-In TRex and HEK (human embryonic kidney)-293T cell lines were maintained in DMEM (Dulbecco’smodified Eagle’s medium; Gibco) supplemented with 10 % FBS(Gibco), 2 mM GlutaMAX (Gibco), 10000 units/ml penicillinand 10 mg/ml streptomycin (Invitrogen) at 37 ◦C with 5% CO2.

Dual-luciferase assays

Cells were seeded in a 24-well tray the day before andtransfected with 400 ng of pML-6CME luciferase reporterconstruct, 0.5 ng of pRL-CMV (Promega), and either of 20 ngof pEF-hARNT-IRES-Neo or 50 ng of pEF-hARNT2-IRES-Neo, using FuGENE® HD according to the manufacturer’sinstructions (Promega). At 7 h after transfection, media wasreplaced with full media supplemented with 1 μg/ml doxycyline.After 16 h of doxycycline treatment, cells were harvested andassayed for luciferase activity. For HIF (hypoxia-inducible factor)reporter assays, cells were transfected with 200 ng of pGL3-4HRE luciferase reporter construct and 0.5 ng of pRL-CMVand media was replaced 7 h after transfection with full mediacontaining 1 μg/ml doxycycline with or without 1 mM DMOG(dimethyloxalylglycine). Cells were harvested and assayed after16 h of treatment. For SIM2s truncation construct reporter assays,HEK-293T cells were transfected with 200 ng of pML-6CMEluciferase reporter construct, 50 ng of pEF-hARNT-IRES-Neo,0.5 ng of pRL-CMV and 20 ng of pEF-hSIM2s-2Myc-IRES-Puro, empty vector or truncated SIM2s expression plasmid. Cellswere harvested and assayed 24 h after transfection. For all reporter

assays, each sample had triplicate wells assayed using the Dual-Luciferase Assay System (Promega), in at least three independentexperiments. Firefly luciferase units were normalized to Renillaluciferase units for each well to give relative luciferase units, andthe mean was calculated for each triplicate.

Immunoblotting

Whole-cell extracts of cell lines were taken as previouslydescribed [13]. Samples were separated using SDS/PAGE,transferred on to nitrocellulose, and immunoblotted using anti-Myc antibodies (4A6, Millipore; or ab9106, Abcam), anti-FLAGantibody (M2, Sigma), anti-ARNT antibody (ab2, Abcam), anti-ARNT2 antibody (M-165, Santa Cruz Biotechnology) and anti-α-tubulin (MCA78G, AbD Serotec).

Immunoprecipitation

293 Flp-In TRex cells were co-treated with 1 μg/ml doxycycline(6 h) and 10 μM MG132 (6.5 h) before being harvested forwhole-cell extracts. HEK-293T cells were harvested 24 h aftertransient transfection. Whole-cell extracts were incubated withanti-Myc antibody (4A6, Millipore) for 3 h and then rec-ProteinG–Sepharose 4B conjugate (Invitrogen) for a further 1 h, orwith anti-FLAG M2 affinity gel (Sigma) for 4 h. Samples wereseparated by SDS/PAGE and analysed by immunoblotting.

Immunocytochemistry

HEK-293T cells or 293 Flp-In TRex cells were seeded on toglucose-coated glass coverslips in a 24-well tray. HEK-293Tcells were transfected with 200 ng of pcDNA5-FRT/TO-hSIM2s-3FLAG WT (wild-type) or variant constructs using FuGENE® 6(Promega) according to the manufacturer’s instructions. 293 Flp-In TRex cells were induced with 1 μg/ml doxycycline for 16 h. At24 h after transfection or 16 h after doxycycline treatment, cellswere fixed with 4% paraformaldehyde/PBS and immunostainedwith anti-FLAG antibody (M2, Sigma) or anti-Myc antibody(4A6, Millipore) and Alexa Fluor® 594-conjugated anti-mousesecondary antibody. Coverslips were mounted on to slides usingProLong Gold antifade reagent with DAPI (Invitrogen).

Homology modelling

The ICM-Pro program suite was used to perform all homologymodelling and carried out using the homology add-on [14].Individual models for each SIM1 variant were created (without adimerization partner first) using residues Asn230–Leu332 (Uniprotnumber P81133) and the HIF-2α subunit of the previouslyreported HIF2α–ARNT crystal structure (PDB code 3F1P [15])as the starting model. After creation of the individual models,they were subjected to regularization and model refinementwithin ICM-Pro (to optimize model geometry, carry out energyminimization and alleviate clashing side chains). These structureswere then docked to ARNT using the HIF2α–ARNT crystalstructure as a guide (PDB code 3F1P). Further regularization andmodel refinement was carried out to ensure the integrity of thedimer interface. Figure 7 was created using UCSF Chimera [16].

Statistics

To assess the significance of the activity of each variant relative toWT in reporter assays, univariate ANOVA was performed on the

c© The Authors Journal compilation c© 2014 Biochemical Society

Dimerization defects in SIM1 and SIM2 protein variants 405

Figure 1 Position of SIM1 and SIM2 amino acid changes due to non-synonymous SNVs

(A) Activity-impairing mutations caused by SNVs previously identified in juvenile-onset obesitypatients (black text) and SNVs identified in human genomic databases (grey text) are located inthe bHLH and two PAS repeats (PASA and PASB) that form the interface of dimerization with apartner factor. In particular, a cluster of low-activity mutations is found within PASB. Domainboundaries of SIM1 and SIM2 have been estimated based on sequence alignments with otherbHLH PAS proteins and structure prediction by PsiPred software. The NLS in SIM1 and SIM2has been previously defined [22]. (B) Human SIM1 and SIM2 proteins have 62 % primarysequence identity overall, but 89 % identity to the end of PASB. All mutated residues are fullyconserved (highlighted). The positions of the basic region, helices and PAS folds (grey) areestimated using alignments and structure prediction by PsiPred. Alignments were performed byClustal W2.

log values of relative luciferase units using IBM SPSS version 20.For comparisons between SIM1 and SIM2 variants as a percentageof WT activity in reporter assays, unpaired Student’s t test wasused.

