View
92
Download
0
Category
Tags:
Preview:
DESCRIPTION
Lab Testing Standardization - Mr. Jeff Baxter, Dr. Ivan Leyva-Baca, Life Technologies, from the 2014 NIAA Annual Conference titled 'The Precautionary Principle: How Agriculture Will Thrive', March 31 - April 2, 2014, Omaha, NE, USA. More presentations at http://www.trufflemedia.com/agmedia/conference/2014_niaa_how_animal_agriculture_will_thrive
Citation preview
1Proprietary & Confidential
Trich Laboratory Testing StandardizationTrichomonas foetus DNA testing
Proper & Confidential
2Proprietary & Confidential
ObjectivesTo build confidence in Trich testingTo increase consistency in test resultsTo minimize sample quality influence variablesTo minimize laboratory testing variablesTo reduce the burden and cost to man and beast
Trich Laboratory Testing Standardization
Proper & Confidential
3Proprietary & Confidential
OpportunitiesVeterinarian sample collectionVeterinarian sample handling & shipment recommended by
LaboratoryLaboratory sample preparation methodLaboratory extract volume usedLaboratory Taq enzyme type usedLaboratory analysis threshold levelLaboratory use of IPC (Internal Positive Control)Laboratory use of USDA licensed kits Laboratory pooling of samples
Trich Laboratory Testing Standardization
Proper & Confidential
4Proprietary & ConfidentialThe world leader in serving scienceProprietary & Confidential
Pooling of cultured samples and comparison of multistate laboratory workflows with the MagMAX sample preparation system and VetMAX quantitative polymerase chain reaction reagents for detection of Tritrichomonas foetus–colonized bullsLee EffingerLalitha PeddireddiMarilyn SimunichRichard OberstCatherine O’ConnellIvan Leyva-Baca
Oregon Department of Agriculture, Animal Health and Identification Division, Animal Health Laboratory, Salem, OR (Effinger) Department of Diagnostic Medicine/Pathobiology (Peddireddi), Kansas State University, Manhattan, KS Kansas State Veterinary Diagnostic Laboratory (Oberst), Kansas State University, Manhattan, KS Animal Health Laboratory, Idaho State Department of Agriculture, Boise, ID (Simunich) Animal Health and Food Safety Group at Life Technologies, Austin, TX (Leyva-Baca, O’Connell)
JVDI, 2014, Vol. 26(1) 72-87
Proper & Confidential
5Proprietary & Confidential
Study Background
2010 AAVLD parasitology committee
• Proposed a study to determine whether T. foetus samples can be pooled in order to reduce the costs for testing
• Lee Effinger from Oregon State Department of Agriculture led Experimental Design for the project
• Marilyn Simunich Idaho State Department of Agriculture served as Study Coordinator & Data Keeper
• The Life Technologies Animal Health & Food Safety Group agreed to support the study
Proper & Confidential
6Proprietary & Confidential
Study Objectives
1. Determine the effect of pooling a single positive sample having various CT ranges with four negative samples (1:5). If a negative effect was seen, a 1:3 pooling study would then be conducted
2. Compare different sample preparation systems and various real-time PCR (feeder lab workflows) with the 5X MagMAXTM-pathogen RNA/DNA purification kit and amplification with VetMAXTM T. foetus reagents (Life Technologies workflow)
3. Assess the specificity of the VetMAXTM T. foetus reagents by sequencing all positive samples with CT values less than 38 and suspect sample CT values between 38 and less than 40 cycles
Proper & Confidential
7Proprietary & Confidential
Materials and Methods
• Sample collection (Cultured Smegma Samples)• 5 Feeder labs provided 803 samples
• 1 on the West Coast
• 1 in the Southwest
• 1 in the Central States
• 2 in the South
• Each feeder lab ran their own protocol including sample preparation system and real-time PCR
1 Central Study lab (KSVDL) Sample preparation with MagMAXTM Real-time PCR with VetMAXTM T. foetus reagents
Proper & Confidential
8Proprietary & Confidential
Cultured smegma samples provided by feeder labs
Sample Matrix
Source
# of positive
samples *
# of negative samples*
# of inconclusive samples *
Total samples
submitted
Cultured smegma samples
(A) 73 301 0 374
(B) 28 72 0 100
(C) 9 52 2 63
(D) 17 33 0 50
(F) 34 182 0 216
Total 161 640 2 803
* As reported by the feeder labs
Proper & Confidential
9Proprietary & Confidential
