Cell–cell communication in sourdough lactic acid bacteria: A proteomic study inLactobacillus sanfranciscensis CB1

RESEARCH ARTICLE

Cell–cell communication in sourdough lactic acid

bacteria: A proteomic study in Lactobacillus

sanfranciscensis CB1

Raffaella Di Cagno1, Maria De Angelis1, Antonio Limitone1, Fabio Minervini1,Maria Carmela Simonetti2, Solange Buchin3 and Marco Gobbetti1

1 Department of Plant Protection and Applied Microbiology, University of Bari, Bari, Italy2 Labo-Biotech, Faculty of Biotechnology, University of Bari, Bari, Italy3 Unité de Recherches en Technologie et Analyses Laitières, INRA, Poligny, France

The mechanisms of cell–cell communication in Lactobacillus sanfranciscensis CB1 were studied.The highest number of dead/damaged cells of L. sanfranciscensis CB1 was found in cocultureswith Lactobacillus plantarum DC400 or Lactobacillus brevis CR13 when the late stationary phase ofgrowth (18 h) was reached. 2-DE analysis was carried out. Almost the same proteins wereinduced in all three cocultures at the mid-exponential phase of growth (7 h). The number ofinduced proteins markedly increased at 18 h, especially when L. sanfranciscensis CB1 was cocul-tured with L. plantarum DC400 or L. brevis CR13. Nineteen overexpressed proteins were identi-fied. These proteins had a central role in stress response mechanisms and LuxS-mediated sig-nalling was involved in the regulation of most of them. The luxS and metF genes were partiallysequenced in L. sanfranciscensis CB1. RT-PCR showed that the expression of luxS gene decreasedfrom 7 to 12 h. It was highest in cocultures with L. plantarum DC400 and L. brevis CR13.2(3H)dihydrofuranone-5ethyl and 2(3H)dihydrofuranone-5pentyl were identified as pre-sumptive signalling molecules when L. sanfranciscensis CB1 was cocultured with L. brevis CR13and, especially, L. plantarum DC400. The synthesis of other volatile compounds and peptidaseactivities were also influenced by the type of microbial cocultures.

Received: September 30, 2006Revised: March 28, 2007

Accepted: April 3, 2007

Keywords:

Cell–cell communication / LuxS / Microbial interaction / Sourdough lactic acid bacteria

2430 Proteomics 2007, 7, 2430–2446

1 Introduction

Bacteria synthesize, release, detect and respond to small sig-nalling hormone-like molecules, termed ‘autoinducers’.These signalling molecules accumulate and trigger cascade

events when a ‘quorum’ (e.g. a certain threshold concentra-tion) is reached; hence the name of ‘quorum sensing’ todescribe this mechanism of cell–cell communication [1].

Although genomic data indicate several exceptions [2–4],the general paradigm is that species-specific quorum sen-sing in Gram-negative bacteria is mediated by the pair LuxI/LuxR and acyl-homoserine lactones (AHLs, e.g. N-3-oxohex-anoyl-homoserine lactone) [5]. Gram-positive bacteria mostlyuse a ribosomally generated oligopeptide termed autoinduc-ing peptide (AIP, or peptide pheromone) as species-specificcommunication signal. The gene for AIP is a part of a three-component regulatory system (3CRS) [6]. A variety of bio-logical processes seemed to be under the control of 3CRS:synthesis of bacteriocins in Lactococcus lactis, Carnobacteriumpiscicola [7], Lactobacillus sakei [8], Lactobacillus plantarum andEnterococcus faecium [9]; conjugal transfer of plasmids in

Correspondence: Dr. Maria De Angelis, Dipartimento di Prote-zione delle Piante e Microbiologia Applicata, Faculty of Biotech-nology, Via G. Amendola 165/a, 70126 Bari, ItalyE-mail: [email protected]: 139-080-5442911

Abbreviations: AHLs, acyl-homoserine lactones; CRS, compo-nent regulatory system; DPD, 4,5-dihydroxy-2,3-pentanedione;PepN, aminopeptidase type N; PepQ, prolidase; PepR, prolinase;PepT, tripeptidase; PepV, dipeptidase; RT, real time; SPME, solidphase microextraction; WFH, wheat flour hydrolysate

DOI 10.1002/pmic.200700143

© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com

Proteomics 2007, 7, 2430–2446 Microbiology 2431

Enterococcus feacalis [10]; genetic competence and sporulationin Bacillus subtilis [11, 12]; biofilm formation and stress re-sponse [13].

Vibrio harveyi has been shown to possess two systemsrepresenting an interesting blend of Gram-positive and-negative mechanisms of cell–cell communication [14]. Sys-tem 1, consisting of the autoinducer-1 (AHL-type) and sensor1 (LuxN), is involved in intraspecies quorum sensing. Sys-tem 2, consisting of the autoinducer-2 (furanosyl borate di-ester, AI-2) and sensor 2 (LuxPQ), is used mainly for inter-species cell–cell communication. Furanosyl borate diester issynthesized from S-adenosylmethionine in at least threeenzymatic steps [15]. LuxS is considered the key enzymewhich catalyzes the cleavage of S-ribosylhomocysteine to 4,5-dihydroxy-2,3-pentanedione (DPD) within the above path-way. Database analysis revealed that highly conserved ho-mologues of luxS gene are present in over 30 species of bothGram-positive and -negative bacteria [16].

Bacterial cell–cell communication has been mainly stud-ied on environmental, plant and human pathogenic bacteria.A very few studies have considered food related lactic acidbacteria [17]. Sourdough is a typical example of complex foodecosystems, where the bacterial behaviour and performanceare influenced by interactions among coexisting species oflactic acid bacteria [18]. During sourdough fermentation,microbial interactions are affected by environmental param-eters (e.g. type of flour, temperature and pH) and physiologi-cal events (e.g. protocooperation and antagonism) that inter-fere in the response mechanisms. Although such a complexecosystem, extracellular signalling may provide a new basisfor explaining the response mechanisms when sourdoughbacteria behave as a consequence of heterogeneous commu-nity interactions.

This work was aimed at investigating the molecularmechanisms of cell–cell communication in Lactobacillussanfranciscensis CB1 when cocultured with other sourdoughlactobacilli, to show that cell–cell relationships may haverepercussions on the sourdough performance during fer-mentation. A proteomic approach based on 2-DE and proteinidentification by nano-LC-ESI-MS/MS and N-terminal se-quencing, coupled with the characterization of the luxS geneand the identification of some furanones, as presumptivesignalling molecules, was used.

2 Materials and methods

2.1 Bacterial strains and culture conditions

L. sanfranciscensis CB1, L. plantarum DC400, Lactobacillusbrevis CR13 and Lactobacillus rossiae A7 (Culture Collection ofthe Department of Plant Protection and Applied Micro-biology, University of Bari, Italy) were identified previouslyfrom Italian sourdoughs by 16S rRNA gene sequence analy-sis. Strains were propagated routinely at 307C for 24 h inSDB broth [19].

Wheat flour hydrolysate (WFH) medium was producedby preliminary incubation of a suspension of wheat flour(20% w/v, in tap water) at 307C for 18 h under stirring con-ditions (200 rpm). After incubation, the suspension was fil-tered through a Whatman apparatus (Polycarp 75 SPF,Whatman International Maidstone, England) and added toyeast extract (0.3% w/v), glucose and maltose (3% w/v).WFH was sterilized by filtration on 0.22 mm membrane fil-ters (Millipore Corporation, Bedford, MA) and stored at 47Cbefore use. The pH of the WFH was ca. 5.6.

Twenty-four-hour-old cells of each strain grown in SDBbroth were inoculated (4% v/v) into WFH. L. sanfranciscensisCB1 was cultivated at 307C for 7 (mid-exponential phase ofgrowth) or 18 h (late-stationary phase of growth) in coculturewith L. plantarum DC400, L. brevis CR13 or L. rossiae A7 intoa double culture vessels apparatus separated by a 0.4 mmmembrane filter (Millipore Isopore™), under stirring condi-tions (140 rpm). Cells grown in monoculture at 307C for 7 or18 h were used as the control. Each fermentation was carriedout in triplicate.

2.2 Growth kinetics and determination of bacterial

viability

Cell numbers were determined by plating on SDB agar me-dium at 307C for 48 h. Growth data were modelled accordingto the Gompertz equation as modified by Zwietering et al.[20]: y ¼ kþ A expf�exp½ðmmaxe=AÞðl� tÞ þ 1�g; where y isthe extent of growth as log CFU/mL at the time t; k is theinitial cell density as log CFU/mL; A represents the differ-ence in cell density between stationary phase and inocula-tion; mmax is the maximum growth rate as Dlog CFU/mL/h; lis the length of the latency phase expressed in hours and t isthe time. The experimental data were modelled through thenonlinear regression procedure of the statistic package Sta-tistica per Windows (Statsoft, Tulsa, Oklahoma, USA).

