View
2
Download
0
Category
Preview:
Citation preview
University of Groningen
The significance of Helicobacter pylori in the approach of dyspepsia in primary careArents, Nicolaas Lodevikus Augustinus
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2003
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Arents, N. L. A. (2003). The significance of Helicobacter pylori in the approach of dyspepsia in primarycare. [S.n.].
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 03-06-2020
The significance of Helicobacter pylori in theapproach of dyspepsia in primary care
N.L.A. Arents
2003
De SENSE studie (Strategy: ENdoscopy versus SErology) is mogelijk gemaakt
door : Aventis Pharma B.V.
Het drukken van dit proefschrift is financieel ondersteund door :
Mediphos Medical Supplies B.V.
Oxoid B.V.
GlaxoSmithKline B.V.
ABBOTT B.V.
bioMérieux B.V.
Janssen-Cilag B.V.
Cover illustration : painting by Suzanne C.B. Prins
Printed by Stichting Drukkerij C. Regenboog, Groningen, The Netherlands
RIJKSUNIVERSITEIT GRONINGEN
The significance of Helicobacter pylori in theapproach of dyspepsia in primary care
Proefschrift
ter verkrijging van het doctoraat in deMedische Wetenschappen
aan de Rijksuniversiteit Groningenop gezag van de
Rector Magnificus, dr. F. Zwarts,in het openbaar te verdedigen op
woensdag 18 juni 2003om 14.15 uur
door
Nicolaas Lodevikus Augustinus Arentsgeboren op 20 augustus 1971
te Rheden
Promotores prof. dr. J.H. Kle ibeukerprof. dr. J.E. Degener
Co-promotores dr. J.C. Thijsdr. A.A. van Zwet
Beoordelings commissie prof. dr. J.B.M.J. Jansenprof. dr. E.J. Kuipersprof. dr. H.A. Verbrugh
ISBN-nummer : 90-367-1788-4
Contents
The significance of Helicobacter pylori in the approach of
dyspepsia in primary care
Contents
Chapter 1 9
Introduction and outline of the thesis.
Chapter 2 15
A rational approach to uninvestigated dyspepsia in primary care. Review of the literature.
Postgraduate Medical Journal 2002; 78: 707-716.
Chapter 3 51
The approach of dyspepsia in primary care. A randomised trial comparing “test-and-treat”
with prompt endoscopy.
In press, Archives of Internal Medicine.
Chapter 4 73
The accuracy of the Helicobacter pylori Stool Antigen test (HpSA test) in diagnosing
Helicobacter pylori in treated and untreated patients.
European Journal of Gastroenterology & Hepatology 2001;13:383-386.
Chapter 5 83
Does the declining prevalence of Helicobacter pylori unmask patients with idiopathic
peptic ulcer disesase ?
Submitted for publication.
Chapter 6 93
Changes in the prevalence of metronidazole and clarithromycin resistance and its influence
on the efficacy of triple therapies in Helicobacter pylori.
In part accepted for publication in Journal of Antimicrobial Chemotherapy.
Chapter 7 105
The importance of vacA, cagA, and iceA genotypes of Helicobacter pylori infection in
peptic ulcer disease and gastroesophageal reflux disease.
American Journal of Gastroenterology 2001; 96:2603-2608.
Chapter 8 119
The value of PCR and serology based methods in determining the presence of the cagA
gene in Helicobacter pylori infection.
Submitted for publication.
Chapter 9 131
Implications of the simultaneous presence of metronidazole-susceptible and -resistant
Helicobacter pylori colonies within a single biopsy specimen.
European Journal of Clinical Microbiology & Infectious Diseases 2001; 20:418-420.
Chapter 10 139
Summary and general conclusions.
Chapter 11 145
Samenvatting en algemene conclusies.
Dankwoord 153
9
Chapter 1
Introduction and outline of the thesis.
Chapter 1
10
Introduction and outline of the thesis
Dyspepsia is a complex of symptoms believed to originate from the upper gastrointestinal tract
[1-4]. These symptoms are very common in Western societies and about 30% of the general
population experiences at least one period of more or less severe dyspepsia during any given year
[5-7]. Despite this high prevalence of dyspepsia, only a minority of the patients will eventually
seek medical attention [5,6]. Nevertheless, dyspepsia accounts for 1 - 4% of all consultations in
primary care [8-10]. Most of these patients are not referred for further investigation and are
managed solely by their general practitioner [8,11,12]. Although general practitioners are
frequently consulted for dyspepsia, the optimal approach towards this problem has not been
established sofar. Defining the optimal approach for dyspepsia is difficult since dyspepsia is not a
diagnosis but may result from various underlying conditions ranging from potentially life
threatening disorders (gastric cancer, peptic ulcer disease (PUD)) to functional diseases with a
benign course. Unfortunately, apart from alarm symptoms, other symptoms relate poorly to
underlying disease [6] and are of limited value for the choice of therapy [13,14]. Several strategies
have been proposed to manage patients with dyspepsia without alarm features in primary care. The
discovery of Helicobacter pylori (H. pylori) and the acknowledgement of its important etiological
role in several diseases of the upper alimentary tract have added even more possibilities to
approach dyspepsia. The main strategies currently considered are: 1. Symptom guided empirical
treatment, 2. Direct referral for endoscopy, 3. Non-invasive testing for H. pylori and subjecting the
H. pylori-positive patients to endoscopy (“test-and-scope”), and 4. Non-invasive testing for
H. pylori and treatment of the infection in H. pylori-positive patients (“test-and-treat”). Both
strategies based on screening for H. pylori infection have been studied in secondary care settings,
but studies evaluating its efficacy in a primary care setting are lacking. Chapter two considers the
rationale for the various strategies in primary care, based on the available data in literature. In
chapter three the results of a randomised clinical trial are reported comparing the “test-and-treat”
strategy to prompt endoscopy. It was hypothesised that only a minority of the patients approached
by the “test-and-treat” strategy would be referred for endoscopy and that significant disease would
not be missed. Moreover, this study was designed to enable a comparison of symptom resolution,
quality of life, patient satisfaction and medical cost per patient in both study groups.
In order to successfully implement a strategy that is based on screening for H. pylori, some
conditions have to be met. First of all, the non-invasive test used to detect the presence of H. pylori
Introduction and outline of the thesis
11
has to be accurate. Chapter four reports the results of a study evaluating a recently introduced non-
invasive method to detect the presence of H. pylori infection by testing for H. pylori antigens in
faecal samples. Secondly, the prevalence of H. pylori has to be sufficiently high in the dyspeptic
population, but especially in patients with PUD, in whom treatment of the infection is most
beneficial. It has recently been suggested that an increasing number of patients with PUD are not
infected with H. pylori and that the decreasing prevalence of H. pylori unmasks this so-called
idiopathic PUD (not associated with H. pylori, NSAID use, or any other identifiable cause) [15].
In Chapter five a study is reported in which we examined the prevalence of idiopathic PUD and
trends over a period of 8 years. Thirdly, since it is well known that antibiotic resistance in
H. pylori (mainly to metronidazole and clarithromycin) has a significant impact on the efficacy of
the frequently used triple regimens [16,17], knowledge about the prevalence of resistance to
metronidazole and clarithromycin is important before prescribing these drugs. Chapter six
describes the prevalence of metronidazole and clarithromycin resistance over an eight year period
in the province of Drenthe. Moreover, the calculated effect of different prevalences of resistance
on the efficacy of two commonly used triple regimens is described .
The second part of the thesis focuses on several microbiological aspects of the highly diverse
H. pylori species. Most H. pylori infected patients carry a unique strain [18,19] and even within a
single patient different H. pylori strains can be encountered [20,21]. It has been suggested that
genetic differences among H. pylori strains are related to the different sequelae of the infection.
Chapter seven presents the results of a study into the relation between several virulence factors of
H. pylori and clinical outcome. Chapter eight evaluates a new rapid test to detect the presence of
CagA antibodies to the virulence factor cagA as compared to polymerase chain reaction (PCR) on
biopsy specimens and the OroVax CagA protein recombinant based ELISA. Finally in chapter
nine we studied patients carrying both metronidazole susceptible and resistant H. pylori bacteria.
The question was whether this phenomenon was based on a multiple strain infection or not.
Chapter ten summarises this thesis and presents the general conclusions that were drawn from all
studies.
Chapter 1
12
References
1. Crean GP, Card WI, Beatti AD, J. HR, James WB, Knill-Jones RP et al. Ulcer-like dyspepsia.
Scandinavian Journal of Gastroenterology 1982; 17 (suppl 79): 9-15.
2. Colin-Jones DG. Management of dyspepsia: report of a working party. Lancet 1988; 1: 576-579.
3. Barbara L, Camilleri M, Corinaldesi R, Crean GP, Heading RC, Johnson AG et al. Definition
and investigation of dyspepsia. Digestive Diseases and Science 1989; 34: 1271-1276.
4. Heading RC . Definitions of Dyspepsia. Scandinavian Journal of Gastroenterology 1991; 26 (suppl
182): 1-6.
5. Jones RH, Lydread SE, Hobbs FDR, Kenkre JE, Williams EI, Jones SJ et al. Dyspepsia in
England and Scotland. Gut 1990; 31: 401-405.
6. Penston JG, Pounder RE. A survey of dyspepsia in Great Britain. Alimentary Pharmacology &
Therapeutics 1996; 10: 83-89.
7. Bernersen B, Johnsen R, Straume B, Burhol PG, Jenssen TG, Stakkevold PA. Towards a true
prevalence of peptic ulcer: the Sorreisa gastrointestinal disorder study. Gut 1990; 31: 989-992.
8. Jones R, Lydeard S. Prevalence of symptoms of dyspepsia in the community. British Medical
Journal 1989; 298: 30-32.
9. Heikkinen M, Pikkarainen P, Takala J, Julkunen R. General practicioners' approach to dyspepsia.
Scandinavian Journal of Gastroenterology 1996; 31: 648-653.
10. Knill-Jones RP. Geographical differences in the prevalence of dyspepsia. Scandinavian Journal of
Gastroenterology 1991; 26 (suppl 182): 17-24.
11. Muris JWM, Starmans R, Fijten GH, Crebolder HFJM, Krebber TFWA, Knottnerus JA.
Abdominal pain in general practice. Family Practice 1993; 10: 387-390.
12. Warndorff DK, Knottnerus JA, Huijnen LGJ, Starmans R. How well do general practitioners
manage dyspepsia ? Journal of the Royal College of General Practitioners 1989; 39: 499-502.
13. Adang RP, Ambergen AW, Talmon JL, Hasman A, Vismans JF, Stockbrugger RW. The
discriminative value of patient characteristics and dyspeptic symptoms for upper gastrointestinal
endoscopic findings: a study on the clinical presentation of 1,147 patients. Digestion 1996; 57: 118-
134.
14. Bytzer P, Schaffalitzky de Muckadell OB. Prediction of major pathologic conditions in dyspeptic
patients referred for endoscopy. A prospective validation study of a scoring system. Scandinavian
Journal of Gastroenterology 1992; 27: 987-992.
15. Higuchi K, Arakawa T, Fuijwara Y, Uchida T, Tominaga K, Watanabe T et al. Is Helicobacter
pylori-negative duodenal ulcer masked by the high prevalence of H.pylori infection in the general
population ? American Journal of Gastroenterology 1999; 94: 3083-3084.
Introduction and outline of the thesis
13
16. Houben MH, Van Der BD, Hensen EF, Craen AJ, Rauws EA, Tytgat GN . A systematic review of
Helicobacter pylori eradication therapy. The impact of antimicrobial resistance on eradication rates.
Alimentary Pharmacology & Therapeutics 1999; 13: 1047-1055.
17. van der Wouden EJ, Thijs JC, van Zwet AA, Sluiter WJ, Kleibeuker JH. The influence of in
vitro nitroimidazole resistance on the efficacy of nitromidazole containing anti-Helicobacter pylori
regimens: a meta-analysis. American Journal of Gastroenterology 1999; 94: 1751-1759.
18. Owen RJ, Bickley J, Costas M, Morgan DR. Genomic variation in Helicobacter pylori: application
to identification of strains. Scandinavian Journal of Gastroenterology 1991; 181: 43-50.
19. Akopyanz N, Bukanov NO, Westblom TU, Kresovich S, Berg DE. DNA diversity among clinical
isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Research
1992; 20: 5137-5142.
20. Jorgensen M, Daskalopoulos G, Warburton V, Mitchell HM, Hazell SL. Multiple strain
colonization and metronidazole resistance in Helicobacter pylori-infected patients: identification
from sequential and multiple biopsy specimens. Journal of Infectious Diseases 1996; 174: 631-635.
21. Prewett EJ, Bickley J, Owen RJ, Pounder RE. DNA patterns of Helicobacter pylori isolated from
gastric antrum, body and duodenum. Gastroenterology 1992; 102: 829-833.
15
Chapter 2
A rational approach to uninvestigated dyspepsia in primary care.
Review of the literature.
Nicolaas L. A. Arents 1, Jacob C. Thijs 2, and Jan H. Kleibeuker 3
1 Regional Public Health Laboratory, Groningen / Drenthe2 Department of Internal Medicine, Bethesda Hospital, Hoogeveen3 Department of Gastroenterology, University Hospital, Groningen
Postgraduate Medical Journal 2002; 78: 707-716.
Chapter 2
16
Abstract
In this paper the rationale and limitations are analysed of the four most important approach
strategies to dyspepsia in primary care (empiric treatment, prompt endoscopy, “test-and-scope”,
and “test-and-treat”). It is concluded that in the absence of alarm symptoms, a “test-and-treat”
approach is currently the most rational approach provided that three conditions are met: 1. a highly
accurate test should be used, 2. the prevalence of H. pylori in the population should not be too low
and 3. an effective anti-H. pylori regimen should be prescribed taking sufficient time to instruct
and motivate the patient.
Introduction
Dyspepsia is not a diagnosis, but merely a cluster of symptoms believed to be referable to the
upper gastrointestinal tract [1-4]. It is very common in the adult western population with
prevalence rates ranging from 19 up to 41% in several epidemiological studies [5-17]. Although
most dyspeptics do not seek medical attention, half of them regularly use over the counter drugs
[10,12,16]. About one out of every four subjects with dyspepsia consults his general practitioner
[9,10,13,16,18] and these visits account for 1- 4% of all consultations in primary care [9,12,19].
Twenty five percent of these patients are referred for further investigations (i.e. endoscopy,
ultrasonography, etc) or to a secondary care physician (about 10%) but the majority of the patients
are managed empirically by their general practitioner [9,10,20-22]. Altogether, dyspepsia is an
important health issue and constitutes a significant clinical problem in primary care.
The objective of general practitioners in the approach of dyspeptic patients is to abolish or
reduce symptoms, either by the detection and treatment of underlying disease or by symptomatic
treatment or mere reassurance of the patient. Secondary objectives are the timely diagnosis of
significant disease, avoidance of over-treatment, and containment of costs (table 1). The optimal
approach to achieve these goals, however, is still a matter of discussion, even though several
guidelines have been formulated [23-25]. This current lack of agreement is related to several
points, starting with the definition of dyspepsia. According to the recent Rome consensus [26] the
term dyspepsia refers to persistent or recurrent upper abdominal pain or discomfort, supposed to be
referable to the upper gastrointestinal tract. The consensus meeting excluded patients with
heartburn or acid regurgitation as the predominant symptom, as these symptoms were thought to
A rational approach to uninvestigated dyspepsia in primary care
17
Table 1.
Objectives in the approach of the dyspeptic patient in primary care
• Abolishment or reduction of symptoms
• Timely diagnosis of significant disease
• Avoidance of over-treatment
• Containment of medical and non-medical costs
be predictive of gastro-esophageal reflux disease (GERD) [27,28]. Nevertheless, many studies
ondyspepsia used other definitions and some do include patients with predominant heartburn [9-
11,13,16]. Secondly, the optimal approach of the dyspeptic patient depends on the prevalences of
the underlying causes of dyspepsia. These prevalences differ between various parts of the world.
For example, in South East Asia, where gastric cancer is a common condition [29], the optimal
approach is likely to be different from that in the Western world [30]. Thirdly, the role of some
conditions in causing dyspeptic symptoms is still debated. This is especially true for the
relationship between Helicobacter pylori (H. pylori) gastritis and dyspepsia without an
endoscopically identifiable cause (functional dyspepsia; FD). Finally, what is the most cost-
effective approach largely depends on the local availability and costs of medical provisions
(especially endoscopy).
The primary care physician can choose between the following strategies for the approach of
uninvestigated dyspepsia: 1. Symptom guided empirical treatment, 2. Direct referral for
endoscopy, 3. Non-invasive testing for H. pylori and subjecting the H. pylori-positive patients to
endoscopy (“test-and-scope”), and 4. Non-invasive testing for H. pylori and treatment of the
infection in H. pylori-positive patients (“test-and-treat”). The aim of this review is to evaluate the
rationale behind each strategy and to weigh the available clinical evidence. It focuses on dyspepsia
as encountered in primary care and the situation in the Western world. It does not discuss the
approach of the patients with mild symptoms of short duration, which usually can be managed by
reassurance and simple lifestyle advice. Nor does it consider the approach of patients with
heartburn or acid-regurgitation as the only or predominant symptom. It is recognised, however,
that heartburn is frequently part of the dyspeptic syndrome [26]. Finally, patients with alarm
symptoms (table 2) and patients using non-steroidal anti-inflammatory drugs (NSAID’s) are not
subject of this review. Patients with alarm symptoms should be subjected to endoscopy without
Chapter 2
18
delay. In patients using NSAID’s, this drug should be discontinued if at all possible before
considering further steps.
Table 2.
Sinister symptoms in the dyspeptic patient, necessitating endoscopy
• Unintentional weight loss
• Iron deficiency anaemia
• Gastro-intestinal bleeding
• Dysphagia
• Odynophagia
• Previous gastric surgery
• Persistent vomiting
• Epigastric mass
Differential diagnosis in uninvestigated dyspepsia
Dyspepsia can be ascribed to several conditions. Only a few studies examined their relative
prevalences in a primary care population. In three studies all patients consulting their general
practitioner for dyspeptic symptoms were referred for endoscopy. Reflux oesophagitis was found
in 6-24%, peptic ulcer disease (PUD) in 13-16%, malignant disease in 1-2%, and in more than
60% of the patients no abnormalities were found at endoscopy [31-33] the latter patients being
usually diagnosed as having FD. More data are available from studies evaluating “open access
endoscopy”. In “open access endoscopy” the general practitioner directly refers the patients for
upper gastrointestinal endoscopy without prior evaluation by a specialist. Data from these studies
should, however, be considered with caution. The patients represent a selected population, as no
more than 25% of the patients in primary care are referred for further investigations [9,10]. In
these studies oesophagitis was diagnosed in 2-31%, PUD in 13-28%, a malignancy in 0.2-4.0%
and endoscopy revealed no visible disease in 35-89%. In table 3 the data from the three primary
care studies and the “open access endoscopy” studies with over 400 participating patients each are
summarised [31-50]. Considering these data, it is noteworthy that the ranges of frequencies of the
various endoscopic diagnoses in the studies evaluating “open access endoscopy” are very much
alike those in the primary care studies. This suggests that clinical judgement does not adequately
A rational approach to uninvestigated dyspepsia in primary care
19
Table 3.
Prevalences of endoscopically encountered diseases in dyspeptic patientsn reflux
oesophagitis(%)
peptic ulcerdisease
(%)
malignancy
(%)
functionaldyspepsia
(%)unselected primary care patientsHeikinnen et al. (31) † 400 15 13 2.3 70Kagevi et al. (32) † 172 6 13 1.2 79Hansen et al. (33) 612 24 16 0.7 59
range 6-24 13-16 0.7-2.3 59-79weighted mean 18 15 1.3 66
open-acces endoscopy studies with > 400 patientsAyoola et al. (34)† 10112 11 17 1.5 70Hungin et al. (35) 6744 17 15 0.6 67Hallisey et al. (36) 2659 19 16 2.7 62Fedail et al. (37) 2500 8 18 2.2 71Mansi et al. (38) 2086 5 13 1.5 81Holdstock et al. (39) 1805 9 14 2.0 75Fjosne et al. (40) † 1275 10 23 4.0 62Capurso et al. (41) 1153 3 8 0.6 89Stanghellini et al. (42) 1057 9 21 0.6 69Davenport et al. (43) 1041 na 24 2.6 naNyren et al. (44) 972 3 23 0.3 74Gear et al. (45) 968 5 17 2.3 76Johannessen et al. (46)†
930 15 17 1.0 67
Bytzer et al. (47) 878 2 15 1.4 82Talley et al. (48) 820 14 23 3.4 60Williams et al. (49) 686 14 28 2.5 56Saunders et al. (50) † 559 31 23 0.2 46
range (%) 2 - 31 13 - 28 0.2 - 4.0 35 - 89weighted mean (%) 12 17 1.6 70na = data not available
† = in these studies more than one diagnosis was allowed in a single patient. Therefore, as
functional dyspepsia was defined as the absence of either reflux oesophagitis, peptic ulcer disease
or malignancy, this may have led to an underestimation of the percentage of patients with
functional dyspepsia (within a total of 100%).
Chapter 2
20
select patients at higher risk for underlying pathology which is in line with other studies showing
that it is impossible to predict endoscopic lesions in dyspeptic patients only from the clinical
presentation [16,47,51,52]. It is recognized, however, that in daily practice clinical judgement is
not the only consideration to refer a patient for endoscopy, and other reasons, like patients fear for
cancer, may be involved. It is also noteworthy that the prevalences of endoscopic diagnoses vary
considerably among the studies. This is probably explained by differences in inclusion criteria and
by geographic differences, but prevalences are also changing. Several studies have shown that
during the last decades the prevalences of GERD and adenocarcinoma of the oesophagus and
cardia have been increasing rapidly in the western world, together with decreasing prevalences of
PUD and distal gastric cancer [53-55]. The decreasing prevalence of H. pylori infection is
generally considered to contribute to these epidemiological changes [56]. Considering these
varying and changing prevalences of underlying conditions in dyspepsia, it is obvious that the
optimal approach of the dyspeptic patient may be different between the various geographic regions
and may also change with time.
The role of H. pylori in dyspepsia
In the years following the first description of H. pylori by Warren and Marshall in 1983 [57] it
has become clear that this gram-negative curved bacterium plays a major role in several conditions
of the upper gastrointestinal tract. There is ample evidence showing a causal relationship between
H. pylori infection and PUD. When patients using NSAID’s are excluded, the large majority of
PUD patients carry the infection [58] and eradication of H. pylori heals the disease [59-66] and
prevents its recurrence [61-64,66-69]. Moreover, H. pylori gastritis is the most important risk
factor for the subsequent development of PUD [70,71] a risk that has been estimated to be about
10% in a lifetime [72,73]. On the other hand, several recent studies show that not all PUD is
caused by H. pylori, even after exclusion of patients using NSAID’s [74-78]. The decreasing
prevalence of H. pylori in the western world is likely to cause a relative increase in the proportion
of these “idiopathic” peptic ulcers [76,79].
In addition to the causal relation with PUD, it has been shown that there is also a strong
association between H. pylori gastritis and the occurence of gastric cancer [80-89] and the
International Agency for Research on Cancer has classified H. pylori as a class I risk factor for
gastric cancer [90]. Moreover, gastric MALT lymphoma (mucosa associated lymphoid tissue
A rational approach to uninvestigated dyspepsia in primary care
21
lymphoma) [91-93] and Ménétrier's disease of the stomach have been associated with H. pylori
[94-96]. These conditions, however, are rare, and therefore this association will not be a major
factor influencing decision making in the dyspeptic patient.
The relationship between H. pylori and FD has been debated for a long time and is still not
entirely clarified [97,98]. Several studies have suggested a higher prevalence of H. pylori in FD,
but others came to dissimilar conclusions [99,100]. Decisive evidence could be expected from
studies evaluating the effect of H. pylori eradication on symptoms in FD. Early studies were
flawed by methodological problems [101,102] but recently, four large well conducted randomised
placebo-controlled clinical trials with a follow-up period of 12 months have been published as full
paper [103-106]. The results, however, are contradictory (table 4). A recent meta-analysis included
these studies as well as five other studies [107-111] and suggested that there is a small but
significant benefit of about 10% of H. pylori eradication over placebo [112]. Another meta-
analysis, however, included other studies [109,113-117] apart from the ones listed in table 4 and
did not show any benefit [118].
H. pylori infection does not seem to be a causal factor in the pathogenesis of GERD [119-121].
Epidemiological data even suggest that the infection protects against this condition. While the
prevalence of H. pylori gastritis is declining in the western world, GERD and Barrett’s carcinoma
are becoming more common [53,122,123]. Moreover, some studies suggest that eradication of H.
pylori can induce GERD [124,125], although this has not been confirmed by others [126-128].
Immediate endoscopy or symptom guided empirical treatment
Endoscopy is the most appropriate investigation to detect pathological lesions in the upper
alimentary tract as well as the presence of H. pylori [129,130]. Immediate endoscopy in patients
with dyspepsia results in a definite diagnosis from the outset and ensures that the patient receives
the most appropriate treatment. It is evident that in most patients with dyspepsia no underlying
disease can be identified. Several studies, however, have shown that even then an endoscopy may
have its merits. A negative endoscopy may have a significant reassuring effect and may result in a
decreased use of medication and in fewer medical consultations [131-133]. Investigating all
dyspeptic patients by endoscopy, however, is not feasible in view of the high incidence of
dyspepsia and the limited availability of endoscopic facilities. Therefore, alternative approaches
have been suggested.
Chapter 2
22
Many dyspeptic patients consult their general practitioner mainly because of fear of possible
serious disease and sometimes mere reassurance may be sufficient [13,18,46,134]. If the
symptoms do not abolish spontaneously, it has been proposed to prescribe a trial of treatment,
reserving endoscopy for those patients who do not respond or whose symptoms recur after
stopping treatment. [20-22,135]. This strategy has been promoted by several organisations of both
primary and secondary care physicians [2,25,49,129,136]. The choice of the drug may be dictated
by the predominant symptom [2] but treatment most often consists of an acid suppressing drug
given during a fixed period. H2-receptor blocking agents (H2RA’s) are used predominantly,
although they are being gradually replaced by the more powerful proton pump inhibiting drugs
(PPI’s). Acid suppression is effective in GERD and PUD and a few studies have shown some
efficacy in FD [137-140]. Besides acid-suppressive drugs, prokinetics, especially cisapride, have
been advocated for the empirical treatment of uninvestigated dyspepsia. This drug is shown to be
of benefit in GERD [141-152] and FD [153-160], and may have some efficacy in PUD [161-164].
Recently, however, serious cardiac side effects of cisapride were reported and, for that reason, the
drug has been withdrawn from the US market [165].
Table 4.
Effect of H. pylori eradication on symptom improvement in patients with functional
dyspepsia: results of double blind placebo controlled studies with
1 year follow-up published as full-papers
n = anti-H. pylori treatment
symptom improvement (%)
placebo
symptom improvement
(%)
Blum et al. (106)
McColl et al. (105)
Talley et al.(104)
Talley et al. (103)
328
318
275
337
27.4
21
24.1
46
20.7
7*
21.8
50
*p = 0.03
A rational approach to uninvestigated dyspepsia in primary care
23
Selection for endoscopy by non-invasive testing for H. pylori: the “test-and-scope” and “test-
and-treat” strategy
The incorporation of the H. pylori concept in the approach of uninvestigated dyspepsia has led
to the development of two major strategies: the “test-and-scope” strategy and the “test-and-treat”
strategy.
The “test-and-scope” strategy was first suggested by Sobala et al. in 1991 [166]. They
reasoned that dyspeptic patients under the age of 45 without alarm symptoms or NSAID use and
testing negative for H. pylori by non-invasive means have a very low probability for serious
underlying disease. Therefore, they postulated that these patients could safely be treated
empirically, without the need for an endoscopy. When this strategy was tested retrospectively in a
group of 293 patients referred for endoscopy, they found that the total number of endoscopies
performed would have been reduced by 25% in all age groups and by 48% in the age group below
45 years, without missing any peptic ulcer or malignancy. Other retrospective studies showed
comparable results with a reduction in the number of endoscopies between 11-35% when all
patients referred for endoscopy were considered, be it at the cost of missing up to 2% of the peptic
ulcers [167-175]. Patel et al. were the first to evaluate this strategy prospectively in 183
consecutive patients [176]. Seventy patients below the age of 45 without sinister symptoms or
NSAID use and testing H. pylori negative by serology were returned to their general practitioner
for symptomatic treatment without an endoscopy performed. Only three of these patients
eventually underwent endoscopy, resulting in an overall reduction in the number of endoscopies
by 37%. Moreover, endoscopy did not seem to influence subsequent symptom severity, quality of
life, and number of days lost from work when these non-endoscoped patients were compared with
an historic control group of H. pylori negative endoscoped subjects. Number of physician visits
and medication use were even less in these non-endoscoped patients. This is in accordance with
the study of Asante et al., who showed that endoscopy in sero-negative patients does not influence
quality of life, number of visits to the general practitioner or number of days lost from work [177].
Further reduction in the number of endoscopies could possibly be reached if H. pylori positive
dyspeptic patients would not be subjected to endoscopy, but would receive immediate anti-H.
pylori treatment : the “test-and-treat” strategy. In this way, patients with H. pylori related PUD
would be treated adequately without the need for an endoscopy. If the symptoms persist, the
patient can still be referred for endoscopy.
Chapter 2
24
Studies comparing the various strategies
In several studies the various strategies to approach the dyspeptic patient were compared by
computer-assisted decision analysis [178-185]. Decision analysis is a quantitative method for
estimating the outcome, both clinical and financial, of alternative management strategies. In such
an analysis calculations are based on data from the literature and on estimates by expert opinion.
Data in the model are often uncertain but recalculation of the outcome after varying a single
assumption over a reasonable range can be used to show to what extent different parameters
influence the conclusions. In that way these studies have identified factors, summarised in table 5,
that have a significant impact on the cost-effectiveness of any approach of dyspepsia. Most studies
concluded that a non-invasive approach, especially by a “test-and-treat” strategy, is likely to be the
most cost-effective [178,181-185], although this conclusion was heavily influenced by the costs of
endoscopy [179]. In these decision analytic studies, however, not all variables were incorporated
in the model and, some aspects with a possible impact on the outcome of a strategy were not
studied. Such aspects include a positive family history (PUD, cancer), the possible reassuring
effect of a negative endoscopy and the significance of detecting Barrett’s oesophagus, to name a
few. Therefore, such mathematical studies cannot replace prospective clinical trials.
Table 5.
Factors with significant impact on the cost-effectiveness of the various approaches in
patients with dyspepsia
• cost of endoscopy
• cost of therapy
• cost of physician visit
• prevalence of H. pylori in the dyspeptic population
• prevalence of PUD in H. pylori positive patients
• prevalence of underlying diseases in dyspepsia
• benefit of H. pylori eradication in patients with functional
• recurrence of dyspeptic symptoms in patients with (functional) dyspepsia after treatment
A rational approach to uninvestigated dyspepsia in primary care
25
Just a few randomised trials have evaluated the various approaches of the dyspeptic patient in a
clinical setting [131,186-190]. Most of them compared a non-invasive approach, either the “test-
and-treat” strategy or empirical acid-suppressive treatment, with prompt endoscopy.
The “test-and-treat” strategy was evaluated in a limited number of studies [186-188,191].
Heaney et al. randomised H. pylori positive patients as determined by the 13C-Urea breath test
(13C-UBT) to either anti-H. pylori treatment or prompt endoscopy [186]. In the endoscopy group
only the PUD patients received anti-H. pylori treatment. At 1-year follow-up, only 27% of the
patients who were not endoscoped initially, had undergone endoscopy. The dyspepsia scores had
improved significantly more in the non-endoscoped patients than in those subjected to endoscopy.
Jones et al. compared the “test-and-treat” strategy with standard clinical care in primary care
[187]. In standard clinical care, only patients with proven PUD received anti-H. pylori treatment. It
was shown that during a follow-up of one year, only 12% of the patients in the “test-and-treat”
group eventually underwent endoscopy, as compared to patients receiving standard clinical care.