RESULTS

Transcriptional activities of reciprocal SIM1/SIM2 variants

Obesity-related SIM1 variants previously reported to harbour<50% WT transcriptional activity (T46R, H323Y [8] and R171H[9]) were selected for further analysis in order to determinethe underlying molecular cause of deficiency. Analysis wasalso performed for three other variants [T292A (I.S. Farooqi,unpublished work), R296G and S309G (P. Froguel, unpublishedwork)] that were identified in a preliminary genomic screeningproject of obese patients and found to have <50% WT activityin reporter assays (a full summary of variants is in Table 1). Ofthese six SIM1 variants, one (T46R) lies in the second helix of thebHLH domain, one (R171H) lies in the first PAS repeat (PASA)and four (T292A, R296G, S309G and H323Y) lie in the secondPAS repeat (PASB) (Figure 1A).

SIM1 and SIM2 share 89% sequence identity from the N-terminus to the end of PASB (amino acids 1–333), and all residuesaffected by these SNVs in SIM1 are fully conserved in SIM2(Figure 1B). Despite this high level of sequence identity andsimilar tissue expression profiles, Sim2-null mice die perinatallyfrom phenotypic defects unique from those of Sim1-null mice[17], indicating that there are critical non-redundant functionalroles specific to SIM1 and SIM2. Unlike SIM1, SIM2 deficiencyhas no association with obesity, but increased SIM2 expression hasbeen correlated with development and aggressiveness of cancerin the prostate, colon and pancreas [18]. The SIM2 gene is alsopart of the ‘Down’s Syndrome Critical’ chromosomal region,although the contribution of SIM2 trisomy to pathogenesis ofDown’s Syndrome is not well understood [19,20].

The SIM2 gene gives rise to two isoforms via alternative mRNAsplicing of the C-terminal region, but the shorter protein isoform(SIM2s) is a less effective transrepressor than the longer isoform(SIM2l). SIM2s can also activate expression of CME (centralmidline element)-containing reporter genes to a similar extent asSIM1 by using the C-terminal transactivation domain of ARNT[21], and so this isoform was selected for comparison experiments.

To determine whether the weak transcriptional effects seenpreviously for SIM1 variants were unique to the function of SIM1or could be reproduced in the structurally similar SIM2, equivalentmutations were made in a SIM2s–3FLAG expression plasmid and293 Flp-In TRex stable cell lines were generated as describedpreviously for SIM1–2Myc [8,9]. The Flp-In TRex system allowsfor doxycycline-inducible expression of a transgene from a singlecommon site of integration, thereby allowing direct comparisonbetween activities of variants in stable cell lines. Successfulexpression of each variant protein was verified by Western blotanalysis, which revealed only minor variations in protein levelswhich did not correlate with activity levels in reporter gene assays.Similar variation from WT intensity was observed for equivalentSIM1/SIM2 variants, suggesting that altered protein levels area result of the mutation and not expression of the transgene(Figure 2A).

Activity of SIM1–2Myc and SIM2s–3FLAG with either ectopicARNT or ectopic ARNT2 was assessed using a syntheticreporter gene containing six repeats of the CME (Figure 2B).All SIM1 and SIM2 variants showed statistically significant(P < 0.001) decreases from WT activity when partnered witheither ARNT or ARNT2. In most cases the weak activityobserved for a SIM1 variant was reproduced near-identicallyin the equivalent SIM2 variant, indicating that the underlyingmechanistic defects causing impairment for these variants iscommon to the structures and functions of both SIM1 and SIM2.However, statistically significant differences in activity relative toWT between respective SIM1 and SIM2 variants were observedfor T46R proteins when partnered with ARNT2 (P = 0.006),and R296G proteins with either ARNT (P = 0.005) or ARNT2(P < 0.001) (Figure 2B). This suggests that, despite a high degreeof primary sequence identity, there are points of distinction in thestructures of SIM1 and SIM2 that contribute differently to theirrespective interactions with general partner proteins. Mutation atthese positions would therefore affect function to different extentsin SIM1 and SIM2.

Genomic database SIM1 and SIM2 variants predicted to haveattenuated function

On the basis of the observation that four out of the six variantswith <50% activity relative to WT were clustered in a region of

c© The Authors Journal compilation c© 2014 Biochemical Society

406 A.E. Sullivan and others

Table 1 Summary of human SIM1 and SIM2 variants

SNV Gene Amino acid change Number of known carriers Phenotype Reference/ID

G>A SIM1 R171H 3 Obesity [9]C>G SIM1 T46R 7 Obesity [8]C>T SIM1 H323Y 2 Obesity [8]A>G SIM1 T292A – – I.S. Farooqi, unpublished workA>G SIM1 R296G – – P. Froguel, unpublished workA>G SIM1 S309G – – P. Froguel, unpublished workA>T SIM1 V290E 1 Unknown rs202065103C>A SIM1 V326F 1 Unknown rs41285857A>C SIM2 N316T – – –G>A SIM2 E334K 11 Unknown rs143650216

Figure 2 Variants produce near-identical decreased activity in SIM1 and SIM2

(A) Expression of empty vector (Empty), WT or mutant proteins in stable 293 Flp-In TRex cell lines induced with doxycycline (1 μg/ml, 16 h) show some variation in protein levels, but in a similarmanner between equivalent mutations in SIM1–2Myc and SIM2s–3FLAG. (B) 293 Flp-In TRex cell lines were transfected with a luciferase reporter construct (6×CME-Luc) and plasmids expressingARNT (left-hand histogram) or ARNT2 (right-hand histogram), and treated with doxycycline (1 μg/ml, 16 h). Equivalent mutant SIM1 and SIM2 proteins partnered with ectopic ARNT or ARNT2show near-identical decreases in function compared with WT proteins, with the exceptions of T46R (with ARNT2) and R296G (with ARNT or ARNT2) which showed statistically significant differences(*P < 0.05, **P < 0.01, ***P < 0.001) (all other SIM1/SIM2 comparisons were not significant). Histograms show the mean fold change in luciferase units +− S.E.M. relative to WT for n = 6 (Empty)or n = 3 (all others) independent experiments. WB, Western blot.