Cell viability was estimated by using LIVE/DEAD BacLightBacterial Viability kit (Molecular Probes, Cambridge Bio-science, Cambridge, UK) according to the manufacturer’sinstructions. The test determines the structural integrity ofthe bacterial membrane employing the fluorescence dyesSYTO 9 and the red-fluorescent propidium iodide (PI).SYTO 9 labels all bacteria, while PI penetrates only bacteriawith damaged membranes, causing a reduction in SYTO 9fluorescence when both dyes are present. Stained bacterialsuspensions were observed using a LEICA LDMC (LeicaMicrosystems SpA, Milano, Italy) with a 606objective. Im-ages were analysed using Image-Pro® Plus image analysissoftware (Media Cybernetics, Silver Spring, MD).

2.3 Protein extraction and 2-DE

For 2-DE analyses, cells of L. sanfranciscensis CB1 grown inmono- and cocultures were used. After the mid-exponential


2432 R. Di Cagno et al. Proteomics 2007, 7, 2430–2446

(7 h) or late-stationary (18 h) phases of growth were reached,cells were harvested (90006g for 10 min at 47C), washed in50 mM Tris-HCl (pH 7.5), and further centrifuged (90006gfor 10 min at 47C). After centrifugation, cells were resus-pended at the same 620 nm absorbance (A620) of 2.5, indenaturating buffer and frozen or directly sonicated asdescribed by De Angelis et al. [21]. After pelleting of unbro-ken cells (90006g for 10 min at 47C), the protein content wasmeasured by the method of Bradford [22].

2-DE was performed using the immobiline/polyacryl-amide system, essentially as described by Hochstrasser et al.[23], using a Pharmacia 2D-EF system (Amersham Pharma-cia Biotech, Milano, Italy). The same amount of total protein(45 mg) was used for each electrophoretic run. IEF was car-ried out on immobiline strips providing a nonlinear pH 3–10gradient (IPG strips, Amersham Pharmacia Biotech) by IPG-phore, at 157C. Voltage was increased from 300 to 5000 Vduring the first 5 h, then stabilized at 8000 V for 8 h. Afterelectrophoresis, IPG strips were equilibrated as described byDe Angelis et al. [21]. For the second dimension, 12.5% ho-mogeneous SDS-PAGE gels were used. Gel calibration andspot detection were performed as described by De Angelis etal. [21]. The protein maps were scanned with a laser densi-tometer (Molecular Dynamics 300s) and analyzed with theImage Master 2D elite computer software (Amersham Phar-macia Biotech). Three gels were analyzed for each culturecondition and spot intensities were normalized as reportedby Bini et al. [24]. In particular, the spot quantification foreach gel was calculated as relative volume (% VOL); the rela-tive VOL was the VOL of each spot divided by the total VOLover the whole image. In this way, differences in the colourintensities among the gels were eliminated [23]. The induc-tion factor for individual proteins was expressed as the ratiobetween the spot intensity of the same protein in cells grownin co- versus monoculture. Induction factors were deter-mined as the average of the spot intensities of three gels foreach condition and SDs were calculated.

2.4 Nano-LC-ESI-MS/MS

Protein identification using nano-LC-ESI-MS/MS was per-formed by Proteome Factory (Proteome Factory AG, Berlin,Germany). The MS system consists of an Agilent 1100NanoLC system (Agilent, Germany), a PicoTip emitter (NewObjective, USA) and an Esquire 3000 plus IT MS (Bruker,Bremen, Germany). Protein spots were in-gel digested bytrypsin (Promega, Mannheim, Germany) and applied tonano-LC-ESI-MS/MS. After trapping and desalting the pep-tides on enrichment column (Zorbax SB C18, 0.365 mm,Agilent) using 1% ACN/0.1% formic acid gradient from 5 to40% ACN within 40 min. MS spectra were automaticallytaken by Esquire 3000 plus according to the manufacturer’sinstrument settings for nano-LC-ESI-MS/MS analyses. Pro-teins were identified using MS/MS ion search of MASCOTsearch engine (Matrix Science, London, UK) and proteindatabase (National Center for Biotechnology Information,

Bethesda, MD, USA). Database searches were also done withthe peptide masses against the nonredundant NCBI data-base using the search program ProFound (http://www.prowl.rockefeller.edu/cgibin/ProFound) from RockefellerUniversity and ProteoMetrics.

2.5 N-Terminal amino acid sequencing

Spots from 2-DE gels were transferred onto polyvinylidenefluoride (PVDF) membranes (Problott Applied Biosystems,Foster City, CA, USA) by passive absorption as described byMesser et al. [25]. N-terminal Edman sequencing was per-formed on an Applied Biosystems Procise 494HT by usingreagents and methods as recommended by the manu-facturer. Sequence comparison was performed by usingSWALL and BLAST at NCBI nonredundant databases.

2.6 DNA isolation, PCR conditions and sequencing of

amplification products

Total DNAs were obtained according to the method of De LosReyes-Gavilán et al. [26]. The set of specific primers used toamplify luxS and HPK genes is shown in Table 1. Fiftymicrolitres of each PCR mixture contained: 200 mM of eachdNTPs, 1 mM of both primers, 2 mM MgCl2, 2 U of Taq DNApolymerase (Invitrogen Life Technologies, Carlsbad, CA), inthe supplied buffer, and ca. 50 ng of DNA. PCR productswere separated by electrophoresis on 1.5% (w/v) agarose gel(Gibco BRL, France) and stained with ethidium bromide(0.5 mg/mL).

When two or more bands were detected on the stainedgel, each amplicon was eluted from gel and purified by theGFX™ PCR DNA and Gel Band Purification kit (AmershamBiosciences). DNA sequencing reactions were performed byPRIMM srl (San Raffaele Biomedical Science Park, Milan,Italy). Sequence comparison was performed by using BasicBLAST database. Translation of nucleotide sequence analy-ses were performed by using the OMIGA software (OxfordMolecular, Madison) or ExPASy translation routine at theExPASy Molecular Biology Server of the Swiss Institute ofBioinformatics (http://ca.expasy.org/). Similarity researcheswere carried out with the advanced BLAST algorithm avail-able at the National Center for Biotechnology Informationsite (htpp://www.ncbi.nlm.nih.gov/). Sequence alignmentswere carried out with the ClustalW algorithm at the ClustalWserver at the European Bioinformatics Institute (http://www.ebi.ac.uk/clustalw/index.html). Partial sequence wasmanually aligned using DNAMAN (4.03 Lynnon BioSoft,Quebec, Canada). A distance matrix and phylogenetic treewere generated using the neighbour-joining method [27].

2.7 RNA isolation and transcript analysis by

quantitative real-time PCR (RT-PCR)

Total RNAs were obtained from 1 mL of L. sanfranciscensisCB1 cells grown in mono- and cocultures with L. plantarum



Table 1. Nucleotide sequences, microbial species and gene targeted of primers used for PCR and RT-PCR amplifications

Primer Specificity/gene target Oligonucleotide sequence (50?30) Reference/NCBI GenBank accessionnumber (of reference sequence)

LuxSlapla(F)/LuxSlapla(R) luxS gene of L. plantarumATCC WCFS1

ATGGCTAAAGTAGAAAGTTTGCAAAGTCGTTGAATAG

AL935254

LuxSLAB(F)/LuxSLAB1(R) Conserved regions of luxS gene ofLactobacillus johnsonii NCC533,L. plantarum ATCC WCFS1 andLactobacillus reuteri 100-23

AAAGTAGAAAGTTTTCATTCTTTATTCTCAGCTAAG

AE017198, AL935254, AY485153

LuxSLAB(F1)/LuxSLAB1(R) Conserved regions of luxS gene ofL. johnsonii NCC533, L. plantarumATCC WCFS1 and L. reuteri 100-23

TTACACACGATTGAACATCATTCTTTATTCTCAGCTAAG

AE017198, AL935254, AY485153

LuxSlacto(F)/LuxSlacto(R) Degenerated primers targeting luxSof Lactobacillus gasseri ATCC33323,L. plantarum ATCC WCFS1,Oenococcus oeni and Streptococcuspyogenes

AAAGTTTTRMATTAGATCATACATGGTCTYKGTAGTTMCCACA

[33] 2005/NZ_AAA002000003,AL935254, X82326, AE014163

RT-PCR-LuxSF/RT-PCR-LuxSR Internal region of luxS gene ofL. sanfranciscensis CB1

GCATGGACGGCGTTATCAATTCAATCGTGTCGCGAATTTC

This work

RT-PCR-16S F/RT-PCR-16S-R 16S rRNA of L. sanfranciscensis CB1 ACGTAGCAGACCTGAGAGGGTAATTACTGCTGCCTCCCGTAGGA