Clinical outcome was comparable in both groups, but medical costs in the “test-and-treat” group
were only about half of that in the control group. Lassen et al. compared the “test-and-treat”
strategy using the 13C-UBT with prompt endoscopy [188]. Again, in the endoscopy arm, only the
PUD patients received anti-H. pylori treatment. At the end, 40% of the patients in the “test-and-
treat” group had been referred for endoscopy. Symptom resolution, changes in quality of life, the
use of resources (medication, visits to outpatient clinics, days in hospital, visits to general
practitioner), and the number of sick-leave days were comparable in both study groups. Patients in
the endoscopy group, however, were more satisfied with the treatment and were more often
prescribed PPI’s. It was concluded that the “test-and-treat” strategy is as efficient and safe as
prompt endoscopy. Finally, Arents et al. compared the “test-and-treat” strategy using H. pylori
serology with prompt endoscopy [191]. In contrast to other studies, all H. pylori positive patients
received anti-H. pylori treatment in both study arms. At 1 year follow-up, 40% of the patients in
the “test-and-treat” group had been referred for endoscopy. Symptom resolution, improvement in
quality of life and patient satisfaction were comparable in both study groups.
The most important study comparing acid suppression to prompt endoscopy was performed by
Bytzer et al. [131]. In that study, patients were randomised to prompt endoscopy or to a trial of
empirical treatment with H2RA. Prompt endoscopy proved to be more cost effective and to cause
more patient satisfaction than empirical treatment with an H2RA. Laheij et al compared prompt
Chapter 2
26
endoscopy with an approach in which patients initially received empirical treatment with
omeprazole, followed by a “test-and-treat” strategy if symptoms persisted [189]. After 1-year
follow-up, 31% of the patients in the group receiving empirical treatment had been referred for
endoscopy. Clinical outcome was the same in both groups, but medical costs were lower in the
group at first subjected to empirical treatment. Finally, in one study, all four different strategies
were compared: initial treatment with acid suppression, “test-and-treat” , “test-and-scope”, and
immediate endoscopy [190]. In that study, prompt endoscopy was initially the most expensive
approach, but after a 1-year follow-up period it became the most cost-effective one as subsequent
costs were reduced.
Like the decision analytic studies, also these clinical studies have their limitations. They were
performed in a specific setting in which the factors, listed in table 5 all have their significant
influence on the outcome. These factors may have a diverse impact in different regions or clinical
settings. For instance, all studies were performed in a secondary care setting and the results may
not be applicable for the dyspeptic patient visiting his primary care physician. Moreover, all
studies used a specific treatment protocol. For example, in the two trials comparing a “test-and-
treat” strategy with prompt endoscopy, all patients testing positive for H. pylori in the “test-and-
treat” group received anti-H. pylori treatment whereas H. pylori positive patients in the endoscopy
group only received such treatment if they had endoscopic evidence of PUD denying FD patients
any possible benefit of anti-H. pylori treatment. Such a study design may have biased the results.
The rationale and limitations of the various approaches of the dyspeptic patient
The optimal approach of the dyspeptic patient in primary care is the one that best serves the
objectives listed in table 1. Frequently, none of the aforementioned strategies will positively serve
all these objectives and in clinical practice none of the strategies is always clearly superior to the
others. What is the most cost-effective strategy is determined by the factors enumerated in table 5
and the significance and impact of most of these factors may vary considerably between different
regions of the world. Even within a single region, however, it is not likely that a single strategy is
the best one in every patient. Sometimes a different approach should be chosen as dictated by the
characteristics of the individual patient (age, family history, comorbidity, fear of cancer etc.).
Therefore, it is the authors' view that, in order to be able to treat the dyspeptic patient in the most
A rational approach to uninvestigated dyspepsia in primary care
27
cost-effective way, the primary care physician should be aware of the factors listed in table 5 and
understand the rationale and limitations of the various approaches of uninvestigated dyspepsia.
If one chooses to prescribe empirical treatment with an acid-suppressive agent, what can be
expected? It is evident that acid-suppressive therapy will be beneficial in patients with PUD and
GERD [192-197]. In FD the benefit of acid suppressive drugs is less clear. Studies examining the
efficacy of acid suppressive agents in this condition are difficult to evaluate [153,157,198-203],
but about half of the studies examining H2RA’s show a modest positive effect. Only a few
randomised-placebo controlled trials studied the efficacy of PPI’s in FD and showed a benefit of
about 10% over placebo [137-140,204]. Taken together with the well known large placebo effect
of any drug in FD [153,157], these data explain that a trial of treatment with an acid-suppressive
agent reduces symptoms in a fair number of patients with uninvestigated dyspepsia. Nevertheless,
several objections can be made to such an approach. The benefit of an attempt to treat the patient
empirically depends on the number of patients becoming permanently symptom-free afterwards or
at least for a long period. Unfortunately, in patients with PUD and GERD, symptoms usually recur
after stopping the treatment [61,193,205,206]. It is very likely that the same can be said about
many patients with FD, as this is also often a chronic condition with the majority of the patients
still experiencing symptoms after one year [7,15,207-209]. Therefore, it can be anticipated that,
unless one is willing to continue acid suppression without a definite diagnosis, a trial with such
medication just postpones endoscopy in most patients. This assumption is supported by the study
of Bytzer et al. [131] who showed that 67% of dyspeptic patients who received empirical
treatment with H2RA’s underwent endoscopy within a year. The second objection that can be
made against this approach is a practical one. If endoscopy is performed after all, signs of PUD or
GERD may be obscured if the medication has not been withdrawn for a sufficiently long period
before endoscopy as commonly occurs in clinical practice. A trial with a prokinetic drug
(cisapride) will be of benefit in patients with GERD and probably in some with PUD and FD and
will also have a considerable placebo effect in FD patients [153,157]. Therefore, it can be
anticipated that, like acid suppression, a trial of such treatment will have a favourable response in a
fair number of patients. Most drawbacks mentioned above for acid suppression, however, are also
pertinent for this class of drugs, be it that prokinetic agents are probably less likely to obscure
endoscopic signs of GERD and PUD. The recently described cardiac side effects of cisapride will
limit its use now.
Chapter 2
28
What about continuing treatment without a definite diagnosis? Although this is an option,
several objections can be made to such an approach. First, patients with PUD will be effectively
treated, but a far more cost-effective treatment (H. pylori eradication) is to be preferred [210].
Second, if patients with GERD, who are likely to respond well to potent acid suppression, are not
subjected to endoscopy, Barrett's metaplasia will not be detected. This condition occurs in about
10 to 15% of all patients with GERD [211-213] and is associated with an increased risk for
oesophageal cancer [214-216], be it that it was recently suggested that this relative risk has been
exaggerated [217]. Recent studies have indeed confirmed the latter [218,219]. Whether or not
failure to diagnose Barrett’s oesophagus is significant depends on one’s view on the necessity of
endoscopic surveillance of these patients. This is still an unsettled issue [214-216,220-226].
Finally, it has been argued that empirical treatment with acid-suppressive agents may lead to a
significant delay in diagnosing malignant disease [227]. In the western world, however, this
contention does not seem to hold as gastrointestinal malignancy is extremely rare in dyspeptic
patients below 45-50 years if alarm symptoms are not present [228-230].
If one chooses to test for H. pylori one should first have knowledge of the reliability of the test
results (its positive and negative predictive value). This is not only dependent on the characteristics
of the test (sensitivity and specificity) but also on the prevalence of the infection in the population.
For instance, as the prevalence of H. pylori infection is decreasing in the younger age group , the
likelihood of a false positive test in this age group increases. This may be acceptable if a “test-and-
scope” strategy is followed as the test can be confirmed by one or more biopsy-based methods, but
it is certainly not acceptable if one follows a “test-and-treat” strategy. In that case, only highly
accurate tests (with very high specificity) are acceptable and serology will soon not be suitable
anymore. Urea breath tests [231,232] and stool antigen tests [233-235] may be valuable
alternatives.
Screening for H. pylori will provide one of two possibilities: a positive test result or a negative
test result. A negative test result leads to the same approach in both the “test-and-scope” and “test-
and-treat” strategies. In such a patient PUD is highly unlikely, leaving FD and GERD as the most
likely diagnoses. In the absence of alarm symptoms malignancies are extremely rare under the age
of 50 [228-230]. Most patients can, therefore, safely be treated blindly with acid-suppression.
Endoscopy will not change the management in most of these patients [177]. In case of a positive
test result the “test-and-scope” strategy will detect most patients with PUD. Anti-H. pylori
A rational approach to uninvestigated dyspepsia in primary care
29
treatment can be limited to these patients as the benefit of such a treatment is only shown
decisively in PUD [236]. Treatment can be guided by susceptibilty testing based on H. pylori
culture. In the “test-and-treat” strategy, however, all H. pylori-positive patients receive anti-H.
pylori treatment. This approach will be beneficial in most patients with PUD and possibly a few
patients with FD, but in the large majority of patients there will be no short-term benefit.
Nevertheless, two additional arguments support the eradication of H. pylori in all patients with
uninvestigated dyspepsia. First, in contrast to all other therapeutic options, anti-H. pylori treatment
only takes 1 to 2 weeks and, if successful, eliminates a potential cause of dyspepsia for lifetime, as
re-infection is rare in the Western world [69,237-242]. Second, it may have a positive effect by
preventing future disease, especially PUD [71-73]. Whether gastric cancer is prevented by
eradication of H. pylori [243] is still highly uncertain but some have advocated prophylactic anti-
H. pylori treatment for patients on long term acid-suppressive therapy as these patients may be at
increased risk of developing gastric cancer [244-246]. This issue is still debated [247,248] but it
may support H. pylori eradication in dyspeptic patients.
On the other hand, several arguments have been cited against treatment of the infection in all
patients with uninvestigated dyspepsia in whom H. pylori is detected. First of all, it will not
diminish symptoms in the large majority of patients and just expose them to the side effects of the
anti-H. pylori regimen [249-253] even though these are usually mild and in a trial setting form a
reason to discontinue treatment in less than 5% of all patients [250-254].
Second, treating H. pylori infection in all these patients may induce antibiotic resistance. To
what extent this occurs in clinical practice is not known. Antibiotic resistance in H. pylori is
indeed a major problem [254-258] and its prevalence seems to be increasing [259,260]. Whether
this increase is caused by anti-H. pylori treatment or by the prescription of antibiotics for other
indications, however, is not known. As the current anti-H. pylori regimens are so effective, with
eradication rates of > 95% in susceptible strains [255], induction of resistance should be a rare
event, as long as the regimen is properly prescribed and time is taken to instruct and motivate the
patient [261]. Third, eradication of H. pylori may induce other diseases, especially GERD
[124,125,262] but this does not seem to be a clinically significant problem in the majority of
patients [110,263]. Considering all these arguments favouring and renouncing H. pylori treatment
in uninvestigated dyspepsia (table 6), it is the authors’ view that the weight of the evidence favours
treatment of the infection when it is diagnosed.
Chapter 2
30
Table 6.
Arguments favouring and renouncing Helicobacter pylori treatment in uninvestigated
dyspepsia
• favouring anti-H. pylori treatment
• a single short-term treatment, with life-long effects when beneficial
• prevents future disease (PUD, gastric cancer)
• renouncing anti-H. pylori treatment
• no benefit in most patients
• exposing patients to side-effects
• induction of anti-biotic resistance (H. pylori and other gastrointestinal bacteria)
• possible induction of GERD after H. pylori eradication
Conclusions and recommendations
It is unlikely that a single strategy will be applicable in all dyspeptic patients in primary care.
Nevertheless, in our view, the “test-and-treat” strategy is currently a rational way to deal with
many patients with uncomplicated dyspepsia, provided that the following conditions are met. First,
the positive predictive value of the test should be adequate. Therefore, an accurate test should be
used and the prevalence of the infection should be monitored. Second, an effective anti-H. pylori
treatment regimen should be used and time should be taken to instruct the patient in order to
improve compliance. If the prevalence of H. pylori gets low, as is the case in the younger age
group in western countries, the “test-and-treat” strategy becomes less suitable. “Test-and-scope”
becomes more appropriate as the positive non-invasive H. pylori test can be confirmed by two or
more biopsy based tests. In our view, if the infection is confirmed, it should be treated even if no
PUD is detected as such an approach may prevent future diagnostic dilemmas and possibly future
disease. In both strategies all patients testing negative for H. pylori can safely be treated with acid
suppression (or prokinetics if symptomatology suggests a motility disorder). If this treatment is
successful, it should be tried to gradually stop the medication. If this approach fails and the patient
remains symptomatic endoscopy should be considered mainly to reassure the patient, as it is
unlikely to reveal underlying disease or change treatment. If the prevalence of H. pylori gets very
low as is likely to be the case in the future in western societies, non-invasive testing for the micro-
organism is probably not opportune any more. In that situation empirical treatment may be the way
A rational approach to uninvestigated dyspepsia in primary care
31
to proceed even though it may just postpone endoscopy in quite some patients. Acid-suppressive
drugs, especially PPI’s, are then the drugs of choice. Prokinetics may become an alternative but
cisapride has recently been withdrawn from the market and other comparably effective prokinetic
drugs, both in patients with FD and GERD, are not yet available. In some patients, however, the
approach should be individualized as dictated by their personal history. Any alarm symtom should
urge for an immediate endoscopy. A strong family history for peptic ulcer disease may be a
persuasive argument in favour of a test and treat approach even if the prevalence of H. pylori is
low. If fear of cancer is deep-rooted early endoscopy should be considered. Therefore, the taking
of an adequate medical history remains the mainstay of the approach of every patient. This holds
no less for the dyspeptic patient in primary care.
References
1. Crean GP, Card WI, Beatti AD, J. HR, James WB, Knill-Jones RP et al. Ulcer-like dyspepsia.
Scandinavian Journal of Gastroenterology 1982; 17 (suppl 79): 9-15.
2. Colin-Jones DG. Management of dyspepsia: report of a working party. Lancet 1988; 1: 576-579.
3. Barbara L, Camilleri M , Corinaldesi R, Crean GP, Heading RC, Johnson AG et al. Definition
and investigation of dyspepsia. Digestive Diseases and Science 1989; 34: 1271-1276.
4. Heading RC . Definitions of Dyspepsia. Scandinavian Journal of Gastroenterology 1991; 26 (suppl
182): 1-6.
5. Doll R, Jones AF, Bucjatzsch MM. Occupational factors in the aetiology of gastric and duodenal
ulcers, with an estimate of their incidence in the general population. Medical research council reports
series 1951; 276: 1-9.
6. Tibblin G. Ulcusfrekvens bland 50-ariga man. Lakartidningen 1966; 63: 4825-4829.
7. Weir RD, Backett EM. Studies of the epidemiology of peptic ulcer in a rural community: prevalence
and natural history of dyspepsia and peptic ulcer. Gut 1968; 9: 75-83.
8. Johnsen R, Straume B, Forde OH. Peptic ulcer disease and non-ulcer dyspepsia - a disease and a
disorder. Scandinavian Journal of Primary Health Care 1988; 6: 239-243.
9. Jones R, Lydeard S. Prevalence of symptoms of dyspepsia in the community. British Medical
Journal 1989; 298: 30-32.
10. Jones RH, Lydread SE, Hobbs FDR, Kenkre JE, Williams EI, Jones SJ et al. Dyspepsia in
England and Scotland. Gut 1990; 31: 401-405.
11. Bernersen B, Johnsen R, Straume B, Burhol PG, Jenssen TG, Stakkevold PA. Towards a true
prevalence of peptic ulcer: the Sorreisa gastrointestinal disorder study. Gut 1990; 31: 989-992.
Chapter 2
32
12. Knill-Jones RP. Geographical differences in the prevalence of dyspepsia. Scandinavian Journal of
Gastroenterology 1991; 26 (suppl 182): 17-24.
13. Talley NJ, Zinsmeister AR, Schleck CD, Melton LJ . Dyspepsia and dyspepsia subgroups: a
population-based study. Gastroenterology 1992; 102: 1259-1268.
14. Agreus L, Svardsudd K , Nyren O, Tibblin G. The epidemiology of abdominal symptoms:
prevalence and demographic characteristics in a Swedish adult population. Scandinavian Journal of
Gastroenterology 1994; 29: 102-109.
15. Kay L, Jorgensen T. Epidemiology of upper dyspepsia in a random population. Prevalence,
incidence, natural history, and risk factors. Scandinavian Journal of Gastroenterology 1994; 29: 2-6.
16. Penston JG, Pounder RE. A survey of dyspepsia in Great Britain. Alimentary Pharmacology &
Therapeutics 1996; 10: 83-89.
17. Nyren O . Functional dyspepsia - a disorder of the stomach ? The Stomach. 1990: 385-415.
18. Holtmann G, Goebell G , Talley NJ. Dyspepsia in consulters and non-consulters: prevalence, health-
care seeking behaviour and risk factors. European Journal of Gatroenterology & Hepatology 1994 ; 6:
917-924.
19. Heikkinen M, Pikkarainen P, Takala J, Julkunen R. General practicioners' approach to dyspepsia.
Scandinavian Journal of Gastroenterology 1996; 31: 648-653.
20. Muris JWM, Starmans R , Fijten GH, Crebolder HFJM, Krebber TFWA, Knottnerus JA.
Abdominal pain in general practice. Family Practice 1993; 10: 387-390.
21. Warndorff DK, Knottnerus JA, Huijnen LGJ, Starmans R. How well do general practitioners
manage dyspepsia ? Journal of the Royal College of General Practitioners 1989; 39: 499-502.
22. Bodger K, Daly MJ, Heatly RV. Prescribing patterns for dyspepsia in primary care: a prospective
study of selected general practitioners. Alimentary Pharmacology & Therapeutics 1996; 10: 889-895.
23. Anonymous. American Gastroenterology Association medical position paper: evaluation of
dyspepsia. Gastroenterology 1997; 114: 579-581.
24. British Society of Gastroenterology. Dyspepsia Management Guidelines. Guidelines in
Gastroenterology 1996; 1: 1-8.
25. Numans ME, de Wit NJ, Geerdes RHM, Muris JWM, Starmans R, Postema PhJ et al. NHG-
standaard maagklachten, eerste herziening. Huisarts en Wetenschap 1996; 39: 565-77.
26. Talley NJ, Colin-Jones D, Koch KL, Nyren O, Stanghellini V. Functional dyspepsia: a
classification with guidelines for diagnosis and management. Gastroenterology International 1991; 4:
145-160.
27. Klauser AG, Schindlbeck NE, Muller-Lissner SA. Symptoms in gastro-oesophageal reflux disease.
Lancet 1990; 335: 205-208.
A rational approach to uninvestigated dyspepsia in primary care
33
28. Silverstein BD, Pope CE . Role of diagnostic tests in esophageal evaluation. American Journal of
Surgery 1980; 139: 744-748.
29. International Agency for Research on Cancer . Cancer incidence in five continents. IARC
Monograph on the evaluation of carcinogenic risks to humans 1987 ; 88: 1-970.
30. Lam SK, Talley NJ. Report of the 1997 Asia pacific consensus conference on the management of
Helicobacter pylori infection. Journal of Gastroenterology and Hepatology 1997; 13: 1-12.
31. Heikinnen M, Pikkarainen P, Takala J, Rasanen H, Julkunen R. Etiology of dyspepsia: four
hundred unselected consecutive patients in general practice. Scandinavian Journal of Gastroenterology
1995; 30: 519-523.
32. Kagevi I, Lofstedt S, Persson LG . Endoscopic findings and diagnoses in unselected dyspeptic
paptients at a primary health care center. Scandinavian Journal of Gastroenterology 1989; 24: 145-
150.
33. Hansen JM. Dyspepsia in primary care. Clinical decision making and pharmacotherapy in non-
organic dyspepsia . Thesis, Odense University, Odense, Danmark 1995.
34. Ayoola EA, al Rashed RS, al Mofleh IA, al Faleh FZ, Laajam M. Diagnostic yield of upper
gastrointestinal endoscopy in relation to age and gender: a study of 10112 Saudi patients. Hepato-
Gastroenterology 1996; 43: 409-415.
35. Hungin P. Open access gastroscopy. Thesis, University of Newcastle upon Tyne, Newcastle upon
Tyne, England 1995.
36. Hallissey MT, Allum WH, Jewkes AJ, Ellis DJ, Fielding JW. Early detection of gastric cancer.
British Medical Journal 1990; 301: 513-515.
37. Fedail SS, Araba BM, Homeida MM, Ghandour ZM . Upper gastrointestinal fibreoptic endoscopy
experience in the Sudan. Analysis of 2500 endoscopies. Lancet 1983; 2: 897-899.
38. Mansi C, Mela GS, Pasini D, Grosso M, Corti L, Moretti M et al. Patterns of dyspepsia in patients
with no clinical evidence of organic diseases. Digestive Diseases and Science 1990; 35: 1452-1458.
39. Holdstock G, Wiseman M, Loehry CA. Open-access endoscopy service for general practitioners.
British Medical Journal 1979; 1: 457-459.
40. Fjosne U, Kleveland PM, Waldum H, Halvorsen T, Petersen H. The clinical benefit of routine
upper gastrointestinal endoscopy. Scandinavian Journal of Gastroenterology 1986; 21: 433-440.
41. Capurso L, Koch M, Dezi A, Koch G, Di Ciocco U. Towards a quantitative diagnosis of dyspepsia:
the value of clinical symptoms. Italian Journal of Gastroenterology 1988; 20: 191-202.
42. Stanghellini V, Tosetti C, Paternico A, Barbara G, Morselli-Labate AM, Monetti N et al. Risk
indicators of delayed gastric emptying of solids in patients with functional dyspepsia.
Gastroenterology 1996; 110: 1036-1042.
Chapter 2
34
43. Davenport PM, Morgan AG, Darnborough A, De Dombal FT. Can preliminary screening of
dyspeptic patients allow more effective use of investigational techniques? British Medical Journal
1985; 290: 217-220.
44. Nyren O, Adami HO, Gustavsson S, Lindgren PG, Loof L, Nyberg A. The epigastric distress
syndrome - a possible disease entity identified by history and endoscopy in patients with nonulcer
dyspepsia. Journal of Clinical Gastroenterology 1987; 9: 303-309.
45. Gear MW, Ormiston MC, Barnes RJ, Rocyn-Jones J, Voss GC . Endoscopic studies of dyspepsia
in the community: an "open-access" service. British Medical Journal 1980; 280: 1135.
46. Johannessen T, Petersen H, Kleveland PM, Dybdahl JH, Sandvik AK, Brenna E et al. The
predicitve value of history in dyspepsia. Scandinavian Journal of Gastroenterology 1990; 25 : 689-
697.
47. Bytzer P, Schaffalitzky de Muckadell OB. Prediction of major pathologic conditions in dyspeptic
patients referred for endoscopy. A prospective validation study of a scoring system. Scandinavian
Journal of Gastroenterology 1992; 27: 987-992.
48. Talley NJ, Weaver AL, Tesmer DL, Zinsmeister AR. Lack of discriminant value of dyspepsia
subgroups in patients referred for upper endoscopy. Gastroenterology 1993; 105: 1378-1386.
49. Williams B, Luckas M, Ellingham JH, Dain A, Wicks AC . Do young patients with dyspepsia need
investigation? Lancet 1988; 2: 1349-1351.
50. Saunders JH, Oliver RJ, Higson DL. Dyspepsia: incidence of a non-ulcer disease in a controlled
trial of ranitidine in general practice. British Medical Journal 1986; 292: 665-668.
51. The Danish Dyspepsia Study Group. Value of the unaided clinical diagnosis in dyspeptic patients in
primary care. American Journal of Gastroenterology 2001; 96: 1417-1421.
52. Adang RP, Ambergen AW , Talmon JL, Hasman A, Vismans JF, Stockbrugger RW. The
discriminative value of patient characteristics and dyspeptic symptoms for upper gastrointestinal
endoscopic findings: a study on the clinical presentation of 1,147 patients. Digestion 1996; 57: 118-
134.
53. El-Seraq HB, Sonnenberg A. Opposing time trends of peptic ulcer and reflux disease. Gut 1997; 43:
327-333.
54. Baldi F, GISMAD . Prevalence of reflux esophagitis (RE) in Italy. Gastroenterology 1997; 112: A63 .
55. Prach AT, MacDonald TA, Hopwood DA, Johnston DA. Increasing incidence of Barrett's
oesophagus: education, enthusiasm, or epidemiology ? Lancet 1997; 350: 933.
56. Blaser MJ. Helicobacter pylori and gastric diseases. British Medical Journal 1998; 316: 1507-1510.
57. Warren JR, Marshall BJ. Unidentified curved bacillus on the gastric epithelium in active chronic
gastritis. Lancet 1983; 1: 1273-1275.
A rational approach to uninvestigated dyspepsia in primary care
35
58. Kuipers EJ, Thijs JC, Festen HPM. Helicobacter pylori and peptic ulcer disease. Alimentary
Pharmacology & Therapeutics 1995; 9 (suppl 2): 59-69.
59. Coghlan JG, Gilligan D, Humphries H, McKenna D, Dooley C, Sweeney E et al. Campylobacter
pylori and recurrence of duodenal ulcers: a 12 month follow-up study. Lancet 1987; 2: 1109-1111.
60. Lam SK, Ching CK, Lai KC, Wong BC, Lai CL , Chan CK et al. Does treatment of Helicobacter
pylori with antibiotics alone heal duodenal ulcer ? A randomised double blind placebo controlled
study. Gut 1997; 41: 43-48.
61. Marshall BJ, Goodwin CS, Warren JR. Prospective double-blind trial of duodenal ulcer relapse
after eradiction of Campylobacter pylori. Lancet 1988; 2: 1437-1442.
62. Hentschel E, Brandstatter G, Dragosics B, Hirschl AM, Nemec H, Schutze K et al. Effect of
ranitidine and amoxicilline plus metronidazole on the eradicition of Helicobacter pylori and the
recurrence of duodenal ulcer . New England Journal of Medicine 1993; 328: 308-312.
63. Mantzaris GJ, Hatzis A, Tamvakologos G, Petraki K, Spiliades C, Triadaphyllou G. Prospective
randomised investigator-blind trial of Helicobacter pylori infection treatment in patients with
refractory duodenal ulcers. Healing and long term relapse rates. Digestive Diseases and Science 1993;
38: 1132-1136.
64. Seppala K, Pikkarainen P, Karvonen AL, Gormsen M, group Fgus. The role of Helicobacter
pylori eradication in gastric ulcer healing and relapses. Gastroenterology 1992; 102: A162.
65. Seppala K, Pikkarainen P, Sipponen P, Kivilaakso E, Gormsen MH. Cure of peptic gastric ulcer
associated with eradication of Helicobacter pylori. Finnish Gastric Ulcer Study Group. Gut 1995; 36:
834-837.
66. Labenz J, Borsch G. Evidence for the essential role of Helicobacter pylori in gastric ulcer disease.
Gut 1994; 35: 19-22.
67. Rauws EA, Tytgat GN. Cure of duodenal ulcer associated with eradication of Helicobacter pylori.
Lancet 1990; 335: 1233-1235.
68. Unge P, Gad A, Eriksson K, Bergman B, Carling L, Estrom P et al. Amoxicillin added to
omeprazole prevents relapse in the treatment of duodenal ulcer patients. European Journal of
Gatroenterology & Hepatology 1993; 5: 325-331.
69. Forbes GM, Glaser ME, Cullen DJE, Warren JR, Christiansen KJ, Marshall BJ et al. Duodenal
ulcer treated with Helicobacter pylori eradication: seven year follow-up. Lancet 1994; 343: 258-260.
70. Nomura A, Stemmermann GN, Chyou PH, Perez-Perez GI, Blaser MJ. Helicobacter pylori
infection and the risk for duodenal and gastric ulceration. Annals of Internal Medicine 1994; 120:
977-981.
Chapter 2
36
71. Sipponen P, Seppala K , Aarynen M, Helske T, Kettunen P. Chronic gastritis and gastroduodenal
ulcer: a case control study on risk of coexisiting duodenal or gastric ulcer in patients with gastritis.
Gut 1989; 30: 922-929.
72. Sipponen P, Varis K, Fraki O, Korri UM, Seppala K, Siurala M. Cumulative 10 year risk of
symptomatic duodenal and gastric ulcer disease in patients with or without chronic gastritis.
Scandinavian Journal of Gastroenterology 1990; 25: 966-973.
73. Cullen DJE, Collins J , Christiansen KJ, Epis J, Warren JR, Cullen KJ. Long term risk of peptic
ulcer disease in people with Helicobacter pylori infection - a community based study.
Gastroenterology 1993; 104 (suppl 2): A60.
74. Jyotheeswaran S, Shah AN, Jin HO, Potter GD, Ona FV, Chey WY. Prevalence of Helicobacter
pylori in peptic ulcer patients in greater Rochester, NY: is empirical triple therapy justified ?
American Journal of Gastroenterology 1998; 93: 574-578.
75. Sprung DJ. The natural history of duodenal ulcer disease and how it relates to Helicobacter pylori.
American Journal of Gastroenterology 1997; 92: 1655.
76. Ciociola AA, McSorley DJ, Turner K, Sykes D, Palmer JBD. Helicobacter pylori infection rates in
duodenal ulcer patients in the United States may be lower than previously estimated. American
Journal of Gastroenterology 1999; 94: 1834-1840.
77. Peterson WL, Ciociola AA, Sykes DL, McSorley DJ, Webb DD, The RBC H.pylori study group.
Ranitidine bismuth citrate plus clarithromycin is effective for healing duodenal ulcers, eradicating
Helicobacter pylori and reducing ulcer recurrence. Alimentary Pharmacology & Therapeutics 1996;
10: 251-261.
78. Schubert M, De Witt JM, Taylor CA. Prospective evaluation of the prevalence of H. pylori in
duodenal abd gastric ulcer: is its role overestimated ? Gastroenterology 1999; 116: A305.
79. Higuchi K, Arakawa T, Fuijwara Y, Uchida T, Tominaga K, Watanabe T et al. Is Helicobacter
pylori-negative duodenal ulcer masked by the high prevalence of H.pylori infection in the general
population ? American Journal of Gastroenterology 1999; 94: 3083-3084.
80. EUROGAST study group. An international association between Helicobacter pylori infection and
gastric cancer. Lancet 1993; 341: 1359-1362.
81. Hansen S, Melby KK, Aase S, Jellum E, Vollset SE. Helicobacter pylori infection and risk of cardia
cancer and non-cardia gastric cancer. A nested case-control study. Scandinavian Journal of
Gastroenterology 1999; 34: 353-360.
82. Jaskiewicz K, Louwrens HD, Woodroof CW, Van Wyk MJ, Price SK. The association of
Campylobacter pylori with mucosal pathological changes in a population at risk for gastric cancer.
South African Medical Journal 1989; 75: 417-419.
A rational approach to uninvestigated dyspepsia in primary care
37
83. Sipponen P, Kosunen TU, Valle J, Riihela M, Seppala K. Helicobacter pylori infection and chronic
gastritis in gastric cancer. J Clin Pathol 1992; 45: 319-323.
84. Hansson LE, Engstrand L, Nyren O, Evans DJ, Jr., Lindgren A, Bergstrom R et al. Helicobacter
pylori infection: independent risk indicator of gastric adenocarcinoma. Gastroenterology 1993; 105:
1098-1103.
85. Kuipers EJ, Gracia-Casanova M, Pena AS, Pals G, Van Kamp G, Kok A et al. Helicobacter
pylori serology in patients with gastric carcinoma. Scandinavian Journal of Gastroenterology 1993;
28: 433-437.
86. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N et al.
Helicobacter pylori infection and the risk of gastric carcinoma. New England Journal of Medicine
1991; 325: 1127-1131.
87. Forman D, Newell DG, Fullerton F, Yarnell JWG, Stacey AR, Wald N et al. Association between
infection with Helicobacter pylori and risk of gastric cancer: evidence from a prospective
investigation. British Medical Journal 1991; 302: 1302-1305.
88. Nomura A, Stemmermann GN, Chyou PH, Kato IK, Perez-Perez GI, Blaser MJ. Helicobacter
pylori and gastric carcinoma among Japanese Americans in Hawaii. New England Journal of
Medicine 1991; 325: 1132-1136.