Real Time PCR Parameters for Feeder Laboratories
Lab A Lab BLab C Herds
1-2Lab C Herds
3-6Lab D Lab F Study Lab
Final reaction volume(µL) 20 20 25 25 25 25 25
Vol. of T. foetus primer/probe per reaction (µL)
1 1 1 1 10.88/1.13-
F&R1
Volume of extract per reaction(µL) 4 4 8 8 5 5 8
Volume Master Mix (µL) 15 15 12.5 12.5 19 18.75 12.5
Primer/probe design McMillen McMillen Vet-Max Vet-Max Vet-MaxModified McMillen
Vet-Max
Taq usedUniversal
qPCRUniversal
qPCRqPCR MM qPCR MM
TaqMan Univ.MM
Absolute qPCR low rox
mixqPCR MM
Thermocycler AB 7500 AB 7500 Cepheid SC AB7500 AB7500 AB7500 AB7500Thermocycler mode Standard Standard Fast Standard StandardStage 1 temperature(°C) 95 95 95 95 50/95 95 95Stage 1 time (sec) 10 10 600 10 120/120 15 600Stage2 denaturation (°C) 95 95 95 97 95 95 95
Stage 2 denaturation time (sec) 15 15 15 2 20 15 15
Stage 2 annealing temp (°C) 55 55 55 55 60 60 55
Stage 2 annealing time (sec) 45 45 45 40 45 60 45
# cycles 40 40 40 40 40 45 40
Analysis threshold Fixed 2.0 Fixed 2.0
Control based threshold-10%
max TF/5% max Xeno
Control based threshold-10%
max TF/5% max Xeno
Fixed 0.2Control based threshold-
10% max TF/Xeno
Analysis baseline setting 3-15 3-15 autoPositive (Ct) <35 <35 <36 <36 <38 <37 <38
Suspect/Inconclusive(CT) 35-40 35-40 36-40 36-40 38-39 >37 38-40/Xeno 28.5-31.5
Negative(CT) >40 >40 >40 >40 >40 undetected Undetected/Xeno 28.5-31.5
Internal extraction control No No Yes <36 CT Yes <36 CT No Yes Yes CT = 28.5-31.5
Proper & Confidential
10Proprietary & Confidential
Results: Individual Sample Testing
Study Lab Result / Feeder Lab Result
Sample Matrix
Lab Sourc
e
Sample preparati
on system
Pos/Pos
Pos/Neg
Pos/Inc
PresPos/Neg
Neg/Pos
Neg/Inc
Neg/Neg TotalPercent
agreement
Cultured smegma samples
A Boiling 71 5 0 1 2 0 295 374 97.9
B Boiling 21 10 0 0 7 0 62 100 83.0
C MagMax 9 2 2 0 0 0 50 63 96.7
D Boiling 17 4 0 1 0 0 28 50 90.0
F Qiagen 34 0 0 1 0 0 181 21 6 99.5
Results All labs Multiple 152 21 2 3 9 0 616 803 95.6
Order of the call = KSVDL Study Lab / Feeder LaboratoryPos = positive, Neg = negative, Inc = inconclusive, PresPos= presumptive positive
Study Lab Results vs. Feeder Lab Results
Proper & Confidential
11Proprietary & Confidential
Conclusions Individual Testing
• 803 smegma samples were provided by feeder labs (FL)
• All the samples were tested by study laboratory with Life Technologies workflow systems:
• MagMAXTM
• VetMAXTM T. foetus reagents
• Agreement of 95.6% was reached with 768/803 samples between feeder labs and study lab
• Interestingly, Lab F reached almost 100% agreement using a different sample prep system and a modified McMillen’s assay
• Study laboratory (KSVDL) with LT protocol identified 24 more positives than the feeder laboratories. On retesting, one of the feeder labs missed 9 samples reported as positives.
Proper & Confidential
12Proprietary & Confidential
Pooling Study
Laboratory ID
Positive Samples Available
Negative Samples Available
Negatives Needed
Deficit /Surplus of Negative Samples
A 77 297 308 -11
B 31 69 124 -55
C 13 50 52 -2
D 21 28 84 -56
F 34 181 136 +45
Total 176 625 704
Positives, presumptive positive and negative samples used from each lab for pooling
Proper & Confidential
13Proprietary & Confidential
Pooling results
Sample ID*
Individual test CT
Pooled1:5 Test CT
Pooled1:3 Test CT
Study lab final call
Pooled 1:5 call
Pooled 1:3 call
1 C-6-11 35.05 Undetected Undetected Positive Negative Negative
2 A-40-5 35.20 37.83 37.86 Positive Positive Positive
3 A-39-2 35.41 35.93 34.82 Positive Positive Positive
4 F-1-7 35.43 35.43 35.53 Positive Positive Positive
5 F-18-1 35.52 36.16 34.75 Positive Positive Positive
6 C-1-23 35.93 35.75 35.82 Positive Positive Positive
7 B-8-4 36.02 34.91 35.59 Positive Positive Positive
8 F-19-10 36.30 33.48 32.82 Positive Positive Positive
10 A-27-9 36.36 Undetected Undetected Positive Negative Negative
9 B-4-1 36.45 Undetected Undetected Positive Negative Negative
11 C-6-10 37.20 Undetected 37.69 Positive Negative Positive
12 A-41-2 37.89 36.92 Not tested Positive Positive Not tested
13 C-4-5** 38.77 (ave of 4) Undetected Undetected Positive WFA* Negative Negative
14 C-6-15** 39.09 (ave of 3) Undetected Undetected Positive WFA Negative Negative
15 A-24-10** 39.12 (ave of 2) Undetected UndetectedSuspect Positive