This work

DC400, L. brevis CR13 or L. rossiae A7 at 307C for 7, 12 (early-stationary phase of growth) or 18 h. Samples were cen-trifuged at 90006g for 10 min at 47C and RNA isolation wasperformed with RNeasy kit as recommended by the manu-facturer (Qiagen, Hilden, Germany). Quality control of RNAwas obtained on agarose-gel electrophoresis.

cDNA synthesis with integrated removal of genomicDNA contamination was performed using QuantiTectReverse Transcription kit (Qiagen) and random hexamers forpriming was done according to the protocol supplied. For RT-PCR amplification, all reactions were set up in 96-well reac-tion plates using QuantiTect SYBR Green PCR kit (Qiagen)following the protocol supplied. Amplification, detection andanalysis of mRNA were performed using the ABI-Prism7000 Sequence Detection System (Applied Biosystems) witha SYBR Green PCR Master Mix (Qiagen). All primers (Table1) were designed using the algorithms provided by PrimerExpress software 2.0.0 (Applied Biosystems). The reactionmixture (25 mL) contained SYBR Green PCR Master Mix(Qiagen), 1–4 mL of the cDNA sample and appropriate(0.3 mM) PCR primers. The assays were carried out in tripli-cates at PCR conditions including an initial denaturation at957C for 10 min, followed by a 40 cycle amplification con-sisting of denaturation at 957C for 15 s, annealing andextension at 607C for 1 min. To determine the specificity ofamplification, the analysis of product melting curve wasperformed after the last cycle of each amplification. PCRamplification products were further loaded on agarose 2%gel to check if they corresponded exactly to amplicon size.Data collection was carried out using the ABI SequenceDetection 1.3 software (Applied Biosystems). Data were nor-

malized to levels of 16S gene and analysed using a com-parative cycle threshold method. The level of expression ofluxS in mono- and cocultures was compared using the rela-tive quantification method [28]. Real-time data are presentedas a relative change compared to L. sanfranciscensis CB1grown in monoculture until the mid-exponential phase (7 h)was reached. Error bars show the SD of the DDCT value[28, 29].

2.8 Quantification of 2(3H)dihydrofuranones

5-substituted

The analysis was carried out on monocultures of L. san-franciscensis CB1, L. plantarum DC400, L. brevis CR13 and L.rossiae A7, and cocultures of CB1 with DC400, CR13 or A7.The growth was at 307C until the late-stationary phase (18 h)was reached. A divinylbenzene/carboxen/PDMS fibre (50/30 mm stableflex-grey hub) and a manual solid phase micro-extraction (SPME) holder (Supelco, Bellefonte, PA, USA)were used for extraction. One millilitre of sample was placedin a 10 ml vial and the vial was sealed. The sample was thenallowed to equilibrate for 10 min at 607C. The SPME fibrewas exposed to the sample for 20 min at 607C and then in-serted into the injection port of the GC for 5 min sample de-sorption at 2507C. GC/MS analyses were carried out on anHP Agilent 6890 gas chromatograph coupled with an HPAgilent 5973 Mass selective detector (Agilent Instruments,USA) operating in electron impact mode (70 eV) with a scanbetween 29 and 206 amu. A JW-Scientific (Folsom, CA, USA)DB-Wax capillary column was used (30 m length, 0.32 mmid, 0.5 mm film thickness). The oven temperature pro-



gramme was: 507C for 5 min, then 17C/min to 657C, then57C/min to 2207C and finally 3 min at 2207C. Injector, inter-face and ion source temperatures were 250, 280 and 2307C,respectively. Injections were performed in spiltless mode andhelium was used as carrier gas, at constant pressure (13 kPainlet, average flow 1 mL/min). Compounds were identifiedusing the Wiley 138 mass spectra database.

2.9 Phenotypic characterization: Determination of

other volatile compounds, organic acids and

peptidase activities

The analyses were carried out on monocultures of L. san-franciscensis CB1, L. plantarum DC400, L. brevis CR13 and L.rossiae A7, and cocultures of CB1 with DC400, CR13 or A7.The growth was at 307C until the late-stationary phase (18 h)was reached. Other volatile components were determined bypurge and trap (PT) coupled with GC-MS (PT-GC/MS). Onemillilitre of sample was introduced in a glass extractor with9 mL of Milli-Q water and 20 mL of antifoam Clerol (Cognis,Dusseldorf, Germany), and connected to PT apparatus (Tek-mar 3000, Agilent Instruments). Purge was performed at377C for 30 min, by a helium flow at 40 mL/min, on a tenaxtrap at 377C. Trap desorption was performed at 2257C andinjection into the chromatograph was performed with cryo-cool down. The chromatograph (Agilent Instruments) wasequipped with a capillary column DB5-like (RTX5 Restek,Agilent Instruments), 60 m length, 0.32 mm diameter, and1 mm thickness. Helium flow was 2 mL/min, oven tempera-ture was 407C for 6 min, and increased at 37C/min until2307C. The mass detector (MSD5973, Agilent Instruments)was used in scan mode, from 29 to 206 amu, at 70 eV.

Concentrations of L- and D-lactic acid and acetic acid weredetermined by enzymatic methods (EnzyPlus, DiffchambAB, Vastra Frohunda, Sweden and Megazyme InternationalIreland Limited Bray, Wicklow, Ireland).

For peptidase activities, cells were harvested by cen-trifugation (90006g for 10 min at 47C), washed twice withsterile 50 mM potassium phosphate buffer, pH 7.0, resus-pended in the same buffer at A620 of 2.5 and used to recoverthe cytoplasm extract as described by Gobbetti et al. [30].Briefly, cells were treated with 1 mg/mL (final concentration)of lysozyme (Sigma Chemical, Milan, Italy) in the presenceof 24% (w/v) of sucrose for 60 min at 377C under stirringcondition (150 rpm). After centrifugation (90006g for10 min at 307C), the pellets were resuspended in isotonicbuffer (Tris-HCl 20 mM, pH 7.5) and sonicated by fourcycles (10 each) (Sony Prep model 150; Sanyo, Tokyo, Japan).All suspensions were incubated for 30 min at 377C and cen-trifuged (16 0006g for 30 min at 47C). The supernatantswere dialyzed for 24 h at 47C against 20 mM phosphate buf-fer, pH 7.0, sterilized by filtration on 0.22 mm membrane fil-ters (Millipore Corporation) and used to assay peptidase ac-tivities. General aminopeptidase type N (EC 3.4.11.11;PepN), was determined as described by Gobbetti et al. [30],using Leu-p-nitroanilide (p-NA). One unit of activity was

defined as the amount of enzyme required to liberate 1 mmolof p-nitroaniline per 0.01 min under the assay conditions.Prolidase (EC 3.4.13.9; PepQ), prolinase (EC 3.4.13.8; PepR),dipeptidase (EC 3.4.13.11; PepV) and tripeptidase (EC3.4.11.4; PepT) activities were determined using Val–Pro,Pro–Gly, Leu–Leu and Leu–Leu–Leu substrates, respectively.Activities on di- and tripeptides were determined by the Cd-ninhydrin method [30]. One unit of activity was defined asthe amount of enzyme required to liberate 1 mmol aminoacid released per 0.01 min under the assay conditions.

3 Results

3.1 Growth kinetics and bacterial viability

L. sanfranciscensis is a key sourdough bacterium that dom-inates in most of the European sourdoughs [18]. It was cho-sen as a model bacterium and its interaction with otherrepresentative sourdough species, having different metabolicpathways such as L. plantarum (facultative hetero-fermentative), L. brevis and L. rossiae (obligate hetero-fermentative), was studied.

The kinetics of growth of L. sanfranciscensis CB1 inmono- and cocultures are shown in Fig. 1. During growth inmonoculture, the cell numbers of L. sanfranciscensis CB1increased of log 2.1 CFU/mL, and the values of mmax and lwere log 0.19 CFU/mL/h and 1.06 h, respectively. Whencocultured, the cell yield of L. sanfranciscensis CB1 did notsignificantly (p,0.05%) vary (log 2.01–2.06 CFU/mL), mmax

slightly decreased (log 0.15–0.17 CFU/mL/h) and l mark-edly decreased to 0.68 h (coculture with L. plantarum DC400)or 0.23–0.20 h (cocultures with L. brevis CR13 and L. rossiaeA7, respectively). After 14 h, the number of cultivable cells ofL. sanfranciscensis CB1 decreased when cocultured with L.brevis CR13 or, especially, L. plantarum DC400.

Figure 1. Kinetics of growth of L. sanfranciscensis CB1 in mono-(d) and cocultures with L. plantarum DC400 (s), L. brevis CR13(m) or L. rossiae A7 (D). The data are the means of three inde-pendent experiments 6 SDs (n = 3).