89. Talley NJ, Zinsmeister AR, Weaver A, DiMagno EP, Carpenter HA, Perez-Perez GI et al.
Gastric adenocarcinoma and Helicobacter pylori infection. J Natl Cancer Inst 1991; 83: 1734-1739.
90. International Agency for Research on Cancer . Schistosomes, liver flukes and Helicobacter pylori.
IARC Monograph on the evaluation of carcinogenic risks to humans 1994; 61: 1-241.
91. Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, Isaacson PG. Helicobacter pylori-associated
gastritis and primary B-cell gastric lymphoma. Lancet 1991; 338: 1175-1176.
92. Stolte M. Helicobacter pylori gastritis and gastric MALT-lymphoma. Lancet 1992; 339: 745-746.
93. Du MQ, Isaacson PG. Recent advances in our understanding of the biology and pathogenesis of
gastric mucosa-associated lymphoid tissue (MALT) lymphoma. Forum Genova 1998; 8: 162-173.
94. Lepore MJ, Smith FB, Bonanno CA. Campylobacter-like organisms in patients with Menetriers
disease. Lancet 1988; 1: 466.
95. Bayerdorffer E, Ritter MM, Hatz R, Brooks W, Stolte M. Menetriers disease and Helicobacter
pylori disease. New England Journal of Medicine 1993; 329: 60.
96. Bayerdorffer E, Ritter MM, Hatz R, Brooks W, Ruckdeschel G, Stolte M. Healing of protein
losing hypertrophic gastropathy by eradication of Helicobacter pylori infection - is Helicobacter
pylori a pathogenic factor in Menetriers disease ? Gut 1994; 35: 701-704.
97. Lambert JR. The role of Helicobacter pylori in nonulcer dyspepsia: a debate for. Gastroenterology
Clinics of North America 1993; 22: 141-151.
Chapter 2
38
98. Talley NJ. The role of Helicobacter pylori in nonulcer dyspepsia. A debate against. Gastroenterology
Clinics of North America 1993 ; 22: 153-167.
99. Armstrong D. Helicobacter pylori and dyspepsia. Scandinavian Journal of Gastroenterology 1996;
215: 38-47.
100. Jaakkimainen RL, Boyle E, Tudiver F. Is Helicobacter pylori associated with non-ulcer dyspepsia
and will eradication improve symptoms? A meta-analysis. British Medical Journal 1999; 319: 1040-
1044.
101. Talley NJ. A critique of therapeutic trials in Helicobacter pylori positive functional dyspepsia.
Gastroenterology 1994; 106: 1174-1183.
102. Veldhuyzen van Zanten SJO . A systematic overview (meta-analysis) of outcome measures in
Helicobacter pylori gastritis trials and functional dyspepsia. Scandinavian Journal of Gastroenterology
1993; 28 (suppl 199): 40-43.
103. Talley NJ, Vakil N, Ballard ED, Fennerty MB. Absence of benefit of eradicating Helicobacter
pylori in patients with nonulcer dyspepsia. New England Journal of Medicine 1999; 341: 1106-1111.
104. Talley NJ, Janssens J, Lauritsen K, Racz I, Bolling-Sternevald E, Havu N et al. H.pylori
eradication therapy for non-ulcer dyspepsia. A randomized double-blind placebo controlled longterm
trial. Gut 1998; 43 (suppl 2): A79.
105. McColl K, Murray L, El-Omar E, Dickson A, El-Nujumi A, Wirz A et al. Symptomatic benefit
from eradicting Helicobacter pylori infection in patients with nonulcer dyspepsia. New England
Journal of Medicine 1998; 339: 1869-1874.
106. Blum AL, Talley NJ, O'Morain C, Veldhuyzen van Zanten S, Labenz J, Stolte M et al. Lack of
effect of treating Helicobacter pylori infection in patients with nonulcer dyspepsia. New England
Journal of Medicine 1998; 339: 1875-1881.
107. Bruley des Varannes S, Flejou JF, Colin R, Zaim M, Meunier A. Helicobacter pylori eradication
in non-ulcer dyspepsia: a randomized, double-blind, placebo-controlled study with a 12-month follow-
up. Gastroenterology 2000 ; 118: A468.
108. Froehlich F, Convers JJ, Wietlisbach V, Burnand B, Hildebrand P, Schneider C et al.
Helicobacter pylori eradication treatment does not benefit patients with non-ulcer dyspepsia.
Gastroenterology 2000; 118: A469.
109. Koelz HR, Arnold R, Stolte M, Blum AL, FROSCH Study Group. Treatment of Helicobacter
pylori (Hp) does not improve symptoms of functional dyspepsia (FD). Gastroenterology 1998; 114:
A182.
110. Malfertheiner P, Fischbach W, Layer P, Moessner J, Stolte M, Leodolter A et al. Elan study
proves symptomatic benefit of Helicobacter pylori eradication in functional dyspepsia (FD).
Gastroenterology 2000; 118: A440.
A rational approach to uninvestigated dyspepsia in primary care
39
111. Miwa H, Hirose M, Kikuchi S, Terai T, Iwakzaki R, Kobayashi O et al. How useful is the
detection kit for antibody to Helicobacter pylori in urine (urinalisa) in clinical practice. American
Journal of Gastroenterology 1999; 94: 3460-3463.
112. Moayyedi P, Soo S, Deeks J, Forman D, Mason J, Innes M et al. Systematic review and economic
evaluation of Helicobacter pylori eradication treatment for non-ulcer dyspepsia. British Medical
Journal 2000; 321: 659-664.
113. Dhali GK, Garg PK, Sharma MP. Role of anti-Helicobacter pylori treatment in H. pylori-positive
and cytoprotective drugs in H. pylori-negative, non-ulcer dyspepsia: results of a randomized, double-
blind, controlled trial in Asian Indians. Journal of Gastroenterology and Hepatology 1999; 14: 523-
528.
114. Greenberg PD, Cello JP . Lack of effect of treatment for Helicobacter pylori on symptoms of
nonulcer dyspepsia. Archives of Internal Medicine 1999; 159: 2283-2288.
115. David J, Lee A, Forbes N, Patel G, Terrany B, Ozick LA. Helicobacter pylori eradication for non-
ulcer dyspepsia: a prospective, double-blind, randomized, placebo controlled study. Gastroenterology
1996; 110: A91.
116. Passos MCF, Coelho LGV, Gloria ALF, Aguiar ROA, Correa MM, Bueno ML et al. H. pylori
eradication for functional dyspepsia: a long-term, randomised, prospective, double-blind, placebo-
controlled study. Gut 1998; 43 (suppl 2): A81.
117. Sheu BS, Lin CY, Lin XZ, Shiesh SC, Yang HB, Chen CY. Long-term outcome of triple therapy in
Helicobacter pylori-related nonulcer dyspepsia: a prospective controlled assessment. American
Journal of Gastroenterology 1996; 91: 441-447.
118. Laine L, Schoenfeld P, Fennerty MB. Therapy for Helicobacter pylori in patients with nonulcer
dyspepsia. A meta-analysis of randomized, controlled trials. Annals of Internal Medicine 2001; 134:
361-369.
119. Vicari JJ, Falk GW, Goldblum JR, Easley K, Peek RM, Perez-Perez GI et al. Helicobacter pylori
is not a pathogenic factor in GERD or its complications. Gastroenterology 1997; 112: A322.
120. Werdmuller BF, Loffeld RJ . Helicobacter pylori infection has no role in the pathogenesis of reflux
esophagitis. Digestive Diseases and Science 1997; 42: 103-105.
121. O'Connor HJ. Review article: Helicobacter pylori and gastro-oesophageal reflux disease - clinical
implications and management. Alimentary Pharmacology & Therapeutics 1999; 13: 117-127.
122. Graham DY, Malaty HM , Evans DG, Klein PD, Adam E. Epidemiology of Helicobacter pylori in
an asymptomatic population in the united states. Effect of age race, and socioeconomic status.
Gastroenterology 1991; 100: 1495-1501.
123. Banatvala N, Mayo K, Megraud F, Jennings R, Deeks JJ, Feldman RA. The cohort effect and
Helicobacter pylori. Journal of Infectious Diseases 1993; 168: 219-221.
Chapter 2
40
124. Labenz J, Blum AL, Bayerdorffer E, Meining A, Stolte M, Borsch G. Curing Helicobacter pylori
infection in patients with duodenal ulcer may provoke reflux esophagitis. Gastroenterology 1997; 112:
1442-1447.
125. Fallone CA, Barkun AN, Friedman GD, Mayrand S, Loo V, Beech R et al. Is Helicobacter pylori
eradication associated with gastroesophageal reflux disease ? American Journal of Gastroenterology
2000; 95: 914-920.
126. Vakil N, Hahn B, McSorley D. Recurrent symptoms and gastro-oesophageal reflux disease in
patients with duodenal ulcer treated for Helicobacter pylori infection. Alimentary Pharmacology &
Therapeutics 2000; 14: 45-51.
127. Schwizer W, Thumshirn M, Dent J, Guldenschuh I, Menne D, Cathomas G et al. Helicobacter
pylori and symptomatic relapse of gastro-oesophageal reflux disease: a randomised controlled trial.
Lancet 2001; 357: 1738-1742.
128. McColl KEL, Dickson A, El-Nujumi A, El-Omar E, Kelman A. Symptomatic benefit 1-3 years
after H.pylori eradication in ulcer patients: impact of gastroesophageal reflux disease. American
Journal of Gastroenterology 1999; 95: 101-105.
129. Kahn K, Greenfield S . Endoscopy in the Evaluation of Dyspepsia. United States 1984. Health and
Public Policy Committee, American College of Physicians, Philadelphia, Pennsylvania. Annals of
Internal Medicine 1985; 102: 266-269.
130. Talley NJ, Silverstein MD, Agreus L, Nyren O, Sonnenberg A, Holtzmann G. AGA Technical
review: evaluation of dyspepsia. Gastroenterology 1998; 114: 582-595.
131. Bytzer P, Hansen JM, Schaffalitzky de Muckadell OB. Empirical H2-blocker therapy or prompt
endoscopy in management of dyspepsia. Lancet 1994; 343: 811-816.
132. Hungin APS, Thomas PR, Bramble MG, Corbett WA, Idle N, Contractor BR et al. What
happens to patients following open access gastroscopy ? An outcome study from general practice.
British Journal of General Practice 1994; 44: 519-521.
133. Jones R. What happens to patients with non-ulcer dyspepsia after endoscopy? Practitioner 1988; 232:
75-78.
134. Lydeard S, Jones R. Factors affecting the decision to consult with dyspepsia: comparison of
conslters and non-consulters. Journal of the Royal College of General Practitioners 1989; 39: 495-498.
135. Nyren O, Adami HO, Gustavsson S, Loof L, Nyberg A. Social and economic effects of non-ulcer
dyspepsia. Scandinavian Journal of Gastroenterology 1985; 20 (suppl 109): 41-45.
136. Brown C, Rees WD . Dyspepsia in general practice. British Medical Journal 1990; 300: 829-830.
137. Talley NJ, Meineche-Schmidt V, Pare P, Duckworth M, Raisanen P, Pap A et al. Efficacy of
omeprazole in functional dyspepsia: double-blind, randomized, placebo-controlled trials (the Bond
and Opera studies). Alimentary Pharmacology & Therapeutics 1998; 12: 1055-1065.
A rational approach to uninvestigated dyspepsia in primary care
41
138. Lauritsen K, Aalykke C, Havelund T, Knudsen T, Glise H, Unge P et al. Effect of omeprazole in
functional dyspepsia: a double-blind, randomized, placebo-controlled study. Gastroenterology 1996;
110: A702.
139. Blum AL, Arnold R, Koelz HR, Stolte M, FROSCH Study Group. Treatment of functional
dyspepsia (FD) with omeprazole and ranitidine. Gastroenterology 1997; 112: A73.
140. Peura DA, Kovacs TO, Metz D, Gudmundson JL, Pilmer BL. Low-dose lansoprazole: effective
for non-ulcer dyspepsia (NUD). Gastroenterology 2000; 113: A2418.
141. Richter JE, Long JF. Cisapride for gastroesophageal reflux disease: a placebo-controlled, double-
blind study. American Journal of Gastroenterology 1995; 90: 423-430.
142. Castell DO, Sigmund C, Jr., Patterson D, Lambert R, Hasner D, Clyde C et al. Cisapride 20 mg
b.i.d. provides symptomatic relief of heartburn and related symptoms of chronic mild to moderate
gastroesophageal reflux disease. CIS-USA-52 Investigator Group. American Journal of
Gastroenterology 1998; 93: 547-552.
143. Vigneri S, Termini R , Leandro G, Badalamenti S, Pantalena M, Savarino V et al. A comparison
of five maintenance therapies for reflux esophagitis. New England Journal of Medicine 1995; 333:
1106-1110.
144. Galmiche JP, Fraitag B, Filoche B, Evreux M, Vitaux J, Zeitoun P et al. Double-blind comparison
of cisapride and cimetidine in treatment of reflux esophagitis. Digestive Diseases and Science 1990;
35: 649-655.
145. Inauen W, Emde C, Weber B, Armstrong D, Bettschen HU, Huber T et al. Effects of ranitidine
and cisapride on acid reflux and oesophageal motility in patients with reflux oesophagitis: a 24 hour
ambulatory combined pH and manometry study. Gut 1993; 34: 1025-1031.
146. Koelz HR. Treatment of reflux esophagitis with H2-blockers, antacids and prokinetic drugs. An
analysis of randomized clinical trials. Scandinavian Journal of Gastroenterology 1989; 156: 25-36.
147. McCallum RW, Ippoliti AF, Cooney C, Sturdevant RA. A controlled trial of metoclopramide in
symptomatic gastroesophageal reflux. New England Journal of Medicine 1977; 296: 354-357.
148. Toussaint J, Gossuin A, Deruyttere M, Huble F, Devis G. Healing and prevention of relapse of
reflux oesophagitis by cisapride. Gut 1991; 32: 1280-1285.
149. Baldi F, Bianchi PG, Dobrilla G, Iascone C, Lobello R, Marzio L et al. Cisapride versus placebo
in reflux esophagitis. A multicenter double- blind trial. Journal of Clinical Gastroenterology 1988; 10:
614-618.
150. Arvanitakis C, Nikopoulos A, Theoharidis A, Giannoulis E, Vagios I, Anthopoulou H et al.
Cisapride and ranitidine in the treatment of gastro-oesophageal reflux disease--a comparative
randomized double-blind trial. Alimentary Pharmacology & Therapeutics 1993; 7: 635-641.
Chapter 2
42
151. Geldof H, Hazelhoff B, Otten MH. Two different dose regimens of cisapride in the treatment of
reflux oesophagitis: a double-blind comparison with ranitidine. Alimentary Pharmacology &
Therapeutics 1993; 7: 409-415.
152. Dakkak M, Jones BP, Scott MG, Tooley PJ, Bennett JR. Comparing the efficacy of cisapride and
ranitidine in oesophagitis: a double-blind, parallel group study in general practice. British Journal of
Clinical Practice 1994; 48: 10-14.
153. Talley NJ. Drug treatment of functional dyspepsia. Scandinavian Journal of Gastroenterology 1991;
182: 47-60.
154. Finney JS, Kinnersley N, Hughes M, O'Bryan-Tear CG, Lothian J. Meta-analysis of antisecretory
and gastrokinetic compounds in functional dyspepsia. Journal of Clinical Gastroenterology 1998; 26:
312-320.
155. Dobrilla G, Comberlato M, Steele A, Vallaperta P. Drug treatment of functional dyspepsia. A
meta-analysis of randomized controlled clinical trials. Journal of Clinical Gastroenterology 1989; 11:
169-177.
156. Archimandritis A, Tzivras M, Fertakis A, Emmanuel A, Laoudi F, Kalantzis N et al. Cisapride,
metoclopramide, and ranitidine in the treatment of severe nonulcer dyspepsia. Clinical Therapeutics
1992; 14: 553-561.
157. Veldhuyzen van Zanten SJ, Cleary C, Talley NJ, Peterson TC, Nyren O, Bradley LA et al. Drug
treatment of functional dyspepsia: a systematic analysis of trial methodology with recommendations
for design of future trials. American Journal of Gastroenterology 1996; 91: 660-673.
158. Carvalhinhos A, Fidalgo P, Freire A, Matos L. Cisapride compared with ranitidine in the treatment
of functional dyspepsia. European Journal of Gatroenterology & Hepatology 1995; 7: 411-417.
159. Miazza B, Halter F, Brignoli R. A multicentre comparative trial in functional dyspepsia: cisapride
versus cimetidine. Gastroenterology 1993; 104: A18.
160. Halter F, Miazza B, Brignoli R. Cisapride or cimetidine in the treatment of functional dyspepsia.
Results of a double-blind, randomized, Swiss multicentre study. Scandinavian Journal of
Gastroenterology 1994; 29: 618-623.
161. Simon B, Bergemann W , Bouzo H, Huttemann W, Hotz F, Muller P et al. Prokinetic drug
treatment (cisapride) is as effective as H2-blocking agent (ranitidine) in the treatment of gastric ulcer.
Hepato-Gastroenterology 1991; 38 (suppl 1): 41-45.
162. Testoni PA, Bagnolo F, Buizza M, Masci E, Toti GL, Spinelli A et al. Effectiveness of cisapride in
gastric ulcer. Results of a double-blind randomized trial versus ranitidine and versus cisapride plus
ranitidine. Journal of Clinical Gastroenterology 1993; 17: 5-9.
A rational approach to uninvestigated dyspepsia in primary care
43
163. Stubberod A, Glise H , Hallerback B, Solhaug JH. The effect of cisapride and ranitidine as
monotherapies and in combination in the treatment of uncomplicated gastric ulceration. Scandinavian
Journal of Gastroenterology 1995; 30: 106-110.
164. Kerrigan DD, Taylor ME, Read NW, Johnson AG. Acid, motility, and ulcers: a comparison of
cisapride with placebo in the prevention of duodenal ulcer relapse. Gut 1993; 34: 1042-1046.
165. Rockville (US): Food and Drug Administration. FDA warnings for cisapride. Department of Public
Health and Human Services 2000; 24.
166. Sobala GM, Crabtree JE, Pentith JA, Rathbone BJ, Shallcross TM, Wyatt JI et al. Screening
dyspepsia by serology to Helicobacter pylori. Lancet 1991; 338: 94-96.
167. Mendall MA, Goggin PM, Marrero JM, Molineaux N, Levy J, Badve S et al. Role of
Helicobacter pylori serology in screening prior to endoscopy. European Journal of Gatroenterology &
Hepatology 1992; 4: 713-717.
168. Mendall MA, Jazrawi RP, Marrero JM, Molineaux N, Levi J, Maxwell JD et al. Serology for
Helicobacter pylori compared with symptom questionnaires in screening before direct access
endoscopy. Gut 1995; 36: 330-333.
169. Tham TC, McLaughlin N, Hughes DF, Ferguson M, Crosbie JJ, Madden M et al. Possible role of
Helicobacter pylori serology in reducing endoscopy workload. Postgraduate Medical Journal 1994;
70: 809-812.
170. Patel P, Mendall MA, Khulusi S, Molineaux N, Levy J, Maxwell JD et al. Salivary antibodies to
Helicobacter pylori : screening dyspeptic patients before endoscopy. Lancet 1994; 344: 511-512.
171. Collins JSA, Bamford KB, Sloan JM, Collins BJ, Moorehead RJ, Love GAH. Screening for
Helicobacter pylori antibody could reduce endoscopy workload in young dyspeptic patients.
European Journal of Gatroenterology & Hepatology 1992; 4: 991-993.
172. Vyas SK, Sharpstone D, Treasure J, Fine D, Hawtkin PR. Pre-endoscopy screening using
serodiagnosis of Helicobacter pylori infection. European Journal of Gatroenterology & Hepatology
1994; 6: 783-785.
173. Werdmuller BF, der Putten AB, Veenendaal RA, Lamers CB, Loffeld RJ . Can screening for IgG
antibodies against Helicobacter pylori be used in clinical practice? Omit endoscopy in seropositive or
seronegative patients? Digestive Diseases and Science 1998; 43: 2296-2300.
174. Vaira D, Stanghellini V, Menegatti M, Palli D, Corinaldesi R, Miglioli M. Prospective screening
of dyspeptic patients by Helicobacter pylori serology: a safe policy? The Italian Helicobacter pylori
Study Group. Endoscopy 1997; 29: 595-601.
175. Reilly TG, Stone D, Poxon V, Elliot TSJ, Walt RP. H. pylori serology in the investigation of
dyspepsia: a general practice based follow-up study. Gut 1996; 38 (suppl 1): A65.
Chapter 2
44
176. Patel P, Khulusi S, Mendall MA, Lloyd R, Jazrawi R, Maxwell JD et al. Prospective screening of
dyspeptic patients by Helicobacter pylori serology. Lancet 1995; 346: 1315-1318.
177. Asante AA, Mendall M , Patel P, Ballam L, Northfield TC. A randomized trial of endoscopy vs no
endoscopy in the management of seronegative Helicobacter pylori dyspepsia. European Journal of
Gatroenterology & Hepatology 1998; 10: 983-989.
178. Fendrick AM, Chernew ME, Hirth RA, Bloom BS . Alternative management strategies for patients
with suspected peptic ulcer disease. Annals of Internal Medicine 1995; 123: 260-268.
179. Silverstein MD, Petterson T, Talley NJ. Initial endoscopy or empirical therapy with or without
testing for Helicobacter pylori for dyspepsia: a decision analysis. Gastroenterology 1996; 110: 72-83.
180. Sonnenberg A. Cost-benefit analysis of testing for Helicobacter pylori in dyspeptic subjects.
American Journal of Gastroenterology 1996; 91: 1773-1777.
181. Briggs AH, Sculpher MJ, Logan RP, Aldous J, Ramsay ME, Baron JH. Cost effectiveness of
screening for and eradication of Helicobacter pylori in management of dyspeptic patients under 45
years of age. British Medical Journal 1996; 312: 1321-1325.
182. Ebell MH, Warbasse L , Brenner C. Evaluation of the dyspeptic patient: a cost-utility study. Journal
of Family Practice 1997; 44: 545-555.
183. Ofman JJ, Etchason J , Fullerton S, Kahn KL, Soll AH. Management strategies for Helicobacter
pylori - seropositive patients with dyspepsia: clinical and economic consequences. Annals of Internal
Medicine 1997; 126: 280-291.
184. Laheij RJ, Severens JL, Jansen JB, van de Lisdonk EH, Verbeek AL. Management in general
practice of patients with persistent dyspepsia. A decision analysis. Journal of Clinical
Gastroenterology 1997; 25: 563-567.
185. Olson AD, Deutsch D. Combined empiric treatment and specific Hp screening and treatment
decrease the cost of evaluating epigastric abdominal pain. Gastroenterology 1998; 114: A248.
186. Heaney A, Collins JSA, Watson RGP, McFarland RJ, Bamford KB, Tham TCK. A prospective
randomised trial of a test-and-treat policy versus endoscopy based management in young Helicobacter
pylori positive patients with ulcer-like dyspepsia, referred to a hospital clinic. Gut 1999; 45: 186-190.
187. Jones R, Tait C, Sladen G, Weston-Baker J. A trial of a test-and-treat strategy for Helicobacter
pylori positive dyspeptic patients in general practice. International Journal of Clincial Practice 1999;
53: 413-416.
188. Lassen AT, Pedersen FM, Bytzer P, Schaffalitzky de Muckadell OB. Helicobacter pylori test-and-
eradicate versus prompt endoscopy for management of dyspeptic patients: a randomised trial. Lancet
2000; 356: 455-460.
A rational approach to uninvestigated dyspepsia in primary care
45
189. Laheij RJ, Severens JL, van de Lisdonk EH, Verbeek AL, Jansen JB. Randomized controlled trial
of omeprazole or endoscopy in patients with persistent dyspepsia: a cost-effectiveness analysis.
Alimentary Pharmacology & Therapeutics 1998; 12: 1249-1256.
190. Duggan A, Elliot C., Tolley K, Whynes D, Hawkey CJ, Logan RF. Randomised controlled trial of
four dyspepsia management strategies in primary care with 12 months follow-up. Gastroenterology
2000; 118: A438.
191. Arents NLA, Thijs JC , Zwet van AA, The SENSE Study Working Party. Screening and treating
for Helicobacter pylori ("test-and-treat" strategy) in dyspepsia reduces the number of endoscopies and
leads to a similar clinical outcome as prompt endoscopy. Gastroenterology 2001; 120: A89.
192. Klinkenberg-Knol EC, Jansen JM, Festen HP, Meuwissen SG, Lamers CB. Double-blind
multicentre comparison of omeprazole and ranitidine in the treatment of reflux oesophagitis. Lancet
1987; 1: 349-351.
193. Hetzel DJ, Dent J, Reed WD, Narielvala FM, Mackinnon M, McCarthy JH et al. Healing and
relapse of severe peptic esophagitis after treatment with omeprazole. Gastroenterology 1988; 95: 903-
912.
194. Hunt RH. The relationship between the control of pH and healing and symptom relief in gastro-
oesophageal reflux disease. Alimentary Pharmacology & Therapeutics 1995; 9 (suppl 1): 3-7.
195. Lauritsen K, Rune SJ , Bytzer P, Kelbaek H, Jensen KG, Rask-Madsen J et al. Effect of
omeprazole and cimetidine on duodenal ulcer. A double-blind comparative trial. New England Journal
of Medicine 1985 ; 312: 958-961.
196. Bardhan KD, Bianchi PG, Bose K, Daly M, Hinchliffe RF, Jonsson E et al. A comparison of two
different doses of omeprazole versus ranitidine in treatment of duodenal ulcers. Journal of Clinical
Gastroenterology 1986; 8: 408-413.
197. Lanza F, Goff J, Scowcroft C, Jennings D, Greski-Rose P. Double-blind comparison of
lansoprazole, ranitidine, and placebo in the treatment of acute duodenal ulcer. Lansoprazole Study
Group. American Journal of Gastroenterology 1994; 89: 1191-1200.
198. Farup PG, Larsen S, Ulshagen K, Osnes M. Ranitidine for non-ulcer dyspepsia. A clinical study of
the symptomatic effect of ranitidine and a classification and characterization of the responders to
treatment . Scandinavian Journal of Gastroenterology 1991; 26: 1209-1216.
199. Johannessen T, Kristensen P, Petersen H, Fosstvedt D, Loge I, Kleveland PM et al. The
symptomatic effect of 1-day treatment periods with cimetidine in dyspepsia. Combined results from
randomized, controlled, single-subject trials . Scandinavian Journal of Gastroenterology 1991; 26:
974-980.
200. Johannessen T, Fjosne U, Kleveland PM, Halvorsen T, Kristensen P, Loge I et al. Cimetidine
responders in non-ulcer dyspepsia. Scandinavian Journal of Gastroenterology 1988; 23 : 327-336.
Chapter 2
46
201. Smith PM, Troughton AH, Gleeson F, Walters J, McCarthy CF. Pirenzepine in non-ulcer
dyspepsia: a double-blind multicentre trial. J Int Med Res 1990; 18: 16-20.
202. Talley NJ, McNeil D, Hayden A, Piper DW. Randomized, double-blind, placebo-controlled
crossover trial of cimetidine and pirenzepine in nonulcer dyspepsia. Gastroenterology 1986; 91: 149-
156.
203. Gad A, Dobrilla G. Campylobacter pylori and non-ulcer dyspepsia. The final results of a double-
blind multicentre trial for treatment with pirenzepine in Italy. Scandinavian Journal of
Gastroenterology 1989; 167: 39-43.
204. Rabeneck L, Souchek J, Wristers K, Menke T, Wray N, Ambriz E et al. Management of
uninvestigated dyspepsia: a randomized, double-blind, placeo-controlled trial of proton pump
inhibitor therapy. Gastroenterology 2001; 119: A468.
205. Koelz HR, Birchler R , Bretholz A, Bron B, Capitaine Y, Delmore G et al. Healing and relapse of
reflux esophagitis during treatment with ranitidine. Gastroenterology 1986; 91: 1198-1205.
206. Graham DY, Colon-Pagan J, Morse RS, Johnson TL, Walsh JH, McCullough AJ et al. Ulcer
recurrence following duodenal ulcer healing with omeprazole, ranitidine, or placebo: a double-blind,
multicenter, 6-month study. The Omeprazole Duodenal Ulcer Study Group. Gastroenterology 1992;
102: 1289-1294.
207. Jones R, Lydeard S. Dyspepsia in the community: a follow-up study. British Journal of Clinical
Practice 1992; 46: 95-97.
208. Talley NJ, Weaver AL , Zinsmeister AR, Melton LJ . Onset and disappearance of gastrointestinal
symptoms and functional gastrointestinal disorders. Am J Epidemiol 1992; 136: 165-177.
209. Agreus L, Svardsudd K, Nyren O, Tibblin G. Irritable bowel syndrome and dyspepsia in the
general population: overlap and lack of stability over time. Gastroenterology 1995; 109: 671-680.
210. Unge P, Jonsson B, Stalhammar NO. The cost effectiveness of Helicobacter pylori eradication
versus maintenance and episodic treatment in duodenal ulcer patients in Sweden. Pharmacoeconomics
1995; 8: 410-427.
211. Hameeteman W. Columnar-lined (Barrett's) esophagus. Thesis, University of Amsterdam,
Amsterdam, The Netherlands 1989.
212. Mann NS, Tsai MF, Nair PK. Barrett's esophagus in patients with symptomatic reflux esophagitis.
American Journal of Gastroenterology 1989; 84: 1494-1496.
213. Winters C, Jr., Spurling TJ, Chobanian SJ, Curtis DJ, Esposito RL, Hacker JF, III et al.
Barrett's esophagus. A prevalent, occult complication of gastroesophageal reflux disease.
Gastroenterology 1987; 92: 118-124.
214. van der Burgh A., Dees J, Hop WC, van Blankenstein M. Oesophageal cancer is an uncommon
cause of death in patients with Barrett's oesophagus. Gut 1996; 39: 5-8.
A rational approach to uninvestigated dyspepsia in primary care
47
215. Spechler SJ, Robbins AH, Rubins HB, Vincent ME, Heeren T, Doos WG et al. Adenocarcinoma
and Barrett's esophagus. An overrated risk ? Gastroenterology 1984; 87: 927-933.
216. Van der Veen AH, Dees J, Blankensteijn JD, van Blankenstein M. Adenocarcinoma in Barrett's
oesophagus: an overrated risk . Gut 1989; 30: 14-18.
217. Shaheen NJ, Crosby MA, Bozymski EM, Sandler RS . Is there publication bias in the reporting of
cancer risk in Barrett's esophagus ? Gastroenterology 2000; 119: 333-338.
218. Rudolph RE, Vaughan TL, Storer BE, Haggitt RC, Rabinovitch PS, Levine DS et al. Effect of
segment length on risk for neoplastic progression in patients with Barrett esophagus. Annals of
Internal Medicine 2000; 132: 612-620.
219. Bytzer P, Christensen PB, Damkier P, Vinding K, Seersholm N. Adenocarcinoma of the
esophagus and Barrett's esophagus: a population- based study. American Journal of Gastroenterology
1999; 94: 86-91.
220. Smith AM, Maxwell-Armstrong CA, Welch NT, Scholefield JH. Surveillance for Barrett's
oesophagus in the UK. British Journal of Surgery 1999; 86: 276-280.
221. van Sandick JW, Bartelsman JF, van Lanschot JJ, Tytgat GN, Obertop H. Surveillance of
Barrett's oesophagus: physicians' practices and review of current guidelines. European Journal of
Gatroenterology & Hepatology 2000; 12: 111-117.
222. Richter JE, Falk GW. Barrett's esophagus and adenocarcinoma. The need for a consensus
conference. Journal of Clinical Gastroenterology 1996; 23: 88-90.
223. Spechler SJ, Lee E, Ahnen D, Goyal RK, Hirano I, Ramirez F et al. Long-term outcome of
medical and surgical therapies for gastroesophageal reflux disease: follow-up of a randomized
controlled trial. JAMA 2001; 285: 2331-2338.