PASB (T292A, R296G, S309G and H323Y) and caused decreasedactivities in both SIM1 and SIM2 proteins, we looked for othernon-synonymous SNVs within or about this region in the 1000Genomes and dbSNP human genomic databases. We identifiedtwo non-synonymous SNVs within the SIM1-coding region thatwere close to the cluster region: V290E (rs202065103) andV326F (rs41285857) (Figure 1A). We also identified two non-synonymous SNVs within the SIM2-coding region that werelikely to disrupt SIM2 protein function and lay close to or withinthe PASB cluster: N316T and E334K (rs143650216). At the timeof analysis, these were the best candidate SNVs within our areaof interest. Unfortunately, N316T was removed in a later build ofthe database as a false-positive variant. These SNVs were clonedinto SIM2s–3FLAG or SIM1–2Myc expression plasmids and 293Flp-In TRex stable cell lines were generated. Inducible expression

of each variant protein was tested by Western blot analysis andprotein levels were similar to WT in all cases (Figure 3).

The variants were assessed for function when partnered withARNT or ARNT2 using the 6×CME–Luciferase reporter geneassay. V290E SIM1–2Myc showed only 25% WT activitywith ARNT (P < 0.001) but retained 65% WT activity withARNT2 (P = 0.032). V326F SIM1–2Myc also demonstrateddecreased activity compared with WT SIM1 with either of ARNT(P = 0.003) and ARNT2 (P = 0.010) (Figure 3A). Although nophenotypic information regarding individuals with these variantsis available, this verifies that previously unidentified SIM1 low-activity variants exist in the population.

N316T SIM2s–3FLAG showed decreased activity comparedwith WT when partnered with either ARNT (P = 0.013) orARNT2 (P < 0.001), but E334K SIM2–3FLAG showed no

c© The Authors Journal compilation c© 2014 Biochemical Society

Dimerization defects in SIM1 and SIM2 protein variants 407

Figure 3 Select SIM1 and SIM2 variants reported in human genomic databases also show impaired function

Expression of empty vector (Empty), WT or mutant proteins in stable 293 Flp-In TRex cell lines induced with doxycycline (1 μg/ml, 16 h) show that mutations in SIM1–2Myc (A) and SIM2s–3FLAG(B) do not alter protein stability compared with WT. 293 Flp-In TRex cell lines were transfected with a luciferase reporter construct (6×CME-Luc) and plasmids expressing ARNT (black) or ARNT2(grey), and treated with doxycycline (1 μg/ml, 16 h). Significantly decreased activity compared with WT was observed for V290E SIM1–2Myc, V326F SIM1–2Myc (A) and N316T SIM2s–3FLAG (B)with both ARNT and ARNT2 (*P < 0.05, **P < 0.01, ***P < 0.001, ns is not significant). Histograms show the mean fold change in luciferase units +− S.E.M. relative to WT for n = 3 independentexperiments. WB, Western blot.

significant change in activity compared with WT (Figure 3B).In total, three out of the four variants tested within or about theobserved ‘mutational hot-spot’ region showed decreased functionon a reporter gene.

Dimerization of SIM1/SIM2 variants with partner proteins

As the weakest SIM variants described thus far lie within thebHLH or PAS repeat domains, which constitute the dimerizationinterfaces of bHLH PAS proteins, co-immunoprecipitations wereperformed for each variant to assess whether dimerization withARNT or ARNT2 was impaired. SIM1 T46R, T292A, R296G,S309G, H323Y and V290E showed decreased binding to ARNT2.SIM1 R171H and V326F, as well as some other previouslytested SIM1 variants identified in individuals with early-onsetobesity {S71R, L238R [9] and K51N (I.S. Farooqi, unpublishedwork)} showed no decrease in binding to ARNT2 compared withSIM1 WT (Figure 4A). All SIM2 variants with reduced activity,except R171H and N316T, showed decreased binding to ARNT(Figure 4B) and ARNT2 (results not shown) relative to SIM2 WT.This is consistent with their positions within domains criticalfor association with partner proteins, and provides evidencethat impaired heterodimerization is a common cause of severelydepleted activities in SIM1 and SIM2 variants.

Nuclear localization of SIM1/SIM2 variants

To determine that the observed loss of dimerization with nuclearproteins ARNT/ARNT2 was not due to mis-localization of SIM1or SIM2 mutants to the nucleus, immunocytochemistry wasperformed. All variants localized predominantly to the nucleus,although some cytoplasmic staining was also observed for SIM1V290E (Figure 5B), and T292A and R296G (results not shown).Variants T46R, T292A, R296G, S309G and H323Y showedsimilar results when tested in SIM1–2Myc (results not shown) andSIM2–3FLAG (Figure 5A). Although this mis-localization maycontribute to the decrease in binding with ARNT and ARNT2,it is unlikely to be the singular cause as distribution still appearsto be primarily nuclear. These variants are not located within thepreviously defined NLS (nuclear localization sequence) for SIM1(amino acids 368–388) and SIM2 (amino acids 367–389) [22],and so increased protein in the cytoplasm may be an indication ofincreased nuclear export rather than decreased import.

