Adeno-associated virus vector serotypes mediate sustained correction of bilirubin UDP glucuronosyltransferase deficiency in rats

Adeno-associated Virus Vector Serotypes MediateSustained Correction of Bilirubin UDP

Glucuronosyltransferase Deficiency in Rats

Jurgen Seppen,1 Conny Bakker,1 Berry de Jong,1 Cindy Kunne,1 Karin van den Oever,1

Kristin Vandenberghe,1 Rudi de Waart,1 Jaap Twisk,2 and Piter Bosma1,*

1Academic Medical Center Liver Center, 1105 BK Amsterdam, The Netherlands2AMT BV, 1105 BA Amsterdam, The Netherlands

*To whom correspondence and reprint requests should be addressed at Academic Medical Center Liver Center, S1-166, Meibergdreef 69,

1105 BK Amsterdam, The Netherlands. Fax: +31205669190. E-mail: [email protected].

Available online 3 April 2006

Crigler–Najjar (CN) patients have no bilirubin UDP glucuronosyltransferase (UGT1A1) activity andsuffer brain damage because of bilirubin toxicity. Vectors based on adeno-associated virus (AAV)serotype 2 transduce liver cells with relatively low efficiency. Recently, AAV serotypes 1, 6, and 8have been shown to be more efficient for liver cell transduction. We compared AAV serotypes 1, 2, 6,and 8 for correction of UGT1A1 deficiency in the Gunn rat model of CN disease. Adult Gunn ratswere injected with CMV-UGT1A1 AAV vectors. Serum bilirubin was decreased over the first year by64% for AAV1, 16% for AAV2, 25% for AAV6, and 35% for AAV8. Antibodies to UGT1A1 weredetected after injection of all AAV serotypes. An AAV1 UGT1A1 vector with the liver-specific albuminpromoter corrected serum bilirubin levels but did not induce UGT1A1 antibodies. Two years afterinjection of AAV vectors all animals had large lipid deposits in the liver. These lipid deposits were notseen in age-matched control animals. AAV1 vectors are promising candidates for CN gene therapybecause they can mediate a reduction in serum bilirubin levels in Gunn rats that would betherapeutic in humans.

Key Words: AAV, liver, gene therapy, Crigler–Najjar, Gunn rat

INTRODUCTION

The majority of inherited liver diseases can be cured onlyby liver transplantation. Because these disorders areusually caused by a single gene defect, gene therapy is amuch more attractive treatment. A good model system tostudy gene therapy for inherited liver diseases is thedeficiency in bilirubin metabolism of Crigler–Najjar type1 (CN) patients.

Bilirubin is the breakdown product of the heme groupof hemoglobin and other heme-utilizing enzymes such ascytochrome P450s. Because bilirubin is hydrophobic, itneeds to be glucuronidated by the hepatic enzymebilirubin UDP glucuronosyltransferase (UGT1A1) beforeit can be excreted into bile [1,2]. Patients with CN type 1have no detectable UGT1A1 activity [3] and thereforehave high serum levels of unconjugated bilirubin.Because unconjugated bilirubin is highly neurotoxic [4],UGT1A1 deficiency leads to brain damage and death ifnot treated. The only permanent treatment option forpatients with CN is liver transplantation. The Gunn rat is

a natural mutant that has no UGT1A1 activity and istherefore a good model for CN and the development ofgene therapy for this disease [5].

A number of gene therapy studies have achievedcorrection of UGT1A1 deficiency in Gunn rats. NakedDNA gene transfer [6], genetically modified fibroblasts[7], and viral vectors based on SV40 [8], adenovirus [9–11], murine retrovirus [12,13], and lentivirus [14,15] havebeen used to correct the high serum bilirubin levels inGunn rats. However, the only gene therapy vectors thathave shown promise in a clinical trial of a liver deficiencyare based on adeno-associated virus (AAV) [16,17]. Thevectors used in these clinical trials are based on AAVserotype 2 and although these vectors have been shownto be safe and well tolerated [16], a drawback is theirrelative inefficiency for liver gene transfer. Studies inmice have shown that, even at high vector doses, AAV2can transduce maximally 5–10% of hepatocytes [18].More recently, the identification of novel AAV serotypesmade it possible to construct AAV vectors with improved

ARTICLEdoi:10.1016/j.ymthe.2006.01.014

MOLECULAR THERAPY Vol. 13, No. 6, June 2006 1085Copyright C The American Society of Gene Therapy

1525-0016/$30.00

mailto:[email protected]

http://dx.doi.org/10.1016/ j.ymthe.2006.01.014

transduction properties. Of these novel serotypes, AAV1[19], AAV6 [20], and AAV8 [21] have been described asbeing more efficient for liver gene transfer [22–25] inmice. The aim of this study was to evaluate the efficiencyof these different AAV serotypes in the Gunn rat model ofthe human metabolic liver deficiency CN.