Representative ratios of the metabolically active anddead/damaged cells of L. sanfranciscensis CB1 grown inmono- and cocultures are shown in Fig. 2. After growth for18 h in monoculture, the cultivable cell numbers of L. san-franciscensis CB1, as estimated by plating on SDB agar medi-um, were ca. log 9.1 CFU/mL, which approximately coin-cided with the live cells, as estimated by fluorescent staining(Fig. 2 and Table 2). Cultivable cell numbers of L. san-franciscensis CB1 decreased to log 8.8 and 8.4 CFU/mL whencocultured with L. brevis CR13 or L. plantarum DC400,respectively. Accordingly, the dead/damaged cell numbers ofL. sanfranciscensis CB1 in coculture with L. brevis CR13 or L.plantarum DC400 were significantly (p,0.05%) higher thanthose found in monoculture (log 8.94 and 9.32 vs. 7.93 cell/mL, respectively). Cultivable and dead/damaged cell num-bers of L. sanfranciscensis CB1 cocultured with L. rossiae A7did not vary with respect to the monoculture.

3.2 2-DE analysis

Figures 3A–D show the 2-DE profile of the whole-cell proteinextracts of L. sanfranciscensis CB1 grown in mono- andcocultures until the mid-exponential phase (7 h) wasreached. Compared to monoculture, 2-DE gels of whole-cellprotein extracts of L. sanfranciscensis CB1 grown in coculturewith L. plantarum DC400, L. brevis CR13 or L. rossiae A7showed the increase (� of twofold, p,0.05) of the levels ofexpression of 18, 21 and 18 proteins, respectively (Figs. 3A–D

and Table 3). These proteins were distributed over a largerange of pI (3.8–9.0) and molecular mass (10.0–66.0 kDa).Except for six (spot numbers 17, 22, 38, 41, 47 and 51), all theother proteins were common to all three cocultures. Thehighest increases of the level of expression were generallyfound for cells grown in coculture with L. plantarum DC400(Figs. 3A–D). Compared to monoculture, six proteins (spotnumbers 1, 2, 27, 32, 34 and 35), common to all cocultures,showed a decrease of the level of expression. The expressionof other two proteins (spot numbers 5 and 33) decreased inthe coculture with L. plantarum DC400 only.

The level of protein expression of L. sanfranciscensis CB1grown in mono- and cocultures was also analysed when thelate-stationary phase (18 h) was reached (Figs. 4A and B,Table 3). Only the coculture with L. plantarum DC400 wasshown since that characterized by the highest number ofproteins induced (Fig. 4B). Totally, 52 and 15 spots signifi-cantly (� of twofold, p,0.05) increased and decreased thelevel of expression in L. sanfranciscensis CB1 depending onthe cocultures. These proteins were distributed in the rangeof pI of 3.5–9.5 and molecular mass of 8.5–80 kDa. Amonginduced proteins, the level of expression of 48, 42 and 14spots increased in cocultures with L. plantarum DC400, L.brevis CR13 or L. rossiae A7, respectively. Only ten of theinduced proteins (spot numbers 5, 6, 9, 10, 13, 14, 16, 45, 53and 74) were common to all three cocultures. Nevertheless,other 25 and 3 (spot numbers 4, 8 and 58) induced proteinswere common to cocultures with strains DC400 or CR13,

Figure 2. Fluorescing L. sanfranciscensis CB1 cells grown until the late-stationary phase of growth (18 h) was reached. Metabolically activeand dead/damaged cells are stained green (panels A, C, E and G) and red (panels B, D, F and H), respectively. L. sanfranciscensis CB1 wasgrown in mono- (panels A and B) and cocultures with L. plantarum DC400 (panels C and D), L. brevis CR13 (panels E and F) or L. rossiae A7(panels G and H).





Figure 3. 2-DE analysis of pro-tein expression of L. san-franciscensis CB1 cells grownuntil the mid-exponential phase(7 h) was reached. Cells weregrown in mono- (A) and cocul-tures with L. plantarum DC400(B), L. brevis CR13 (C) or L. ros-siae A7 (D). Numbered ovalsand triangles refer to proteinsthat showed, respectively,increased and decreased levelsof expression under cocultiva-tion with the other lactobacilli.The position of the proteinsidentified by PMF and N-termi-nal sequencing are indicated:phosphoglycerate kinase (P-Gly-kinase), glyceraldehydes-3-phosphate dehydrogenase (Gly-3PDH), GTP-binding EngA, lac-tate dehydrogenase (Lac-DH),S-adenosyl-methyltransferasemraW (mraW), aldose reductoserelated protein (Ald-red), aldo/keto reductase (AKR), phos-phoglycerate mutase 1 (PGM),ribosonal protein L5 (Rp-L5),phosphocarrier protein Hpr(Hpr), SSU ribosomal proteinS10P (Rp-S10P), 30S ribosomalprotein S10 (30S Rp-S10), eno-lase, 50S ribosomal protein L31(50S Rp-L31), 50S ribosomalprotein L7/L12 (L7/L12), CspC,beta-phosphoglucomutase/glu-cose-1-phosphate phospho-dismutase (b-PGM) and GroES.



Figure 4. 2-DE analysis of pro-tein expression of L. san-franciscensis CB1 cells grownuntil the late-stationary phase(18 h) was reached. Cells weregrown in mono- (A) and cocul-tures with L. plantarum DC400(B). Spot designation and sym-bols correspond to those of thegel shown in Fig. 3.



Table 2. Live, dead/damaged and cultivable cells of L. sanfranciscensis CB1 when cultivated in mono- and cocul-tures with L. plantarum DC400, L. brevis CR13 or L. rossiae A7 at 307C for 18 h (late-stationary phase ofgrowth)

Culture conditions Live cells(log cell/mL)a)

Dead/damagedcells(log cell/mL)a)

Cultivable cells(log CFU/mL)b)

L. sanfranciscensis CB1 9.3c) 7.93e) 9.1c)

L. sanfranciscensis CB1 – L. plantarum DC400 8.45e) 9.32c) 8.4e)

L. sanfranciscensis CB1 – L. brevis CR13 8.83d) 8.94d) 8.8d)

L. sanfranciscensis CB1 – L. rossiae A7 9.33c) 8.0e) 9.04c)

a) Cell number estimated by using LIVE/DEAD BacLight Bacterial Viability kit.b) Cell number estimated by plating on SDB agar medium.

c–e) Data are the mean of three independent experiments and values in the same column with differentsuperscript letters differ significantly (p,0.05).

Table 3. Proteins showing an increased and decreased level of expression when L. sanfranciscensis CB1 cells were cocultured with L.plantarum DC400, L. brevis CR13 or L. rossiae A7

Phase of growth Coculture Total numberof spot

Spot designationa) Total numberof spot commonto all cocultures

Increased

Mid-exponential phase CB1-DC400 18 4, (10)b), 11, 12, (13), (14), 15, (16), 17,18, 19, 23, 30, 43, 47, 50, (53), 65

16

CB1-CR13 21 4, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,22, 23, 30, 41, 43, 47, 50, 51, 53, 65

CB1-A7 18 4, 10, 11, 12, 13, 14, 15, 16, 18, 19, 22,23, 30, 38, 43, 50, 53, 65

Late-stationary phase CB1-DC400 48 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16,18, 20, 21, 22, 25, 28, 33, 37, 39, 41,42, 44, 45, 46, 48, 50, 51, 53, 55, 58,59, 61, 63, 64, 65, 66, 67, 69, 70, 71,72, 73, 74, 75, 76

10

CB1-CR13 42 3, 5, 6, 9, 10, 13, 14, 16, 19, 21, 22, 25,28, 33, 37, 40, 41, 45, 46, 48, 50, 51,53, 56, 57, 59, 60, 62, 63, 64, 65, 66,67, 68, 69, 70, 71, 72, 73, 74, 75, 76

CB1-A7 14 4, 5, 6, 8, 9, 10, 13, 14, 16, 29, 45, 53, 58, 74

Decreased

Mid-exponential phase CB1-DC400 8 1, 2, 5, 27, (32)c), 33, (34), (35) 6CB1-CR13 6 1, 2, 27, 32, 34, 35CB1-A7 6 1, 2, 27, 32, 34, 35

Late-stationary phase CB1-DC400 6 23, 31, 32, 34, 35, 43 6CB1-CR13 12 1, 2, 23, 26, 31, 32, 34, 35, 36, 38, 43, 54CB1-A7 13 23, 24, 26, 31, 32, 34, 35, 36, 38, 43, 49,

52, 54

a) Spot designation corresponds to that of the gels in Figs. 3 and 4.b) Numbers in parentheses indicate spot showing an increased level of expression in all the cocultures and both the phase of growth.c) Numbers in parentheses indicate spot showing a decreased level of expression in all the cocultures and both the phase of growth.



and DC400 or A7, respectively. No other induced proteinswere common to cocultures with strains CR13 or A7.Overall, L. sanfranciscensis CB1 cells cocultured withstrains DC400, CR13 or A7 had, respectively, 11, 11 and 6proteins commonly induced between the mid-exponentialand late-stationary phases of growth. Five of them werecommon to all three cocultures (spot numbers 10, 13, 14,16 and 53). Among under-expressed proteins, the intensityof 6, 12 and 13 spots decreased in cocultures with L.plantarum DC400, L. brevis CR13 or L. rossiae A7, respec-tively. Six of these proteins (spot numbers 23, 31, 32, 34,35 and 43) were common to all three cocultures and fourproteins were common to the cocultures with L. brevisCR13 or L. rossiae A7. Spot numbered 32, 34 and 35decreased in cells from both the phases of growth and allthree cocultures.