224. Johansson KE, Tibbling L. Maintenance treatment with ranitidine compared with fundoplication in
gastro-oesophageal reflux disease. Scandinavian Journal of Gastroenterology 1986; 21: 779-788.
225. Negre JB, Markkula HT, Keyrilainen O, Matikainen M. Nissen fundoplication. Results at 10 year
follow-up. American Journal of Surgery 1983; 146: 635-638.
226. Spechler SJ. Comparison of medical and surgical therapy for complicated gastroesophageal reflux
disease in veterans. The Department of Veterans Affairs Gastroesophageal Reflux Disease Study
Group. New England Journal of Medicine 1992; 326: 786-792.
227. Griffin SM, Raimes SA. Proton pump inhibitors may mask early gastric cancer. Dyspeptic patients
over 45 should undergo endoscopy before these drugs are started. British Medical Journal 1998; 317:
1606-1607.
228. Breslin NP, Thomson ABR, Bailey RJ, Blustein PK, Meddings J, Lalor E et al. Gastric cancer
and other endoscopic diagnoses in patients with benign dysplasia. Gut 2000; 46: 93-97.
Chapter 2
48
229. Christie J, Shepherd NA, Codling BW, Valori RM. Gastric cancer below the age of 55:
implications for screening patients with uncomplicated dyspepsia. Gut 1997; 41: 513-517.
230. Gillen D, McColl KE. Does concern about missing malignancy justify endoscopy in uncomplicated
dyspepsia in patients aged less than 55 ? American Journal of Gastroenterology 1999; 94: 75-79.
231. Leodolter A, Dominguez-Munoz JE, von Arnim U, Kahl S, Peitz U, Malfertheiner P. Validity of
a modified 13C-urea breath test for pre- and posttreatment diagnosis of Helicobacter pylori infection
in the routine clinical setting. American Journal of Gastroenterology 1999; 94: 2100-2104.
232. Savarino V, Mela GS, Zentilin P, Bisso G, Pivari M, Mansi C et al. Comparison of isotope ratio
mass spectrometry and nondispersive isotope- selective infrared spectroscopy for 13C-urea breath
test. American Journal of Gastroenterology 1999; 94: 1203-1208.
233. Vaira D, Malfertheiner P, Megraud F, Axon ATR, Deltenre M, Hirschl AM et al. Diagnosis of
Helicobacter pylori infection with a new non-invasive antigen-based assay. Lancet 1999; 354: 30-33.
234. Vaira D, Malfertheiner P, Megraud F, Axon ATR, Deltenre M, Gasbarrini G et al. Noninvasive
antigen-based assay for assessing Helicobacter pylori eradication: a European multicenter study.
American Journal of Gastroenterology 2000; 95: 925-929.
235. Arents NLA, van Zwet AA, Thijs JC, de Jong A, Pool MO, Kleibeuker JH. The accuracy of the
Helicobacter pylori stool antigen test in diagnosing H. pylori in treated and untreated patients.
European Journal of Gatroenterology & Hepatology 2001; 13: 383-386.
236. NIH Consensus Conference . Helicobacter pylori in peptic ulcer disease. JAMA 1994; 272: 65-69.
237. van der Wouden EJ, Thijs JC, van Zwet AA, Kleibeuker JH. Six year follow-up after successful
triple therapy for Helicobacter pylori infection in patients with peptic ulcer disease. Gut 1998; 43
(suppl 2): A100.
238. Bell GD, Powell KU, Burridge SM, Harrison G, Rameh B, Weil J et al. Reinfection or
recrudescence after apparently successful eradication of Helicobacter pylori infection: implications
for treatment of patients with duodenal ulcer disease. Quarterly Journal of Medicine 1993; 86: 375-
382.
239. Abu-Mahfouz MZ, Prasad VM, Santogade P, Cutler AF. Helicobacter pylori recurrence after
successful eradication: 5-year follow-up in the United States. American Journal of Gastroenterology
1997; 92: 2025-2028.
240. Borody TJ, Andrews P , Mancuso N, McCauley D, Jankiewicz E, Ferch N et al. Helicobacter
pylori reinfection rate, in patients with cured duodenal ulcer. American Journal of Gastroenterology
1994; 89: 529-532.
241. Borody T, Andrews P, Mancuso N, Jankiewicz E, Brandl S. Helicobacter pylori reinfection 4
years post-eradication. Lancet 1992; 339: 1295.
A rational approach to uninvestigated dyspepsia in primary care
49
242. van der Hulst RW, Rauws EA, Koycu B, Keller JJ, Bruno MJ, Tijssen JG et al. Prevention of
ulcer recurrence after eradication of Helicobacter pylori: a prospective long-term follow-up study.
Gastroenterology 1997; 113: 1082-6.
243. Uemura N, Mukai T, Okamoto S, Yamaguchi S, Mashiba H, Taniyama KSN et al. Helicobacter
pylori eradication inhibits the growth of intestinal type of gastric cancer in initial stage.
Gastroenterology 1996; 110: A282.
244. Kuipers EJ, Lundell L, Klinkenberg-Knol EC, Havu N, Festen HP, Liedman B et al. Atrophic
gastritis and Helicobacter pylori infection in patients with reflux esophagitis treated with omeprazole
or fundoplication. New England Journal of Medicine 1996; 334: 1018-22.
245. Lamberts R, Creutzfeldt W, Struber HG, Brunner G, Solcia E. Long-term omeprazole therapy in
peptic ulcer disease: gastrin, endocrine cell growth, and gastritis. Gastroenterology 1993; 104: 1356-
1370.
246. Mowat C, Williams C, Gillen D, Hossack M, Gilmour D, Carswell A et al. Omeprazole,
Helicobacter pylori status, and alterations in the intragastric milieu facilitating bacterial N-nitrosation.
Gastroenterology 2000; 119: 339-347.
247. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Mashiba H et al. Changes in
Helicobacter pylori-induced gastritis in the antrum and corpus during long-term acid-suppressive
treatment in japan. Alimentary Pharmacology & Therapeutics 2000; 14: 1345-1352.
248. Genta RM. Atrophy, acid suppression and Helicobacter pylori infection: a tale of two studies.
European Journal of Gatroenterology & Hepatology 1999; 11 (suppl 2): S29-S33.
249. Bell GD, Powell K, Burridge SM, Pallecaros A, Jones PH, Gant PW et al. Experience with 'triple'
anti-Helicobacter pylori eradication therapy: side effects and the importance of testing the pre-
treatment bacterial isolate for metronidazole resistance. Alimentary Pharmacology & Therapeutics
1992; 6: 427-435.
250. Thijs JC, van Zwet AA, Oey HB. Efficacy and side effects of a triple drug regimen for the
eradication of Helicobacter pylori. Scandinavian Journal of Gastroenterology 1993; 28: 934-938.
251. Thijs JC, van Zwet AA, Moolenaar W, Wolfhagen MJ, ten Bokkel HJ. Triple therapy vs.
amoxicillin plus omeprazole for treatment of Helicobacter pylori infection: a multicenter, prospective,
randomized, controlled study of efficacy and side effects. American Journal of Gastroenterology
1996; 91: 93-97.
252. Marshall BJ, Hoffman SR, McCallum RW. Incidence of side effects during bismuth subsalicylate
and antibiotic therapy for H. pylori (HP). Gastroenterology 1992; 100: A117.
253. de Boer WA, Tytgat GN. The best therapy for Helicobacter pylori infection: should efficacy or side-
effect profile determine our choice ? Scandinavian Journal of Gastroenterology 1995; 30: 401-407.
Chapter 2
50
254. Houben MH, van de BD , Hensen EF, de Craen AJ, 't Hoff BW, Tytgat GN . Helicobacter pylori
eradication therapy in The Netherlands. Scandinavian Journal of Gastroenterology 1999; 230: 17-22.
255. van der Wouden EJ, Thijs JC, van Zwet AA, Sluiter WJ, Kleibeuker JH. The influence of in
vitro nitroimidazole resistance on the efficacy of nitromidazole containing anti-Helicobacter pylori
regimens: a meta-analysis. American Journal of Gastroenterology 1999; 94: 1751-1759.
256. Laheij RJ, Rossum LG , Jansen JB, Straatman H, Verbeek AL. Evaluation of treatment regimens
to cure Helicobacter pylori infection-- a meta-analysis. Alimentary Pharmacology & Therapeutics
1999; 13: 857-864.
257. Schmid CH, Whiting G , Cory D, Ross SD, Chalmers TC. Omeprazole plus antibiotics in the
eradication of Helicobacter pylori infection: a meta-regression analysis of randomized, controlled
trials. Am J Ther 1999; 6: 25-36.
258. Unge P, Berstad A. Pooled analysis of anti-Helicobacter pylori treatment regimens. Scandinavian
Journal of Gastroenterology 1996; 220: 27-40.
259. van der Wouden EJ, van Zwet AA, Vosmaer GD, Oom JA, de Jong A, Kleibeuker JH. Rapid
increase in the prevalence of metronidazole-resistant Helicobacter pylori in the Netherlands.
Emerging Infectious Diseases 1997; 3: 385-9.
260. Megraud F. Epidemiology and mechanism of antibiotic resistance in Helicobacter pylori.
Gastroenterology 1998; 115: 1278-1282.
261. de Boer WA. How to achieve a near 100% cure rate for H. pylori infection in peptic ulcer patients. A
personal viewpoint. Journal of Clinical Gastroenterology 1996; 22: 313-316.
262. Schutze K, Hentschel E, Dragosics B, Hirschl AM. Helicobacter pylori reinfection with identical
organisms: transmission by the patients' spouses. Gut 1995; 36: 831-833.
263. Graham DY. The only good Helicobacter pylori is a dead Helicobacter pylori. Lancet 1997; 350:
70-1.
51
Chapter 3
The approach of dyspepsia in primary care. A randomised trial
comparing “test-and-treat” with prompt endoscopy.
Nicolaas L. A. Arents 1, Jacob C. Thijs 2, Anton A. van Zwet 1, Marco Oudkerk Pool 3,
Jan-Mark Götz 4, Ger Th. van de Werf 5, Klaas Reenders 5, Wim J. Sluiter 6, and Jan H.
Kleibeuker 7
1 Regional Public Health Laboratory, Groningen / Drenthe2 Department of Gastroenterology, Bethesda Hospital, Hoogeveen3 Department of Gastroenterology, Isala Clinics, Zwolle4 Department of Gastroenterology, Wilhelmina Hospital, Assen5 Department of General Practice, University Hospital, Groningen6 Department of Pathology, University Hospital, Groningen7 Department of Gastroenterology, University Hospital, Groningen
in press, Archives of Internal Medicine.
Chapter 3
52
Abstract
Background
The clinical value of the “test-and-treat” strategy in the approach of dyspepsia has only been
evaluated in a few secondary care studies. The majority of the dyspeptic patients, however, are
managed by their primary care physician only. This study evaluated the “test-and-treat” strategy in
primary care.
Methods
Patients consulting their general practitioner (GP) for dyspepsia were randomised to either
direct open-access endoscopy with H. pylori testing or a “test-and-treat” strategy based on H.
pylori serology. All patients received eradication therapy if H. pylori positive. In the 12 months
follow-up period, any additional treatment or referral for further investigations was left at the
discretion of the GP. At the end of the study, data were collected in both study groups concerning
the number of endoscopies performed, changes in symptom severity, changes in quality of life,
patient satisfaction, and the use of medical resources.
Results
Two hundred seventy patients were enrolled (129 endoscopy and 141 “test-and-treat” patients).
The prevalence of H. pylori infection was 38% and 37% in the “test-and-treat” and endoscopy
group respectively. In the “test-and-treat” group, forty-six patients (33%) were referred for
endoscopy during follow-up. Improvement in symptom severity, quality of life, and patient
satisfaction was comparable in both groups. Patients in the “test-and-treat” group paid more
dyspepsia related visits to their GP (p=0.005). Patients in the endoscopy group were more often
prescribed PPI’s (p=0.007), whereas patients in the “test-and-treat” group were more often
prescribed prokinetic drugs (p=0.005).
Conclusions
The “test-and-treat” strategy proved to be as effective and safe as prompt endoscopy. Only a
minority of patients were referred for endoscopy after “test-and-treat”.
A randomised trial comparing “test-and-treat” with prompt endoscopy
53
Introduction
In primary care, general practitioners (GP’s) usually treat younger dyspeptic patients
empirically with acid suppressing agents before considering endoscopy. This approach, in which
endoscopy is reserved for patients with persisting symptoms, was asserted to be the most cost-
effective strategy by the American College of Physicians in 1985 [1]. Since then, however, new
data have become available, suggesting that this common practice may have to be reconsidered.
First of all, the most common cause of dyspepsia in general practice is functional dyspepsia [2]
and there is no sound evidence to support the use of acid suppression in this condition [3,4].
Secondly, although peptic ulcer disease (PUD) and gastro-oesophageal reflux disease (GERD) are
initially adequately treated by a course of acid suppression, they usually relapse after
discontinuation of the drug [5-8]. Therefore, in most of these patients endoscopy is merely
postponed when the aforementioned approach is followed [9]. Finally, eradication of Helicobacter
pylori (H. pylori) in PUD patients harbouring this bacterium is far more cost-effective than
symptomatic acid suppressive treatment [10].
These data have led to the development of several alternative strategies. Some authors
proposed a strategy based on non-invasive screening for H. pylori and referring only those patients
testing positive for endoscopy (“test-and-scope”) [11,12]. Others have modified this approach and
recommended a “test-and-treat” strategy, in which patients testing positive receive anti-H. pylori
treatment, possibly obviating the need for endoscopy [13-15]. On the other hand, it has also been
suggested that immediate endoscopy may be the most cost-effective approach [16,17].
All strategies have been extensively tested by decision-analytic studies [18-25], but only a few
studies have actually compared the different approaches in a clinical setting [9,13-15,26,27]. These
clinical studies, however, suffer from one significant drawback. None of them was performed
entirely in a primary care setting, where most patients with dyspepsia are treated [28,29]. This
article presents the results of a study comparing a “test-and-treat” strategy to prompt endoscopy.
The study was performed entirely in a primary care setting, using open-access endoscopy facilities.
Methods
According to the Rome I criteria, dyspepsia was defined as persistent or recurrent pain or
discomfort centred in the upper abdomen [30]. Patients consulting any of the 56 participating
general practitioners (GP’s) for dyspepsia were eligible for the study if the GP considered the
Chapter 3
54
symptoms severe enough to warrant endoscopy or the prescription of acid-suppressive medication.
The GP’s were instructed not to include patients with symptoms suggestive of GERD (heartburn
or acid regurgitation as the only or predominant symptom). Other exclusion criteria were age
younger than 18 years; the presence of sinister symptoms (including the first appearance of
dyspeptic symptoms after the age of 55); previously documented PUD or GERD; previous surgery
of the upper alimentary tract, other than uncomplicated cholecystectomy; previous anti-H. pylori
treatment; the use of proton pump inhibitors (PPI’s), bismuth compounds, or antibiotics in the
month before inclusion; the use of non-steroidal anti-inflammatory drugs (NSAID’s) other than
low-dose acetyl salicylic acid in the preceding two weeks; known allergy for the drugs used in the
study; suspected poor compliance; pregnancy or lactation; and participation in any other study.
Patients were withdrawn from the study if any malignancy was diagnosed or if the patient got
pregnant. After giving written informed consent, patients were randomised by their GP.
Randomisation was stratified for each GP by supplying each GP with blocks of four sealed
envelopes, ensuring two patients randomised to the “test-and-treat” and two patients to the
endoscopy group.
In the endoscopy group the patients were referred for open-access endoscopy, which was
performed within 2 weeks after inclusion. At endoscopy three biopsy samples were taken within 2
cm of the pylorus for H. pylori culture (n=1) and histology (haematoxylin-eosin staining and either
Giemsa staining or immuno staining for H. pylori) (n=2). Antibiotic susceptibility for
metronidazole (resistant if Minimal Inhibitory Concentration (MIC) ≥ 8) and claritromycin
(resistant if MIC ≥ 2) was tested by E-test (AB-Biodisk, Sweden). A venous blood sample was
drawn for the detection of anti-H. pylori IgG antibodies using a commercially available assay
(Pyloriset EIA-G III, Orion Diagnostica, Espoo, Finland). This assay has shown a sensitivity and
specificity of 98.4% and 88.4% respectively in a previous study performed in the same region
[31]. A peptic ulcer was defined as a mucosal break of > 5 mm with a clearly visible ulcer crater in
either the stomach or the duodenal bulb. Erosive inflammation of the duodenal bulb was
considered to be an appearance of PUD. If at endoscopy PUD was detected, the patient was
prescribed ranitidine immediately after endoscopy. Patients with reflux oesophagitis were
prescribed lansoprazole for a period of three months. The dosages were left at the discretion of the
endoscopist. In all other cases the patients were referred back to their GP awaiting culture and
histology results. All H. pylori infected patients (either culture or histology positive) received a
A randomised trial comparing “test-and-treat” with prompt endoscopy
55
one-week anti-H. pylori regimen guided by susceptibility testing: lansoprazole (30 mg bid),
amoxicillin (1000 mg bid), and either metronidazole (500 mg bid) (LAM) if metronidazole-
sensitive or clarithromycin (500 mg bid) (LAC) if metronidazole-resistant. If susceptibility was
not tested the microorganism was considered metronidazole-resistant. In a previous study,
performed in the same region [32], resistance of H. pylori to clarithromycin was shown to be very
rare (about 2%). If a patient had normal endoscopic findings and was H. pylori negative, cisapride
(20 mg bid) was prescribed for four weeks by the GP according to protocol. Peptic ulcers, erosive
gastritis, and erosive duodenitis in the absence of H. pylori infection were treated after confering
with the gastroenterologist, usually with acid suppressive agents.
In the “test-and-treat” group, a venous blood sample was drawn for H. pylori serology. If
testing positive the patients were prescribed LAC by the GP. If negative, the GPs were encouraged
to prescribe cisapride (20 mg bid) for four weeks. After the initial treatment according to protocol,
the GP was free to manage the patients according to his or her own insights. This could include
either a change in treatment, referral for diagnostic tests, including endoscopy, or referral to a
gastroenterologist or another specialist.
The patients were followed for 12 months. At inclusion and at 12 months, the patients were
asked to complete a dyspepsia questionnaire evaluating the severity of eight dyspeptic symptoms
(pain in the upper abdomen, bloating, nausea, burping / belching, flatulence, heartburn, sour taste,
and halitosis) on a 5-point Likert scale [33]. Quality of life (QoL) was evaluated at inclusion and
after 12 months using the RAND-36 questionnaire, a validated Dutch translation of the SF-36
questionnaire [34,35]. At 12 months, patients were invited to donate a second blood sample for H.
pylori serology. Successfull H. pylori treatment was defined as a decrease in titer of IgG H. pylori
antibodies ≥ 40% [36]. For the detection of a decrease in antibody level both the entry sample and
the 12 months sample were examined in the same run. Patient's satisfaction with medical treatment
was evaluated on a 5-point Likert scale. Whenever a patient did not return a questionnaire, they
were contacted by telephone by one of the investigators (NLAA) and urged to do so for up to three
times.
At the end of the study, the GPs' records of each patient (electronic and/or patient charts) were
reviewed by a single investigator (NLAA). Data were collected concerning the number of visits for
dyspepsia, the number of visits for other reasons, additional investigations (endoscopy, abdominal
ultrasound, and X-rays of the gastrointestinal tract), specialist referrals, and hospital admissions.
Chapter 3
56
Finally, all pharmacies were asked to provide a printed list of all medications delivered to the
patients within the one-year follow-up period. The dyspepsia-related use of medical resources was
calculated for medical consultations, dyspepsia-related investigations, hospital admissions, and
dyspepsia-related prescriptions.
Differences in mean scores and mean changes in scores between groups were compared after
correction for continuity by the method of Yates and Cochran. Mean changes in score within a
group were evaluated after correction for continuity by the method of Pitman. Frequencies were
compared by the chi-square test with Yates' correction. Differences in continuous variables
between groups were studied by the Mann-Whitney-U-test. All tests were two-sided with a level of
significance of p < 0.05.
The study protocol was approved by the medical ethical committee of the University Hospital
Groningen.
Results
Two hundred and eighty one patients consented to participate in the study (Figure 1). Eleven of
these patients were not enrolled for the following reasons: failed to return the first questionnaires
(n=2), no show-up at endoscopy (n=4), no biopsies taken at endoscopy (n=2), suspected poor
compliance (alcohol abuse (n=1), shortly staying foreigner (n=1)), presence of sinister symptoms
(n=1). Therefore, 270 patients were enrolled, 141 patients in the “test-and-treat” group and 129 in
the endoscopy group. Quality of life, time elapsed since the first appearance of symptoms as well
as the duration of current symptoms were not significantly different between both groups (p
ranging between 0.21 and 0.98 for all items). The mean score of one symptom in the dyspepsia
questionnaire (nausea) was significantly higher in the “test-and-treat” group (2.09 vs 1.79,
p=0.039). Mean scores of the other symptoms, however, as well as other baseline characteristics
(table 1) were comparable.
Forty-six patients (32.6%) randomised to the “test-and-treat” group (16 serologically H. pylori-
positive) were referred for endoscopy during follow-up. One endoscopy was aborted due to lack of
co-operation of the patient. The endoscopic diagnoses in the remaining 45 patients as well as in the
patients randomised to the endoscopy group are summarised in figure 2. The endoscopic diagnosis
most commonly made in both groups was GERD (“test-and-treat” group: 31.1%; endoscopy
group: 28.7%). GERD included oesophageal erosions (Savary-Miller grade 1 and higher) and/or
A randomised trial comparing “test-and-treat” with prompt endoscopy
57
Figure 1.
Flow diagram of the study patients.
281 patients consented to
participate
270 patients randomised
11 patients excluded
141 assigned to
“test-and-treat”
129 assigned to
prompt endoscopy
124 patients included
in final analysis
120 patients included
in final analysis
follow-up data not
available in 17 patients
follow-up data not
available in 9 patients
Chapter 3
58
Table 1.
Baseline characteristics of patients in the “test-and-treat” group and endoscopy group.
“Test-and-treat” group
(n=141)
Endoscopy group
(n=129) p-value
% %
Median age 47 44 0.35
Male 70 49.6 59 45.7 0.62
Smokers 55 39.0 47 36.4 0.75
Alcohol use (>1 unit daily) 24 17.0 22 17.1 0.87
Born outside The Netherlands 9 6.4 6 4.7 0.72
H. pylori positive 54 38.3 48 37.2 0.95
Barrett’s metaplasia (n=2). Duodenal ulcer disease (including erosive duodenitis in four) was
found in one of the 46 patient in the “test-and-treat” group and in 10 patients in the endoscopy
group (7.8%; one patient also had GERD). GU was not found in the “test-and-treat” group and in
one patient (0.8%; this patient also had GERD) in the endoscopy group. Erosive gastritis was
found in one (2.2%) and three (2.3%) patients in the “test-and-treat” and endoscopy group
respectively. In three patients with PUD both histology and culture were negative for H. pylori.
One of these patients (“test-and-treat” group) had been treated for H. pylori infection, but still
showed erosive inflammation of the duodenal bulb. The other two patients, randomised to the
endoscopy group, both had a duodenal ulcer. In both serology was negative as well. The H. pylori
status in all endoscoped patients is shown in table 2. In one 54 year old patient, randomised to the
“test-and-treat” group a gastric malignancywas diagnosed three weeks after inclusion. Further
examination showed multiple liver metastases with ascites and the patient passed away within 6
months. In both study groups, endoscopy did not show any abnormality or just a hiatal hernia in
most patients (62.2% and 60.5% in the “test-and-treat” and endoscopy group respectively).
Statistical analysis did not show any significant difference in frequencies of endoscopic diagnoses
between both study groups (p=0.83). When compared to the biopsy based detection methods in the
endoscopy group (H. pylori positive when histology and/or culture positive), the serological test
showed a sensitivity, specificity, positive and negative predictive value of 86.7% (95% confidence
interval (CI) 73.2 - 95.0), 92.5% (95% CI 84.4 - 97.2), 86.7% (95% CI 73.2 - 95.0), and 92.5%
A randomised trial comparing “test-and-treat” with prompt endoscopy
59
Figure 2.
Endoscopic diagnoses in the “test-and-treat” patients referred for endoscopy (n=45) and the
endoscopy group (n=129).
Test-and-treat group
Endoscopy group
N = normal or hiatal hernia only; GERD = Gastro-oesophageal reflux disease; EG = Erosive
gastritis; DU = Duodenal ulcer (including erosive duodenitis); GU = Gastric cancer
GERD31,1%
EG2,2%
GC2,2%
DU2,2%
N62,2%
N60,5%
DU7,8%
EG2,3%
GU0,8%
GERD28,7%
Chapter 3
60
Table 2.
H. pylori status in patients in the endoscopy group and in endoscoped patients in the
“test-and-treat” group.
Endoscopic diagnoses Endoscopy group (n=129) “Test-and-treat” group (n=45)
H. pylori positive1 H. pylori positive2
% %
GERD 12/37 32.4 3/14 21.4
DU 8/10 80.0 1/1 100.0
GU 1/1 100.0 0/0 0
Erosive gastritis 1/3 33.3 0/0 0
Gastric malignancy 0/0 0 1/1 100.0
normal 26/78 33.3 11/28 39.3
GERD = Gastro-oesophageal reflux disease; DU = Duodenal ulcer (including erosive duodenitis);
GU = Gastric ulcer. 1as determined by culture and/or histology; 2as determined by serology at
inclusion
(95% CI 84.4 - 97.2) respectively.
Follow-up data were not available of 17 patients in the “test-and-treat” group (12.1%) and of 9
patients in the endoscopy group (7.0%) (p=0.22) for the following reasons: failed to return follow-
up questionnaires (n=22), pregnancy (n=2) or malignancy (n=2) diagnosed during follow-up.
Besides the patient with gastric cancer mentioned above, Hodgkin’s disease was diagnosed in
another patient. Baseline characteristics (table 1) and mean symptom severity score of these
dropout patients were comparable to the baseline characteristics of the remaining patients.
Symptom changes in both study groups were evaluated by subtracting the scores in the last
questionnaire from the scores in the first questionnaire for each symptom. Figure 3 shows the
mean change for each symptom in both groups. All symptoms improved over the study period and
improvement was comparable in both study groups.
The scores of the QoL categories evaluated by the RAND-36 questionnaire (change in health,
general health perception, bodily pain, energy / fatigue, general mental health, role limitations due
to personal or emotional problems, role limitations due to physical health problems, social
functioning, and physical functioning) were calculated according to the instructions of the
A randomised trial comparing “test-and-treat” with prompt endoscopy
61
questionnaire's designers [34]. To detect any improvement or worsening within a category, the
first QoL scores were subtracted from the 12-month QoL scores. The median score changes for all
categories are shown in figure 4. There was an improvement in most categories in both groups and
the differences between the two groups were not statistically significant.
The use of medical resources in each study group is summarised in table 3. The mean number
of dyspepsia-related GP visits was significantly higher in the “test-and-treat” group (p=0.005). In
the endoscopy group, more patients were prescribed PPIs (p=0.007), making the mean standard
daily dosage (SDD) in this group higher than in the “test-and-treat” group. The mean SDD in the
patients receiving PPIs, however, was comparable in both groups (p=0.71). Sixty eight percent of
the patients in the endoscopy group who were prescribed PPIs had endoscopy proven GERD.
Prokinetic drugs were significantly more often prescribed in the “test-and-treat” group (p=0.005),
making the mean SDD in this group higher than in the endoscopy group. The use of H2RA and
antacids in both study groups was comparable. In both groups, the same number of patients did not
receive any medication for dyspepsia (18.5% and 23.3% for the “test-and-treat” and endoscopy
group respectively (p=0.5). Apart from endoscopy, the number of dyspepsia related medical
investigations were comparable in both groups (p=0.34), as was the mean number of specialist
referrals for dyspepsia (p=0.81). Just one patient (“test-and-treat” group) was admitted to hospital
because of upper abdominal symptoms. The use of medical resources for reasons other than
dyspepsia was comparable in both groups.
A second serum sample was available of 83/96 (86.5%) H. pylori-positive patients. According
to our definition anti-H. pylori treatment had been succesfull in 39/45 (86.7%) patients in the “test-
and-treat” group and 34/38 (89.5%) in the endoscopy group (p=0.95).
Patient satisfaction with medical treatment in both groups is shown in figure 5. The large
majority of patients (94.4%) were satisfied and there were no differences between both study
groups (p=0.75).
Chapter 3
62
Figure 3.
Mean change in symptom score in the test-and-treat” (n=124) and the endoscopy group
(n=120) and the mean difference between both scores with the 95% confidence interval.
Figure 4.
Median change in Quality of life scores in the “test-and-treat” (n=124) and the endoscopy
group (n= 120).
-20% -10% 0% 10% 20% 30% 40% 50% 60% 70%
Test-and-treat Endoscopy
-0,5 -0,3 -0,1 0,1 0,3 0,5 0,7 0,9 1,1 1,3 1,5
Endoscopy Test-and-treat Difference between Test-and-treat and Endoscopy
A randomised trial comparing “test-and-treat” with prompt endoscopy
63
Figure 5.
Patient satisfaction in the “test-and-treat” (n=124) and endoscopy group (n= 120).
0%
10%
20%
30%
40%
50%
60%
VeryUnsatisfied
Unsatisfied ModeratelySatisfied
Satisfied VerySatisfied
Test-and-treat Endoscopy
Chapter 3
64
A randomised trial comparing “test-and-treat” with prompt endoscopy
65
Chapter 3
66
Discussion
This study showed that prompt endoscopy in patients consulting their primary care doctor for
dyspepsia led to similar symptom resolution, improvement in quality of life and patient
satisfaction as compared to the “test-and-treat” strategy. Over two thirds of the patients treated
according to the “test-and-treat” strategy were not referred for endoscopy during a follow-up
period of one year. Our study is the first study comparing the “test-and-treat” strategy to prompt
endoscopy in a primary care setting. As most dyspeptic patients are entirely managed by their
general practitioner (GP), the “test-and-treat” approach should be evaluated in that setting. Lassen
et al. recently compared the “test-and-treat” strategy to prompt endoscopy [15]. In that study,
however, follow-up was performed completely in a secondary care setting, which may have biased
the results. Reassurance and treatment by a gastroenterologist with a special interest in dyspepsia
may be more effective than that by a GP, resulting in a decreased use of medical resources and a
higher patient satisfaction. Our primary care study has several other positive features. After the
initial investigation and treatment guidelines, GPs were allowed to treat and manage their patients
according to their own insights. Therefore, it is to be assumed that the outcome of the “test-and-
treat” strategy in our study will be very similar to the outcome if a similar approach would be
followed in daily clinical practice, thus increasing the external validity of the results. Secondly, all
questionnaires regarding symptoms, quality of life, and patient satisfaction were self administered,
avoiding any interpretation bias by the GP. Finally, anti-H. pylori treatment was prescribed to all
H. pylori infected patients. Although the benefit of anti-H. pylori treatment has only been
demonstrated unequivocally in patients with PUD, we aimed to prevent any bias by a possible
effect in patients with FD or GERD. Inevitably, our study had some drawbacks. Patients were
recruited by their own GP which may have introduced a potential selection bias, limiting the
comparability between the study patients and the normal dyspeptic population. Moreover, our
study does not allow a comparison of the “test-and-treat” strategy to the currently most often
chosen approach (empiric treatment). We chose to include a control group (prompt endoscopy)
rather than an empiric study group, in order to determine whether the “test-and-treat” strategy
missed any important disease.The presence of abnormalities in the “test-and-treat” group at
inclusion are assumingly similar to the endoscopic findings in the prompt endoscopy group. It
should be noted that in the endoscoped “test-and-treat” patients H. pylori positive PUD was not
diagnosed. This strongly indicates that the “test-and-treat” strategy correctly identified all patients
A randomised trial comparing “test-and-treat” with prompt endoscopy
67
with H. pylori associated PUD and that these patients received adequate treatment. The only
patient in the “test-and-treat” group in whom PUD was diagnosed, had erosive inflammation in the
duodenal bulb at endoscopy six months after anti-H. pylori treatment. Endoscopic biopsies
excluded H. pylori infection. NSAIDs were not prescribed to this patient during the study year, but
over the counter use can not be excluded.