RESULTS

Construction of AAV VectorsWe constructed an AAV vector in which the UGT1A1cDNA was under control of the CMV promoter, CMV-UGT1A1. This vector also includes the woodchuckhepatitis PRE, which has been shown to increaseexpression levels in AAV vectors [26]. We constructeda liver-specific AAV vector (ALB-UGT1A1) by using thealbumin promoter enhancer region [27] to driveUGT1A1 expression.

Recombinant AAV particles were made with Rep fromAAV2 and Cap from serotypes 1, 2, 6, and 8. With ALB-UGT1A1 we generated only the AAV serotype 1. In this

paper we designate the different AAV serotypes by theorigin of their Cap genes only. To confirm the generationof infectious AAV particles, we used the different sero-types to transduce 293T cells and a hepatoma cell line,HepG2, which has no endogenous UGT1A1 activity.After infection with adenovirus, we harvested the cellsand confirmed expression of UGT1A1 by immunohisto-chemistry and Western blotting (not shown).

Correction of Serum Bilirubin LevelsInjection of all UGT1A1 AAV pseudotypes lowered serumbilirubin levels (Fig. 1). To be able to determine accu-rately the relative efficiencies of the different CMV-UGT1A1 AAV serotypes we compared the average serumbilirubin levels over periods of 1 to 26, 27 to 54, and 55 to82 weeks after injection. We used analysis of varianceusing a mixed linear model to determine statisticalsignificances. This analysis showed that AAV1 is the mostefficient, followed by AAV8, AAV6, and AAV2 (Table 1).All AAV serotypes lowered serum bilirubin levels signifi-cantly for at least 26 weeks (Table 1).

FIG. 1. Correction of serum bilirubin by injection of AAV vectors. Male Gunn rats were injected with CMV-UGT1A1 vectors and serum bilirubin was measured.

Dashed lines in each graph represent the same group of control or sham-operated rats, N = 14. The solid lines show the serum bilirubin concentrations of animals

injected with the indicated AAV serotypes. Each AAV-treated group consisted of five animals up to 1 year, later time points are from fewer than five animals. All

serotypes lowered serum bilirubin significantly over this period. Data shown are mean and standard deviation per time point.

ARTICLE doi:10.1016/j.ymthe.2006.01.014

MOLECULAR THERAPY Vol. 13, No. 6, June 20061086Copyright C The American Society of Gene Therapy

A significant reduction in serum bilirubin was sus-tained for up to 82 weeks with CMV-UGT1A1 AAV1 andAAV8. Rats injected with AAV6 were followed for only 54weeks. Serum bilirubin levels of control rats increased intime and this trend was also observed in the AAV-treatedrats. However, in AAV2- and AAV8-treated rats themagnitude of the therapeutic effect decreased at the latertime points, with loss of significance for AAV2 at 27weeks (Fig. 1, Table 1).

Biodistribution of AAV Gene TransferWe determined AAV vector distribution by isolation ofhigh-molecular-weight DNA and PCR to detect specifi-cally the human UGT1A1 sequence (Fig. 2). As expected,

we observed the most intense band in liver for allserotypes. Because spleen also gave a strong signal withall serotypes except AAV6, we analyzed DNA from liverand spleen further by quantitative real-time PCR.

AAV1 and AAV6 gave widespread transduction with apositive signal detected in most organs. Interestingly,AAV2 and AAV8 seem to be more specific, with thehighest gene transfer observed in liver and spleen and, inthe case of AAV2, duodenum.

Quantitative Determination of AAV Gene Transfer byPCRWe determined the transduction efficiency of liver andspleen by detection of the AAV vector by quantitativereal-time PCR in genomic DNA from these tissues. Theresults are averages of tissues from four animals andsummarized in Table 2. Values shown are AAV copiespresent per haploid genome. AAV1-transduced liverhad the highest number of viral genomes per cell,which correlates well with this serotype also being themost efficient for the correction of UGT1A1 deficiency.AAV2 and AAV6 had the least amount of viralgenomes per cell, which agrees with the inefficientcorrection of hyperbilirubinemia observed with theseserotypes.

Transduction of spleen by AAV vectors was similar forall serotypes but at least 1 order of magnitude lower thantransduction of liver.