Repression of HIF activity by SIM2 variants

SIM1 and SIM2 compete with other Class I bHLH PAStranscription factors, such as HIF-1α, for binding to commonpartner proteins ARNT and ARNT2 [23]. HIF-1α protein,which is expressed ubiquitously, is degraded under normalcellular conditions but becomes stabilized when oxygen is scarce

c© The Authors Journal compilation c© 2014 Biochemical Society

408 A.E. Sullivan and others

Figure 4 SIM1 and SIM2 variants show impaired dimerization with partner proteins

Whole-cell extracts from 293 TRex lines co-treated with doxycycline (1 μg/ml, 6 h) and proteasome inhibitor (10 μM MG132, 6.5 h) were used in co-immunoprecipitations of (A) SIM1–2Mycvariants with endogenous ARNT2 and (B) SIM2s–3FLAG variants with endogenous ARNT. T46R, T292A, R296G, S309G and H323Y variants in both SIM1 and SIM2s caused a decrease in dimerizationcompared with WT proteins, whereas no change was seen in R171H, N316T and V326F variants. Some other SIM1 activity-deficient variants identified in individuals with early-onset obesity (K51N,S71R and L238R) were also tested but showed no loss of dimerization with ARNT2. IP, immunoprecipitation; WB, Western blot.

(hypoxia). HIF-1α heterodimerizes with ARNT, which is alsoknown as HIF-1β, and binds HREs (hypoxic-response elements)to up-regulate target genes involved in hypoxic survival andcell development. SIM1 and SIM2 are also capable of bindingHREs, and SIM1 has been shown to activate expression of HRE-based reporter constructs [23]. Conversely, HRE-bound SIM2is known to inhibit expression of both reporter genes and theendogenous HIF-1 target gene BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein 3) [24].

To confirm the impaired activity of a representative selectionof SIM2s variants using an alternative system, 293 Flp-In TRexcell lines were transfected with a luciferase reporter constructcontaining four HRE repeats (pGL3-4HRE) and treated withthe hypoxia mimetic DMOG, which stabilizes HIF-1α protein(Figure 6). In the absence of SIM2s (Empty), DMOG treatmentinduces reporter activity greater than 20-fold. SIM2s–3FLAG WTprotein does not alter expression of luciferase in the absenceof DMOG, but represses induction to background levels bycompeting with HIF-1α for partner factors and binding to HREs.SIM2s R171H, which does not show impaired dimerization,represses DMOG induction in an identical manner with SIM2sWT. Conversely SIM2s T46R, T292A and R296G variants, whichare dimerization-deficient, fail to fully inhibit induction of thereporter gene presumably due to reduced competition with HIF-

1α for ARNT and reduced binding of HRE sequences by SIM2s–ARNT heterodimers.

Despite being similarly deficient in dimerization when analysedby co-immunoprecipitation (Figure 4B), SIM2s T46R was moreeffective than SIM2s T292A and R296G variants at inhibitingreporter gene induction. This is potentially due to the observedexclusive nuclear localization of SIM2s T46R, whereas T292Aand R296G variants were partially localized to the cytoplasm(Figure 5A). Competition between SIM2s and HIF-1α for otherunknown cofactors may also contribute to observed changes inreporter gene activity. In general, these results are consistent withprevious observations of SIM2s variant activity.

Homology modelling of SIM1 PASB

A total of seven weak-activity variants in SIM1 and SIM2 clusterto a ‘hot-spot’ region in PASB (V290E, T292A, R296G, S309G,N316T, H323Y and V326F), and five also impair dimerizationwith a partner factor (V290E, T292A, R296G, S309G andH323Y). To further investigate how these variants cluster ona tertiary PAS fold, homology modelling of SIM1 PASB wasperformed (Figure 7A, blue chain) based on the most closelyrelated protein structure available: HIF-2α PASB (42% identity

c© The Authors Journal compilation c© 2014 Biochemical Society

Dimerization defects in SIM1 and SIM2 protein variants 409

Figure 5 Activity-deficient variants show predominantly nuclear localization

(A) HEK-293T cells were transiently transfected with plasmids expressing SIM2s–3FLAG WT or mutant proteins, then fixed and stained with and anti-FLAG antibody (red) and DAPI nuclear stain(blue). Nuclear localization was observed for all SIM2s proteins, although some cytoplasmic staining was also seen for T292A and R296G variants (×600 magnification). (B) 293 Flp-In TRex celllines were treated with doxycycline (1 μg/ml, 16 h), then fixed and stained with an anti-Myc antibody (red) and DAPI nuclear stain (blue). V326F SIM1–2Myc showed exclusively nuclear localization,but V290E SIM1–2Myc also showed some cytoplasmic localization (×600 magnification).

with SIM1 PASB), which was co-crystallized with ARNT PASB(Figure 7B, right brown chain) (PDB code 3F1P). Of the aminoacids that cause dimerization defects when mutated (red), fourout of five (Val290, Thr292, Arg296 and Ser309) roughly cluster ina region on the β-sheet face of the PASB fold. The remainingresidue, His323, is located at the edge of a loop region which maybe highly mobile or differentially structured. Other low-activityvariant residues (Leu238, Asn316 and Val326) not associated withimpaired dimerization (green) were not located in a commonregion.

The homology-modelled SIM1 PASB was then superimposedon the position of HIF-2α PASB in the HIF-2α–ARNT co-crystal structure and subjected to more rounds of minimizationand regularization, in order to model the association betweenSIM1 PASB and ARNT PASB. However, the locations of thevariants are not entirely consistent with this dimerization interface(Figure 7B). In particular, R296G variants demonstrated thelowest dimerization ability, but Arg296 is located at a distal pointfrom the modelled dimerization interface. This indicates that thehomology model is insufficient to fully characterize interactionsbetween the PASB folds of SIM1 and ARNT, but also thatthe SIM1–ARNT dimerization interface is possibly structurallyunique from those of previously reported structures of PASdomain proteins.