The efficacy of the anti-H. pylori regimen was > 85% in both study arms. Susceptibility testing
prior to anti-H. pylori treatment did not seem to improve treatment succes rate, but this may be
related to the low prevalence of clarithromycin resistance in our region. An often cited argument
against the “test-and-treat” strategy is the possibility of overlooking gastric or oesophageal cancer.
In our study, gastric cancer was diagnosed in one patient three weeks after inclusion, which is a
duration of doctors delay that has been suggested to be acceptable [37].
PPIs were more often prescribed in the endoscopy group than in the “test-and-treat” group.
Most likely, this was related to the prescription of PPIs in nearly all patients with endoscopy
proven GERD, as recommended by the study guidelines, whereas in primary care it is common
practice to start treatment with a H2RA if GERD is expected in uninvestigated patients.
Prokinetics were more often prescribed in the “test-and-treat” group, which was clearly the direct
result of our study protocol advising prokinetics in all non-invasively tested H. pylori negative
patients. Other dyspepsia related drugs were equally used in both study groups. Patients in the
“test-and-treat” group more often consulted their GP for dyspepsia, which may indicate more
effective treatment or better reassurance in the endoscopy group. The use of other medical
resources, including specialist referrals, hospital admissions, and additional investigations for
dyspepsia other than endoscopy were comparable in both study groups.
Most current guidelines advocate empiric treatment with acid-suppressive agents as a first
approach to dyspepsia. Whether the “test-and-treat” strategy is more cost-effective than an empiric
approach can not be concluded from this study. One of the most important variables, however,
influencing cost-effectiveness of any approach for dyspepsia is the number (and cost) of
endoscopies [18,19]. The study by Bytzer et al, comparing an empiric acid-suppressive approach
with H2RA with prompt endoscopy, showed a 34% reduction in the number of endoscopies in the
first year [9]. When compared to this outcome, both our study and the study by Lassen et al.
showed a higher reduction in number of endoscopies (67.4% and 60% respectively). It could
therefore be hypothesized that the “test-and-treat” approach may be more cost-effective than
Chapter 3
68
empiric acid suppression. It should be emphasized, however, that the cost-effectiveness of a “test-
and-treat” strategy largely depends on the prevalence of PUD and H. pylori infection in the
population. The reported declining prevalence of H. pylori has a negative impact on the predictive
value of non-invasive tests for H. pylori. Moreover, the decreasing prevalence of PUD will limit
the number of patients most clearly benefiting from anti-H. pylori treatment.
In conclusion, a “test-and-treat” approach of dyspeptic patients in primary care is as effective
and safe as a strategy in which all patients are immediately referred for endoscopy. Only a
minority (33%) of patients are referred for endoscopy after “test-and-treat”.
Acknowledgements
The SENSE study (Strategy : Endoscopy versus Serology) was supported by a grant from Aventis
Pharma, Hoevelaken, The Netherlands.
References
1. Kahn K, Greenfield S . Endoscopy in the Evaluation of Dyspepsia. United States 1984. Health and
Public Policy Committee, American College of Physicians, Philadelphia, Pennsylvania. Annals of
Internal Medicine 1985; 102: 266-269.
2. Talley NJ, Silverstein MD, Agreus L, Nyren O, Sonnenberg A, Holtzmann G. AGA Technical
review: evaluation of dyspepsia. Gastroenterology 1998; 114: 582-595.
3. Talley NJ. Drug treatment of functional dyspepsia. Scandinavian Journal of Gastroenterology 1991;
182: 47-60.
4. Veldhuyzen van Zanten SJ, Cleary C, Talley NJ, Peterson TC, Nyren O, Bradley LA et al. Drug
treatment of functional dyspepsia: a systematic analysis of trial methodology with recommendations for
design of future trials. American Journal of Gastroenterology 1996; 91: 660-673.
5. Graham DY, Colon-Pagan J, Morse RS, Johnson TL, Walsh JH, McCullough AJ et al. Ulcer
recurrence following duodenal ulcer healing with omeprazole, ranitidine, or placebo: a double-blind,
multicenter, 6-month study. The Omeprazole Duodenal Ulcer Study Group. Gastroenterology 1992; 102:
1289-1294.
6. Dammann HG, Walter TA. Efficacy of continuous therapy for peptic ulcer in controlled clinical trials.
Alimentary Pharmacology & Therapeutics 1993; 7 (suppl 2): 17-25.
7. Hetzel DJ, Dent J, Reed WD, Narielvala FM, Mackinnon M, McCarthy JH et al. Healing and
relapse of severe peptic esophagitis after treatment with omeprazole. Gastroenterology 1988; 95: 903-
912.
A randomised trial comparing “test-and-treat” with prompt endoscopy
69
8. Koelz HR, Birchler R, Bretholz A, Bron B, Capitaine Y, Delmore G et al. Healing and relapse of
reflux esophagitis during treatment with ranitidine. Gastroenterology 1986; 91: 1198-1205.
9. Bytzer P, Hansen JM, Schaffalitzky de Muckadell OB. Empirical H2-blocker therapy or prompt
endoscopy in management of dyspepsia. Lancet 1994; 343: 811-816.
10. Unge P, Jonsson B, Stalhammar NO. The cost effectiveness of Helicobacter pylori eradication versus
maintenance and episodic treatment in duodenal ulcer patients in Sweden. Pharmacoeconomics 1995; 8:
410-427.
11. Sobala GM, Crabtree JE, Pentith JA, Rathbone BJ, Shallcross TM, Wyatt JI et al. Screening
dyspepsia by serology to Helicobacter pylori. Lancet 1991; 338: 94-96.
12. Patel P, Khulusi S, Mendall MA, Lloyd R, Jazrawi R, Maxwell JD et al. Prospective screening of
dyspeptic patients by Helicobacter pylori serology. Lancet 1995; 346: 1315-1318.
13. Heaney A, Collins JSA, Watson RGP, McFarland RJ, Bamford KB, Tham TCK. A prospective
randomised trial of a test-and-treat policy versus endoscopy based management in young Helicobacter
pylori positive patients with ulcer-like dyspepsia, referred to a hospital clinic. Gut 1999; 45: 186-190.
14. Jones R, Tait C, Sladen G, Weston-Baker J. A trial of a test-and-treat strategy for Helicobacter pylori
positive dyspeptic patients in general practice. International Journal of Clincial Practice 1999; 53: 413-
416.
15. Lassen AT, Pedersen FM, Bytzer P, Schaffalitzky de Muckadell OB. Helicobacter pylori test-and-
eradicate versus prompt endoscopy for management of dyspeptic patients: a randomised trial. Lancet
2000; 356: 455-460.
16. Bytzer P. Diagnosing dyspepsia: any controversies left ? Gastroenterology 1996; 110: 302-306.
17. Tytgat G, Hungin APS, Malfertheiner P, Talley N, Hongo M, McColl K et al. Decision-making in
dyspepsia: controversies in primary and secondary care. European Journal of Gatroenterology &
Hepatology 1999; 11: 223-230.
18. Fendrick AM, Chernew ME, Hirth RA, Bloom BS . Alternative management strategies for patients
with suspected peptic ulcer disease. Annals of Internal Medicine 1995; 123: 260-268.
19. Silverstein MD, Petterson T, Talley NJ. Initial endoscopy or empirical therapy with or without testing
for Helicobacter pylori for dyspepsia: a decision analysis. Gastroenterology 1996; 110: 72-83.
20. Sonnenberg A. Cost-benefit analysis of testing for Helicobacter pylori in dyspeptic subjects. American
Journal of Gastroenterology 1996; 91: 1773-1777.
21. Briggs AH, Sculpher MJ, Logan RP, Aldous J, Ramsay ME, Baron JH. Cost effectiveness of
screening for and eradication of Helicobacter pylori in management of dyspeptic patients under 45 years
of age. British Medical Journal 1996; 312: 1321-1325.
22. Ebell MH, Warbasse L, Brenner C. Evaluation of the dyspeptic patient: a cost-utility study. Journal of
Family Practice 1997; 44: 545-555.
Chapter 3
70
23. Ofman JJ, Etchason J, Fullerton S, Kahn KL, Soll AH. Management strategies for Helicobacter
pylori - seropositive patients with dyspepsia: clinical and economic consequences. Annals of Internal
Medicine 1997; 126: 280-291.
24. Laheij RJ, Severens JL, Jansen JB, van de Lisdonk EH, Verbeek AL. Management in general
practice of patients with persistent dyspepsia. A decision analysis. Journal of Clinical Gastroenterology
1997; 25: 563-567.
25. Olson AD, Deutsch D . Combined empiric treatment and specific Hp screening and treatment decrease
the cost of evaluating epigastric abdominal pain. Gastroenterology 1998; 114: A248.
26. Laheij RJ, Severens JL, van de Lisdonk EH, Verbeek AL, Jansen JB. Randomized controlled trial of
omeprazole or endoscopy in patients with persistent dyspepsia: a cost-effectiveness analysis. Alimentary
Pharmacology & Therapeutics 1998; 12: 1249-1256.
27. Duggan A, Elliot C., Tolley K, Whynes D, Hawkey CJ, Logan RF. Randomised controlled trial of
four dyspepsia management strategies in primary care with 12 months follow-up. Gastroenterology
2000; 118: A438.
28. Jones R, Lydeard S . Prevalence of symptoms of dyspepsia in the community. British Medical Journal
1989; 298: 30-32.
29. Muris JWM, Starmans R, Fijten GH, Crebolder HFJM, Krebber TFWA, Knottnerus JA.
Abdominal pain in general practice. Family Practice 1993; 10: 387-390.
30. Talley NJ, Colin-Jones D, Koch KL, Nyren O, Stanghellini V. Functional dyspepsia: a classification
with guidelines for diagnosis and management. Gastroenterology International 1991; 4: 145-160.
31. Thijs JC, van Zwet AA, Thijs WJ, Oey HB, Karrenbeld A, Stellaard F et al. Diagnostic tests for
Helicobacter pylori: a prospective evaluation of their accuracy, without selecting a single test as the gold
standard. American Journal of Gastroenterology 1996; 91: 2125-2129.
32. Arents NLA, van Zwet AA, Thijs JC, Degener JE, Kleibeuker JH. A six-year surveillance of H.
pylori resistance in a large study population in the Netherlands (n=5946): Prevalence of clarithromycin
resistance increases, while metronidazole resistance does not increase. Gastroenterology 2001; 120:
A229.
33. Veldhuyzen van Zanten SJO, Tytgat KMAJ, Pollak PT, Goldie J, Goodacre RL, Riddell RH et al.
Can severity of symptoms be used as an outcome measure in trials of non-ulcer dyspepsia and
Helicobacter pylori associated gastritis ? J Clin Epidemiol 1993; 46: 273-279.
34. van der Zee KI, Sanderman R, Heyink J. De psychometrische kwaliteiten van de MOS 36-item Short
Form Health Survey (SF-36). T Soc Gezondheidszorg 1993; 71: 183-191.
35. Ware JE, Sherbourne CD. The RAND-36 Short-form Health Status Survey: 1. Conceptual framework
and item selection . Medical Care 1992; 30: 473-481.
A randomised trial comparing “test-and-treat” with prompt endoscopy
71
36. Kosunen TU, Seppala K, Sarna S, Sipponen P. Diagnostic value of decreasing IgG, IgA, and IgM
antibody titres after eradication of Helicobacter pylori. Lancet 1992; 339: 893-895.
37. Anonymous. American Gastroenterology Association medical position paper: evaluation of dyspepsia.
Gastroenterology 1997; 114: 579-581.
73
Chapter 4
The accuracy of the Helicobacter pylori Stool Antigen test (HpSA
test) in diagnosing Helicobacter pylori in treated and untreated
patients.
Nicolaas L. A. Arents 1, Anton A. van Zwet 1, Jacob C. Thijs 2, Albertine de Jong 1,
Marco Oudkerk Pool 3, and Jan H. Kleibeuker 4.
1 Regional Public Health Laboratory, Groningen / Drenthe2 Department of Internal Medicine, Bethesda Hospital, Hoogeveen3 Department of Gastroenterology, Isala Clinics, Zwolle4 Department of Gastroenterology, University Hospital, Groningen
European Journal of Gastroenterology & Hepatology 2001;13:383-386.
Chapter 4
74
Summary
Objective and design
To evaluate the performance of the HpSA test in detecting H. pylori infection and monitoring the
effect of treatment. This was done in two separate studies using either a biopsy- or 13C-urea breath
test based gold standard (in untreated and treated patients respectively).
Setting
Endoscopy units of two general hospitals.
Patients
Hundred twenty-eight dyspeptic patients undergoing endoscopy in the first study. Sixty-five
patients receiving anti-H. pylori treatment in the second study.
Results
Sensitivity and specificity in untreated patients were 96.3% and 81.8% respectively. Seven days
after treatment these figures were 20% and 95% and four weeks after treatment 40% and 95%
Conclusion
The HpsA test is accurate in untreated patients but fails in monitoring treatment success.
The accuracy of the Helicobacter pylori Stool Antigen test
75
Introduction
The optimal diagnostic approach in patients with dyspepsia is still controversial. Upper
endoscopy is frequently performed as the primary diagnostic test, but it is costly and in most
patients no underlying disease can be identified [1]. It has been suggested that a strategy based on
non-invasive testing for Helicobacter pylori (H. pylori) could be more cost-effective. Such a
strategy could either imply the referral of only H. pylori-positive patients for endoscopy (“test and
scope” strategy) [2-5] or subjecting H. pylori-positive patients to anti-H. pylori treatment (“test
and treat” strategy) [6-8]. Whatever approach is chosen, its efficacy is highly dependent on the
accuracy of the test used to diagnose H. pylori infection. So far, two non-invasive diagnostic tests
for H. pylori were clinically available: ELISA based serology and urea breath tests using either 13C
or 14C. Both tests have been thoroughly validated [9-17] but have their limitations. The urea breath
tests are expensive and the samples need to be examined in a specialised laboratory. ELISA
serology may still be positive several years after (accidental) eradication of H. pylori by antibiotic
treatment, as antibody titres decline very slowly [18,19]. Recently, a new easy to perform non-
invasive diagnostic test has been introduced: the H. pylori Stool Antigen test (HpSA test, Meridian
Diagnostics, Cincinnati, OH, USA), based on the detection of H. pylori antigens in faeces. The
first studies evaluating this test are highly promising [20,21]. Moreover, the test was claimed to be
suitable for early monitoring of treatment success [21,22]. In that respect the test could be
competitive with breath testing. In this study we evaluated the HpSA test in a group of untreated
patients and also tested its performance to monitor treatment success.
Methods
In the first part of our study (study A), we evaluated the accuracy of the HpSA test in patients
who had never been treated for H. pylori infection. Patients undergoing gastroduodenoscopy in
two regional hospitals in the Netherlands were invited to bring their faeces the day after
endoscopy. Patients using protonpump inhibitors (PPI) and/or antibiotics during the previous four
weeks were excluded. At endoscopy, four biopsy specimens were taken within 4 cm of the
pylorus: one for culture, two for histology (HE and Giemsa stain), and one for rapid in-house
urease testing. Culture and rapid urease testing were performed as described previously [23]. A
patient was considered H. pylori infected if culture was positive and/or histology and rapid urease
test were both positive. All other combinations were regarded as H. pylori negative.
Chapter 4
76
In the second part of our study (study B), we evaluated the HpSA test after treatment. Culture
proven H. pylori positive patients receiving anti H. pylori therapy were asked to collect a faecal
sample 7 days and 4 weeks after cessation of treatment. Success of treatment was determined by
UBT 4 and 8 weeks after the end of therapy. Patients were not allowed to use PPI's or antibiotics
in the time between treatment and the second UBT. If both UBT tests were negative, the patient
was considered H. pylori negative. If any UBT was positive, endoscopy was performed and H.
pylori status was determined in the same way as in study A. UBT was performed using 100 mg13C-urea and orange juice as a test meal. The test was considered positive if δ 13CO2/12CO2 was ≥ 5
per mil at 20 and/or 30 minutes after intake of the labelled urea. The HpSA test was performed
according to the manufacturer's guidelines by a single experienced technologist in batches of 48
samples including two controls.
Optical density (OD) was determined by dual wavelength spectrophotometry (450/630 NM).
Cut-off values advocated by the manufacturer were used: negative < 0.1; equivocal ≥ 0.1 but <
0.12; positive ≥ 0.12. We also drew a Receiver-Operator Characteristic curve (ROC-curve) and
recalculated the optimal cut-off value for our population. All patients gave informed consent and
the local ethics committee approved the study protocol.
Results
Hundred twenty eight patients participated in study A (54 males, age range 16-84 years, mean
53). Fifty-five of them (43%) were H. pylori positive by gold standard. Using the manufacturer’s
cut-off values, eight patients (6.2%) had an equivocal HpSA test result (one patient H. pylori-
positive and seven H. pylori negative by gold standard). The HpSA test identified 52 (96.3%) of
the remaining 54 H. pylori positive patients correctly. Fifty-four (81.8%) of the remaining 66 H.
pylori-negative patients were negative by HpSA test. The ROC-curve is shown in figure 1. The
optimal cut-off in our population proved to be OD = 0.2. This cut-off value led to a sensitivity and
specificity of 89.1% and 89.0% respectively.
Sixty-five patients were included in study B (29 males, mean age 58, range 18-76). In five
patients (7.7%) UBT was positive after treatment (first UBT in four and second in one) and
persisting H. pylori infection was confirmed by endoscopy in all of them. In this study no
The accuracy of the Helicobacter pylori Stool Antigen test
77
Figure 1.
Receiver operator characteristic curve based on data from study A.
equivocal HpSA results were encountered using the manufacturer’s cut-off values. Using these
values, the HpSA test, performed 7 days after cessation of treatment was positive in only one
(20.0%) of the five patients in whom treatment failed. Four weeks after cessation of treatment this
figure was 2 out of five (40.0%). In the 60 patients who were successfully treated, HpSA was
falsely positive in three both 7 days and 4 weeks after cessation of treatment (specificity at both
occasions 95.0%). Figures changed only marginally when the optimal cut-off value determined by
the ROC-curve obtained from study A was applied (after 7 days sensitivity 20.0% and specificity
96.7%; after 4 weeks sensitivity 20.0% and specificity 98,3%). The data are summarised in table 1.
0,000
0,100
0,200
0,300
0,400
0,500
0,600
0,700
0,800
0,900
1,000
0,000 0,200 0,400 0,600 0,800 1,000
sens
itivi
ty
1 - specificity→ →
↑
Chapter 4
78
The accuracy of the Helicobacter pylori Stool Antigen test
79
Discussion
The good performance of the HpSA test in study A is in agreement with the data reported by
Vaira et al. [20]. The accuracy was somewhat lower in our study, but due to the limited number of
patients tested, confidence intervals are rather wide and our results still suggest that in untreated
patients, the HpSA test may be a valuable diagnostic method. When compared to the UBT, the test
has got the advantage that it does not need a specialised laboratory and is less expensive. In our
view, however, it has still to be shown that the HpSA test has a significant advantage above the
cheaper serological test for screening purposes.
It has been claimed that the HpSA test can be used for monitoring treatment success and that
successful eradication of H. pylori can be confirmed as early as 1 week after treatment [24,25]. In
that respect the HpSA test could have an important advantage over serological tests as antibody
titres decline slowly and it takes about six months before serology can reliably be used to confirm
treatment success [17,19]. Moreover, in contrast with serological monitoring of treatment success
for which pre- and post treatment titres are needed, only one faecal sample is required when the
HpSA test is used for that purpose. Several authors found the HpSA test to have a sensitivity and
specificity of > 91% and > 95% respectively in treated patients 4 weeks after cessation of therapy
[21,22,26]. Our study, however, does not substantiate these findings as sensitivity and positive
predictive value were poor both 7 days and 4 weeks after cessation of therapy. The employment of
the most optimal cut-off value for our population, as determined in study A, did not improve the
accuracy of the HpSA test in treated patients.
The difference between our results and the excellent results reported by others is striking and
we have no adequate explanation for that difference. It is difficult to conceive that differences
between the populations studied could be an explanation and it is also unlikely to be due to
methodological problems, as the HpSA test is very easy to perform. Nevertheless, our results led
us to question our methodology and we asked independent investigators to repeat the tests on the
same post-treatment faecal samples. The results, however, did not change.
Based on our results, we have to conclude that the HpSA test is accurate in detecting the
presence of H. pylori in untreated patients. In our hands, however, the HpSA test failed as a
method to monitor treatment success.
Chapter 4
80
References
1. Talley NJ, Silverstein MD, Agreus L, Nyren O, Sonnenberg A, Holtzmann G. AGA Technical
review: evaluation of dyspepsia. Gastroenterology 1998; 114: 582-595.
2. Patel P, Khulusi S, Mendall MA, Lloyd R, Jazrawi R, Maxwell JD et al. Prospective screening of
dyspeptic patients by Helicobacter pylori serology. Lancet 1995; 346: 1315-1318.
3. Sobala GM, Crabtree JE , Pentith JA, Rathbone BJ, Shallcross TM, Wyatt JI et al. Screening
dyspepsia by serology to Helicobacter pylori. Lancet 1991; 338: 94-96.
4. Mendall MA, Goggin PM, Marrero JM, Molineaux N, Levy J, Badve S et al. Role of
Helicobacter pylori serology in screening prior to endoscopy. European Journal of Gatroenterology &
Hepatology 1992; 4: 713-717.
5. Slade PE, avidson AR, teel A, ox RA, lackburn PA. Reducing the endoscopic workload: does
serological testing for Helicobacter pylori help ? European Journal of Gatroenterology & Hepatology
1999; 11: 857-862.
6. Ofman JJ, Etchason J, Fullerton S, Kahn KL, Soll AH. Management strategies for Helicobacter
pylori - seropositive patients with dyspepsia: clinical and economic consequences. Annals of Internal
Medicine 1997; 126: 280-291.
7. Breslin NP, Lee J, Buckley M, O'Morain C. Screening for Helicobacter pylori in young dyspeptic
patients referred for investigation--endoscopy for those who test negative. Alimentary Pharmacology
& Therapeutics 1998; 12: 577-582.
8. Moayyedi P, Zilles A, Clough M, Hemingbrough E, Chalmers DM, Axon ATR. The effectiveness
of screening and treating Helicobacter pylori in the management of dyspepsia. European Journal of
Gatroenterology & Hepatology 1999; 11: 1245-1250.
9. Graham DY, Klein PD, Evans DJ, Jr., Evans DG, Alpert LC, Opekun AR et al. Campylobacter
pylori detected noninvasively by the 13C-urea breath test. Lancet 1987; 1: 1174-1177.
10. Logan RPH. The 13C-UBT for the detection of Helicobacter pylori. In: Rathbone BJ, Heatly RV,
editors. Helicobacter pylori and gastroduodenal disease. London: Blackwell Scientific Publications,
1992: 88-107.
11. Thijs JC, van Zwet AA , Thijs WJ, Oey HB, Karrenbeld A, Stellaard F et al. Diagnostic tests for
Helicobacter pylori: a prospective evaluation of their accuracy, without selecting a single test as the
gold standard. American Journal of Gastroenterology 1996; 91: 2125-2129.
12. Meijer BC, Thijs JC, Kleibeuker JH, van Zwet AA, Berrelkamp RJ . Evaluation of eight enzyme
immunoassays for detection of immunoglobulin G against Helicobacter pylori. Journal of Clinical
Microbiology 1997; 35: 292-294.
The accuracy of the Helicobacter pylori Stool Antigen test
81
13. Perez-Perez GI, Dworkin BM, Chodos JE, Blaser MJ. Campylobacter pylori antibodies in humans.
Annals of Internal Medicine 1988; 109: 11-17.
14. Talley NJ, Newell DG, Ormand JE, Carpenter HA, Wilson WR, Zinsmeister AR et al.
Serodiagnosis of Helicobacter pylori: comparison of enzyme-linked immunosorbent assays. Journal of
Clinical Microbiology 1991; 29: 1635-1639.
15. Crabtree JE, Shallcross TM, Heatley RV, Wyatt JI. Evaluation of a commercial ELISA for
serodiagnosis of Helicobacter pylori infection. J Clin Pathol 1991; 44: 326-328.
16. Cullen DJ, Cullen KJ, Collins BJ, Christiansen KJ, Epis J. Serological assessment of
Helicobacter pylori eradication [letter]. Lancet 1992; 340: 1161-1162.
17. Cutler A, Schubert A, Schubert T. Role of Helicobacter pylori serology in evaluating treatment
success. Digestive Diseases and Science 1993; 38: 2262-2266.
18. Cutler AF, Prasad VM. Long-term follow-up of Helicobacter pylori serology after successful
eradication. American Journal of Gastroenterology 1996; 91: 85-88.
19. Thijs JC, van Zwet AA , Meijer BC, Berrelkamp RJP. Serology to monitor the efficacy of anti-
Helicobacter pylori treatment. European Journal of Gatroenterology & Hepatology 1994; 6: 579-583.
20. Vaira D, Malfertheiner P, Megraud F, Axon ATR, Deltenre M, Hirschl AM et al. Diagnosis of
Helicobacter pylori infection with a new non-invasive antigen-based assay. Lancet 1999; 354: 30-33.
21. Braden B, Teuber G, Dietrich CF, Caspary WF, Lembcke B. Comparison of new faecal antigen
test with 13C-urea breath test for Helicobacter pylori infection and monitoring eradication treatment :
prospective clinical evaluation. British Medical Journal 2000; 320: 16-17.
22. Vaira D, Malfertheiner P, Megraud F, Axon ATR, Deltenre M, Gasbarrini G et al. Noninvasive
antigen-based assay for assessing Helicobacter pylori eradication: a European multicenter study.
American Journal of Gastroenterology 2000; 95: 925-929.
23. van Zwet AA, Thijs JC , Kooistra-Smid AMD, Schirm J, Snijder JAM. Sensitivity of culture
compared with that of polymerase chain reaction for detection of Helicobacter pylori from antral
biopsy samples. Journal of Clinical Microbiology 1993; 31: 1918-1920.
24. Van 't Hoff BWM, van der Ende A, van der Hulst RWM, Roorda PLH, Houben MHMG,
Rauws EAJ et al. Helicobacter pylori antigen stool specimen as a possible monitoring tool for
eradication therapy. Gut 1998; 43 (suppl 2): A49 (abstract).
25. Bleau BL, Veldhuyzen van Zanten S, Best L, Hutchison D, Blevins J, Thee D. Determination of
eradication of Helicobacter pylori (Hp) by the Hp stool antigen test (HPSAT). Gut 1998; 43 (suppl 2):
A50 (abstract).
26. Oderda G, Rapa A, Ronchi B, Lerro P, Pastore M, Staiano A et al. Detection of Helicobacter
pylori in stool specimens by non-invasive antigen enzyme immunoassay in children: multicentre
Italian study. British Medical Journal 2000; 320: 347-348.
Chapter 4
82
27. Braden B, Teuber G, Dietrich CF, Caspary WF, Lembcke B. Comparison of new faecal antigen
test with 13C-urea breath test for Helicobacter pylori infection and monitoring eradication treatment :
prospective clinical evaluation. British Medical Journal 2000; 320: 16-17.
83
Chapter 5
Does the declining prevalence of Helicobacter pylori unmask
patients with idiopathic peptic ulcer disease ?
Trends over an eight-year period.
Nicolaas L. A. Arents 1, Jacob C. Thijs 2, Anton A. van Zwet 1, and
Jan H. Kleibeuker 3.
1 Regional Public Health Laboratory, Groningen / Drenthe
2 Department of Gastroenterology, Bethesda Hospital, Hoogeveen
3 Department of Gastroenterology, University Hospital, Groningen
Submitted for publication.
Chapter 5
84
Abstract
Objectives
Recent North American studies have suggested that the prevalence of Helicobacter pylor (H.
pylori) infection in patients with peptic ulcer disease (PUD) not using non-steroidal anti-
inflammatory drugs (NSAIDs) has been overestimated. The decreasing prevalence of H. pylori
could lead to a relative increase in the number of patiens with this idiopathic PUD (IPUD).
Aim
This study aimed to investigate the prevalence of IPUD and any possible trends.
Methods
The reports of all upper gastro-intestinal endoscopies performed in a Dutch regional hospital over
the period 1991 to 1998 were reviewed. If a gastric and/or duodenal ulcer had been diagnosed,
data concerning a possible H. pylori infection (culture, histology, rapid in-house urease test) were
retrieved. If H. pylori tests were negative, hospital files were examined for possible NSAIDs use
or other rare causes of PUD. When these were not found, stored biopsy specimens were tested for
H heilmanii by PCR.
Results
PUD was diagnosed in 405 endoscopies (GU=159, DU=235, GU+UD=11). In 349 of these cases
(86.2%), H. pylori infection was found. Thirty three of the 56 H. pylori negative patients used
NSAIDs and three patients had Crohn’s disease leaving 20 patients with IPUD (4.9%, GU=12,
DU=8). Timetrends over the study period showed a decrease of H. pylori associated PUD
(p<0.002) and an increase of NSAIDs associated PUD (p<0.0005). The prevalence of IPUD
remained stable (p=0.978).
Conclusion
IPUD is rare in the Netherlands and its prevalence did not increase over a period of eight years.
The prevalence of H. pylori associated PUD is decreasing while the prevalence of NSAIDs
associated PUD is increasing.
Does the declining prevalence of Helicobacter pylori unmask patients with IPUD ?
85
Introduction
Peptic ulcer disease (PUD) has been strongly associated with Helicobacter pylori (H. pylori)
infection [1]. It has previously been suggested that about 80% of the patients with gastric ulcer
(GU) and over 90% of the patients with duodenal ulcer (DU) are infected with this bacterium
[2,3]. Most PUD patients, not infected with H. pylori, were thought to have used non-steroidal
anti-inflammatory drugs (NSAIDs) [2,4,5]. In a small minority of patients, however, neither H.
pylori nor NSAIDs can be incriminated, even after exclusion of falsely negative tests for H. pylori
(mainly due to recent use of acid-suppressive drugs or antibiotics [6,7]) or concealed use of
NSAIDs [8]. If rare causes of the ulcer (table 1) are not identified, these patients are considered to
suffer from idiopathic PUD (IPUD).
Table 1.
Rare causes of Duodenal and Gastric ulcer disease
Helicobacter heilmanii (Gastrospirillum hominis)
Crohn’s disease
Penetrating carcinoma / lymphoma's
Gastrinoma
Cytomegalovirus infection
Tuberculosis
Ischaemia
It has recently been suggested, however, that the prevalence of H. pylori in patients with
NSAID-negative DU has been overestimated and the combined results of several large well-
performed North American studies showed that no more than 75% of those patients are infected
with H. pylori [9]. Two other recent North American studies also reported lower prevalence rates
of 74% and 61% respectively [10,11]. Another argument supporting the suggestion that the
significance of H. pylori in PUD has been overestimated, comes from studies reporting that
duodenal ulcers still recur in about 20% of the patients after successful H. pylori eradication [5,12-
14]. These observations have resulted in the hypothesis that in some patients with PUD H. pylori
infection actually masks the presence of IPUD [7,15]. If this is true, it can be anticipated that the
decreasing prevalence of H. pylori infection will reveal an increasing number of patients with
Chapter 5
86
IPUD. This would have significant implications for the approach of patients with peptic ulcer
disease in the near future.
On the other hand, most of these s tudies were performed in North America and recent studies
from other parts of the world still have shown H. pylori prevalence rates to exceed 90% in DU
[3,15-19]. The aim of this retrospective study was to investigate the prevalence of IPUD in an
European population and to detect any change in that prevalence over a period of 8 years.