Bile Analysis Confirms Functional UGT1A1 GeneTransferWe collected bile from Gunn rats injected with the AAVUGT1A1 serotypes 12 months after injection of AAV6

TABLE 1: Reduction in serum bilirubin in Gunn rats by AAV UGT1A1 gene transfer

Serum bilirubin, P value versus control rats

1 to 26 weeks 27 to 54 weeks 55 to 82 weeks

Control rats 113 F 27 AM 120 F 24 AM 131 F 17 AM

AAV1 33 F 12 AM, P b 0.001 52 F 15 AM, P b 0.001 66 F 10 AM, P b 0.001

AAV2 89 F 18 AM, P = 0.015 106 F 19 AM, P = 0.094 131 F 27 AM, P = 0.480

AAV6 82 F 23 AM, P = 0.003 88 F 17 AM, P = 0.001 ND

AAV8 69 F 23 AM, P b 0.001 88 F 20 AM, P = 0.001 107 F 18 AM, P = 0.004

Average serum bilirubin was calculated over periods of 1 to 26, 27 to 54, and 55 to 82 weeks after injection. Each AAV-treated group consisted of five animals until 1 year, later time points

are from fewer than five animals. A mixed linear model analysis of variance was used to calculate P values. ND, not determined.

FIG. 2. Biodistribution of AAV-mediated UGT1A1 gene transfer. High-

molecular-weight DNA was isolated between 14 and 20 months after

administration of AAV vectors for serotypes 1, 2, and 8 and at 12 months

for serotype 6. DNA samples were analyzed for the presence of human

UGT1A1 sequence by PCR as described. As loading control endogenous

GAPDH was amplified. M, marker; Li, liver; Lu, lung; Ki, kidney; Sp, spleen; St,

stomach; Du, duodenum; Il, ileum; Je, jejunum; Co, colon; Pa, pancreas; He,

heart; Mu, skeletal muscle; Te, testis; Th, thymus; Br, brain.

TABLE 2: Quantitative PCR determination of AAV genetransfer in liver and spleen

Serotype Liver Spleen

AAV-1 1.5 F 1 3.0 F 3 � 10�3

AAV-2 0.069 F 0.05 14 F 30 � 10�3

AAV-6 0.046 F 0.03 0.028 F 0.01 � 10�3

AAV-8 0.23 F 0.7 12 F 20 � 10�3

The number of AAV vector copies per haploid genome as determined by quantitative real-

time PCR is shown. Values are averages of four animals.



and 14 to 22 months after injection of AAV1, AAV2, andAAV8 and analyzed it for the presence of bilirubinglucuronides by reverse-phase HPLC. Bilirubin glucuro-

nides were detected in bile of all AAV-treated animalsand were absent in control rat bile (Fig. 3). This showsthat functional UGT1A1 is expressed after injection of allAAV serotype UGT1A1 vectors. The reduction of serumbilirubin by AAV2 vectors was modest but the presenceof small amounts of bilirubin glucuronides in bile fromthese animals confirms functional UGT1A1 expressionby AAV2.

Histological Demonstration of AAV-Mediated GeneTransfer to the LiverAs described before [14], we were not successful indetecting UGT1A1 by immunohistochemistry in Gunnrats. We therefore injected Gunn rats with GFP AAVvectors to be able to demonstrate histologically AAVgene transfer (Fig. 4). Most of the GFP-positive cells werehepatocytes, as determined by their characteristic mor-phology. GFP-positive hepatocytes were detected inlivers from rats injected with all AAV serotypes. Asexpected, the GFP-positive hepatocytes were most abun-dant in the AAV1-injected animals. However, the num-ber of transduced hepatocytes was low. Counting of

FIG. 3. HPLC analysis of bilirubin glucuronides in bile. Bile was collected and

analyzed for the presence of bilirubin glucuronides. HPLC traces of represen-

tative bile samples from AAV 1, 2, 6, and 8 are shown. For comparison, a trace

from an untreated control Gunn rat is also shown. BDG, bilirubin diglucur-

onide; BMG, bilirubin monoglucuronide; UCB, unconjugated bilirubin.

Bilirubin glucuronides are present only in bile from rats injected with CMV

AAV vectors. Bile from control rats contains only unconjugated bilirubin.

FIG. 4. Histological demonstration of AAV gene

transfer in liver. Gunn rats were injected with GFP

AAV vectors and GFP was detected by immunohisto-

chemistry. The different images show that GFP-

positive hepatocytes (darkly stained cells) are present

in animals injected with all AAV serotypes. Sections

from AAV-injected rat livers are shown at original

magnification of 10�. To show accurately the specif-

icity of the staining, a section of an untreated control

rat liver is shown at original magnification of 5�.



three random fields of hepatocytes revealed that thepercentage of transduced hepatocytes with all AAVserotypes was below 1%.