Table 4 shows the estimated molecular mass, pI andlevels of expression of proteins that showed the highestinduction at the late-stationary phase of growth. Except forspots 15 and 19, all proteins were at various levels inducedin both the cocultures with L. plantarum DC400 or L. bre-vis CR13. Only 7 of the 19 proteins considered were alsoinduced in cells from the mid-exponential phase ofgrowth. These proteins were subjected to further identifi-cation.

3.3 Identification of proteins by nano-LC-ESI-MS/MS

and N-terminal sequencing

Table 5 shows the identification of the proteins mainlyinduced in L. sanfranciscensis CB1 cells when cocultured withL. plantarum DC400, L. brevis CR13 or L. rossiae A7 until thelate-stationary phase of growth was reached. Their putativefunction and the percentage of identity with homologousproteins of other microorganisms are also reported. Inducedpolypeptides were identified as energy metabolism related(phosphoglycerate kinase, lactate dehydrogenase, phos-phoglycerate mutase 1, enolase, glyceraldehyde-3-phosphatedehydrogenase, aldose reductase related protein, aldo/ketoreductase, b-phosphoglucomutase/glucose-1-phosphatephosphodismutase and phosphocarrier protein Hpr), stressproteins (ribosomal proteins L5, L7/L12, L31, S10 and S10P,GroES and CspC), GTP-binding protein EngA, S-adenosyl-methyltransferase and proline dehydrogenase.

3.4 PCR amplification of putative luxS and HPK gene

fragments and expression of luxS gene

L. sanfranciscensis CB1 was screened for luxS and HPK genes.The degenerated primers LuxSLacto(F) and LuxSLacto(R)[33] gave two PCR products of ca. 650 and 380 bp. The pre-

Table 4. Properties of proteins mainly induced in L. sanfranciscensis CB1 cells when cocultured with L. plantarum DC400, L. brevis CR13 orL. rossiae A7 until the late-stationary phase of growth (18 h) was reached

Spota) Estimated Mid-exponential phase – induction factorb) Late-stationary phase – induction factor

Mr (kDa) pI DC400 CR13 A7 DC400 CR13 A7

3 66.2 5.8 0c) 0 0 2.0 6 0.14 2.0 6 0.20 09 43.8 4.8 0 0 0 2.5 6 0.12 3.0 6 0.15 3.0 6 0.29

22 32.4 5.6 0 2.0 6 0.05 2.0 6 0.04 2.5 6 0.03 3.0 6 0.27 050 18.1 9.0 2.0 6 0.06 2.0 6 0.07 2.5 6 0.06 3.0 6 0.12 3.0 6 0.24 053 15.1 3.9 3.0 6 0.08 2.5 6 0.05 3.0 6 0.05 3.5 6 0.11 4.5 6 0.27 2.065 10.7 3.8 2.0 6 0.04 2.5 6 0.09 2.0 6 0.04 2.0 6 0.07 2.5 6 0.15 067 10.3 4.5 0 0 0 1.5 6 0.01 2.0 6 0.14 068 10.3 7.0 0 0 0 2.0 6 0.05 2.5 6 0.11 070 10.5 4.5 0 0 0 2.0 6 0.03 1.5 6 0.02 071 10.3 7.8 0 0 0 2.0 6 0.12 1.5 6 0.05 073 9.5 5.4 0 0 0 2.0 6 0.21 2.5 6 0.22 05 45.0 4.7 0 0 0 2.0 6 0.09 1.8 6 0.10 4.0 6 0.076 45.0 5.9 0 0 0 3.0 6 0.13 2.5 6 0.20 3.0 6 0.05

15 35.0 7.3 4.0 6 0.10 4.0 6 0.23 3.5 6 0.10 2.5 6 0.09 0 016 35.2 7.8 4.0 6 0.33 2.0 6 0.07 3.0 6 0.12 2.5 6 0.14 2.5 6 0.08 019 34.2 7.7 3.5 6 0.14 4.0 6 0.16 4.0 6 0.18 0 3.0 6 0.16 066 10.6 5.0 0 0 0 2.0 6 0.21 2.5 6 0.26 069 10.2 3.6 0 0 0 2.0 6 0.04 3.5 6 0.19 072 9.8 4.7 0 0 0 2.0 6 0.06 3.0 6 1.31 0

a) Spot designation corresponds to that of the gels in Figs. 3 and 4. The progressive spot numbers were according to Table 5.b) The induction factor is defined as the ratio between the spot intensity of a protein from cells cocultivated with L. plantarum DC400, L.

brevis CR13 or L. rossiae A7 and the spot intensity of the same protein from cells grown in monoculture. All the induction factors werecalculated as the average of the spot intensities of three gels and 6 SD are shown.

c) No induction was found.



Table 5. Mass fingerprint or N-terminal sequencing and putative function of proteins mainly induced in L. sanfranciscensis CB1 cells whencocultured with L. plantarum DC400, L. brevis CR13 or L. rossiae A7 until the late-stationary phase of growth (18 h) was reached

Spota) Homologous protein/functionb) ANc) Organism Identityscore (%)

Sequencecoverage (%)

3 Phosphoglycerate kinase YP_6187714 Lactobacillus delbrueckii ATCC11842 99.99 19.0 (11)d)

9 Lactate dehydrogenase ZP_00323772 Pediococcus pentosaceus ATCC25745 99.29 20.0 (9)22 Phosphoglycerate mutase 1 NP_7864521 L. plantarum WCFS1 94.91 5.2 (2)50 Ribosomal protein L5 ZP_00323960 P. pentosaceus ATCC25745 86.4 32.7 (7)53 Phosphocarrier protein Hpr AN_P23534 Staphylococcus carnosus 90.5 15.8 (3)65 Enolase BAB81005.1 Clostridium perfrigens str. 13 93.4 26.8 (3)67 SSU ribosomal protein S10P YP_536323 Lactobacillus salivarius subsp.

salivarius UCC11896.4 21.1 (3)

68 30S ribosomal protein S10 Q839G5 Enterococcus faecalis 12.5 10.0 (2)70 50S ribosomal protein L7/L12 AA508407 Lactobacillus johnsonii NCC533 98.0 19.8 (2)71 50S ribosomal protein L31 BAB07499 Bacillus halodurans C-125 91.3 18.5 (2)73 GroES protein AJ831551.1 Oenococcus oeni 96.5 30.1 (3)

Protein functionb) ANc) N-terminal sequence/organism Identity score (%)

5 Glyceraldehyde-3-phosphatedehydrogenase

NP_562220.1 IGRLALRLMIDNP Clostridiumperfringens str. 13

100

6 GTP-binding EngA YP_079584 VVAIVGRP Bacillus licheniformisATCC14580

100

15 Aldose reductase related protein YP_535214 GQYSDPKLKIFAL L. salivarius subsp.salivarius UCC118

100

16 S-adenosyl-methyltransferasemraW

Q99YJ9 MEFNNVTV Streptococcus pyogenesser. M3

100

19 Aldo/keto reductase ZP_00384814.1 GGTFFVGG Exiguobacteriumsibiricum 255-15

100

66 Proline dehydrogenase ZP_00539188.1 GGTFFVGG E. sibiricum 255-15 10069 CspC Q88Y09 HGTVKWFNADKG L. plantarum WCFS1 10072 Beta-phosphoglucomutase/

glucose-1-phosphate phospho-dismutase

ABF06645 GFAFDLGVIADTAR L. reuteriATCC55730

100

a) Spot designation corresponds to that of the gels in Fig. 3 and 4.b) Similarity of the amino acid sequence to a sequence found in the databases. The similarity researches were done by using the BLASTat

NCBI non redundant databases and SWALL database.c) Accession number.d) Number in parentheses indicates the number of peptides identified.

dicted amino acid sequences of ca. 650 bp amplificationproduct showed 41% of identity with 5,10-methylenetetrahy-drofolate reductase (MetF) of Coxiella burnetii RSA493. Thenucleotidic sequence of ca. 380 bp PCR product had highidentity (83%) with the luxS gene of Lactobacillus reuteri (A.N.DQ233673.1) and L. plantarum WCFS1 (A.N. AL935254.1).Alignment of the internal luxS fragment of L. sanfranciscensisCB1 with the most similar sequences from other bacterialluxS genes gave the phylogenetic tree of Fig. 5A. PCR prod-ucts without any identity to HPK were found by using otherprimers constructed targeting regions of known bacterialHPK genes (Table 1) [34].