WFANegative Negative
Effect of pooling for T. foetus samples with CT>35 after individual testing
*WFA: Suspect workflow A; ** samples confirmed T. foetus by sequencing
Proper & Confidential
14Proprietary & Confidential
Pooling results
1:5 Pools• 1:5 pooling of positive samples with a CT of 35 and below were all
detected• Only 3 of 9 positive samples with CTs between 36-39.9 were detected
in 1:5 pools• Pooling at 1:5 missed 4% (7/176) of T. foetus positive samples
1:3 Pools• Only 8 of 15 positive samples with CTs between 36-39.9 were
detected in the 1:3 pools• 1:3 pooling missed 3.5% (6/176) of T. foetus positive samples
Proper & Confidential
15Proprietary & Confidential
Sequencing primer design for nested PCR
(R-TFSM-primer)
(O-F-TFSM-Primer) (M13-I-F-TFSM-Primer)
(M-13-R-TFSM-primer)
TTAGCTTTCTTT GCGA T. foetus
TTAGCTAACAAT GCGA S. moskowitzi
Primers for Nested PCR Abbreviation Primer Sequence
Forward outer forward primer
(O-F-TFSM-Primer) CCTTAGGCAATGGATGTCTTGGC
Reverse primer (R-TFSM-primer) GCGCAATGTGCATTCAAAG
M13 Forward Inner primer(M13-I-F-TFSM-Primer)
TGTAAAACGACGGCCAGTCTTACACGATGAAGAACGTTGC
M13 Reverse primer(M-13-R-TFSM-primer)
CAGGAAACAGCTATGACCGCGCAATGTGCATTCAAAG
GenBank: GQ254636.1 Simplicimonas moskowitziGenBank: AY349189.1 Tritrichomonas foetus
Proper & Confidential
16Proprietary & Confidential
Sequencing results for 175 T. foetus positives
175/176 T. foetus positive samples, including three late risers, were confirmed T. foetus by DNA sequencing
Proper & Confidential
17Proprietary & Confidential
Sensitivity, specificity, & predictive values of positive & negative results for all cultured smegma samples
Calculation Formula Result Result
% Sensitivity True Positives
True Positives + False Negatives X 100
175_ 175 + 0 x100
100%
% Specificity True Negatives
True Negatives + False Positives X 100
625___ 625 + 3 x100
99.52%
Predictive value of a
positive test
True Positives
True Positives + False Positives X 100
175__ 175 + 3 x100
98.31%
Predictive value of a
negative test
True Negatives
True Negatives + False Negatives X 100
625__ 625 + 0 x100
100%
* Calculations made after qPCR and sequence confirmation
Proper & Confidential
18Proprietary & Confidential
Sequencing Results
• 175/176 positive samples by qPCR were able to be sequenced
• 1 sample (A-7-25) with a CT 33.95 was not able to be sequenced. • It is possible that there are point mutations in this positive sample in the
sequencing primer regions, which were designed based on a few T. foetus and a single S. moskowitzi sequences from GenBank
• Most importantly, none of the samples reported S. moskowitzi DNA sequences
Proper & Confidential
19Proprietary & Confidential
Overall Study Results
• 95.6 % agreement was reached between Study Lab (KSVDL) using Life technologies MagMAXTM and VetMAXTM T. foetus reagents and the feeder laboratories
• 1:5 Pooling it is likely to miss 4% of the positives• 1:3 Pooling it is likely to miss 3.5% of the positives
• DNA sequencing• 175/176 positive samples were confirmed to be T. foetus, the 176th
sample could not be sequenced with the primers designed for this study
Proper & Confidential
20Proprietary & Confidential
Acknowledgements
Lalitha Peddireddi, KSVDL – performed the study at KSVDLLee Effinger, ODA-Animal Health LaboratoryMarilyn Simunich, Idaho State Dept. of AgricultureCate O’Connell, Life TechnologiesMangkey Bounpheng, Texas Veterinary Medical Diagnostic LaboratoryDawn Bueschel, NMDA Veterinary Diagnostic ServicesMuthu Chengappa, Kansas State Veterinary Diagnostic LaboratoryAlfonso Clavijo, Texas Veterinary Medical Diagnostic LaboratoryKris A. Clothier, California Animal Health & Food Safety Lab SystemHemant K. Naikare, Texas Veterinary Medical Diagnostics LaboratoryJeff Zinza, Life TechnologiesMary Anne Williams, Life Technologies
Proper & Confidential
21Proprietary & Confidential
ObjectivesTo build confidence in Trich testingTo increase consistency in test resultsTo minimize sample quality influence variablesTo minimize laboratory testing variablesTo reduce the burden and cost to man and beast
Trich Laboratory Testing Standardization
Proper & Confidential
22Proprietary & Confidential
Trich Laboratory Testing StandardizationTrichomonas foetus DNA testing
Proper & Confidential
Recommended