Immune Response to UGT1A1Because we have observed that UGT1A1 antibodies weregenerated after lentiviral UGT1A1 gene transfer [28], weinvestigated whether AAV gene transfer also induced animmune response to UGT1A1. Using an ELISA, wedetected antibodies to UGT1A1 in animals injected withall serotypes of AAV CMV-UGT1A1 (Fig. 5). We confirmedthe specificity of the UGT1A1 antibodies by Westernblotting (not shown). To investigate the mechanism ofthe immune response to UGT1A1, we constructed anAAV1 UGT1A1 vector in which the liver-specific albuminpromoter was driving UGT1A1 expression (ALB-UGT1A1).ALB-UGT1A1 also corrected serum bilirubin levels (Fig. 5).However, animals injected with this vector did notdevelop antibodies to UGT1A1 (Fig. 5). In this figure theimmune response to AAV1 vectors is shown but the titersof antibodies to UGT1A1 that developed after injection ofAAV serotypes 2, 6, and 8 were similar (not shown).

Histology of Gunn Rat LiversTwo years after the start of the experiment, we sacrificedthe animals. Autopsies revealed the presence of largewhite nodules on the livers of all AAV-injected animals(Fig. 6A). Although age-matched sham-operated oruntreated control rats have areas of fatty liver, the largenodules seen in the AAV-treated animals were absent.Histology on paraffin-embedded tissue showed that thesenodules were large structures resembling fat deposits (Fig.6C). Oil Red O staining on cryosections confirmed thatthese nodules are indeed lipid deposits (Figs. 6E and 6F).The lesions contained nuclei but these did not show anabnormal amount of metaphases. In contrast, a control

rat with a spontaneous liver tumor is shown in Fig. 6D. Inthis section numerous metaphases were seen, indicatingactively proliferating tissue. We isolated high-molecular-weight DNA from the lipid lesions to investigate whetherintegrated AAV sequences were responsible for thegeneration of these structures. PCR analysis of the DNAfailed to detect AAV sequences in DNA obtained from thelipid deposits (not shown).

DISCUSSION

We have shown that AAV1 vectors are more efficient forthe correction of the UGT1A1 deficiency in the Gunn ratthan AAV2, 6, and 8. Several reports document that AAVserotypes other than 2 are more efficient for the trans-duction of hepatocytes. The most efficient serotype formurine liver transduction seems to be AAV8, as a recentstudy documents that AAV8 transduction is not restrictedin mouse liver. Vectors based on AAV8 were able totransduce complete murine livers, an efficiency notobtained with any other serotype [24]. However, we findthat, in rats, AAV1 is the most efficient serotype. AAV2transduction of rat liver is relatively inefficient; injectionof 5 � 1012 AAV genomes per kilogram resulted in anaverage copy number of 0.069 vector copies per haploidgenome. These results are in agreement with an earlierstudy in which a similar AAV2 transduction efficiencywas obtained in rat liver [29].

The number of AAV genomes per cell exceeds thepercentage of transduced cells that we detected bycounting positive cells in immunohistochemistry oftransduced livers. This discrepancy is explained by theproperty of AAV vectors to form large concatemers ofviral copies after a productive transduction event [30].

Our study confirms that AAV serotypes other than 2are more efficient for liver gene transfer. Tropism of AAV

FIG. 5. Use of a liver-specific promoter abrogates immune response to UGT1A1. Male Gunn rats were injected with CMV-UGT1A1 and ALB-UGT1A1 vectors.

Serum bilirubin and antibody titers were measured as described. Both AAV1 ALB-UGT1A1 (N = 2) and CMV-UGT1A1 (N = 5) reduce serum bilirubin levels in

Gunn rats as shown on the left. The dashed line represents control animals (N = 14). On the right, titrations of sera from ALB-UGT1A1- (N = 2) and CMV-

UGT1A1- (N = 2) injected animals are shown. A strong immunoreactivity is seen in sera from CMV-UGT1A1-injected animals only. AAV1 ALB UGT1A1

administration did not lead to the formation of UGT antibodies. Titrations of sera 10 and 17 weeks after administration of AAV vector are shown.



vector serotypes in rats seems to be different from that inmice since in our experiments AAV1 performs better thanAAV8, which contrasts with the superior performance ofAAV8 in mice [24]. Thus, since two closely related speciesshow such distinct AAV tropisms, our findings under-score the importance of testing the efficiency of differentAAV serotypes in human hepatocytes before startingclinical trials.

In all animals injected with CMV-UGT1A1 vectors,antibodies to UGT1A1 were observed. The formation ofUGT1A1 antibodies could be completely blocked by theuse of an AAV vector (ALB-UGT1A1) with a liver-specificpromoter. The most straightforward explanation of theseresults is that this immune response is caused by thetransduction of antigen-presenting cells by the AAVvectors. An alternative but more unlikely mechanismfor the generation of an immune response to UGT1A1would be the transduction of nonhepatic cells with AAVvectors, which subsequently cross present UGT1A1 frag-ments to professional antigen-presenting cells. Becauseall AAV serotypes tested induced an immune responsetoward UGT1A1 it is likely they have comparable trop-

isms for hematopoietic (antigen-presenting) cells. In-deed, quantitative PCR analysis showed that portal veinadministration of AAV serotypes 1, 2, 6, and 8 resulted inequal levels of transduction to splenic cells.