To determine whether the expression of the luxS gene in L.sanfranciscensis CB1 was regulated by interactions with otherlactobacilli, RT-PCR was performed using RNA isolated fromcells grown in mono- and cocultures for 7, 12 and 18 h. All cellsfrom the mid-exponential phase of growth (7 h) showed the

expression of luxS (Fig. 5B). Nevertheless, the level of expres-sion markedly varied according to the following order: L. plan-tarum DC400 . L. brevis CR13 . L. rossiae A7 % mono-culture. At the early-stationary phase of growth (12 h), cellsfrom the monoculture did not express the luxS gene and cellsfrom all cocultures showed a decreased expression by main-taining the above statistically significant (p,0.05) differences.No expression of the luxS gene was found in the cells from thelate-stationary phase of growth (18 h), except for a very lowlevel in the coculture with L. brevis CR13.

3.5 Quantification of 2(3H)dihydrofuranones

5-substituted

Furanone derivatives were identified by SPME and furtherGC/MS. Table 6 shows the concentration of 2(3H)dihy-drofuranone-5ethyl and 2(3H)dihydrofuranone-5pentyl in



Figure 5. Phylogenetic tree based uponthe neighbour-joining method ofdeduced partial LuxS sequences. Hor-izontal bar represents 1% sequencedivergence. Numbers indicate bootstrapvalue branch points (A). Expression ofthe luxS gene of L. sanfranciscensis CB1in monoculture (CB1) and cocultureswith L. plantarum DC400, L. brevis CR13or L. rossiae A7 (B). RT-PCR was per-formed after 7 (mid-exponential phaseof growth, a), 12 (early-stationary phaseof growth, b) and 18 (late-stationaryphase of growth, c) h of incubation at307C (see Section 2 for details). The dataare the means of three independentexperiments 6 SDs (n = 3).

Table 6. Concentrations (ppb) of 2(3H)dihydrofuranone-5ethyland 2(3H)dihydrofuranone-5pentyl in the monocul-turesa) of L. sanfranciscensis CB1, L. plantarum DC400, L.brevis CR13 and L. rossiae A7, and in the coculturesa) ofstrain CB1 with strains DC400 or CR13 or A7

Cultureconditions

2(3H)dihydro-furanone-5ethyl

2(3H)dihydro-furanone-5pentyl

CB1 10.24c) 12.52d)

DC400 2.15d) 1.98e)

CR13 1.82d) 1.45e)

A7 1.35d) 1.10e)

CB1-DC400 43.62b) 47.51b)

CB1-CR13 12.06c) 35.09c)

CB1-A7 9.25c) 11.03d)

a) Cells were grown until the late-exponential phase (18 h)was reached.

b–e) Data are the mean of three independent experiments andvalues in the same column with different superscript lettersdiffer significantly (p,0.05).

the monocultures of L. sanfranciscensis CB1, L. plantarumDC400, L. brevis CR13 and L. rossiae A7, and when strain CB1was cultivated in cocultures. Compared to monoculture, bothcompounds markedly increased in the coculture with L.plantarum DC400. Only 2(3H)dihydrofuranone-5pentylincreased when L. sanfranciscensis CB1 was grown with L.brevis CR13 and both compounds decreased in coculturewith L. rossiae A7. The levels of 2(3H)dihydrofuranone-5ethyland 2(3H)dihydrofuranone-5pentyl synthesized by strainsDC400, CR13 and A7 in monocultures were always ca. one-tenth of the levels detected in the monoculture of L. san-franciscensis CB1. Traces of 2(3H)dihydrofuranone-5butyland 2(3H)dihydrofuranone-5hexyl were also found in cocul-tures with L. plantarum DC400 or L. brevis CR13 only.

3.6 Phenotypic characterization

After growth of L. sanfranciscensis CB1 in monoculture, 41other volatile components were identified by PT-GC/MS.They belong to the following chemical classes: alcohols (2),



ketones (11), aldehydes (13), esters (7), furans (1), alkanes(3), benzene derivatives (1) and terpens (3). Table 7 refers tosome of the volatile compounds that showed the highestvariations by cultivating L. sanfranciscensis CB1 in mono- orcocultures. The effect of the associated strain on the increas-ing or decreasing levels of 2-propanol, 2,3-butandione, 3-methyl butanal and ethyl-acetate was according to this order:L. plantarum DC400 . L. brevis CR13 . L. rossiae A7. Almostthe same trend was also found for 2-heptanone, butanal, 2-methyl butanal, acetaldehyde, pentanal, exanal, octanal,phenylacetaldehyde, ethyl-formate, methyl-acetate, 3-methylbutyl-acetate, ethyl-benzene and beta-pinene. Thesynthesis of the above compounds in the monocultures of L.plantarum DC400, L. brevis CR13 and L. rossiae A7 was absentor at a noninterfering level. The other 24 volatile compoundsdid not show significant variations (data not shown).

After 18 h of growth, the pH of WFH was in the range3.50–3.21 depending on the coculture conditions. Duringgrowth in monoculture (pH 3.50), L. sanfranciscensis CB1produced 39.93 6 0.94 mM of lactic acid and 11.54 6

0.36 mM of acetic acid. Almost the same concentrations oflactic and acetic acids were found in the monocultures of L.brevis CR13 and L. rossiae A7. L. plantarum DC400 aloneproduced 50.11 6 0.59 mM of lactic acid and 0.37 6

0.05 mM of acetic acid. Assuming that at 18 h the con-centrations of the fermentation end-products reached anapproximate equilibrium in both the double vessels of thecoculture apparatus, the level of lactic acid was 62.9 6 0.97and 50.82 6 1.05 mM when L. sanfranciscensis CB1 wascocultured with L. plantarum DC400 (pH 3.21) or L. brevisCR13 (pH 3.35), respectively. The concentration of aceticacid was 1.4 6 0.25 and 10.77 6 0.71 mM, respectively.Compared to monoculture, no differences were found for theconcentration of lactic and acetic acids when L. san-franciscensis CB1 was cocultured with L. rossiae A7.

Several peptidase activities (PepN, PepQ, PepR, PepVandPepT) were assayed by using the cytoplasm extracts of L.sanfranciscensis CB1 cells after growth in mono- and cocul-tures until the late-stationary phase was reached. All enzymeactivities were highest in L. sanfranciscensis CB1 cells grown

Table 7. Concentrations (ppb) of some volatile components found in the monoculturesa) of L. sanfranciscensisCB1, L. plantarum DC400, L. brevis CR13 and L. rossiae A7, and in the coculturesa) of strain CB1 withstrains DC400 or CR13 or A7

Chemical class CB1 DC400 CR13 A7 CB1-DC400 CB1-CR13 CB1-A7

Alcohols

2-Propanol 651.07b) 45.7e) 33.2e) 78.04d) 53.4d) 99.03d) 209.30c)

Ketones

2,3-Butandione 4.52e) 8.15d) 2.42e) 0.65f) 59.98b) 15.53c) 8.73d)

2-Heptanone 0.55e) 1.63c) 1.05d) 0.89e) 5.14b) 3.45b) 1.59c)

Aldehydes

Butanal 1.14d) 0.25e) 0.09e) 0.10e) 2.01b) 1.91b) 1.87c)

2-Methyl butanal 3.41b) 1.08d) 0.96d) 1.56c) 1.47c) 1.77c) 2.65b)

3-Methyl butanal 3.30c) 1.24d) 0.17e) 0.84d) 6.53b) 5.51b) 3.55c)

Acetaldehyde 23.80c) 7.52d) 6.15d) 4.01e) 39.01b) 32.94b) 26.19c)

Pentanal 5.13d) 7.81c) 6.81d) 3.41e) 13.78b) 11.54b) 10.09c)

Hexanal 1.77e) 5.04d) 0.00 2.35e) 10.24b) 6.52c) 4.43d)

Octanal 1.42d) 0.53e) 0.06f) 0.12f) 5.51b) 4.57b) 4.05c)

Phenylacetaldehyde 45.32b) 10.34d) 5.63e) 5.23e) 10.35d) 15.10c) 17.24c)

Esters

Ethyl-acetate 581.86b) 118.12d) 45.20e) 25.26e) 75.31d) 310.8c) 347.25c)

Ethyl-formate 94.61e) 18.02f) 10.2f) 5.41f) 350.11b) 275.30c) 178.20d)

Methyl-acetate 254.15b) 42.05e) 32.87f) 24.89f) 65.19d) 99.35c) 135.09c)

3-Methylbutyl-acetate 24.81b) 0.00 2.54d) 1.89e) 3.45d) 5.56c) 6.04c)

Benzene derivatives

Ethyl-benzene 3.05d) 1.54e) 0.88f) 2.08e) 4.55c) 5.25b) 5.98b)

TerpenesBeta-pinene 1.61e) 0.00 0.00 0.00 10.84b) 7.42c) 6.38d)

a) Cells were grown until the late-exponential phase of growth (18 h) was reached.b–f) Data are the mean of three independent experiments and values in the same row with different superscript

letters differ significantly (p,0.05).



in monoculture (Fig. 6). For instance, PepN activity on Leu-p-NA decreased from 8.28 6 0.51 UA in monoculture to2.14 6 0.36 U, 5.40 6 0.28 U and 6.32 6 0.48 U in coculturewith L. plantarum DC400, L. brevis CR13 or L. rossiae A7,respectively. The same trend was found for PepQ, PepR,PepV and PepT activities.