DISCUSSION

Weak-activity variants in SIM1 have previously been identifiedin juvenile-onset obesity patients [8,9], but the mechanisms

of impairment were only speculated. In the present study wedetermined that two (T46R and H323Y) SIM1 variants found inhuman obesity patients, as well as a further three low-activityvariants (T292A, R296G and S309G), experienced reducedfunction due to impaired binding of partner factor ARNT2. Thisis consistent with the location of the variants within domains thatmediate dimerization. Only one SIM1 variant, R171H, showedno deficiency in dimerization. It is possible that this particularvariant may impair PASA interactions with other unidentifiedproteins that are required for target gene activation. We alsodemonstrated that activity-deficient SIM1 variants (V290E andV326F) are present in the general population. Unfortunately nophenotypic data was available, but we predict that the individualsharbouring these SNVs may have an above-average BMI (bodymass index).

In total, we have confirmed deficiencies for nine variants ineither or both SIM1 and SIM2, eight of which are located inthe PAS repeat domain. This is consistent with the importanceof the PAS region in the function of bHLH PAS transcriptionfactors. The PAS repeat domain is considered the primarymeans of selective dimerization between specific bHLH PASfamily members, to the exclusion of other subfamily bHLH PASproteins and species of the broader bHLH superfamily [25].PASB is particularly critical to the function of SIM2 proteinsuch that when this repeat is lost through truncation, the SIM2protein loses all ability to dimerize with ARNT and becomescompletely transcriptionally inactive (Supplementary Figure S1at http://www.biochemj.org/bj/461/bj4610403add.htm and [26]).This importance of PASB to the function of full-length SIM

c© The Authors Journal compilation c© 2014 Biochemical Society

410 A.E. Sullivan and others

Figure 6 SIM2s variants with impaired dimerization show reducedrepression of HIF activity

Treatment with the hypoxia mimetic DMOG (1 mM, 16 h) was used to stabilize HIF-1α proteinand induce luciferase expression from a transiently transfected HIF-responsive reporter construct(4×HRE-Luc) in 293 Flp-In TRex cell lines. Expression of empty vector (Empty), WT or mutantproteins was simultaneously induced with doxycycline (1 μg/ml, 16 h). SIM2s WT protein hasno effect on reporter activity alone (WT no DMOG), but reduces HIF-mediated induction tonon-induced levels. SIM2s T46R, T292A and R296G variants, which have impaired dimerizationwith ARNT, fail to completely repress induction of the reporter gene. SIM2s R171H, whichhas no loss of dimerization, shows similar repression to SIM2s WT (***P < 0.001, ns is notsignificant). Histogram shows the mean fold change in luciferase units +− S.E.M. relative toEmpty (no DMOG) for n = 4 independent experiments.

proteins is also evident in the observed critical loss of activitycaused by missense SNVs within our defined mutational hot-spotregion in PASB.

There is also evidence that PAS domains contribute to thespecific binding of DNA sequences and target gene recognition[25,27]. The importance of PAS domains in the unique functionof individual bHLH PAS proteins was demonstrated in akey experiment whereby the PAS domain of the Drosophilamelanogaster orthologue of HIF-1α, Trh (Trachealess), wasreplaced with the PAS domain of the SIM1/SIM2 orthologue,Sim (Single-minded). The Trh–Sim PAS chimaeric protein lostthe ability to regulate Trh target genes and instead induced targetgenes and phenotypes specific to Sim [28]. Exactly how the PASdomain dictates this unique activity is not well understood.

In a previous study, a random mutagenesis screen wasperformed for key residues in the PASA repeat of ARNTthat mediate heterodimerization with the PASA repeat of AhR(aryl hydrocarbon receptor). A total of 22 individual mutationswere found to inhibit or ablate AhR–ARNT dimerization but,interestingly, four of these variants did not affect activity of ARNTwith other partners such as SIM1, SIM2 or NPAS4 (neuronal PASdomain protein 4) [13]. This indicates that although the generalinterface of ARNT PASA with its partner may be conserved, thereare key residues which are critical to partner-specific interactions.

This conclusion is consistent with the observation that theR296G variant, located in PASB, produces significantly differentchanges in activity when present in SIM1 or SIM2s and whenpartnered with either ARNT or ARNT2. R296G SIM1–2Mycretains 42% of WT activity when partnered with ARNT2, butappears to be completely inactive when partnered with ARNT,indicating that different residues may be critical in ARNT- andARNT2-specific interactions with SIM1. That R296G SIM2s–3FLAG shows below-basal activity in all cases indicates that,despite sharing high sequence identity, there are some partnerinteractions that are specific to SIM1 or SIM2. These specificPAS-mediated interactions may also be a factor that differentiatesthe biological activities of SIM1 and SIM2 in vivo.

The T46R variant, which is located in the second helix ofthe bHLH domain, also produced significantly different effectson activity in SIM1 compared with SIM2s when partnered withARNT but not ARNT2. This may indicate that some SIM1- and

Figure 7 Mapping of variants on the SIM1 PASB homology model

(A) Homology modelling of SIM1 PASB (blue chain) based on HIF-2α PASB (PDB code 3F1P) shows the position of residues that, when mutated, either impaired (red; Val290, Thr292, Arg296, Ser309

or His323) or did not alter (green; Leu238, Asn316 or Val326) dimerization with ARNT2. With the exception of His323, red residues roughly cluster together at the β-sheet face. Green residues do notseem to cluster with red residues or each other. (B) ARNT PASB (brown chain, right), which was co-crystallized with HIF-2α PASB, does not seem to interact closely with the red cluster.

c© The Authors Journal compilation c© 2014 Biochemical Society

Dimerization defects in SIM1 and SIM2 protein variants 411

SIM2-specific interactions are also mediated by the bHLH region,although in all cases T46R variant activity was approximate tobasal levels and so the true relevance of this difference in activityis uncertain.