It is possible that the immune response to UGT1A1 isthe cause of the decline in therapeutic effect we observedin AAV2- and AAV8-treated animals. However, we feelthat this is not very likely because a humoral responsedoes not usually affect expression of an intracellularprotein such as UGT1A1. Furthermore, treatment ofGunn rats with ALB-UGT1A1 did not lead to theformation of antibodies but the therapeutic effect inthese animals also slowly declined. In a previous study inwhich UGT1A1 lentiviral vectors were introduced in fetalGunn rats, we also observed high titers of UGT1A1antibodies, which did not preclude a long-term thera-peutic effect [28].

Large macroscopic lipid lesions were observed in allAAV-treated animals. Tumorigenesis induced by AAVvectors is a controversial issue. An initial report docu-mented a high incidence of hepatocellular carcinomas inAAV-injected mice [31]. However, a large study of 695

FIG. 6. Liver histology 2 years after AAV vector

administration. Gunn rats were sacrificed 2 years after

the start of the experiment and tissues were processed

for immunohistochemistry. (A) A macroscopic image

of the left median lobes from two sham-operated

control rats and AAV1-, 2-, and 8-injected animals. On

the surface of the AAV-injected rat livers large white

spots can be seen. These spots are absent from the

age-matched control livers. (B and C) Hematoxylin/

phloxin staining of sham-operated control and AAV1-

injected rat livers, respectively. A large lesion can be

seen in the liver from the AAV1-injected rat. (D) A

spontaneous liver tumor in an untreated control rat. (E

and F) Oil red O staining of livers from control and

AAV1-injected rats, respectively. The strong red stain-

ing in the liver from the AAV1-injected rat identifies

the lesions as fatty deposits.



mice injected with AAV vectors did not reveal anincreased incidence of tumors compared to control mice[32]. Interestingly, the one AAV-treated animal with aliver tumor in this study developed a lipoma [32]. We didnot observe any hepatocellular carcinomas in our AAV-injected rats. The nature of the lipid deposits observed inour experimental animals is uncertain; they did notcontain abnormal amounts of dividing cells and wererelatively small, which suggests that they might not bemalignant. No AAV sequences were detected in thelesions which argues against a role for AAV in thegeneration of these structures. However, age-matched,sham-operated, control rats did contain areas of fattyliver but none of the large macroscopic fat deposits thatwere seen in the treated animals. At this point we do notknow whether AAV vectors in general, our method ofAAV vector preparation, or the transgene is responsiblefor the formation of the lipid deposits. Because the lipidlesions were associated with AAV vector administration,additional studies must be performed to determinewhether this phenomenon is restricted to our exper-imental setup.

We have shown that AAV1 vectors are more efficientfor the transduction of rat hepatocytes in vivo than AAV2,6, or 8. The level of UGT1A1 correction obtained in ourstudy would be therapeutic in humans and our resultstherefore warrant the development of AAV gene therapyfor the treatment of Crigler–Najjar disease.

MATERIALS AND METHODS

Construction and production of AAV vectors. An AAV vector with the

CMV promoter driving UGT1A1 expression was constructed by cloning

the UGT1A1 cDNA into the pTRCGW AAV vector backbone [33]. The

inclusion of the woodchuck hepatitis virus posttranscriptional regulatory

element in this vector ensures high expression levels. Control GFP

expression vectors were also based on the pTRCGW backbone.

To generate AAV with the liver-specific albumin promoter enhancer

[27] driving UGT1A1 expression, UGT1A1 was inserted after the albumin

promoter enhancer. This expression cassette was subsequently inserted

into an AAV vector backbone with a SV40 polyadenylation signal [34].

Recombinant AAV was produced with AAV2 Rep and pseudotyped

with capsids from AAV serotypes 1, 2, 6, and 8. The different AAV vectors

are designated throughout this paper by the serotype of their capsid only.

AAV1, 2, and 6 vectors were produced by transient transfection of the

packaging constructs pDF1, 2, and 6 [35] and the AAV vector into 293T

cells. AAV8 vectors were produced by transient transfection as described

[21]. The average yields of the AAV serotypes were similar, between 3 �

1011 and 9 � 1011 genome copies per plate.

AAV vector particles were purified by iodixanol gradient centrifuga-

tion as described [36].

Titration of AAV vectors was performed by quantitative PCR as

described below. Average titers (genome copies/ml) of AAV vectors were

5.3 � 1012 for AAV1, 4.5 � 1012 for AAV2, 5.4 � 1012 for AAV6, and 19 �

1012 for AAV8. For this study two or three different virus preparations

were made per AAV serotype.

Qualitative and quantitative PCR. High-molecular-weight DNA from

tissues and DNA from AAV vector preparations was isolated using

proteinaseKdigestionasdescribed [37]. Inall PCRs,250ngofDNAwasused.