4 Discussion

A few studies have considered the mechanisms of cell–cellcommunication in food related lactic acid bacteria [17]. Someof them have shown that potential elements of the 3CRS areencoded by genome sequences of Streptococcus thermophilus[31] and that synthesis of surface polysaccharides is undercontrol of quorum sensing in L. plantarum [32]. The secre-tion of bacteriocins classes I and II in several lactic acid bac-teria is regulated by the same antimicrobial peptide, acting assignalling molecule also, and/or by dedicated small peptidesstimulating the autophosphorylation cascade of sensor andregulator proteins [7]. First, this study gave complementaryinsights of the mechanism of cell–cell communication in L.sanfranciscensis CB1 as a response to cocultivation with otherlactobacilli.

WFH as the culture medium and long-time fermentation(18 h) were used to resemble the chemical composition ofwheat flour and the most widely used protocol of sourdoughpropagation [18]. The cocultivation of L. sanfranciscensis CB1

with strains L. brevis CR13 or, especially, L. plantarum DC400was a stressing condition when the late stationary phase ofgrowth was reached. The number of dead/damaged cellsmarkedly increased and number of cultivable cells decreasedcompared to the monoculture or to the coculture with L. ros-siae A7. Several and not easily definable factors such as acid-ity, synthesis of antimicrobial compounds and nutrientcompetition may interfere with the above stress conditions.

2-DE analysis was carried out either at the mid-exponen-tial (7 h) or at the late-stationary (18 h) phases of growth toshow variations of the level of protein expression of L. san-franciscensis CB1 cells grown in cocultures with respect tomonoculture. Although the highest increases of the level ofexpression were found in coculture with L. plantarumDC400, almost the same proteins were induced in all threecocultures at the mid-exponential phase of growth. On thecontrary, the number of induced proteins markedlyincreased and varied between the three cocultures at the late-stationary phase of growth which coincided with theincreased dead/damaged cells. The number of induced pro-teins was highest when L. sanfranciscensis CB1 was cocul-tured with L. plantarum DC400 or L. brevis CR13 (48 and 42,respectively). Only a few proteins (14) were moderatelyinduced in the coculture with L. rossiae A7. Nineteen pro-teins, mostly having the highest induction at 18 h in cocul-tures with strains DC400 or CR13, were identified. All theseproteins had a central role in the stress response mechan-isms and LuxS-mediated signalling was shown to be involved

Figure 6. PepN, PepR, PepQ, PepV andPepTactivities of L. sanfranciscensis CB1cells grown in monoculture and cocul-tures with L. plantarum DC400, L. brevisCR13 or L. rossiae A7 until the late-exponential phase (18 h) was reached.Cell preparation, substrates and calcula-tion of the units of activity (UA) arereported in Section 2. The data are themeans of three independent experi-ments 6 SDs (n = 3).



in this regulation of responses [33–35]. Energy metabolismrelated proteins (e.g. phosphoglycerate kinase, lactate dehy-drogenase, phosphocarrier protein Hpr, enolase and glycer-aldheyde-3-phosphate dehydrogenase) were also shown to beupregulated in Lactobacillus rhamnosus HN001 when sub-jected to heat or osmotic stresses [36] or to be induced (e.g.aldose reductase and aldo-keto reductase) when bacterialcells were subjected to various environmental stresses [37].Almost the same was found for proline dehydrogenase [38]and CspC, not only induced during cold adaptation but alsounder other environmental stresses [39]. Under these stres-sing conditions, the expression of LuxS in Lactobacillus acid-ophilus and E. coli [34, 35] was involved in the induction ofmost of the above proteins. A cluster of five ribosomal pro-teins, L5, L7/L12, L31, S10 and S10P and GTP-bindingEngA, involved in ribosome assembly or stability, were iden-tified also. As shown in Gram-negative bacteria, ribosomesor ribosome-associated factors were involved in sensingstress [40] and some of them were also induced by addition ofAHLs [41]. Ribosomal L7–L12 protein was supposed to be thebinding site for several of the factors involved in proteinsynthesis and appeared to be essential for accurate transla-tion, acting as one of the primary sensors of conditions thatevoke the heat shock response [42, 43]. GroES and S-adeno-syl-methyltransferase were shown to be specifically involvedin cell–cell communication. The LuxR transcriptor in Gram-negative bacteria required chaperonines such as GroEL andGroES for folding into an active conformation [44]. Theinduction of GroES was previously found in L. san-franciscensis during acid adaptation [21]. S-adenosyl-methyl-transferase MraW uses the cofactor AdoMet to methylate avariety of molecular targets, thereby modulating importantcellular and metabolic activities. In E. coli K-12 the S-adeno-syl-methyltransferase (tam gene), located in the lsrACDBFGoperon, was regulated by LuxS [45].

The luxS gene was for the first time partially sequencedin L. sanfranciscensis CB1. The phylogenetic tree based on thededuced amino acid sequence of LuxS showed the highestsimilarity with species naturally occurring in sourdough (e.g.Lactobacillus delbrueckii ssp., L. reuteri and L. plantarum) [18].The phylogenetic tree of the LuxS protein for a large numberof Firmicutes and Proteobacteria species was previouslyreconstructed [46]. For instance, Bifidobacterium longum wasfound as a sister group to the Firmicutes L. plantarum and Lc.lactis, and several streptococci. This homology was explaineddue to the same human gastrointestinal habitat that possiblyfavoured the gene transfer among the species. MetF was alsopartially cloned in L. sanfranciscensis CB1. MetF and MetEenzymes, located upstream of LuxS in the metabolic pathwayfor the synthesis of signalling molecules, seem to be indis-pensable for the generation of methionine, which is part ofS-adenosylmethionine [47]. The expression of the luxS genewas determined during growth of L. sanfranciscensis CB1 inmono- and cocultures. As shown by RT-PCR, the expressionof luxS at the mid-exponential phase of growth (7 h) washigher when L. sanfranciscensis CB1 was cocultured with L.

brevis CR13, and, especially, with L. plantarum DC400 com-pared to mono- or coculture with L. rossiae A7. Subsequently,the expression of the luxS gene decreased at early- (12 h) andlate-stationary (18 h) phases of growth. As shown by otherauthors [48] in Porphyromonas gingivalis, the levels of the luxSmessage usually decreased ca. fivefold between the expo-nential and stationary phases of growth. In agreement with2-DE analysis, it seemed that the expression of luxS beforethe late-stationary phase of growth might be related to thesubsequent induction of stress response and cell–cell com-munication proteins.

Beyond furanosyl borate diester [16], other derivativesmay be generated and serve as signalling molecules in na-ture [49]. Overall, all LuxS-containing bacteria synthesize theDPD precursor but it is likely that DPD may cyclize to avarieties of furanones. It has been suggested that the evolvedbiological function of a number of furanone analogues is toact as interspecies signal molecules in several ecosystems[50]. The chemical properties of furanones are ideal for thesignalling mechanisms; they are water and/or fat soluble orvolatile depending on the substituents on the central ring[50]. The variety of signalling furanones synthesized by bac-teria could be the basis of an extensive chemical lexicon thatencodes information about habitat, not necessarily inter-species related, and the number of members and speciescomposition of a given community [51]. Recently,2(5H)dihydrofuranones were considered as possible signal-ling molecules in L. helveticus [52] as well as the role of LuxSfor in vitro synthesis of furanones was elucidated [53].2(3H)dihydrofuranone-5ethyl and 2(3H)dihydrofuranone-5pentyl were identified as presumptive signalling moleculeswhen L. sanfranciscensis CB1 was grown in monoculture.Their levels increased in cocultures with L. brevis CR13 and,especially, L. plantarum DC400, where cell viability, inductionof stress and LuxS related proteins, and expression of luxSgene were mainly affected. Almost the same was found in E.coli that produced furanosyl borate diester in pure culture toactivate a cascade of upregulations for sensing the environ-ment and, especially, synthesized the same signal at higherlevels when in mixed culture with V. harveyi, probably to getinformation about cell numbers of the coexisting bacterium[51].