Specificity of partner selection is likely to also be influencedby the structural orientation and interfacing of PASB. Althoughstructural data of bHLH PAS proteins is limited, the PASB repeatsof family members CLOCK (circadian locomotor output cycleskaput) and BMAL1 (brain and muscle ARNT-like 1) have beenrevealed to associate in an approximately parallel manner [29],whereas isolated PASB folds of HIF-2α and ARNT show an anti-parallel orientation and β-sheet interface [15]. This may explainthe preference of CLOCK for BMAL1 rather than ARNT, andraises the question of how the PASB dimerization interface variesamong other family members. Homology modelling of SIM1PASB on HIF-2α PASB revealed that hot-spot activity-impairedvariants that impair dimerization cluster roughly to a region on theβ-sheet face of the fold, indicating that the dimerization interfaceof SIM1 is more similar to that of HIF-2α than that of CLOCK.However, the exact location of the cluster relative to ARNT PASBsuggests that this model is incomplete, and implies that the PASBdimerization interface may vary between SIM1 and HIF-2α. It isalso possible that the isolated HIF-2α PASB and ARNT PASBfolds, which lack the structural context of the larger protein, donot accurately depict the natural dimerization interface.

The structure of SIM1 will need to be solved to ultimatelyresolve these questions, but data regarding the influence of pointmutations on protein activity is still important when assessingand interpreting solved structures; for example, data from theaforementioned AhR/ARNT PASA mutational study [13] wasused in analysis of the recently generated AhR PASA crystalstructure [30]. Therefore the present study will be useful to futureSIM or bHLH PAS structural determination projects.

In conclusion, we have identified a hot-spot region in SIM1 andSIM2 spanning amino acids 290–326 which is critical for proteinfunction, and defined a subset of human variants within this hot-spot which inhibit dimerization with partner proteins ARNT andARNT2. These data may be used in the future for assessment ofdeleterious human SNVs in SIM1 and SIM2, and in understandingthe mechanistic deficiencies in protein variants that currently existin the population. Severely deficient SIM1 variants that wereidentified in obese patients are possibly monogenic causes ofobesity, but less-deficient variants could also contribute to weightgain in combination with other factors. In the future, identifyingany genetic factors contributing to development of obesity maybe important in order to manage the patient condition effectively.Thus screening patients for SIM1 variants and testing activitywith molecular assays is likely to be an important diagnostic tool.

AUTHOR CONTRIBUTION

Adrienne Sullivan, Anne Raimondo, Daniel Peet and Murray Whitelaw conceived theproject and designed the experiments. Adrienne Sullivan, Anne Raimondo and TanjaSchwab conducted experiments. John Bruning generated the SIM1 homology model.Philippe Froguel and I. Sadaf Farooq provided reagents and information about SIM1variants. Adrienne Sullivan and Murray Whitelaw wrote the paper.

ACKNOWLEDGEMENT

We thank the third-year Biochemistry students of the University of Adelaide for their workin cloning variants.

FUNDING

This work was supported by the Australian Research Council.

REFERENCES

1 Bersten, D. C., Sullivan, A. E., Peet, D. J. and Whitelaw, M. L. (2013) bHLH-PAS proteinsin cancer. Nat. Rev. Cancer 13, 827–841 CrossRef PubMed

2 Michaud, J. L., Rosenquist, T., May, N. R. and Fan, C. M. (1998) Development ofneuroendocrine lineages requires the bHLH-PAS transcription factor SIM1. Genes Dev.12, 3264–3275 CrossRef PubMed

3 Duplan, S. M., Boucher, F., Alexandrov, L. and Michaud, J. L. (2009) Impact of Sim1 genedosage on the development of the paraventricular and supraoptic nuclei of thehypothalamus. Eur. J. Neurosci. 30, 2239–2249 CrossRef PubMed

4 Michaud, J. L., Boucher, F., Melnyk, A., Gauthier, F., Goshu, E., Levy, E., Mitchell, G. A.,Himms-Hagen, J. and Fan, C. M. (2001) Sim1 haploinsufficiency causes hyperphagia,obesity and reduction of the paraventricular nucleus of the hypothalamus. Hum. Mol.Genet. 10, 1465–1473 CrossRef PubMed

5 Tolson, K. P., Gemelli, T., Gautron, L., Elmquist, J. K., Zinn, A. R. and Kublaoui, B. M.(2010) Postnatal Sim1 deficiency causes hyperphagic obesity and reduced Mc4r andoxytocin expression. J. Neurosci. 30, 3803–3812 CrossRef PubMed

6 Kublaoui, B. M., Holder, Jr, J. L., Tolson, K. P., Gemelli, T. and Zinn, A. R. (2006) SIM1overexpression partially rescues agouti yellow and diet-induced obesity by normalizingfood intake. Endocrinology 147, 4542–4549 CrossRef PubMed

7 Holder, Jr, J. L., Butte, N. F. and Zinn, A. R. (2000) Profound obesity associated with abalanced translocation that disrupts the SIM1 gene. Hum. Mol. Genet. 9, 101–108CrossRef PubMed

8 Bonnefond, A., Raimondo, A., Stutzmann, F., Ghoussaini, M., Ramachandrappa, S.,Bersten, D. C., Durand, E., Vatin, V., Balkau, B., Lantieri, O. et al. (2013) Loss-of-functionmutations in SIM1 contribute to obesity and Prader-Willi-like features. J. Clin. Invest.123, 3037–3041 CrossRef PubMed

9 Ramachandrappa, S., Raimondo, A., Cali, A. M., Keogh, J. M., Henning, E., Saeed, S.,Thompson, A., Garg, S., Bochukova, E. G., Brage, S. et al. (2013) Rare variants insingle-minded 1 (SIM1) are associated with severe obesity. J. Clin. Invest. 123,3042–3050 CrossRef PubMed

10 Moffett, P. and Pelletier, J. (2000) Different transcriptional properties of mSim-1 andmSim-2. FEBS Lett. 466, 80–86 CrossRef PubMed