Qualitative PCR to determine the biodistribution of the AAV vectors

was performed with primers specific for human UGT1A1 that did not

amplify rat UGT1A1: forward, TTCAGAGGACGTGCAGACAG; reverse,

CAAGGTGGCACCTATGAAGC.

Quantitative real-time PCR to determine transduction efficiency of rat

tissue was performed on an ABI Prism 7000 using SYBR green to detect the

amplification products. Primers were directed toward the CMV promoter:

forward, ATGGGCGGTAGGCGTGTA; reverse, AGGCGATCTGACGGTT-

CACTAA. Sensitivity of this assay was 10 copies per reaction. Quantitative

real-time PCR to determine AAV vector titer was performed on a Roche

LightCycler using SYBR green detection. Primers directed at UGT1A1 were

used: forward, TACACTGGAACCCGACCATC; reverse, AACAAGGGCAT-

CATCACCA.

Standard curves for real-time PCR were constructed by using dilutions

of AAV vector DNA.

Animal experiments. Gunn rats from our own breeding colony were

used for all experiments and fed ad libitum. All animal experiments

were performed in accordance with the Animal Ethical Committee

guidelines of the Academic Medical Center of Amsterdam. Male Gunn

rats, 6 to 8 weeks of age, 150 to 200 g, were used for all experiments.

Each experimental group consisted of five animals. Rats were anes-

thetized with an intraperitoneal injection of KAR mix: 4 ml ketamine

(100 mg/ml), 2 ml Rompun (xylazine; 20 mg/ml), 1 ml atropine (1 mg/

ml); dose of 0.1 ml/100 g body wt. Under deep anesthesia, the

peritoneal cavity was opened and the rats were injected intraportally,

using a 30-gauge needle, with AAV vector resuspended in a maximum

volume of 500 Al. All animals received a dose of 2.5–5 � 1012 AAV

vector genomes per kilogram. The animals were sutured and received

the analgesic Temgesic subcutaneously following recovery from KAR

mix. Control animals were either sham operated (opening of the

peritoneal cavity and preparation of the portal vein) or untreated. For

bile collection, rats were anesthetized by intraperitoneal injection of

KAR mix as above and bile was collected by cannulation of the bile

duct as described [14].

Blood was collected by tail vein puncture under gas anesthesia in

pediatric heparin tubes.

Histology. GFP was detected by immunohistochemistry as described [14].

Hematoxylin and azaphloxin staining was performed on formaldehyde

and Paraplast-embedded tissue sections as described [14]. Oil red O

staining was performed on formaldehyde-fixed cryosections as described

[38].

ELISA for UGT1A1 antibodies. UGT1A1 and GFP were expressed in 293T

cells by calcium phosphate coprecipitation. Expression of UGT1A1 was

confirmed by Western blotting and GFP expression was confirmed by

fluorescence microscopy. The cells were harvested with 5 mM EDTA in

PBS, concentrated by centrifugation, and lysed by sonication. Protein was

determined by Bio-Rad Bradford assay.

ELISA plates (Nunc) were coated overnight with 5 Ag cellular protein

per well in 96-well plates in 50 mM carbonate buffer, pH 9.6. The wells

were blocked with 1% gelatin in phosphate-buffered saline, washed, and

incubated with serial dilutions of Gunn rat plasma. After being washed

the bound Gunn rat immunoglobulins were detected with anti-rat IgG

peroxidase (Nordic) and o-phenylenediamine tablets (Sigma). Color

development was measured at 490 nm in an ELISA reader. ELISAs were

always performed in duplicate with the same samples applied on

UGT1A1- and GFP-coated plates. The staining in the GFP plate was

subtracted from the staining in the UGT1A1 plate to correct for

background binding.

Bilirubin quantification. Unconjugated bilirubin and bilirubin conju-

gates in bile were analyzed and quantified by HPLC as described [7] with

the modification that an Omnisphere column (Varian, The Netherlands)

was used. Bilirubin in serum was quantified by the hospital Routine

Clinical Chemistry Department.

Statistics. Average serum bilirubin levels and standard deviations per

treatment group were calculated for every time point during 1 year. A

mixed linear model analysis of variance (SPSS version 11.5) was used to

test the differences between the treatment groups.



ACKNOWLEDGMENTS

We thank Dr. Jan Ruijter for help with the statistical analysis and Lizzy Comijn

and Sanne Derks of Amsterdam Molecular Therapeutics for producing AAV-GFP

batches and for performing Q-PCR analysis of tissue samples. Dr. J.