Methods
The study was performed in a small regional hospital in the north-eastern part of The
Netherlands, serving a population of 75.000 persons. The reports of all upper gastrointestinal
endoscopies performed over an 8-year period (1991-1998) were studied. After exclusion of the
endoscopy reports of patients with previous gastric resection and patients undergoing endoscopy
for the follow up of previously diagnosed disease, endoscopy reports describing a gastric or
duodenal ulcer (defined as a mucosal break of > 5 mm with a clearly visible ulcer crater) were
selected. In the large majority of these PUD patients biopsy samples had been taken for the
diagnosis of H. pylori infection by rapid urease testing, histology (Haematoxylin-eosin and
Giemsa stain), and H. pylori culture as previously described [20]. The patients were classified as
having “H. pylori associated PUD” if any of these tests was positive and as having “H. pylori-
negative PUD” if no test was positive and at least two tests were negative. Endoscopy reports were
omitted from further evaluation, if the patient was not tested for H. pylori, if the test results were
lost, or if only one test was performed and described as negative.
In case of “H. pylori-negative PUD” the hospital files of the patients were retrieved and the
clinical presentation was noted. Moreover, the files were carefully searched for documented
NSAID use, especially in the presence of diseases (such as arthritis and cardiovascular disease)
making the use of NSAIDs or (low-dose) aspirin likely. If NSAID use could be demonstrated the
“H. pylori-negative PUD” was subclassified as “NSAID-associated PUD”. The hospital files were
also searched for the possible presence or developement of other rare causes of PUD mentioned in
table 1. If such a cause was not identified and both H. pylori and NSAID use could not be
incriminated paraffin embedded antral biopsy specimens were retrieved and assessed by a nested
PCR procedure for the presence of Helicobacter heilmanii (H. heilmanii). The biopsy specimens
were extracted from the paraffin and DNA isolation was performed on each entire biopsy
Does the declining prevalence of Helicobacter pylori unmask patients with IPUD ?
87
specimen according to Boom et al. [21]. Subsequently, all bacterial 16S rDNA-genes were
amplified by PCR using the following primers: forward 5’ CTTTACGCCATTTAATCCG 3’ and
reversed 5’ AGAGTTTGATCCTGGTTCAG 3’. PCR conditions were 40 cycles of 30 sec at 95ºC,
30 at 60ºC, and 60 at 72ºC, followed by a final extension of 10 minutes at 72ºC. The amplification
products were used in a second PCR amplification to detect the presence of H. heilmanni using the
following primers: forward 5’ AACGATGAAGCTTCTAGCTTGCTAG 3’ and reverse 5’
GTGCTTATTCGTTAGATACC-GTCAT 3’. In this case, PCR conditions were 35 cycles of 30
sec at 95ºC, 30 at 50ºC, and 60 at 72ºC followed by a final extension of 10 minutes at 72ºC. The
presence of a specific amplificate for H. heilmanii was visualised by standard 2% agarose gel
electrophoresis and ethidium bromide staining.
Group proportions were compared by Chi-square testing with Yates' correction. The presence
of time trends was investigated by Cochran's linear trend analysis. A p value of <0.05 was
considered significant.
Results
In the period from 1991 to 1998 6241 endoscopies of the upper alimentary tract were
performed. Of these, 1381 endoscopies were performed in patients with previous gastric resection
or for the follow up of previously diagnosed disease, leaving 4860 endoscopy reports for
evaluation. In 439 of these reports (9.0%) peptic ulcer was described ((GU in 173 (39.4%), DU in
254 patients (57.9%), and GU+DU in 12 patients (2.7%)). Thirty-four of the 439 endoscopy
reports (7.7%) were omitted as the H. pylori status could not be determined adequately. Three
hundred-forty-nine (86.2%) of the remaining 405 reports described at least one positive H. pylori
test result and the ulcers were therefore classified as “H. pylori associated PUD”. During the study
period, the percentage of PUD that was associated with H. pylori decreased significantly
(p=0.002). In 56 reports (13.8%) “H. pylori-negative PUD” was documented, which proved to be
“NSAID associated PUD” in 33 cases (8.1%). The proportion of PUD patients having “NSAID
associated PUD” increased significantly over the study period (p<0.0005). Finally, in 23 cases
(5.7%) neither H. pylori infection nor NSAID use could be incriminated. Three of these patients
suffered from Crohn’s disease (one patient with GU, one patient with DU, and one patient with
both GU and DU), leaving 20 patients with IPUD (4.9%). PCR on H. heilmanii was negative in all
of them. The proportion of PUD patients having IPUD did not change significantly over the study
Chapter 5
88
period (p=0.978) and varied between 0% and 12.5% (mean 4.9%). Table 2 summarises the
absolute numbers in the different subgroups. Figure 1 shows the proportions of the subgroups
within the PUD group, omitting the three patients with Crohn's disease.
the three patients with Crohn's disease.
Table 2.
Absolute numbers of H. pylori associated PUD, NSAID associated PUD, Crohn’s disease
associated PUD, and IPUD over the study period.
Year ‘91 ‘92 ‘93 ‘94 ‘95 ‘96 ‘97 ‘98 Total
Hp+ 39 54 49 52 34 42 40 39 349
Hp- / NSAID+ 1 2 1 3 4 8 5 9 33
Hp- / NSAID- / M. Crohn + 0 0 1 0 1 0 0 1 3
Hp- / NSAID- / M. Crohn - (IPUD) 3 2 1 3 3 3 5 0 20
total PUD 43 58 52 58 42 53 50 49 405
Hp = Helicobacter pylori, PUD = peptic ulcer disease, IPUD = idiopathic peptic ulcer disease,
NSAID = non-steroidal anti-inflammatory drugs
When GU and DU were considered separately (GU+DU omitted because of the limited number
of patients), it was shown that the relative proportions of both conditions within the total PUD
group did not change significantly during the study period (p=0.2 and p=0.6 respectively). H.
pylori infection was more prevalent in DU (mean 89.4%) than in GU (mean 81.1%) (p=0.03), but
its prevalence in DU decreased significantly during the study period (p=0.01), whereas the
prevalence of H. pylori in GU decreased only marginally (p=0.052). In both groups, NSAID use
could be demonstrated in an increasing number of patients (p=0.023 for GU and p=0.003 for DU).
GU seemed to represent IPUD more often than DU (7.5% vs 3.4%) but the difference did not reach
statistical significance (p=0.10) and no significant trends were observed within either group during
the study period. In a remarkably high percentage of patients with IPUD (50%) the first clinical
presentation proved to be an upper gastro-intestinal haemorrhage.
Does the declining prevalence of Helicobacter pylori unmask patients with IPUD ?
89
Figure 1.
The contribution of all PUD subgroups: H. pylori associated PUD, NSAID associated PUD,
and IPUD to the total number of patients with PUD.
Discussion
In accordance with many other studies [2,3], our study showed that the prevalence of H. pylori
infection is higher in DU (89.4%) than in GU (81.1%). It also showed that the prevalence of H.
pylori in patients with DU visiting a Dutch hospital is gradually decreasing, even though most
patients still harbor the infection. The prevalence of H. pylori in patients with GU seemed to
decrease, but the trend did not reach statistical significance. Most patients with “H. pylori–
negative PUD” had used NSAIDs as documented in their endoscopy reports and hospital files. The
proportion of PUD that could reasonably be ascribed to NSAID use increased significantly from
1991 to 1998. This was true for both DU and GU. The proportion of PUD patients in whom
neither H. pylori nor NSAID use could be incriminated did not increase significantly during the
study period. In none of these patients H. heilmanii could be demonstrated by PCR but in three of
them Crohn’s disease was detected. The proportion of PUD patients having IPUD was only 4.9%.
Being retrospective, our study has some inevitable shortcomings. First of all, even though any
NSAID use is usually mentioned in the endoscopy report and the hospital files were thoroughly
checked for it, it cannot be excluded that some patients with IPUD actually had concealed NSAID
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
91 92 93 94 95 96 97 98
H. pylori + H. pylori- / NSAID + True IPUD
Chapter 5
90
use. Secondly, it could be argued that the prevalence of H. pylori infection was underestimated as
the tests for H. pylori might have been falsely negative due to sampling error or the recent use of
antibiotics or proton pump inhibitors. As we usually take both antral and corpus biopsy samples
and test by three methods (culture, histology and rapid urease test) we consider this less likely.
Moreover, we excluded patients if only one test result was available and described as negative. In
any case, if either possibility would be true it would only strengthen our conclusion that IPUD is
still rare in The Netherlands.
The low prevalence of IPUD in our study is in strong contrast with data from the USA [9-11] but
in line with prevalences found in other European studies [17,18]. An explanation for the observed
difference between Europe and the USA is yet to be given, as differences in detection methods for
H. pylori are an unlikely explanation and concealed NSAID use was carefully excluded in the
American studies [9-11].
When reviewing the hospital files of patients with IPUD we were struck by the observation that
50% of the patients acutely presented with an upper gastro-intestinal haemorrhage. To our
knowledge, this has not previously been discribed. This is remarkable as it has been estimated that
this complication occurs in approximately 15% of all PUD patients [22].
In conclusion, in a Dutch population the proportion of PUD associated with H. pylori infection
is gradually decreasing. This decrease is accompanied by an increase in the proportion of PUD
attributable to NSAID use. These developments are especially seen in DU patients and less so in
GU. The proportion of PUD that cannot be attributed to either H. pylori or NSAID use (IPUD)
seems to remain stable and is still very small. In those patients H. heilmanii does not seem to be a
significant cause but other diseases, especially Crohn’s disease should be looked for.
References
1. Marshall BJ. Helicobacter pylori. American Journal of Gastroenterology 1994; 89: S116-S127.
2. Kuipers EJ, Thijs JC, Festen HPM. Helicobacter pylori and peptic ulcer disease. Alimentary
Pharmacology & Therapeutics 1995; 9 (suppl 2): 59-69.
3. Nishikawa K, Sugiyama T, Kato M, Ishizuka J, Komatsu Y, Kagaya H et al. Non-Helicobacter
pylori and non-NSAID peptic ulcer disease in the Japanese population. European Journal of
Gatroenterology & Hepatology 2000; 12: 635-640.
4. Borody TJ, Brandl S, Andrews P, Jankiewicz E, Ostapowicz N. Helicobacter pylori-negative
gastric ulcer. American Journal of Gastroenterology 1992; 87: 1403-1406.
Does the declining prevalence of Helicobacter pylori unmask patients with IPUD ?
91
5. Lanas A, Remacha B, Sainz R, Hirschowitz BI. Study of outcome after targeted intervention for
peptic ulcer resistant to acid suppresion therapy. American Journal of Gastroenterology 2000; 95:
513-519.
6. Nensey YM, Schubert TT , Bologna SD, Ma CK. Helicobacter pylori-negative duodenal ulcer. Am
J Med 1991; 91: 15-18.
7. Howden CW. What causes Helicobacter pylori negative non-NSAID-related ulcers ? In: Hunt RH,
Tytgat GNJ, editors. Helicobacter pylori. Basic Mechanisms to clinical cure 2000. Dordrecht: Kluwer
Academic Publishers, 2000: 339-345.
8. Hirschowitz BI, Lanas A. Intractable upper gastrointestinal ulceration due to aspirin in patients who
have undergone surgery for peptic ulcer. Gastroenterology 1998; 114: 883-892.
9. Ciociola AA, McSorley DJ, Turner K, Sykes D, Palmer JBD. Helicobacter pylori infection rates in
duodenal ulcer patients in the United States may be lower than previously estimated. American
Journal of Gastroenterology 1999; 94: 1834-1840.
10. Peterson WL, Ciociola AA, Sykes DL, McSorley DJ, Webb DD, The RBC H.pylori study group.
Ranitidine bismuth citrate plus clarithromycin is effective for healing duodenal ulcers, eradicating
Helicobacter pylori and reducing ulcer recurrence. Alimentary Pharmacology & Therapeutics 1996;
10: 251-261.
11. Jyotheeswaran S, Shah AN, Jin HO, Potter GD, Ona FV, Chey WY. Prevalence of Helicobacter
pylori in peptic ulcer patients in greater Rochester, NY: is empirical triple therapy justified ?
American Journal of Gastroenterology 1998; 93: 574-578.
12. Lanza F, Ciociola AA, Sykes D, Heath A, McSorley DJ, Webb PM. Ranitidine bismuth citrate plus
clarithromycin is effective in eradicating H. pylori, and preventing ulcer relapse. Gastroenterology
1996; 91: 917.
13. Sprung DJ. The natural history of duodenal ulcer disease and how it relates to Helicobacter pylori.
American Journal of Gastroenterology 1997; 92: 1655.
14. Laine L, Hopkins RJ, Girardi LS . Has the impact of Helicobacter pylori therapy on ulcer
recurrence in the United States been overstated? A meta-analysis of rigorously designed trials.
American Journal of Gastroenterology 1998; 93: 1409-1415.
15. Higuchi K, Arakawa T, Fuijwara Y, Uchida T, Tominaga K, Watanabe T et al. Is Helicobacter
pylori-negative duodenal ulcer masked by the high prevalence of H.pylori infection in the general
population ? American Journal of Gastroenterology 1999; 94: 3083-3084.
16. Cutler AF, Schubert TT. Patient factors affecting Helicobacter pylori eradication with triple therapy.
American Journal of Gastroenterology 1993; 88: 505-509.
Chapter 5
92
17. Gisbert JP, Blanco M, Mateos JM, Fernandez-Salazar L, Fernandez-Bermejo M, Cantero J et
al. H. pylori-negative duodenal ulcer prevalence and causes in 774 patients. Digestive Diseases and
Science 1999; 44: 2295-2302.
18. McColl KEL, El-Nujumi AM, Chittajallu RS, Dahill SW, Dorrian CA, El-Omar E et al. A study
of the pathogenesis of Helicobacter pylori negative chronic duodenal ulcer. Gut 1993; 34: 762-768.
19. Pan ZJ, Berg DE, van der Hulst R, Su WW, Raudonikiene A, Xiao SD et al. Prevalence of
vacuolating cytotoxin production and distribution of distinct vacA alleles in Helicobacter pylori from
China. Journal of Infectious Diseases 1998; 178: 220-226.
20. Thijs JC, van Zwet AA , Thijs WJ, Oey HB, Karrenbeld A, Stellaard F et al. Diagnostic tests for
Helicobacter pylori: a prospective evaluation of their accuracy, without selecting a single test as the
gold standard. American Journal of Gastroenterology 1996; 91: 2125-2129.
21. Boom R, Sol CJA, Heijtink R, Wertheim-van Dillen PME, van der Noordaa J. Rapid purification
of hepatitis B virus DNA from serum. Journal of Clinical Microbiology 1991; 29: 1804-1811.
22. Del Valle J, Cohen H, Laine L, Scheiman JM. Acid peptic disorders. In: Yamada Y, editor.
Textbook of Gatroenterology. Philadelphia, New York, Baltimore: Lippincott, Williams & Wilkins,
1999: 2023-2045.
93
Chapter 6
The influence of changing prevalences in metronidazole and
clarithromycin resistance on the efficacy of Helicobacter pylori
treatment.
Nicolaas L. A. Arents 1, Anton A. van Zwet 1, Jacob C. Thijs 2, John E. Degener 3, and
Jan H. Kleibeuker 4.
1 Regional Public Health Laboratory, Groningen / Drenthe2 Department of Internal Medicine, Bethesda Hospital, Hoogeveen3 Department of Medical Microbiology, University Hospital, Groningen4 Department of Gastroenterology, University Hospital, Groningen
Submitted for publication.
Chapter 6
94
Abstract
Dyspeptic patients managed by the “test-and-treat” strategy in primary care receive “blind”
anti-H. pylori therapy as knowledge about antimicrobial susceptibility is lacking. Antibiotic
resistance in H. pylori, however, has a significant impact on the efficacy of the frequently used
triple regimens.
The aim of this study was to detect trends in the prevalence of metronidazole and
clarithromycin resistance in biopsy specimens obtained at endoscopy of more than 16000 patients
collected during an eight year period. Moreover we have calculated the theoretical efficacy of two
triple regimens (PAM: protonpump inhibitor - amoxicillin - metronidazole, and PAC: protonpump
inhibitor - amoxicillin - clarithromycin) when prescribed “blindly” to 100 consecutive H. pylori
positive dyspeptic patients based on data from meta-analysis studies in the literature.
During the study period, the prevalence of metronidazole resistance decreased significantly
from 28.4% in 1996 to 13.5% in 2001. The prevalence of clarithromycin resistance remained
stable at about 2.2%. Both triple regimens had an overall efficacy of > 80%, but the PAM regimen
was more effective than the PAC regimen and will become increasingly more effective when the
prevalence of metronidazole resistance continues to decline.
Introduction
The majority of the world population is infected with Helicobacter pylori (H. pylori) [1]. This
bacterium is the most important cause of gastritis and peptic ulcer disease (PUD) and is also
associated with the development of gastric cancer [2-4]. Nevertheless, most patients harbouring H.
pylori will never develop any symptoms [5], and therefore, most guidelines have recommended to
treat the infection only in PUD patients as only those patients will most likely benefit from H.
pylori eradication. To diagnose PUD, however, endoscopy is needed and an increasing number of
younger dyspeptic patients is managed by their general practitioner (GP) by the “test-and-treat”
approach [6]. In this strategy, dyspeptic patients are screened for H. pylori by non-invasive means
and those testing positive receive anti-H. pylori therapy without prior endoscopy. H. pylori
negative patients are usually reassured or treated empirically with acid-suppressive or prokinetic
agents [7,8]. This approach is likely to be more cost-effective, as it leads to a decrease in the
number of endoscopies and has therefore been embraced by several international authorities in the
The influence of changing prevalences of antibiotic resistance in Helicobacter pylori
95
field of gastroenterology [9-12]. In view of these developments, most H. pylori infections will be
treated without prior knowledge of antibiotic susceptibility.
Treating H. pylori infection in primary care is only possible when short, effective, and well
tolerated, regimens are available which are easy to comply with. The most commonly prescribed
anti-H. pylori regimens in primary care are the triple regimens which fulfil most of these
conditions. These 7-14-day regimens contain a proton-pump inhibitor, amoxicillin, and either
metronidazole (PAM) or clarithromycin (PAC). According to the recommendations of the
European Society of Primary Care Gastroenterology, treatment of H. pylori infection in primary
care should achieve a cure rate of at least 80% [13]. Such a cure rate can easily be achieved by
both triple regimens [14], provided that the patient is carrying a metronidazole and/or
clarithromycin susceptible strain [15]. In the presence of a metronidazole and/or clarithromycin
resistance, however, the efficacy of these triple regimens is significantly lowered [14,15].
Resistance to amoxicillin is extremely rare and so-far only one case of a stable amoxicillin
resistant H. pylori strain has been reported [16]. Widespread resistance to metronidazole and
clarithromycin in H. pylori would, therefore, seriously hamper the suitability of the “test-and-treat”
strategy and recently, several studies have suggested that the prevalence of metronidazole and
clarithromycin resistance may be increasing [17-20]. Even though most of these studies were
performed in a relatively small number of strains it can be questioned whether the goal of the
European Society of Primary Care Gastroenterology will remain achievable in the near future if
the PAM or PAC regimens are used. The aim of this study was to determine the prevalence of
metronidazole and clarithromycin resistance in a large population over an eight-year period and to
investigate the presence of trends. Moreover, we calculated the theoretical efficacy of the PAM
and PAC regimen when prescribed “blindly” at different prevalence rates of antibiotic resistance.
Methods
The study was performed in the northeastern part of the Netherlands in the microbiology
laboratories of five different regional hospitals (Refaja Hospital Stadskanaal, Bethesda Hospital
Hoogeveen, Diaconessen Hospital Meppel, Scheper Hospital Emmen and Regional Hospital
Hardenberg). In those laboratories H. pylori cultures have been performed by the same
standardised protocol since 1995. Briefly, biopsy specimens obtained at endoscopy from the
antrum and corpus of the stomach were transported in thioglycolate broth to the microbiology
Chapter 6
96
laboratory. The specimens were rubbed on Belo Horizonte Medium (BHM) and on Campylobacter
selective medium (Becton Dickinson, Sparks, USA). Subsequently, the plates were incubated
microaerobically (Campypak, BBL, Becton Dickinson, Sparks, USA) at 35°C and were examined
three, five and seven days after incubation. Growth of H. pylori colonies was confirmed by typical
Gram stain, oxidase and urease activity. From all positive cultures, H. pylori colonies were
suspended in saline (3 McFarland) and plated on two seperate BHM agar plates. Each plate was
incubated with an E-test (AB-Biodisk, Solna, Sweden), one with clarithromycin and the other with
metronidazole. E-tests were read after two or three days microaerobical incubation (Campypak,
BBL, Becton Dickinson, Sparks, USA) at 35°C. Strains were considered resistant to metronidazole
if the minimal inhibitory concentration (MIC) was above 8 µl per ml. Resistance to clarithromycin
was considered to be present if the MIC of the strain was above 2 µl per ml.
The results of all H. pylori cultures and susceptibility tests performed from January 1st 1996 to
December 31st 2001 were collected. Subsequently, the prevalences of metronidazole and
clarithromycin resistance were calculated for each year and studied for any trends. To calculate the
expected efficacy of a 7-day PAM or PAC regimen, we used data from two meta-analyses [14,15].
Data on the total number of prescriptions for metronidazole and macrolides / lincosamides
(including clarithromycin) were collected from the Dutch “College voor Zorgverzekeringen”
covering about 65% of all Dutch inhabitants [21,22].
Secular trends in prevalence of both metronidazole and clarithromycin resistance were tested
for significance in Poisson regression models with resistance rates as dependent and time in years
as independent variable. A p value < 0.05 was considered significant.
Results
During the study period in total 16661 H. pylori cultures were performed. Seven (0.0008%)
cultures failed because of bacterial or fungal overgrowth and in six cases the results were lost,
leaving 16648 culture results for evaluation (99.9%). The presence of H. pylori was demonstrated
in 6231 (37.4%) cultures. The percentage of H. pylori cultures yielding a positive result remained
stable for each year over the study period (p=0.245). The results of susceptibility testing for
metronidazole and clarithromycin, and the data on total number of prescriptions for these drugs are
summarised in table 1.
The influence of changing prevalences of antibiotic resistance in Helicobacter pylori
97
Table 1.
The number of H. pylori positive cultures, and the prevalence of metronidazole and
clarithromycin resistance together with the number of prescriptions for these antibiotics in
the Netherlands.
Year 1996 1997 1998 1999 2000 2001
Total number of H. pylori cultures 2651 3072 3110 3248 2621 1959
Number of H. pylori positive cultures 1044 1094 1229 1287 915 662
Prevalence of metronidazole resistance (%) 28.4 27.1 19.3 14.1 11.3 13.5
Prevalence of carithromycin resistance (%) 2.2 1.7 1.2 3.3 2.8 2.1
• Total number of metronidazole
prescriptions (x1000)
10.48 9.88 9.21 8.61 8.58 8.7
• Total number of macrolide/lincosamide
prescriptions (x1000)
51 58 61 56 54 59
The prevalence of metronidazole resistance decreased from 28.4% in 1996 to 13.5% in 2001
and statistical analysis showed that this decreasing trend was significant over the study period
(p=0.011). The total number of prescriptions for metronidazole decreased significantly from
10.480 to 8700 during the study period (Pearson correlation coefficient = -0.914). The prevalence
of clarithromycin resistance fluctuated between 1.2% and 3.3% (mean 2.2%) without any
significant trend during the study period (p=0.49). The number of prescriptions for clarithromycin
remained about the same during the study period (Pearson correlation coefficient = 0.340).
Based on data from the meta-analysis by van der Wouden et al, the theoretical efficacy of the
PAM regimen in 100 consecutive H. pylori positive patients treated blindly with the PAM regimen
can be calculated (figure 1) [15]. The meta-analysis found that the efficacy of the PAM regimen
was 93% in patients harbouring a metronidazole susceptible strain and was lowered to 56% in case
a metronidazole resistant strain was present. When 100 consecutiveH. pylori positive patients have
to be treated in a region with a prevalence of metronidazole resistance of 13.5% (as in 2001), it can
be expected that 86.5 patients will carry a metronidazole susceptible strain. In these 86.5 patients,
the PAM regimen will have an efficacy of 93% resulting in 80.4 cured patients. In the
remaining13.5 patients, the PAM regimen will be less effective but will still result in 7.6 cured
Chapter 6
98
Figure 1.
The calculated efficacy of the protonpump inhibitor-amoxicillin-metronidazole (PAM)
regimen in 100 consecutive patients treated blindly for H. pylori at a prevalence of
metronidazole resistance of 13.5%.
100 H. pylori positive patients
Infected with metronidazole
susceptible strain
Infected with metronidazole resistant
strain
Efficacy of PAM in case of
metronidazole susceptible strain
Efficacy of PAM in case of
metronidazole resistant strain
Number of eventually cured patients
80.4 patients
Number of eventually cured patients
7.6 patients
Total cured patients (cure rate %)
88 patients (88%)
The influence of changing prevalences of antibiotic resistance in Helicobacter pylori
99
patients. Therefore, the overall efficacy of the PAM regimen will be 88.0%. Based on this model,
the influence of changes in the prevalence of metronidazole resistance on the overall cure rate of
the PAM regimen can be calculated and is shown in figure 2.
The same calculation can be applied to the PAC regimen using the data from the meta-analysis
by Houben et al. The calculated overall efficacy of the PAC regimen at a clarithromycin resistance
rate of 2.1% (as in 2001) is 80.3%. Figure 3 shows how changes in the prevalence of
clarithromycin resistance affect the overall efficacy of the PAC regimen.
Figure 2.
The influence of changes in the prevalence of metronidazole resistance on the overall efficacy
of the PAM regimen prescribed in patients with unknown Helicobacter pylori susceptibility
status. (The cross marks the current situation)
Eff
icac
y of
the
PAM
regi
men
→
Prevalence of metronidazole resistance →
50%
60%
70%
80%
90%
100%
0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
x
Chapter 6
100
Figure 3.
The influence of changes in the prevalence of clarithromycin resistance on the overall
efficacy of the PAC regimen prescribed in patients with unknown Helicobacter pylori
susceptibility status. (The cross marks the current situation)
Eff
icac
y of
the
PAC
regi
men
→
Discussion
This study showed that in the northeastern part of the Netherlands the prevalence of
metronidazole resistance in H. pylori decreased significantly from 1996 to 2001, while the
prevalence of clarithromycin resistance remained stable.
The observed decrease in the number of prescriptions for metronidzole may explain the
decrease in the prevalence of metronidazole resistance. It is to be noted that most prescriptions for
metronidazole are no part of an anti-H. pylori regimen, but are used for other conditions like
gynaecological infections and abdominal surgery [23,24]. In a previous publication by our group, a
rapid increase in the prevalence of metronidazole resistance was reported during the period 1993
to 1996 [25]. We have no consistent explanation for these discrepant findings, but it is striking that
during that period a slight increase in the number of metronidazole prescriptions was observed. It
is evident that the decreasing trend in metronidazole resistance will increase the efficacy of the
Prevalence of clarithromycin resistance →
75%
76%
77%
78%
79%
80%
81%
82%
83%
84%
85%
0% 1% 2% 3% 4% 5% 6% 7% 8% 9% 10%
x
The influence of changing prevalences of antibiotic resistance in Helicobacter pylori
101
PAM regimen in the future. Even at the time of the highest prevalence of metronidazole resistance
in 1996, however, the PAM regimen still had an efficacy of 82.5%, meeting the recommendations
of the European Society of Primary Care Gastroenterology.
The prevalence of clarithromycin resistance remained stable between 1996 to 2001 and is still
quite low as compared to other European countries [26-28]. Data from the “College voor
Zorgverzekeraars” also did not show any changes in the yearly number of prescriptions for
macrolides and lincosamides during the study period. It has to be kept in mind, however, that the
low prevalence of clarithromycin resistance in this part of the Netherlands may prohibit the
detection of trends (type II error). Despite the low prevalence of clarithromycin resistance, the
calculated efficacy of the PAC regimen was only 80.3% and thereby only just above the cut-off
value of 80% as recommended by the European Society of Primary Care Gastroenterology. As a
result of the great impact of clarithromycin resistance on the efficacy of clarithromycin containing
anti-H. pylori regimens, even a small increase in the prevalence of clarithromycin resistance (to >
3.0%) will result in a drop in expected efficacy of the PAC regimen to 79.9%. Remarkably, the
European Society of Primary Care Gastroenterology has recommended the PAC regimen as the
first choice for blind anti-H. pylori therapy [13]. Based on our calculations, however, it is clear
that the PAM regimen currently has a higher efficacy than the PAC regimen, despite the much
higher prevalence of metronidazole resistance as compared to clarithromycin resistance.
Several other studies have described changes in the prevalence of metronidazole and/or
clarithromycin resistance in H. pylori [27]. Most of these studies found that the prevalence of
metronidazole and clarithromycin resistance increased during the past decade [17-19,27,29-32].
Although it has often been suggested that this increase is caused by an increased use of antibiotics,
only two studies have actually correlated the use of these antibiotics to the prevalence of
antimicrobial resistance for these drugs. In one study an increase in the prevalence of H. pylori
resistance to macrolides was not associated with an increased use of these drugs [20]. Another
study concluded that the increase in both metronidazole and clarithromycin resistance in H. pylori
was associated with an increased use of these antibiotics [32]. To our knowledge, the data in our
study represent the most recent data on prevalences of metronidazole and clarithromycin resistance
in H. pylori (up to 2001). Whether the observed decrease in the prevalence of metronidazole
resistance is really related to the decreased use of metronidazole in our region, or is part of a
natural fluctuation remains to be seen.
Chapter 6
102
In conclusion, over the period 1996 to 2001, the prevalence of metronidazole resistance
decreased significantly in the northeastern part of the Netherlands, whereas the prevalence of
clarithromycin resistance remained stable. The decrease in the prevalence of metronidazole
resistance may be related to a decrease in the total number of metronidazole. Currently, it is still
possible to achieve a cure rate of at least 80% with both the PAM and PAC regimen when treating
H. pylori infections blindly in primary care. When the decreasing trend in metronidazole resistance
is consistent it will increase the efficacy of the PAM regimen in the future. On the other hand,
even a slight increase (<1%) in the prevalence of clarithromycin resistance will reduce the efficacy
of the PAC regimen to less than 80%. To ensure that blind treatment of H. pylori infections with a
protonpump inhibitor based triple regimen remains effective in the future, continuous monitoring
the prevalence of metronidazole and clarithromycin resistance is necessary.
References
1. EUROGAST study group. Epidemiology of, and risk factors for, Helicobacter pylori infection among
3194 asymptomatic subjects in 17 populations. Gut 1993; 34: 1672-1676.
2. Marshall BJ. Helicobacter pylori. American Journal of Gastroenterology 1994; 89: S116-S127.
3. EUROGAST study group. An international association between Helicobacter pylori infection and
gastric cancer. Lancet 1993; 341: 1359-1362.
4. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M et al.
Helicobacter pylori infection and the development of gastric cancer. New England Journal of Medicine
2001; 345: 784-789.
5. Blaser MJ. Not all Helicobacter pylori strains are created equal: should all be eliminated ? Lancet 1997;
349: 1020-1022.
6. Lassen AT, Pedersen FM, Bytzer P, Schaffalitzky de Muckadell OB. Helicobacter pylori test-and-
eradicate versus prompt endoscopy for management of dyspeptic patients: a randomised trial. Lancet
2000; 356: 455-460.
7. Kuipers EJ, Thijs JC, Festen HPM. Helicobacter pylori and peptic ulcer disease. Alimentary
Pharmacology & Therapeutics 1995; 9 (suppl 2): 59-69.
8. Price AB. Histological aspects of Campylobacter pylori colonisation and infection of gastric and
duodenal mucosa. Scandinavian Journal of Gastroenterology 1988; 142: 21-24.
9. Lam SK, Talley NJ. Report of the 1997 Asia pacific consensus conference on the management of
Helicobacter pylori infection. Journal of Gastroenterology and Hepatology 1997; 13: 1-12.
The influence of changing prevalences of antibiotic resistance in Helicobacter pylori
103
10. Talley NJ, Axon A, Bytzer P, Holtmann G, Lam SK, Zanten SV. Management of uninvestigated and
functional dyspepsia: a working party report for the World Congress of Gastroenterology 1998.
Alimentary Pharmacology & Therapeutics 1999; 1135-1148.