11 Michaud, J. L., DeRossi, C., May, N. R., Holdener, B. C. and Fan, C. M. (2000) ARNT2acts as the dimerization partner of SIM1 for the development of the hypothalamus. Mech.Dev. 90, 253–261 CrossRef PubMed

12 Woods, S., Farrall, A., Procko, C. and Whitelaw, M. L. (2008) The bHLH/Per-Arnt-Simtranscription factor SIM2 regulates muscle transcript myomesin2 via a novel,non-canonical E-box sequence. Nucleic Acids Res. 36, 3716–3727 CrossRef PubMed

13 Hao, N., Whitelaw, M. L., Shearwin, K. E., Dodd, I. B. and Chapman-Smith, A. (2011)Identification of residues in the N-terminal PAS domains important for dimerization ofArnt and AhR. Nucl. Acids Res. 39, 3695–3709 CrossRef

14 Cardozo, T., Totrov, M. and Abagyan, R. (1995) Homology modeling by the ICM method.Proteins 23, 403–414 CrossRef PubMed

15 Scheuermann, T. H., Tomchick, D. R., Machius, M., Guo, Y., Bruick, R. K. and Gardner,K. H. (2009) Artificial ligand binding within the HIF2α PAS-B domain of the HIF2transcription factor. Proc. Natl. Acad. Sci. U.S.A. 106, 450–455 CrossRef PubMed

16 Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng,E. C. and Ferrin, T. E. (2004) UCSF Chimera: a visualization system for exploratoryresearch and analysis. J. Comput. Chem. 25, 1605–1612 CrossRef PubMed

17 Goshu, E., Jin, H., Fasnacht, R., Sepenski, M., Michaud, J. L. and Fan, C. M. (2002) Sim2mutants have developmental defects not overlapping with those of Sim1 mutants. Mol.Cell. Biol. 22, 4147–4157 CrossRef PubMed

18 DeYoung, M. P., Tress, M. and Narayanan, R. (2003) Identification of Down’s syndromecritical locus gene SIM2-s as a drug therapy target for solid tumors. Proc. Natl. Acad. Sci.U.S.A. 100, 4760–4765 CrossRef PubMed

19 Muenke, M., Bone, L. J., Mitchell, H. F., Hart, I., Walton, K., Hall-Johnson, K., Ippel, E. F.,Dietz-Band, J., Kvaloy, K., Fan, C. M. et al. (1995) Physical mapping of theholoprosencephaly critical region in 21q22.3, exclusion of SIM2 as a candidate gene forholoprosencephaly, and mapping of SIM2 to a region of chromosome 21 important forDown syndrome. Am. J. Hum. Genet. 57, 1074–1079 PubMed

20 Ema, M., Ikegami, S., Hosoya, T., Mimura, J., Ohtani, H., Nakao, K., Inokuchi, K., Katsuki,M. and Fujii-Kuriyama, Y. (1999) Mild impairment of learning and memory in miceoverexpressing the mSim2 gene located on chromosome 16: an animal model of Down’ssyndrome. Hum. Mol. Genet. 8, 1409–1415 CrossRef PubMed

21 Metz, R. P., Kwak, H. I., Gustafson, T., Laffin, B. and Porter, W. W. (2006) Differentialtranscriptional regulation by mouse single-minded 2s. J. Biol. Chem. 281,10839–10848 CrossRef PubMed

22 Yamaki, A., Kudoh, J., Shimizu, N. and Shimizu, Y. (2004) A novel nuclear localizationsignal in the human single-minded proteins SIM1 and SIM2. Biochem. Biophys. Res.Commun. 313, 482–488 CrossRef PubMed

c© The Authors Journal compilation c© 2014 Biochemical Society

412 A.E. Sullivan and others

23 Woods, S. L. and Whitelaw, M. L. (2002) Differential activities of murine single minded 1(SIM1) and SIM2 on a hypoxic response element. Cross-talk between basichelix-loop-helix/per-Arnt-Sim homology transcription factors. J. Biol. Chem. 277,10236–10243 CrossRef PubMed

24 Farrall, A. L. and Whitelaw, M. L. (2009) The HIF1α-inducible pro-cell death gene BNIP3is a novel target of SIM2s repression through cross-talk on the hypoxia response element.Oncogene 28, 3671–3680 CrossRef PubMed

25 Pongratz, I., Antonsson, C., Whitelaw, M. L. and Poellinger, L. (1998) Role of the PASdomain in regulation of dimerization and DNA binding specificity of the dioxin receptor.Mol. Cell. Biol. 18, 4079–4088 PubMed

26 Moffett, P., Reece, M. and Pelletier, J. (1997) The murine Sim-2 gene product inhibitstranscription by active repression and functional interference. Mol. Cell. Biol. 17,4933–4947 PubMed

27 Chapman-Smith, A., Lutwyche, J. K. and Whitelaw, M. L. (2004) Contribution of thePer/Arnt/Sim (PAS) domains to DNA binding by the basic helix-loop-helix PAStranscriptional regulators. J. Biol. Chem. 279, 5353–5362 CrossRef PubMed

28 Zelzer, E., Wappner, P. and Shilo, B. Z. (1997) The PAS domain confers target genespecificity of Drosophila bHLH/PAS proteins. Genes Dev. 11, 2079–2089CrossRef PubMed

29 Huang, N., Chelliah, Y., Shan, Y., Taylor, C. A., Yoo, S. H., Partch, C., Green, C. B., Zhang,H. and Takahashi, J. S. (2012) Crystal structure of the heterodimeric CLOCK:BMAL1transcriptional activator complex. Science 337, 189–194CrossRef PubMed

30 Wu, D., Potluri, N., Kim, Y. and Rastinejad, F. (2013) Structure and dimerization propertiesof the aryl hydrocarbon receptor PAS-A domain. Mol. Cell. Biol. 33, 4346–4356CrossRef PubMed