Kleinschmidt of the Deutsches Krebsforschungszentrum is acknowledged for

providing the production systems for AAV-1, 2, and 6. Dr. J. M. Wilson and the

Vector Core Facility of the University of Pennsylvania are acknowledged for

providing the AAV-8 production system. This research was made possible by

grants from the Dutch Crigler–Najjar Foundation and the Dutch Organization

for Scientific Research (NWO) (016.026.012).

RECEIVED FOR PUBLICATION NOVEMBER 16, 2005; REVISED JANUARY 25,

2006; ACCEPTED JANUARY 26, 2006.

REFERENCES1. Ostrow, J. D., Mukerjee, P., and Tiribelli, C. (1994). Structure and binding of

unconjugated bilirubin: relevance for physiological and pathophysiological function.

J. Lipid Res. 35: 1715 –1737.

2. Tukey, R. H., and Strassburg, C. P. (2000). Human UDP-glucuronosyltransferases:

metabolism, expression, and disease. Annu. Rev. Pharmacol. Toxicol. 40: 581 – 616.

3. Jansen, P. L. (1999). Diagnosis and management of Crigler–Najjar syndrome. Eur. J.

Pediatr. 158(Suppl. 2): S89 – S94.

4. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2002). Mechanisms of bilirubin neuro-

toxicity. Hepatology 35: 1277– 1280.

5. Chowdhury, J. R., Kondapalli, R., and Chowdhury, N. R. (1993). Gunn rat: a model

for inherited deficiency of bilirubin glucuronidation. Adv. Vet. Sci. Comp. Med. 37:

149 –173.

6. Danko, I., Jia, Z., and Zhang, G. F. (2004). Nonviral gene transfer into liver and muscle

for treatment of hyperbilirubinemia in the Gunn rat. Hum. Gene Ther. 15: 1279 –1286.

7. Seppen, J., et al. (1997). Transplantation of Gunn rats with autologous fibroblasts

expressing bilirubin UDP-glucuronosyltransferase: correction of genetic deficiency and

tumor formation. Hum. Gene Ther. 8: 27 –36.

8. Sauter, B. V., et al. (2000). A replication-deficient rSV40 mediates liver-directed gene

transfer and a long-term amelioration of jaundice in Gunn rats. Gastroenterology 119:

1348– 1357.

9. Askari, F. K., Hitomi, Y., Mao, M., and Wilson, J. M. (1996). Complete correction of

hyperbilirubinemia in the Gunn rat model of Crigler–Najjar syndrome type I following

transient in vivo adenovirus-mediated expression of human bilirubin UDP-glucurono-

syltransferase. Gene Ther. 3: 381 –388.

10. Takahashi, M., Ilan, Y., Chowdhury, N. R., Guida, J., Horwitz, M., and Chowdhury, J. R.

(1996). Long term correction of bilirubin–UDP-glucuronosyltransferase deficiency in

Gunn rats by administration of a recombinant adenovirus during the neonatal period.

J. Biol. Chem. 271: 26536 – 26542.

11. Toietta, G., et al. (2005). Lifelong elimination of hyperbilirubinemia in the Gunn rat

with a single injection of helper-dependent adenoviral vector. Proc. Natl. Acad. Sci. USA

102: 3930 –3935.

12. Bellodi-Privato, M., Aubert, D., Pichard, V., Myara, A., Trivin, F., and Ferry, N. (2005).

Successful gene therapy of the Gunn rat by in vivo neonatal hepatic gene transfer using

murine oncoretroviral vectors. Hepatology 42: 431 –438.

13. Tada, K., et al. (1998). Long-term reduction of serum bilirubin levels in Gunn rats by

retroviral gene transfer in vivo. Liver Transplant. Surg. 4: 78 –88.

14. Seppen, J., van der Rijt, R., Looije, N., van Til, N. P., Lamers, W. H., and Oude, R. P.

(2003). Elferink, Long-term correction of bilirubin UDPglucuronyltransferase deficiency

in rats by in utero lentiviral gene transfer. Mol. Ther. 8: 593 –599.

15. Nguyen, T. H., et al. (2005). Therapeutic lentivirus-mediated neonatal in vivo gene

therapy in hyperbilirubinemic Gunn rats. Mol. Ther. 12: 852 –859.

16. Carter, B. J. (2005). Adeno-associated virus vectors in clinical trials. Hum. Gene Ther. 16:

541 –550.

17. Kay, M. A., et al. (2000). Evidence for gene transfer and expression of factor IX in

haemophilia B patients treated with an AAV vector. Nat. Genet. 24: 257 –261.

18. Nakai, H., et al. (2002). A limited number of transducible hepatocytes restricts a wide-

range linear vector dose response in recombinant adeno-associated virus-mediated

liver transduction. J. Virol. 76: 11343 –11349.

19. Xiao, W. D., Chirmule, N., Berta, S. C., McCullough, B., Gao, G. P., and Wilson, J. M.

(1999). Gene therapy vectors based on adeno-associated virus type 1. J. Virol. 73:

3994 –4003.