11. Delaney BC, Innes MA, Deeks J, Wilson S, Cooner MK, Moayyedi P et al. Initial management
strategies for dyspepsia. Cochrane Database Syst Rev 2001; 3: CD001961.
12. Malfertheiner P, Megraud F , O'Morain C, Hungin APS, Jones R, Axon A et al. Current concepts in
the management of Helicobacter pylori infection. The Maastricht 2-2000 consensus report. Alimentary
Pharmacology & Therapeutics 2002; 16: 167-180.
13. European Society of Primary Care Gastroenterology. The management of Helicobacter pylori
infection. Consensus meeting, 9-10 may, Zurich 1998.
14. Houben MH, Van Der BD, Hensen EF, Craen AJ, Rauws EA, Tytgat GN . A systematic review of
Helicobacter pylori eradication therapy. The impact of antimicrobial resistance on eradication rates.
Alimentary Pharmacology & Therapeutics 1999; 13: 1047-1055.
15. van der Wouden EJ, Thijs JC, van Zwet AA, Sluiter WJ, Kleibeuker JH. The influence of in vitro
nitroimidazole resistance on the efficacy of nitromidazole containing anti-Helicobacter pylori regimens:
a meta-analysis. American Journal of Gastroenterology 1999; 94: 1751-1759.
16. van Zwet A, Vandenbroucke-Grauls CMJE, Thijs J, van der Wouden EJ, Gerrits MM, Kusters
JG. Stable amoxicillin resistance in Helicobacter pylori. Lancet 1998; 352: 1595.
17. Lang TKW, Cheng AFB, Sung JJY, Yui PYL, Chung SSC. An increase in Helicobacter pylori
strains resistant to metronidazole: A five-year study. Helicobacter 1996; 1: 57-61.
18. de Koster E, Devaster JM, Van den Borre C, Delaunoit T, Langlet P, Deltrene M. A nine year
surveillance of Hp resistance to macrolides and imidazoles. Gastroenterology 1999; 116: A145.
19. Lopez-Brea M, Martinez MJ, Domingo D, Alarcon T. A 9 year study of clarithromycin and
metronidazole resistance in Helicobacter pylori from Spanish children. Journal of Antimicrobial
Chemotherapy 2001; 48: 295-297.
20. Bontems P, Devaster JM, Corvaglia L, Dezsofi A, Van den BC, Goutier S et al. Twelve year
observation of primary and secondary antibiotic-resistant Helicobacter pylori strains in children.
Pediatric Infectious Diseases Journal 2001; 20: 1033-1038.
21. College voor Zorgverzekeringen . Genees- en hulpmiddelen Informatie Project (GIP). GIP-peilingen
1996 t/m 2001 2002; 10, 12, 14, 16, 18, 20.
22. College voorZorgverzekeringen . Genees- en hulpmiddelen Informatie Project (GIP). GIP-peilingen,
metronidazol voorschriften 1996 t/m 2002 2002.
23. Rautelin H, Seppala K, Renkonen OV, Vainio U, Kosunen TU. Role of metronidazole resistance in
therapy of Helicobacter pylori infections. Antimicrobial Agents and Chemotherapy 1992; 36: 163-166.
Chapter 6
104
24. Glupczynski Y. Results of a multicentre European survey in 1991 of metronidazole resistance in
Helicobacter pylori. European Journal of Clinical Microbiology & Infectious Diseases 1992; 11: 777-
781.
25. van der Wouden EJ, van Zwet AA, Vosmaer GD, Oom JA, de Jong A, Kleibeuker JH. Rapid
increase in the prevalence of metronidazole-resistant Helicobacter pylori in the Netherlands. Emerging
Infectious Diseases 1997; 3: 385-9.
26. Megraud F. Resistance of Helicobacter pylori to antibiotics. Alimentary Pharmacology & Therapeutics
1997; 11: 43-53.
27. Lopez-Brea M, Domingo D, Sanchez I, Alarcon T. Evolution of resistance to metronidazole and
clarithromycin in Helicobacter pylori clinical isolates from Spain. Journal of Antimicrobial
Chemotherapy 1997; 40: 279-81.
28. Glupczvnski Y, Megraud F, Andersen LP, Lopez-Brea M. Antibiotic susceptibility of H.pylori in
Europe in 1998: results of the third multicentre study. Gut 1999 ; 45 (suppl 3): A3.
29. Glupczynski Y, Goutier S, van de Borre C, Butzler JP, Burette A. Surveillance of Helicobacter
pylori resistance to antimicrobial agents in Belgium from 1984 to 1994. Gut 1995; 37 (suppl 1): A97.
30. Weissfeld AS, Simmons DE, Vance PH, Trevino E, Kidd S, Greski-Rose P. In vitro susceptibility of
pre-treatment isolates of Helicobacter pylori from two multicenter United States clinical trials.
Gastroenterology 1996; 110: A295.
31. Perez AL, Kato M, Nakagawa S, Kawarasaki M, Nagasako T, Mizushima T et al. The relationship
between consumption of antimicrobial agents and the prevalence of primary Helicobacter pylori
resistance. Helicobacter 2002; 7: 306-309.
32. Cabrita J, Oleastro M, Matos R, Manhente A, Cabral J, Barros R et al. Features and trends in
Helicobacter pylori antibiotic resistance in Lisbon area, Portugal (1990-1999). Journal of Antimicrobial
Chemotherapy 2000; 46: 1029-1031.
105
Chapter 7
The importance of vacA , cagA, and iceA genotypes of Helicobacter
pylori infection in peptic ulcer disease and gastroesophageal reflux
disease.
Nicolaas L. A. Arents 1, Anton A. van Zwet 1, Jacob C. Thijs 2, Anne M.D. Kooistra-
Smid 1, Kornelis R. van Slochteren 1, John E. Degener 3, Jan H. Kleibeuker 1, and Leen-
Jan van Doorn 5.
1 Regional Public Health Laboratory, Groningen / Drenthe2 Department of Internal Medicine, Bethesda Hospital, Hoogeveen3 Department of Medical Microbiology, University Hospital, Groningen4 Department of Gastroenterology, University Hospital, Groningen5 Delft Diagnostic Laboratory, Delft
Published in American Journal of Gastroenterology 2001; 96: 2603-2608.
Chapter 7
106
Abstract
Objective
To study the relationship between the presence of H. pylori virulence factors and clinical outcome
in H. pylori infected patients.
Methods
DNA was isolated from an antral biopsy sample and vacA, cagA, and iceA genotype were
determined by PCR and a reverse hybridization technique in 183 patients with culture-proven H.
pylori infection: 51 with peptic ulcer disease (PUD), 62 with gastroesophageal reflux disease
(GERD), and 70 with a normal endoscopy (gastritis only; GO).
Results
Forty-four samples (24 %) showed more than one allelic variant in the vacA s- or m-region and/or
both iceA1 and iceA2 genotypes, indicating multiple strain infection. These were excluded from
statistical analysis. vacA s1 and cagA were significantly more common in PUD than in GERD and
GO. Logistic regression analysis showed that GERD patients were more often infected with strains
lacking both cagA and iceA than GO patients (OR = 0.36; CI = 0.15 - 0.89). Trend analysis
showed that GERD patients were most often infected with less virulent strains (p < 0.002).
Conclusions
Multiple strain infection is common. H. pylori strains possessing the vacA s1 genotype and/or
cagA are associated with PUD. GERD patients, infected with H. pylori mostly carry less virulent
strains possessing neither cagA nor iceA1. Our findings support the hypothesis that virulent strains
protect against the development of GERD.
The importance of the vacA, cagA, and iceA genotype
107
Introduction
Helicobacter pylori (H. pylori) infection is highly prevalent, especially in the developing world
where the large majority of the population is infected. In the western world the infection rate is
gradually decreasing but prevalences still range from 25 to 50% [1]. The majority of the infected
population, however, never develops clinically significant disease [2]. Only about 10 % of the
infected subjects will eventually develop peptic ulcer disease (PUD) and 1-2 % a gastric
malignancy [3,4].
The reason for the variable outcome of the infection is still unclear, but it is likely that three
elements are involved. First, host factors like the HLA system and receptors to Lewis antigens
have been suggested to influence clinical outcome [5]. Second, environmental factors, such as
smoking and food, may be important [6-8]. Third, as with other gastrointestinal pathogens [9,10],
the clinical outcome probably depends on differences in the virulence of the infecting strain. In
this study, the importance of several putative virulence factors in the development of H. pylori
related disease, was evaluated.
Several H. pylori genes associated with pathogenicity have been identified [11]. The vacA
gene, encoding a vacuolating cytotoxin (VacA) is present in all strains, but only about 50 % of
these strains produce a detectable active toxin [12]. This depends on the type of sequences within
the signal and middle region (s- and m-region) of the vacA gene [13]. The s-region contains one of
the following allelic subtypes: s1a, s1b, s1c or s2. The m-region contains either the m1 or the m2
allele. Previous studies have shown that vacA s1/m1 strains produce large amounts of vacuolating
cytotoxin and that these strains are associated with PUD [13-17]. On the other hand, the s2/m2
strains produce no or only small amounts of cytotoxin and are uncommon in patients with PUD
[13]. The s1/m2 strains seem to take an intermediate position.
The cytotoxin associated gene (cagA) is responsible for the production of the CagA protein, the
function of which is not yet understood. However, cagA is considered as a marker for the presence
of a genomic pathogenicity island [18]. This island contains other genes enhancing the virulence of
the infecting strain, such as picB, known to promote the induction of cytokines by the host [19,20].
Several studies have shown that cagA positive H. pylori strains cause more extensive epithelial
damage [21,22]. Other studies have indicated an association between the presence of cagA and
PUD [17,23-27].
Chapter 7
108
Recently, another virulence-associated gene was described [28]. This designated iceA gene
("induced by contact with epithelium") has two allelic variants (iceA1 and iceA2). The iceA1
variant is upregulated upon contact of the bacterium with epithelial cells and seems to be
associated with PUD [17,28].
In this study the relationship between these three virulence-associated factors and clinical
outcome was investigated. As recent studies have suggested that infection with a virulent (cagA-
positive) H. pylori strain may in fact protect against the development of gastroesophageal reflux
disease (GERD), we also included biopsy samples obtained from patients with GERD [29-31].
Furthermore, as infection with more than one strain is rather common [32-35], and false
conclusions can be drawn if only a few colonies of a culture are examined [36,37], we used whole
biopsy specimens, to be sure that all H. pylori DNA was included.
Materials and methods
In all patients undergoing upper gastrointestinal endoscopy for dyspepsia in a Dutch regional
hospital, antral biopsy specimens were taken for H. pylori culture as described previously [38]. All
culture-positive biopsy samples were frozen and stored at -70o C. From this collection, consecutive
antral biopsy specimens were selected to form three predefined groups: samples from patients with
peptic ulcer disease (PUD), samples from patients with gastroesophageal reflux disease (GERD),
and samples from patients with gastritis only or just an hiatal hernia (gastritis only; GO). The PUD
group included patients with an active ulcer (mucosal break > 5 mm with clearly visible ulcer
crater) or evident deformation of the duodenal bulb at endoscopy as well as patients with a history
of endoscopically or radiologically documented ulcer disease. Patients with endoscopic signs of
GERD (visible erosions or Barrett's metaplasia) and patients using non-steroidal anti-inflammatory
drugs (NSAIDs) were excluded from the PUD group. The GERD group included patients with
visible erosions at endoscopy (Savary-Miller grade 1 or higher) or Barrett's metaplasia. Patients
with a PUD history or endoscopic signs of PUD were excluded from this group. Patients with
previous H.pylori eradication treatment, the use of H2-receptor antagonists in the two weeks
before endoscopy, or the use of proton pump inhibitors in the four weeks preceding endoscopy
were discarded in all groups. None of these patients participated in any previous study regarding
virulence factors.
The importance of the vacA, cagA, and iceA genotype
109
Extraction and isolation of DNA was performed on each entire biopsy specimen according to
Boom et al. [39] or by the phenol-chloroform extraction method [40]. For the detection of cagA
and the determination of the vacA and iceA genotype, isolated DNA was amplified by PCR in a
Thermocycler (MJ Research, PTC 200) as described [35]. The PCR conditions were: 9 min pre-
incubation at 94ºC, followed by 40 cycles of 30 sec at 94ºC (denaturation), 45 at 50ºC (annealing)
and 45 at 72ºC (extension). A final extension was performed for 5 min at 72ºC [17].
To detect the presence of cagA and to determine the vacA s- and m-genotypes, a single step
reverse hybridization technique ( prototype line probe assay, LiPA, Innogenetics NV, Gent,
Belgium) was used. This assay comprises a nitrocellulose strip containing multiple specific
oligonucleotide probes for the vacA s-region (s1a, s1b, s1c and s2), the vacA m-region (m1 and
m2) and the cagA gene [35], enabling the simultaneous detection of all these alleles. For each of
the genotypes, two specific probes were present on the strip, permitting accurate genotyping. The
iceA genotype was determined by type-specific PCR and standard agarose gel electrophoresis. The
iceA primers generated a 210 bp amplificate for the iceA1 genotype and a 124, 229, 334 or 439 bp
amplificate for the iceA2 genotype.
If more than one allele of either the s-region or the m-region of vacA was detected or if biopsy
specimens showed both the iceA1 and iceA2 genotype, it was concluded that the biopsy specimen
harbored at least two different strains. These specimens were excluded when studying the
relationship between virulence factors and clinical outcome. To compare differences between two
groups, statistical analysis was performed using the Chi-square test with Yates' correction. Trends
were analyzed by the Mann-Whitney U-test. Furthermore, logistic regression analysis was
performed to evaluate which virulence factors contributed significantly in predicting the
underlying disease (Sysstat 7.0). Results are presented as odds ratios (OR) with 95% confidence
intervals (CI). For the Mann-Whitney U-test, a p value < 0.05 was considered significant.
Chapter 7
110
Results
One hundred and eighty three biopsy specimens, all obtained from different patients were
studied. The PUD group included 51 specimens, the GERD group of 62 specimens, and the GO
group of 70 specimens. The age of the patients was similar in all groups. PUD patients were more
frequently male than GO patients (OR = 2.38; CI = 1.07 - 5.35). Severity of the esophagitis in the
GERD group, according to the Savary-Miller classification, was grade 1 in 50, grade 2 in six,
grade 3 in two and grade 4 in three patients. Barrett's dysplasia was encountered in 7 patients, 1 of
whom had no active esophagitis (grade 0).
Based on the vacA and iceA genotypes, 138 specimens (75%) were colonized by a single H.
pylori strain. This group includes five biopsy specimens that did not show any iceA genotype. One
biopsy specimen did not yield a result for the m-region and could therefore not be classified. The
remaining 44 biopsy specimens (24%) harbored more than one strain. In 26 (14%) of these cases,
multiple vacA genotypes were detected, but only a single iceA genotype was present. Conversely,
ten biopsy specimens (5%) showed both iceA genotypes, but only a single genotype for the vacA
region. Eight samples (6%) revealed multiple alleles for both vacA and iceA. The prevalence of
multiple strain infection was not significantly different between the three groups (PUD: 22%; GO:
29%; GERD: 21%, n.s.).
Table 1 shows all encountered vacA genotype combinations per group after exclusion of biopsy
specimens containing multiple strains. In accordance with the findings of others [13], we did not
detect the s2/m1 genotype. The vacA s1 genotype (vacA s1a, s1b or s1c) was present in 58% of all
biopsy specimens and was significantly more common in PUD than in GO and GERD (PUD:
88%; GO: 51%; GERD: 41%; OR = 6.72; CI = 2.08 - 25.14 and OR = 10.15; CI = 3.12 - 37.95
respectively). The vacA s1 genotype seemed less prevalent in GERD than in GO, but this
difference was not significant (OR = 0.66; CI = 0.28 - 1.58). The vacA m1 genotype was present in
34 (25%) of the 138 biopsy specimens. The prevalence of the vacA m1 genotype did not differ
between the three groups (PUD: 33%; GO: 29%; GERD: 14%; n.s.).
The cagA gene was present in 64 (46%) of the 138 biopsy specimens and was most common in
PUD (70%) and less common in GO (43%) and GERD (31%). The prevalence of cagA was higher
in PUD than in GO and GERD, (OR = 3.11; CI = 1.19 - 8.31 and OR = 5.29; CI 1.95 - 14.56
respectively). The cagA genotype seemed less prevalent in GERD than in GO, but statistical
analysis did not show a difference (OR = 0.59; CI = 0.24 - 1.46).
The importance of the vacA, cagA, and iceA genotype
111
Table 1.
Prevalence of different vacA genotypes in the three groups for single strain harboring biopsy
specimens (n=138).
vacA
genotype
s1a-
m1
s1a-
m2
s1b-
m1
s1b-
m2
s1c-
m1
s1c-
m2
s2-
m2
total
PUD 11 20 1 1 1 1 5 40
GO 13 9 1 2 0 0 24 49
GERD 7 13 0 0 0 0 29 49
total 31 42 2 3 1 1 58 138
PUD = peptic ulcer disesae, GO = gastritis only, GERD = gastroesophageal reflux disease
Table 2 shows the distribution of the iceA genotypes in single strain harboring biopsy
specimens. Five samples (4%) did not show either iceA1 or iceA2, and were omitted when the
relationship between the iceA genotype and clinical outcome was studied. The iceA1 genotype was
present in 58 (44%) of the remaining 133 biopsy specimens (PUD: 60 %; GO: 47 %; GERD: 29
%) and was significantly more prevalent in PUD than in GERD (OR = 3.75; CI = 1.37 - 10.40).
The differences between PUD and GO and between GO and GERD, however, were not significant
(OR = 1.70; CI = 0.65 - 4.49 and OR = 0.45; CI = 0.18 - 1.13 respectively). The prevalences of the
various virulence factors in the three groups are shown in Figure 1.
Table 2.
iceA genotypes present in the three groups for single strain harboring biopsy specimens
(n=138).
iceA genotype A1 A2 none total
PUD 21 14 5 40
GO 23 26 0 49
GERD 14 35 0 49
total 58 75 5 138
PUD = peptic ulcer disesae, GO = gastritis only, GERD = gastroesophageal reflux disease
Chapter 7
112
Figure 1.
Prevalence of vacA s1, cagA and iceA1 genotype in peptic ulcer disease (PUD; n = 40),
gastritis only (GO; n = 49) and gastroesophageal reflux disease (GERD; n = 49). Only biopsy
specimens harboring one strain are included.
Figure 2.
Prevalence of different combinations of cagA and iceA1 in 49 H. pylori positive patients with
GERD. The trend is significant (p < 0.002).
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
PUD GO GERD
vaca s1 cagA+ iceA1
0%
10%
20%
30%
40%
50%
60%
cagA+ / iceA 1 cagA+ or iceA 1 cagA- / iceA 2
The importance of the vacA, cagA, and iceA genotype
113
To investigate what virulence factor was most predictive for underlying disease, logistic
regression analysis was performed. It showed that vacA s1 was the only factor predictive for PUD
(OR = 3.0; CI 1.73 - 5.28), no factor was predictive for GO, and both cagA and iceA1 were
negatively associated with GERD (OR = 0.44; CI = 0.21 - 0.91 and OR = 0.42; CI = 0.19 - 0.90
respectively). When all virulence factors were considered separately, no differences were found
between GO and GERD. When, however, both cagA and iceA1 were taken into account, GERD
patients proved to be significantly more often infected with strains showing none of these factors
(OR = 0.36; CI = 0.15 - 0.89); vacA genotype was left out from this analysis as logistic regression
did not show a predictive value for this factor in GO and GERD).
To test the hypothesis that patients with GERD are usually infected with less virulent strains,
we examined how often these patients were infected with strains possessing both cagA and iceA1,
either cagA or iceA1, or neither of these factors (figure 2). The Mann-Whitney U-test showed a
significant trend: GERD patients were most often infected with strains possessing none of these
factors and strains showing both factors were least common (p < 0.002).
Discussion
The present study investigated the relationships between various virulence factors (vacA, cagA
and iceA) of H. pylori and the clinical outcome of the infection, using the line probe assay (LiPA)
that enables the detection of multiple PCR-amplified products at the same time.
As the vacA gene contains only one allele for the s-region and one for the m-region in each H.
pylori strain [13], the presence of more than one line for either region on the LiPA strip suggests
that the specimen harbors more than one strain. Moreover, since each H. pylori strain only
possesses a single iceA locus the detection of both iceA1 and iceA2 in a single biopsy specimen
also indicates the presence of multiple strains.
Our study revealed a high prevalence of multiple strain infection (24 %). In a previous study,
using the same method, multiple strain infection was found in 29 % of a Portuguese and in 8 % of
a Dutch population [35]. However, other studies using various methods for the detection of
multiple strain infection, found this phenomenon in only 7 - 13 % [32,33,41] of samples. These
discrepancies are likely to be due to sampling error, but geographic differences can also be
responsible. While in some studies, like ours, the entire biopsy specimen was used, in others only a
few H. pylori colonies were examined [32,33,41]. It is possible, however, that even in our study
Chapter 7
114
the prevalence is an underestimation, since the detection of multiple strains was solely based on
the presence of multiple vacA and iceA genotypes. Moreover, we only examined one biopsy
sample. Although it is still debated whether or not the bacterial population in one biopsy sample is
representative for the entire stomach population, some suggest that strain-specific colonisation of
different regions within the stomach occurs [33,36,37,42-45]. Considering the frequent occurrence
of multiple strain infection it can be easily imagined that false conclusions will be drawn on the
associations between virulence factors and clinical outcome if only a small number of bacterial
colonies, not representative for the entire stomach population, are examined [36,37]. As mentioned
above, we therefore used the whole biopsy specimen for DNA isolation and excluded samples
shown to harbor more than one H. pylori strain.
Our study suggests that both vacA s1 and cagA are associated with PUD, as these factors were
significantly more common in the PUD group than in both other groups. In that respect our data
are in agreement with the findings of several other investigators and suggest a possible role of
these factors in the pathogenesis of H pylori related peptic ulcer disease [17,23-27]. In predicting
underlying disease, a logistic regression analysis, however, only pointed at vacA s1 as a predictive
factor. This suggests that the presence of cagA is not independently associated with PUD, but
associated with vacA s1. Our results do not point at vacA m1 as a significant virulence factor.
iceA1 seemed to be more common in PUD than in both other groups, only the difference with
GERD was statistically significant.
Recently, it has been suggested that H. pylori infection may be protective against GERD
[30,31,46,47] and that H. pylori positive GERD patients (especially those with the more serious
manifestations of the disease) are infected with less virulent strains [29]. Our data seem to support
this view. All putative virulence factors seemed to be more common in GO than in GERD
although the differences never reached statistical significance. As the groups were relatively small,
however, a type II error can not be excluded. Moreover, when we took the two factors, shown by
logistic regression to be markers for the absence of GERD, both into account (cagA and iceA1),
GERD patients proved to be significantly more often infected with strains showing neither of these
factors than patient with GO. Finally, the Mann-Whitney U-test showed that there was a
significant trend: our H.pylori positive GERD patients were most often infected with strains
showing neither of these two factors and least often with strains possessing both factors.
The importance of the vacA, cagA, and iceA genotype
115
In conclusion, our study performed in a rural region of The Netherlands, shows that multiple
strain infection is rather common (24%). PUD is associated with the presence of H. pylori strains
of the vacA s1 genotype that in most cases are also cagA-positive. On the other hand, GERD
patients, infected with H. pylori mostly carry less virulent strains possessing neither cagA nor
iceA1. Our findings support the hypothesis that virulent strains protect against the development of
GERD.
References1. Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clin Microbiol Rev 1997; 10: 720-41.
2. Blaser MJ. Not all Helicobacter pylori strains are created equal: should all be eliminated ? Lancet 1997;
349: 1020-1022.
3. Kuipers EJ, Thijs JC, Festen HPM. Helicobacter pylori and peptic ulcer disease. Alimentary
Pharmacology & Therapeutics 1995; 9 (suppl 2): 59-69.
4. Cats A, Meuwissen SGM, Forman D, Craanen ME, Kuipers EJ . Helicobacter pylori: a true
carcinogen? European Journal of Gatroenterology & Hepatology 1998; 10: 447-450.
5. Go MF. What are the host factors that place an individual at risk for Helicobacter pylori-associated
disease? Gastroenterology 1997; 113: S15-S20.
6. Kurata JH, Nogawa AN. Meta-analysis of risk factors for peptic ulcer. Nonsteroidal anti-inflammatory
drugs, Helicobacter pylori and smoking. Journal of Clinical Gastroenterology 1997; 24: 2-17.
7. Martin DF, Montgomery E, Dobek AS, Patrissi GA, Peura DA. Campylobacter pylori, NSAIDS, and
smoking: risk factors for peptic ulcer disease. American Journal of Gastroenterology 1989; 84: 1268-
1272.
8. McCarthy DM. Smoking and ulcers - time to quit. New England Journal of Medicine 1984; 311: 726-
728.
9. Brubaker RR. Mechanisms of bacterial virulence. Annu Rev Microbiol 1985; 39: 21-50.
10. Sparling PF. Bacterial virulence and pathogenesis: an overview. Rev Infect Dis 1983; 5: S637-S646.
11. Blaser MJ. Heterogeneity of Helicobacter pylori. European Journal of Gatroenterology & Hepatology
1997; 9 (suppl 1): S3-S7.
12. Cover TL. The vacuolating cytotoxin of Helicobacter pylori. Mol Microbiol 1996; 20: 241-246.
13. Atherton JC, Cao P, Peek RM, Jr., Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating
cytotoxin alleles of Helicobacter pylori.Association of specific vacA types with cytotoxin production
and peptic ulceration. Journal of Biological Chemistry 1995; 270: 17771-17777.
14. Atherton JC. The clinical relevance of strain types of Helicobacter pylori. Gut 1997; 40: 701-703.
Chapter 7
116
15. Rudi J, Kolb C, Maiwald M, Kuck D, Sieg A, Galle PR et al. Diversity of Helicobacter pylori vacA
and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and
associated diseases. Journal of Clinical Microbiology 1998; 36: 944-948.
16. Stephens JC, Stewart JAD, Folwell AM, Rathbone BJ. Helicobacter pylori cagA status, vacA
genotypes and ulcer disease. European Journal of Gatroenterology & Hepatology 1998; 10: 381-384.
17. van Doorn LJ, Figueiredo C , Sanna R, Plaisier A, Schneeberger P, de Boer W et al. Clinical
relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 1998; 115: 58-
66.
18. Covacci A, Falkow S, Censini S, Lange C, Segal E, Salama N et al. The cag pathogenicity island of
Helicobacter pylori: origin, molecular biology and relevance to virulence. In: Moran AP , O'Morain CA,
editors. Pathogenesis and host response in Helicobacter pylori infections. Galway, Ireland: Normed
Verlag, 1997: 88-100.
19. Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M et al. cag, a pathogenicity
island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors.
Proceedings of the National Academy of Sciences of the United States of America 1996; 93: 14648-
14653.
20. Megraud F. Pathogenic diversity of Helicobacter pylori. Journal of Gastroenterology 1997; 32: 278-
281.
21. Peek RM, Jr., Blaser MJ, Mays DJ, Forsyth MH, Cover TL, Song SY et al. Helicobacter pylori
strain-specific genotypes and modulation of the gastric epithelial cell cycle. Cancer Res 1999; 59: 6124-
6131.
22. Odenbreit S, Puls J, Sedlmaier B, Gerland E, Fischer W, Haas R. Translocation of Helicobacter
pylori CagA into gastric epithelial cells by type IV secretion. Science 2000; 287: 1497-1500.
23. Atherton JC, Peek RM, Jr., Tham KT, Cover TL, Blaser MJ. Clinical and pathological importance
of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology 1997;
112: 92-99.
24. Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D, Macchia G et al. Molecular
characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with
cytotoxicity and duodenal ulcer. Proceedings of the National Academy of Sciences of the United States
of America 1993; 90: 5791-5795.
25. Crabtree JE, Taylor JD, Wyatt JI, Heatlley RV, Shallcross TM, Tompkins DS et al. Mucosal IgA
recognition of Helicobacter pylori 120 kDa protein, peptic ulceration, and gastric pathology. Lancet
1991; 338: 332-335.
26. Warburton VJ, Everett S, Mapstone NP, Axon AT, Hawkey P, Dixon MF. Clinical and histological
associations of cagA and vacA genotypes in Helicobacter pylori gastritis. J Clin Pathol 1998; 51: 55-61.
The importance of the vacA, cagA, and iceA genotype
117
27. Weel JF, van der Hulst RW, Gerrits Y, Roorda P, Feller M, Dankert J et al. The interrelationship
between cytotoxin-associated gene A, vacuolating cytotoxin, and Helicobacter pylori-related diseases.
Journal of Infectious Diseases 1996; 173: 1171-1175.
28. Peek RM, Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ et al. Adherence to
gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with
clinical outcome. Proc Assoc Am Physicians 1998; 110: 531-544.
29. Vicari JJ, Peek RM, Falk GW, Goldblum JR, Easley KA, Schnell J et al. The seroprevalence of
cagA-positive Helicobacter pylori strains in the spectrum of gastroesophageal reflux disease.
Gastroenterology 1998; 115: 50-57.
30. Chow WH, Blaser MJ, Blot WJ, Gammon MD, Vaughan TL, Risch HA et al. An inverse relation
between cagA+ strains of Helicobacter pylori infection and risk of esophageal and gastric cardia
adenocarcinoma. Cancer Res 1998; 58: 588-590.
31. Loffeld RJ, Werdmuller BF, Kuster JG, Perez-Perez GI, Blaser MJ, Kuipers EJ . Colonization with
cagA-positive Helicobacter pylori strains inversely associated with reflux esophagitis and Barrett's
esophagus. Digestion 2000; 62: 95-99.
32. Hirschl AM, Richter M, Makristathis A, Pruckl PM, Willinger B, Schutze K et al. Single and
multiple strain colonization in patients with Helicobacter pylori-associated gastritis: detection by
macrorestriction DNA analysis. Journal of Infectious Diseases 1994; 170: 473-475.
33. Prewett EJ, Bickley J, Owen RJ, Pounder RE. DNA patterns of Helicobacter pylori isolated from
gastric antrum, body and duodenum. Gastroenterology 1992; 102: 829-833.
34. Taylor NS, Fox JG, Akopyants NS, Berg DE, Thompson N, Shames B et al. Long-term colonization
with single and multiple strains of Helicobacter pylori assessed by DNA fingerprinting. Journal of
Clinical Microbiology 1995; 33: 918-923.
35. van Doorn LJ, Figueiredo C , Rossau R, Jannes G, van Asbroeck M, Sousa JC et al. Typing of
Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization. Journal of
Clinical Microbiology 1998; 36: 1271-1276.
36. Jorgensen M, Daskalopoulos G, Warburton V, Mitchell HM, Hazell SL. Multiple strain
colonization and metronidazole resistance in Helicobacter pylori-infected patients: identification from
sequential and multiple biopsy specimens. Journal of Infectious Diseases 1996; 174: 631-635.
37. van der Ende A, Rauws EA, Feller M, Mulder CJ, Tytgat GN, Dankert J. Heterogeneous
Helicobacter pylori isolates from members of a family with a history of peptic ulcer disease.
Gastroenterology 1996 ; 111: 638-647.
38. van Zwet AA, Thijs JC, Roosendaal R, Kuipers EJ, Pena S, de Graaff J. Practical diagnosis of
Helicobacter pylori infection. European Journal of Gatroenterology & Hepatology 1996; 8: 501-7.
Chapter 7
118
39. Boom R, Sol CJA, Heijtink R, Wertheim-van Dillen PME, van der Noordaa J. Rapid purification of
hepatitis B virus DNA from serum. Journal of Clinical Microbiology 1991; 29: 1804-1811.
40. van Zwet AA, Thijs JC, Kooistra-Smid AMD, Schirm J, Snijder JAM. Sensitivity of culture
compared with that of polymerase chain reaction for detection of Helicobacter pylori from antral biopsy
samples. Journal of Clinical Microbiology 1993; 31: 1918-1920.