Since interaction and communication between lactoba-cilli take place during sourdough fermentation, this studyalso showed that some phenotypic traits were conditioned bythe composition of the microbial consortium. Both the syn-thesis of volatile compounds and peptidase activitiesresponsible for the sensory and nutritional properties ofsourdough baked goods [18] were influenced by the micro-bial association thus mirroring the different effect of othersourdough lactobacilli on stress response and cell–cell com-munication of L. sanfranciscensis CB1.

It is likely that for food related lactic acid bacteria futuremassive genetic and proteomic efforts have to be focused inunderstanding cell–cell signalling and coordinate behavioursince bacterial performances are mostly the consequence of



very complex community interactions. In such a context, thiswork elucidated some traits of the cell–cell communicationin sourdough L. sanfranciscensis CB1 showing how the fea-tures and industrial performances of starters are also medi-ated by molecular mechanisms of bacterial interactions.

5 References

[1] Fuqua, C., Winans, S. C., Greenberg, E. P., Annu. Rev.Microbiol. 1996, 50, 727–751.

[2] Michiels, J., Dirix, G., Vanderleyden, J., Xi, C., Trends Micro-biol. 2001, 9, 164–168.

[3] Holden, M. T., Ram Chhabra, S., de Nys, R., Stead, P. et al.,Mol. Microbiol. 1999, 33, 1254–1266.

[4] Ren, D., Bedzyk, L. A., Ye, R. W., Thomas, S. M., Wood, T. K.,Appl. Environ. Microbiol. 2004, 70, 2038–2043.

[5] Fuqua, C., Parsek, M. R., Greenberg, E. P., Ann. Rev. Gen.2001, 35, 439–468.

[6] Nakayama, J., Cao, Y., Horii, T., Sakuda, S. et al., Mol.Microbiol. 2001, 41, 145–154.

[7] Kleerebezem, M., Quadri, L. E., Peptides 2001, 22, 1579–1596.

[8] Brurberg, M. B., Nes, I. F., Eijsink, V. G. H., Mol. Microbiol.1997, 26, 347–360.

[9] O’Keeffe, T., Hill, C., Ross, R. P., Appl. Environ. Microbiol.1999, 65, 1506–1515.

[10] Clewell, D. B., Cell 1993, 73, 9–12.

[11] Magnuson, R., Solomon, J., Grossman, A. D., Cell 1994, 77,207–216.

[12] Rudner, D. Z., LeDeaux, J. R., Ireton, K., Grossman, A. D., J.Bacteriol. 1991, 173, 1388–1398.

[13] Hoch, J. A., Curr. Opin. Microbiol. 2000, 3, 165–170.

[14] Bassler, B. L., Wright, M., Silverman, M. R., Mol. Microbiol.1994, 13, 273–286.

[15] Schauder, S., Penna, L., Ritton, A., Manin, C. et al., J. Bac-teriol. 2005, 187, 392–395.

[16] De Keersmaecker, S. C. J., Sonck, K., Vanderleyden, J.,Trends Microbiol. 2006, 14, 114–119.

[17] Gobbetti, M., De Angelis, M., Di Cagno, R., Minervini, F.,Limitone, A., Int. J. Food Microbiol. 2007, in press.

[18] Gobbetti, M., De Angelis, M., Corsetti, A., Di Cagno, R.,Trends Food Sci. Technol. 2005, 16, 57–69.

[19] Kline, L., Sugihara, T. F., Appl. Environ. Microbiol. 1971, 21,459–465.

[20] Zwietering, M. H., Jongeberger, I., Roumbouts, F. M., van’tRiet, K., Appl. Environ. Microbiol. 1990, 56, 1875–1881.

[21] De Angelis, M., Bini, L., Pallini, V., Cocconcelli, P. S. et al.,Microbiology 2001, 147, 1863–1873.

[22] Bradford, M. M., Anal. Biochem. 1976, 72, 248–254.

[23] Hochstrasser, D. F., Harrington, M. G., Hochstrasser, A. C.,Miller, M. J., Merril, C. R., Anal. Biochem. 1988, 173, 424–435.

[24] Bini, L., Magi, B., Marzocchi, B., Arcuri, F. et al., Electropho-resis 1997, 18, 2832–2841.

[25] Messer, M., Griffiths, M., Rismiller, P. D., Shaw, D. C., Comp.Biochem. Physiol. 1997, 118B, 403–410.

[26] De Los Reyes-Gavilán, C. G., Limsowtin, G. K. Y., Tailliez, P.,Séchaud, L., Accolas, J., Appl. Environ. Microbiol. 1992, 58,3429–3432.

[27] Saitou, N., Nei, M., Mol. Biol. Evol. 1987, 4, 406–425.

[28] Perkin-Elmer Corporation, Applied Biosystem Prism 7700Sequence Detection System: User Bullettin 2, The Perkin-Elmer Corporation, Norwalk, CT, USA 1997.

[29] Walters, M., Sircili, M. P., Speradio, V., J. Bacteriol. 2006, 188,5668–5681.

[30] Gobbetti, M., Lanciotti, R., De Angelis, M., Corbo, M. R. et al.,Enzyme Microb. Technol. 1999, 25, 795–809.

[31] Hols, P., Hancy, F., Fontaine, L., Grossiord, B. et al., FEMSMicrobiol. Rev. 2005, 29, 435–463.

[32] Sturme, M. H. J., Nakayama, J., Molenaar, D., Murakami, Y.et al., J. Bacteriol. 2005, 187, 5224–5235.

[33] When, Z. T., Burne, R. A., J. Bacteriol. 2004, 186, 2682–2691.

[34] Azcarate-Peril, M. A., McAuliffe, O., Altermann, E., Lick, S. etal., Appl. Environ. Microbiol. 2005, 71, 5794–5804.

[35] Hardie, K. R., Cooksley, C., Green, A. D., Winzer, K., Micro-biol. 2003, 149, 715–728.

[36] Prasard, J., McJarrow, P., Gopal, P., Appl. Environ. Microbiol.2003, 69, 917–925.

[37] Ehrensberger, A., Wilson, D. K., Acta Cryst. 2003, D59, 375–377.

[38] Milner, J. L., McClellan, D. J., Wood, J. M., J. Gen. Microbiol.1987, 133, 1851–1869.

[39] De Angelis, M., Gobbetti, M., Proteomics 2004, 4, 106–122.

[40] Van Bogelen, R., Neidhardt, F. C., Proc. Natl. Acad. Sci. 1990,87, 5589–5593.

[41] Chen, H., Teplitski, M., Robison, J. B., Rolfe, B. G. et al., J.Bacteriol. 2003, 185, 5029–5036.

[42] De Angelis, M., Di Cagno, R., Huet, C., Crecchio, C. et al.,Appl. Environ. Microbiol. 2004, 70, 1336–1346.

[43] Di Cagno, R., De Angelis, M., Limitone, A., Fox, P. F. et al.,Appl. Environ. Microbiol. 2006, 72, 4503–4514.

[44] Adar, Y. Y., Simaan, M., Ulitzur, S., J. Bacteriol. 1992, 174,7138–7143.

[45] Wang, L., Li, J., March, J. C., Valdes, J. J. et al., J. Bacteriol.2005, 187, 8350–8360.

[46] Lerat, E., Moran, N. A., Mol. Microbiol. Evol. 2004, 21, 903–913.

[47] Schauder, S., Penna, L., Ritton, A., Manin, C. et al., J. Bac-teriol. 2005, 187, 392–395.

[48] James, C. E., Hasegawa, Y., Park, Y., Yeung, V. et al., Infect.Immun. 2006, 74, 3834–3844.

[49] Chen, X., Schauder, S., Poffer, N., Van Dorsselaer, A. et al.,Nature 2002, 415, 545–549.

[50] Slaughter, J. C., Biol. Rev. Camb. Philos. Soc. 1999, 74, 259–276.

[51] Xavier, K. B., Bassler, B. L., Nature 2005, 437, 750–753.

[52] Ndagijimana, M., Vallicelli, M., Cocconcelli, P. S., Cappa, F. etal., Appl. Environ. Microbiol. 2006, 72, 6053–6061.

[53] Winzer, K., Hardie, K. R., Burgess, N., Doherty, N. et al.,Microbiology 2002, 148, 909–922.


Documents

Cell–cell communication in sourdough lactic acid bacteria: A proteomic study inLactobacillus sanfranciscensis CB1