20. Rutledge, E. A., Halbert, C. L., and Russell, D. W. (1998). Infectious clones and vectors

derived from adeno-associated virus (AAV) serotypes other than AAV type 2. J. Virol. 72:

309 –319.

21. Gao, G. P., Alvira, M. R., Wang, L. L., Calcedo, R., Johnston, J., and Wilson, J. M. (2002).

Novel adeno-associated viruses from rhesus monkeys as vectors for human gene

therapy. Proc. Natl. Acad. Sci. USA 99: 11854 –11859.

22. Davidoff, A. M., et al. (2005). Comparison of the ability of adeno-associated viral

vectors pseudotyped with serotype 2, 5, and 8 capsid proteins to mediate efficient

transduction of the liver in murine and nonhuman primate models. Mol. Ther. 11:

875 –888.

23. Grimm, D., et al. (2003). Preclinical in vivo evaluation of pseudotyped adeno-

associated virus vectors for liver gene therapy. Blood 102: 2412 –2419.

24. Nakai, H., Fuess, S., Storm, T. A., Muramatsu, S., Nara, Y., and Kay, M. A. (2005).

Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in

mice. J. Virol. 79: 214 –224.

25. Rabinowitz, J. E., et al. (2002). Cross-packaging of a single adeno-associated virus (AAV)

type 2 vector genome into multiple AAV serotypes enables transduction with broad

specificity. J. Virol. 76: 791 –801.

26. Loeb, J. E., Cordier, W. S., Harris, M. E., Weitzman, M. D., and Hope, T. J. (1999).

Enhanced expression of transgenes from adeno-associated virus vectors with the

woodchuck hepatitis virus posttranscriptional regulatory element: implications for gene

therapy. Hum. Gene Ther. 10: 2295–2305.

27. Pinkert, C. A., Ornitz, D. M., Brinster, R. L., and Palmiter, R. D. (1987). An albumin

enhancer located 10 kb upstream functions along with its promoter to direct efficient,

liver-specific expression in transgenic mice. Genes Dev. 1: 268 –276.

28. Seppen, J., van Til, N.P., van der Rijt, R., Hiralall, J.K., Kunne, C., and Oude-Elferink,

R.P.J. (2006). Immune response to lentiviral bilirubin UDP-glucuronosyltransferase

gene transfer in fetal and neonatal rats. Gene Ther., (electronic publication ahead of

print).

29. Ohashi, K., Nakai, H., Couto, L. B., and Kay, M. A. (2005). Modified infusion

procedures affect recombinant adeno-associated virus vector type 2 transduction in the

liver. Hum. Gene Ther. 16: 299 –306.

30. Vincent-Lacaze, N., Snyder, R. O., Gluzman, R., Bohl, D., Lagarde, C., and Danos, O.

(1999). Structure of adeno-associated virus vector DNA following transduction of the

skeletal muscle. J. Virol. 73: 1949 –1955.

31. Donsante, A., et al. (2001). Observed incidence of tumorigenesis in long-term rodent

studies of rAAV vectors. Gene Ther. 8: 1343 –1346.

32. Bell, P., et al. (2005). No evidence for tumorigenesis of AAV vectors in a large-scale

study in mice. Mol. Ther. 12: 299 – 306.

33. Ross, C. J., et al. (2004). Long-term correction of murine lipoprotein lipase deficiency

with AAV1-mediated gene transfer of the naturally occurring LPL(S447X) beneficial

mutation. Hum. Gene Ther. 15: 906 –919.

34. Schimmenti, S., Boesen, J., Claassen, E. A., Valerio, D., and Einerhand, M. P. (1998).

Long-term genetic modification of rhesus monkey hematopoietic cells following

transplantation of adenoassociated virus vector-transduced CD34+ cells. Hum. Gene

Ther. 9: 2727 –2734.

35. Grimm, D., Kay, M. A., and Kleinschmidt, J. A. (2003). Helper virus-free, optically

controllable, and two-plasmid-based production of adeno-associated virus vectors of

serotypes 1 to 6. Mol. Ther. 7: 839 –850.

36. Hermens, W. T., et al. (1999). Purification of recombinant adeno-associated virus by

iodixanol gradient ultracentrifugation allows rapid and reproducible preparation of

vector stocks for gene transfer in the nervous system. Hum. Gene Ther. 10: 1885 –1891.

37. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989). Molecular Cloning: A Laboratory

Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

38. Koopman, R., Schaart, G., and Hesselink, M. K. (2001). Optimisation of oil red O

staining permits combination with immunofluorescence and automated quantification

of lipids. Histochem. Cell Biol. 116: 63 – 68.



Documents

Adeno-associated virus vector serotypes mediate sustained correction of bilirubin UDP glucuronosyltransferase deficiency in rats