Received 9 December 2013/15 April 2014; accepted 12 May 2014Published as BJ Immediate Publication 12 May 2014, doi:10.1042/BJ20131618

c© The Authors Journal compilation c© 2014 Biochemical Society

Biochem. J. (2014) 461, 403–412 (Printed in Great Britain) doi:10.1042/BJ20131618

SUPPLEMENTARY ONLINE DATACharacterization of human variants in obesity-related SIM1 proteinidentifies a hot-spot for dimerization with the partner protein ARNT2Adrienne E. SULLIVAN*, Anne RAIMONDO*1, Tanja A. SCHWAB*, John B. BRUNING*, Philippe FROGUEL†‡§,I. Sadaf FAROOQI‖, Daniel J. PEET* and Murray L. WHITELAW*2

*School of Molecular and Biomedical Science (Biochemistry) and Centre for Molecular Pathology, University of Adelaide, Adelaide 5005, South Australia, Australia†CNRS-UMR8199, Lille Pasteur Institute, 59010 Lille, France‡Lille Nord de France University, 59044 Lille, France§Department of Genomics of Common Disease, School of Public Health, Imperial College London, Hammersmith Hospital, London W12 ONN, U.K.‖University of Cambridge Metabolic Research Laboratories, Wellcome Trust-MRC Institute of Metabolic Science, Addenbrooke’s Hospital, Cambridge CB2 0QQ, U.K.

Figure S1 SIM2 PASB is essential for transcriptional activation and heterodimerization

Expression of SIM2s truncations lacking the C-terminal transrepression domain (3) or both PASB and the transrepression domain (2) (A) was confirmed by transient expression in HEK-293T cellsand Western blot analysis (B). Activity of the truncated proteins was assessed by transiently co-transfecting with plasmids expressing ARNT and luciferase reporter construct (6 × CME-Luc) inHEK-293T cells (C). Loss of the transrepression domain does not inhibit SIM2s activity, but loss of PASB ablates all reporter gene induction. Co-immunoprecipitation experiments using co-transfectedFLAG-tagged ARNT demonstrate that this loss of activity corresponds with a loss of dimerization with ARNT (D). Histograms show the mean fold change in luciferase units +− S.E.M. relative to ARNTonly for n = 4 independent experiments (*P<0.05, ns is not significant). IP, immunoprecipitation; WB, Western blot.

1 Present address: Oxford Centre for Diabetes, Endocrinology and Metabolism, University of Oxford, Churchill Hospital, Headington, Oxford OX37LE, U.K.

2 To whom correspondence should be addressed (email murray.whitelaw@adelaide.edu.au).

c© The Authors Journal compilation c© 2014 Biochemical Society

A.E. Sullivan and others

Table S1 List of primer sequences used in cloning (5′→3′)

(a) Overlap extension PCR

hSIM2s–3FLAG variants

Forward primer Reverse primer

Flanking primersENTR1A TTAGTTAGTTACTTAAGCTCGGGC GTAACATCAGAGATTTTGAGACAC

Mutation (silent enzyme)T46R (SpeI) ATCCGCCTCCGCACTAGTTACCTGAAG CTTCAGGTAACTAGTGCGGAGGCGGATR171H (NheI) CGAATGAAATGTGTGCTAGCGAAACACAACGCGGGC GCCCGCGTTGTGTTTCGCTAGCACACATTTCATTCGT292A (AgeI) CCAGGTCACCGCCAAGTACTACCGGTTGCTGTCCAAG CTTGGACAGCAACCGGTAGTACTTGGCGGTGACCTGGR296G (AccI) AAGTACTACGGTCTACTGTCCAAG CTTGGACAGTAGACCGTAGTACTTS309G (Eco471) TGGGTGTGGGTCCAGGGCTACGCCACC GGTGGCGTAGCCCTGGACCCACACCCAH323Y (NaeI) CGCTCGAGCCGGCCCTACTGCATCGTG CACGATGCAGTAGGGCCGGCTCGAGCGN316T (Eco471) GCCACCGTGGTCCACACCTCCCGCTCGTCC GGACGAGCGGGAGGTGTGGACCACGGTGGCE334K (MboI) GTACTCACGAAGATCGAATACAAGGAA TTCCTTGTATTCGATCTTCGTGAGTAC

(b) Gibson isothermal assembly

hSIM1–2Myc variants

Forward primer Reverse primer

Mutation (silent enzyme)

V290E (SpeI) 5′ fragment TTTTTTTCTTCCATTTCAGGTGTCGTGAGGAACCTGTAGTACTTGGTGGTTTCCTGTCCCTTCACTAG-TAGCAAATGGTGCGCGCA

V290E (SpeI) 3′ fragment TGCGCGCACCATTTGCTACTAGTGAAGGGACAGGAAACCACCAAGTACTACAGGTTCC GAAGGCTGGTTTGGAGGCTGV326F (HpaI) 5′ fragment TTTTTTTCTTCCATTTCAGGTGTCGTGA GTGTCTGTGAGGACATAGTTAACGCTGAAGATACAGTGTGGCCTGGAGV326F (HpaI) 3′ fragment CTCCAGGCCACACTGTATCTTCAGCGTTAACTATGTCCTCACAGACAC GAAGGCTGGTTTGGAGGCTG

Backbone fragment pEF hSIM1-2myc IRES Puro cut with PstI (6.8 kb)

(c) hSIM2s–2Myc truncations

Primer name Sequence

EF1α promoter primer F TCAAGCCTCAGACAGTGGTTCEnd of PASA + EcoRV half-site R ATCGGGTGGCAGCGACTGGCCCACGEnd of PASB + EcoRV half-site R ATCAGTGGACACCTGCTCCAGGGAC

Received 9 December 2013/15 April 2014; accepted 12 May 2014Published as BJ Immediate Publication 12 May 2014, doi:10.1042/BJ20131618

c© The Authors Journal compilation c© 2014 Biochemical Society