41. Fujimoto S, Marshall B, Blaser MJ. PCR-based restriction fragment length polymorphism typing of
Helicobacter pylori. Journal of Clinical Microbiology 1994; 32: 331-334.
42. Akopyants NS, Eaton KA, Berg DE. Adaptive mutation and cocolonization during Helicobacter pylori
infection of gnotobiotic piglets. Infection & Immunity 1995; 63: 116-21.
43. Marshall DG, Chua A, Keeling PW, Sullivan DJ, Coleman DC, Smyth CJ. Molecular analysis of
Helicobacter pylori populations in antral biopsies from individual patients using randomly amplified
polymorphic DNA (RAPD) fingerprinting. FEMS Immunol Med Microbiol 1995; 10: 317-23.
44. Owen RJ, Bickley J, Costas M, Morgan DR. Genomic variation in Helicobacter pylori: application to
identification of strains. Scandinavian Journal of Gastroenterology 1991; 181: 43-50.
45. Owen RJ, Desai M, Figura N, Bayeli PF, Di Gregorio L, Russi M et al. Comparison between degree
of histological gastritis and DNA fingerprints, cytotoxicity and adhesivity of Helicobacter pylori from
different gastric sites. Eur J Epidemiol 1993; 9: 315-321.
46. Blaser MJ. Hypotheses on the pathogenesis and natural history of Helicobacter pylori-induced
inflammation. Gastroenterology 1992; 102: 720-727.
47. Labenz J, Blum AL, Bayerdorffer E, Meining A, Stolte M, Borsch G. Curing Helicobacter pylori
infection in patients with duodenal ulcer may provoke reflux esophagitis. Gastroenterology 1997; 112:
1442-1447.
119
Chapter 8
The value of PCR and serology based methods in determining the
presence of the cagA gene in Helicobacter pylori infection.
Nicolaas L. A. Arents 1, Anton A. van Zwet 1, Jacob C. Thijs 2, Raymond G. Pot 3,
Jan H. Kleibeuker 4, John E. Degener 5, and Johannes G. Kusters 3.
1 Regional Public Health Laboratory, Groningen / Drenthe2 Department of Internal Medicine, Bethesda Hospital, Hoogeveen3 Department of Gastroenterology, Erasmus MC University Medical Center, Rotterdam4 Department of Gastroenterology, University Hospital, Groningen5 Department of Medical Microbiology, University Hospital, Groningen
Submitted for publication.
Chapter 8
120
Abstract
Background
To compare PCR, OroVax CagA protein recombinant based ELISA, and a recently introduced
rapid serological test for anti-CagA antibodies (CagA rapid test, Orion Diagnostica) for the
detection of the cagA gene of Helicobacter pylori.
Materials and Methods
PCR followed by hybridisation was compared to the frequently used OroVax CagA recombinant
based ELISA in 91 culture proven H. pylori positive patients and 50 culture and histology proven
H. pylori negative controls. The CagA rapid test (Orion) was compared to a surrogate gold
standard based on the samples of patients showing concordant PCR and OroVax CagA
recombinant based ELISA results.
Results
PCR with hybridisation and OroVax CagA recombinant based ELISA showed concordant results
in 118 patients. In the remaining patients, PCR was positive in 22 patients and OroVax CagA
recombinant based ELISA was positive in 1 patient. When the CagA rapid test (Orion) was
compared to the surrogate gold standard, the test showed very accurate results : sensitivity =
96.8%, specificity = 95.4%, and accuracy = 95.8%.
Conclusions
Although a reliable gold standard for the detection of cagA is lacking, the CagA rapid test (Orion)
provides a very accurate and easy to perform tool when compared to PCR with hybridisation and
OroVax CagA recombinant based ELISA.
The value of PCR and serology based methods in determining the presence of cagA
121
Introduction
Infection of the gastric mucosa with Helicobacter pylori (H. pylori) is highly prevalent and
occurs worldwide. The clinical consequences of this infection, however, are remarkably variable
and while most infected subjects are asymptomatic others suffer from significant disease, such as
peptic ulcer disease (PUD) or gastric cancer [1]. H. pylori DNA profiles indicate a considerable
amount of genomic variation between unrelated strains [2,3] and as a consequence, most patients
harbour unique strains [4,5]. This genetic diversity is likely to play an important role in the wide
range of clinical outcomes as several distinct alleles of H. pylori genes were shown to be
associated with the more severe disease types of the upper alimentary tract [6]. These genes, or so-
called virulence factors, include vacA, iceA, and cagA. While the vacA and iceA genes are present
in all strains, the cagA gene (cytotoxin associated gene), is present only in about one out of two H.
pylori strains [7]. The cagA encoded CagA protein is highly immunogenic in humans and thought
to induce an antibody response in virtually all infected subjects [8]. CagA is probably not a
virulence factor itself, but represents a convenient marker for the presence of the Cag
pathogenicity island [9-11] that contains other genes enhancing the virulence of the infecting strain
[12]. Although it is not a virulence factor itself, CagA has been the subject of many studies. The
reliability of these studies, however, depends on the accuracy of the methods used to detect the
presence of CagA and the latter is complicated because a firm gold standard is lacking.
In this study, we evaluated the agreement between PCR and a frequently used anti-CagA
antibody ELISA based on the orv220 antigen from OroVax (OroVax, Inc, Cambridge, MS, USA)
[13]. Based on these results, a reliable gold standard could be constructed and this was then used to
evaluate the accuracy of a recently introduced anti-CagA antibody rapid test (Orion Diagnostica,
Espoo, Finland).
Methods
Patients
The study was performed in a regional hospital in the northern part of The Netherlands. In all
patients undergoing upper gastrointestinal endoscopy for dyspepsia in this hospital, antral biopsy
samples are routinely taken for H. pylori culture and histology (HE and Giemsa stain). H. pylori
positive specimens are frozen and stored at -70oC. For 91 of these specimens, we also had a frozen
Chapter 8
122
serum sample (obtained immediately before endoscopy), and this set was used in this study. The
control group consisted of serum and biopsy samples of 50 individuals, that were shown to be H.
pylori negative by both culture and histology.
PCR detection of the cagA gene
The entire biopsy specimens (only from the H. pylori positive patients) were used to extract
and isolate H. pylori DNA according to Boom et al. [14]. The isolated DNA was amplified in a
Thermocycler (MJ Research, PTC 200). A PCR procedure amplified the cagA gene, if present,
using the following primers: TTGACCAACAACCACAAACCGAAG (F (+)) and
CTTCCCTTAATTGCGAGATTCC (R (-)) [15]. PCR conditions were: 9 minutes pre-incubation
at 94ºC, followed by 40 cycles of 30 seconds at 94ºC (denaturation), 45 at 50ºC (annealing) and 45
at 72ºC (extension). A final extension was performed for 5 minutes at 72ºC. To detect the presence
of cagA amplificate a single step reverse hybridisation technique (prototype line probe assay,
LiPA, Innogenetics NV, Gent, Belgium) was used. This assay comprises a nitro-cellulose strip
containing two different specific oligonucleotide probes for the cagA gene, permitting a
convenient hybridisation based confirmation of the cagA PCR product [16].
Serological testing for anti-H. pylori IgG antibodies and anti-CagA antibodies
All serum samples were tested for the presence of anti-H. pylori IgG antibodies using a
commercially available assay (Pyloriset EIA-G III, Orion Diagnostica, Espoo, Finland). The
presence of anti-CagA antibodies was determined by two different serological tests. An in-house
standard ELISA was performed based on the recombinant orv220 antigen from OroVax (OroVax,
Inc, Cambridge, MS, USA) [13] and results were expressed as optical densities (OD). We used the
cut-off value as determined in a previous study, based on the upper limit of two standard
deviations from the mean in a large H. pylori negative Dutch population (OD = 0.458 nm) [17].
The CagA rapid test (Orion) is an immunochromatographic test acquiring a single drop of serum
or whole blood to show a positive or negative result within 10 minutes. Sensitivity, specificity, and
accuracy were calculated in the usual way. As positive and negative predictive value have no
meaning in this selected population, these were omitted. The CagA rapid test (Orion) was
compared to the serum samples in which PCR and the OroVax CagA recombinant based ELISA
The value of PCR and serology based methods in determining the presence of cagA
123
were in agreement (gold standard). Statistical comparison was performed by Chi-square testing
using Yates correction and p < 0.05 was considered significant.
Results
Comparison of PCR and OroVax CagA recombinant based ELISA
PCR detected cagA positive H. pylori strains in 53 (58%) of the 91 H. pylori positive biopsy
specimens (table 1). The OroVax CagA recombinant based ELISA detected anti-CagA antibodies
in 31 (34.1%) of the 91 H. pylori positive biopsy specimens and was negative in 49 (98.0%) of the
50 H. pylori negative biopsy specimen. PCR and the OroVax CagA recombinant based ELISA
were in agreement in 118 (83.7%) of the 141 patients (table 1). IgG anti-H. pylori antibodies were
detected in 78 (85.7%) of the 91 H. pylori positive patients. The 13 false negative IgG results
occurred in eight patients with a negative result for both PCR cagA and OroVax CagA
recombinant based ELISA, in four patients with only a positive PCR cagA, and in one patients
with both positive PCR cagA and OroVax CagA recombinant based ELISA. The IgG anti-H.
pylori antibody test was negative in 47 (94.0%) of the 50 H. pylori negative patients. In one of the
three samples with a false positive result, the OroVax CagA recombinant based ELISA was also
false positive.
Evaluation of the CagA rapid test (Orion)
The accuracy of the CagA rapid test (Orion) was evaluated by constructing a gold standard
based on the serum samples and biopsy specimens in which PCR and the OroVax CagA
recombinant based ELISA were in agreement. The CagA rapid test (Orion) identified 30 (96.8%)
of the 31 cagA positive and 83 (95.4%) of the 87 cagA negative serum samples. The test was
negative in 48 (96.0%) of the 50 H. pylori negative patients. Changing the cut-off value for the
CagA rapid test (Orion) did not improve its accuracy, indicating that the OD's of false positive and
false negative results were not close to the selected cut-off value. In one of the two samples with a
false positive results, both the OroVax CagA recombinant based ELISA and H. pylori IgG-
antibodies were also false positive. The overall accuracy of the CagA rapid test (Orion) as
compared to the gold standard was 95.8%.
Chapter 8
124
The value of PCR and serology based methods in determining the presence of cagA
125
Chapter 8
126
Discussion
Several studies have shown that anti-CagA antibodies can be detected in patients infected with
a cagA positive H. pylori strain [9-11,18]. The presence of anti-CagA antibodies correlates with
the presence of many cag pathogenicity island encoded virulence factors, and patients infected
with a cagA positive strain were shown to be more prone for the development of clinically
significant H. pylori-related disease. A significant association between the presence of cagA on the
one hand and PUD and gastric cancer on the other has been reported [19,20]. Moreover, a
recently published population based epidemiological study showed a significant association
between infection with a cagA positive strain and symptoms of dyspepsia [21]. On the other hand,
it has been suggested that infection with a cagA positive H. pylori strain protects against gastro-
esophageal reflux disease (GERD) and its consequences, Barrett’s metaplasia and adenocarcinoma
of the oesophagus [22,23]. As a result screening for anti-CagA antibodies might be useful to
identify patients with an increased risk for development of pathology, thus allowing selective
and/or differential treatment regimes [11,24]. A simple and reliable, non-invasive test for this
marker is thus not only a relevant tool for research purposes, but may also bear a clinical
relevance.
The relation between the presence of cagA and the clinical outcome of H. pylori infection is
primarily based on studies using the detection of anti-CagA antibodies to determine the cagA
status [20-22,25-27]. Only very few studies, however, (summarised in table 2) addressed the
accuracy of these serological tests [11,28-31]. The results of these studies are difficult to compare
as each study compared anti-CagA antibody serology to a different reference method, reflecting
the absence of a reliable generally accepted gold standard. Moreover, all studies only used a single
method as the gold standard, and all suffer from potential drawbacks. Firstly, the possibility of an
infection with both cagA positive and negative H. pylori strains has to be considered [32,33].
Secondly, it has been observed that H. pylori can spontaneously lose or obtain the cagA gene [34].
Thirdly, not all cagA positive H. pylori strains express CagA and cause an antibody response [11].
Finally, as in anti-H. pylori IgG serology, anti CagA-antibodies may persist after (accidental) H.
pylori eradication. Therefore, the reliability of PCR, colony hybridisation, or serology based
methods as the sole reference method is questionable.
In our study the agreement between PCR and the OroVax recombinant based ELISA was
compared and showed reasonable correspondence (83.7%). To avoid sampling error, we used the
The value of PCR and serology based methods in determining the presence of cagA
127
whole biopsy specimen for our PCR. PCR showed considerably more cagA positive H. pylori
strains as compared to the OroVax recombinant based ELISA, possibly indicating the absence of
an anti-CagA antibody response in many patients. An absent immune response may be explained
by variations in the anti-body type between patients and the possibility that not all cagA positive
H. pylori strains express this gene. In only one patient the OroVax recombinant based ELISA
detected anti-CagA antibodies, while this patient was H. pylori negative by histology and culture.
In this patient, both anti-H. pylori IgG serology and the CagA rapid test (Orion) were also positive
which could point at sampling error when obtaining biopsy specimens or previous accidental
eradication of H. pylori with persisting circulating antibodies. Considering the troubling issues
hampering the formation of a gold standard, it is impossible to determine which of both tests, PCR
or OroVax recombinant based ELISA most reliably approaches reality. In this era of genome
based research, there is no longer a need to perform such studies with anti-CagA antibody serology
as the sole detection method. Therefore, we composed a gold standard based on those biopsy
specimens and serum samples in which both tests were in agreement. The CagA rapid test (Orion)
showed to be very accurate when compared to this gold standard. Moreover this test is easily
performed and no expensive laboratory equipment has to be used. Just a single drop of blood is
needed and the results can be read within ten minutes.
In conclusion, detection of H. pylori cagA by PCR and CagA antibody based ELISAs shows
reasonable agreement. The possibility of mixed infections, genetic drift, serological scars, and
cagA positive strains not expressing CagA make it impossible to determine which of these tests
approaches reality most reliably. When a gold standard was constructed based on concordance
between PCR and OroVax CagA recombinant based ELISA, the CagA rapid test (Orion) proved to
be very accurate.
Acknowledgements
The CagA rapid test (Orion) was supplied by Orion Diagnostica, Espoo, Finland
Chapter 8
128
References
1. Blaser MJ. Not all Helicobacter pylori strains are created equal: should all be eliminated ? Lancet 1997;
349: 1020-1022.
2. Majewski SIH, Goodwin CS . Restriction endonuclease analysis of the genome of Campylobacter
pylori with a rapid extraction method: evidence for considerable genomic variation. Journal of Infectious
Diseases 1988; 157: 465-471.
3. Akopyanz N, Bukanov NO, Westblom TU, Kresovich S, Berg DE. DNA diversity among clinical
isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Research
1992; 20: 5137-5142.
4. Owen RJ, Bickley J, Costas M, Morgan DR. Genomic variation in Helicobacter pylori: application to
identification of strains. Scandinavian Journal of Gastroenterology 1991; 181: 43-50.
5. Langenberg W, Rauws EA, Widjojokusumo A, Tytgat GNJ, Zanen HC . Identification of
Campylobacter pyloridis isolates by restriction endonuclease DNA analysis. Journal of Clinical
Microbiology 1986; 24 : 414-416.
6. Blaser MJ. Heterogeneity of Helicobacter pylori. European Journal of Gatroenterology & Hepatology
1997; 9 (suppl 1): S3-S7.
7. Solca NM, Bernasconi MV, Valsangiacomo C, van Doorn LJ, Piffaretti JC. Population genetics of
Helicobacter pylori in the southern part of Switzerland analysed by sequencing of four housekeeping
genes (atpD, glnA, scoB and recA), and by vacA, cagA, iceA and IS605 genotyping. Microbiology 2001;
147: 1693-1707.
8. Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D, Macchia G et al. Molecular
characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with
cytotoxicity and duodenal ulcer. Proceedings of the National Academy of Sciences of the United States
of America 1993; 90: 5791-5795.
9. Covacci A, Falkow S, Censini S, Lange C, Segal E, Salama N et al. The cag pathogenicity island of
Helicobacter pylori: origin, molecular biology and relevance to virulence. In: Moran AP , O'Morain CA,
editors. Pathogenesis and host response in Helicobacter pylori infections. Galway, Ireland: Normed
Verlag, 1997: 88-100.
10. Gerstenecker B, Eschweiler B, Vogele H, Koch HK, Hellerich U, Kist M. Serodiagnosis of
Helicobacter pylori infections with an enzyme immunoassay using the chromatographically purified 120
kilodalton protein. European Journal of Clinical Microbiology & Infectious Diseases 1992; 11: 595-601.
11. Cover TL, Glupczynski Y, Lage AP, Burette A, Tummuru MKR, Perez-Perez GI et al. Serologic
detection of infection with cagA+ Helicobacter pylori strains. Journal of Clinical Microbiology 1995;
33: 1496-1500.
The value of PCR and serology based methods in determining the presence of cagA
129
12. Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M et al. cag, a pathogenicity
island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors.
Proceedings of the National Academy of Sciences of the United States of America 1996; 93: 14648-
14653.
13. Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, Chyou PH et al. Infection with
Helicobacter pylori strains possessing cagA is associated with an increased risk of developing
adenocarcinoma of the stomach. Cancer Research 1995; 55: 2111-2115.
14. Boom R, Sol CJA, Heijtink R, Wertheim-van Dillen PME, van der Noordaa J. Rapid purification of
hepatitis B virus DNA from serum. Journal of Clinical Microbiology 1991; 29: 1804-1811.
15. van Doorn LJ, Figueiredo C , Sanna R, Plaisier A, Schneeberger P, de Boer W et al. Clinical
relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 1998; 115: 58-
66.
16. van Doorn LJ, Figueiredo C , Rossau R, Jannes G, van Asbroeck M, Sousa JC et al. Typing of
Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization. Journal of
Clinical Microbiology 1998; 36: 1271-1276.
17. Loffeld RJ, Werdmuller BF, Kusters JG, Kuipers EJ . IgG antibody titer against Helicobacter pylori
correlates with presence of cytotoxin associated gene A-positive H. pylori strains. FEMS Immunology
and Medical Microbiology 2000; 28: 139-141.
18. Miehlke S, Go MF, Kim JG, Graham DY, Figura N. Serologic detection of Helicobacter pylori
infection with cagA-positive strains in duodenal ulcer, gastric cancer, and asymptomatic gastritis.
Journal of Gastroenterology 1998; 33 (suppl 10): 18-21.
19. Crabtree JE, Taylor JD, Wyatt JI, Heatlley RV, Shallcross TM, Tompkins DS et al. Mucosal IgA
recognition of Helicobacter pylori 120 kDa protein, peptic ulceration, and gastric pathology. Lancet
1991; 338: 332-335.
20. Parsonnet J, Friedman GD, Orentreich N, Vogelman H. Risk for gastric cancer in people with CagA
positive or CagA negative Helicobacter pylori infection. Gut 1997; 40: 297-301.
21. Nelson DB, Murdoch M, Sandozi IK, Dalmasso AP, Crabtree JE, Ho SB. Dyspepsia is associated
with CagA-positive Helicobacter pylori. American Journal of Gastroenterology 2000; 95: 3412-3417.
22. Vicari JJ, Peek RM, Falk GW, Goldblum JR, Easley KA, Schnell J et al. The seroprevalence of
cagA-positive Helicobacter pylori strains in the spectrum of gastroesophageal reflux disease.
Gastroenterology 1998; 115: 50-57.
23. Loffeld R, Werdmuller B, Kusters J, Perez - Perez G, Blaser MJ, Kuipers E. Cag-A positive
H.pylori infection (HP) portects against development of GORD. The Netherlands Journal of Medicine
1999; 54: A6-A63.
Chapter 8
130
24. Menegatti M, Vaira D, Figura N, Palli D, Miglioli M. Age, Helicobacter pylori, and/or CagA
antibodies as a pre-endoscopic screening policy. American Journal of Gastroenterology 1999; 95: 320-
321.
25. Heikkinen M, Mayo K, Megraud F, Vornanen M, Marin S, Pikkarainen P et al. Association of
cagA-positive and cagA-negative Helicobacter pylori strains with patients' symptoms and gastritis in
primary care patients with functional upper abdominal complaints. Scandinavian Journal of
Gastroenterology 1998; 33: 31-38.
26. Ching CK, Wong BC, Kwok E, Ong L, Covacci A, Lam SK. Prevalence of CagA-bearing
Helicobacter pylori strains detected by the anti-CagA assay in patients with peptic ulcer disease and in
controls. American Journal of Gastroenterology 1996; 91: 949-953.
27. Kikuchi S, Crabtree JE, Forman D, Kurosawa M. Association between infections with CagA-
positive or -negative strains of Helicobacter pylori and risk for gastric cancer in young adults. American
Journal of Gastroenterology 1999; 94: 3455-3459.
28. Yamaoka Y, Kodama T, Graham DY, Kashima K. Comparison of four serological tests to determine
the CagA or VacA status of Helicobacter pylori strains. Journal of Clinical Microbiology 1998; 36:
3433-3434.
29. Basso D, Stefani A, Brigato L, Navaglia F, Greco E, Zambon CF et al. Serum antibodies anti-
H.pylori and anti-CagA: a comparison between four different assays. Journal of Clinical Laboratory
Analysis 1999; 13: 194-198.
30. Klaamas K, Kurtenkov O, Covacci A, Lipping A, Wadstrom T. Immune response to a recombinant
fragment of the CagA protein of Helicobacter pylori in blood donors and patients with gastric cancer:
relation to ABO(H) blood group phenotype, stage of the disease and tumor morphology. Medical
Microbiology and Immunology (Berlin) 1999; 187: 227-232.
31. Figueiredo C, Quint W, Nouhan N, van Den MH, Herbrink P, Scherpenisse J et al. Assessment of
Helicobacter pylori vacA and cagA Genotypes and Host Serological Response. Journal of Clinical
Microbiology 2001; 39: 1339-1344.
32. van der Ende A, Rauws EA, Feller M, Mulder CJ, Tytgat GN, Dankert J. Heterogeneous
Helicobacter pylori isolates from members of a family with a history of peptic ulcer disease.
Gastroenterology 1996 ; 111: 638-647.
33. Hamlet A, Thoreson AC, Nilsson O, M. SA, Olbe L. Duodenal Helicobacter pylori infection differs in
cagA genotype between asymptomatic subjects and patients with duodenal ulcers. Gastroenterology
1999; 116: 259-268.
34. Kuipers EJ, Israel DA, Kusters JG, Gerrits MM, Weel J, van Der EA et al. Quasispecies
development of Helicobacter pylori observed in paired isolates obtained years apart from the same host.
Journal of Infectious Diseases 2000; 181: 273-282.
131
Chapter 9
Implications of the simultaneous presence of metronidazole-
susceptible and -resistant Helicobacter pylori colonies within a
single biopsy specimen.
Nicolaas L. A. Arents 1, Leonard C. Smeets 2, Anton A. van Zwet 1, Jacob C. Thijs 3,
Egbert Jan van der Wouden 3, Albertine de Jong 1, John E. Degener 4, and Johannes G.
Kusters 5.
1 Regional Public Health Laboratory, Groningen / Drenthe2 Department of Medical Microbiology, Free University, Amsterdam3 Department of Internal Medicine, Bethesda Hospital, Hoogeveen4 Department of Medical Microbiology, University Hospital, Groningen
Published in European Journal of Clinical Microbiology & Infectious Diseases
2001; 20: 418-420.
Chapter 9
132
Abstract
This study examined whether the simultaneous presence of metronidazole - susceptible and -
resistant Helicobacter pylori in a single biopsy specimen is caused by a multiple strain infection
with a susceptible and a resistant strain, or by two subpopulations within a single strain. Single
colonies obtained from seven biopsy specimens known to harbour both susceptible and resistant
Helicobacter pylori were fingerprinted by Restricted Fragment Length Polymorphism typing
(RFLP) of the ureC gene and by the Random Amplified Polymorphic DNA procedure (RAPD).
Metronidazole susceptibility was determined by E test. The results indicated that the occurrence of
metronidazole resistant and metronidazole susceptible bacteria within one single biopsy does not
imply the presence of a multiple strain infection with one resistant and one sensitive strain.
Introduction
Metronidazole is frequently used in the treatment of Helicobacter pylori infection.
Metronidazole resistance, however, is common and affects the efficacy of treatment regimens
containing this drug [1]. For that reason, culturing Helicobacter pylori for metronidazole
susceptibility testing has become mandatory. By such susceptibility testing several authors
observed that some patients are infected with both susceptible and resistant Helicobacter pylori
bacteria [2-5]. In a previous study we detected susceptible and resistant bacteria in 10% of our
biopsy specimens [3].
In 1989, another observation was made by Beji et al. [6]. These authors were the first to
describe the presence of more than one infecting strain in a single patient [6]. Since that time,
evidence for the occurrence of multiple Helicobacter pylori strain infection has accumulated and it
has been shown that this condition is not uncommon [7-10]. Both phenomena, heterogeneity in
metronidazole susceptibility and multiple strain infection, were extensively studied by Weel et al.
[4] and Dore et al. [5]. In both studies, Helicobacter pylori colonies obtained from biopsy
specimens known to harbour both metronidazole-susceptible and - resistant bacteria were
fingerprinted. Most biopsy specimens were colonised by a single strain, but about 10% contained
more than one Helicobacter pylori strain. The question whether these biopsy specimens were
infected with one susceptible Helicobacter pylori strain and one resistant strain, however, was not
answered as neither study mentioned any association between metronidazole susceptibility and
strain type. This study tries to address that question.
The simultaneous presence of metronidazole susceptible and resistant colonies
133
Materials and Methods
Seven biopsy specimens known to harbour both metronidazole-susceptible and metronidazole-
resistant Helicobacter pylori were studied. The biopsy specimens were obtained from separate
patients undergoing gastroduodenoscopy for dyspeptic symptoms. To our knowledge none of the
patients had previously received any anti-Helicobacter pylori treatment. Immediately after
endoscopy the biopsy specimens were transported in thyoglycolate broth to the laboratory and
used to inoculate Belo horizonte plates (BHM) containing brain heart infusion agar (35 mg/ml),
sheep blood (10%), vancomycin (6 mg/l), nalidixic acid (20 mg/l), amphotericin B (2 ml/l), and
2,3,5-triphenyltetrazolium chloride (40 mg/l). After incubation for 3 days under microaerobic
conditions, randomly selected single colonies were subcultured on separate BHM plates. The total
number of colonies selected from each primary culture plate varied between 8 and 12, depending
on the availability of clearly separated colonies. After another 3 days, these subcultures were used
to inoculate Columbia agar plates for metronidazole susceptibility testing as previously described
[3](E test; AB-Biodisk, Sweden) and BHM plates to produce stock colonies for DNA
fingerprinting. DNA isolation was performed according to the procedure described by Boom et al.
[11]. To fingerprint the Helicobacter pylori strains, we used two different procedures
recommended to type Helicobacter pylori: a Random Amplified Polymorphic DNA procedure
(RAPD) on the entire DNA and a Restricted Fragment Length Polymorphism typing (RFLP) of the
ureC gene [12,13]. RAPD-PCR reactions were performed in 50 microliter PCR reaction buffer,
containing 10 mM TRIS, 50 mM KCl, 3 mM MgCl2, 0.01% gelatine, 2 U Taq polymerase
(Boehringer-Mannheim, Germany), 0.25 mM dNTP's (Boehringer-Mannhein), 0.2 nmol primers
and 2 microliter isolated Helicobacter pylori DNA. The RAPD primers used were :
AAGAGCCCCG and : AACGCGCAAC. PCR was performed in a PTC 200 thermocycler (MJ
Research, USA) as follows: 9 min preincubation at 94°C, followed by 40 cycles of 30 s at 94°C,
45 s at 45°C and 45 s at 72°C. A final extension was performed for 10 min at 72°C. Twelve
microliter of the obtained product was used for gel electrophoresis, stained with ethidium bromide,
and photographed according to standard protocols. RFLP-PCR reactions were performed in 50
microliter PCR reaction buffer, containing 10 mM TRIS, 50 mM KCl, 3 mM MgCl2 , 0.01%
gelatine, 1.5 U Taq polymerase (Boehringer-Mannheim), 10 pmol dNTP's (Boehringer-
Mannheim), 40 pmol primers and 2 microliter isolated Helicobacter pylori DNA. PCR conditions
were 9 min preincubation at 94°C, followed by 35 cycles of 60 s at 94°C, 60 s at 50°C and 60 s at
Chapter 9
134
72°C. We used the primers described by Fujimoto et al. [9] for the amplification of the ureC gene,
'5-TGG GAC TGA TGG CGT GAG GG and '5-AAG GGC GTT TTT AGA TTT TT. These
primers yielded a 820 bp amplicon corresponding with the ureC gene. The amplicon was digested
by three different endonucleases according to the guidelines of the manufacturer (Boehringer-
Mannheim) : Sau 3A1, Tru 9I, and Cfo 1. The digested DNA was electrophoresed, stained with
ethidium bromide, and photographed according to standard protocols.
Results and Discussion
The MIC values for metronidazole for all tested colonies are shown in Table 1. As can be seen,
the selection of single colonies from each biopsy specimen enclosed both susceptible and resistant
Helicobacter pylori bacteria and a large variety of MIC values ranging from fully susceptible to
completely resistant was observed. Not all colonies tested for metronidazole susceptibility could
be fingerprinted successfully, as some colonies were lost in the process or DNA isolation failed. In
all biopsy specimens, however, fingerprinting results were available for both susceptible and
resistant colonies. Typing of the Helicobacter pylori colonies by both methods showed complete
concordance between RAPD and RFLP of the ureC gene. Fingerprinting showed a single
Helicobacter pylori strain in six of the seven biopsy specimens. In one biopsy specimen both
methods indicated the presence of two different Helicobacter pylori strains. Surprisingly, however,
the metronidazole resistant phenotype was not confined to a particular strain, as both Helicobacter
pylori strains were shown to consist of susceptible and resistant bacteria.
Our data show that in most biopsy specimens containing both susceptible and resistant
Helicobacter pylori bacteria, a single strain is involved. This confirms the finding of others,
showing a single strain infection in > 90% of the biopsy specimens with metronidazole susceptible
and resistant bacteria [4,5]. Weel et al. [4] found that in 28 of 156 consecutive patients, biopsy
specimens harboured both metronidazole - susceptible and - resistant Helicobacter pylori bacteria.
In 20 of these 28 specimens, single colonies were fingerprinted by RAPD and multiple strains
were found in two specimens (10%). Dore et al. [5] fingerprinted single colonies of 12 biopsy
specimens known to harbour Helicobacter pylori strains heterogeneous for metronidazole
susceptibility. Repetitive extragenic palindrome-based PCR typing showed that only one biopsy
specimen harboured two different, but closely related Helicobacter pylori strains (1 of 12). Neither
study, however, looked into the possibility that metronidazole resistance was confined to a
The simultaneous presence of metronidazole susceptible and resistant colonies
135
Chapter 9
136
particular strain. In our study, even in the biopsy specimen that contained two different
Helicobacter pylori strains, metronidazole susceptibility was not confined to a single strain as both
strains consisted of metronidazole - susceptible and -resistant bacteria.
It has been shown that in many cases, metronidazole resistance is caused by a null-mutation in
the rdxA gene, which encodes for a nitroreductase capable of converting metronidazole to its
active form [14-16]. Recently, another gene capable of reducing metronidazole has been described,
the frxA gene encoding for a NAD(P)H flavin oxidoreductase, which is possibly also involved in
metronidazole resistance among H. pylori isolates [17]. As heterogeneity in fmetronidazole
susceptibility is not explained by multiple strain infection, differences in susceptibility are more
likely caused by novel mutations in these genes within a single infecting strain.
References
1. van der Wouden EJ, Thijs JC , van Zwet AA, Sluiter WJ, Kleibeuker JH. The influence of in vitro
nitroimidazole resistance on the efficacy of nitromidazole containing anti-Helicobacter pylori regimens:
a meta-analysis. American Journal of Gastroenterology 1999; 94: 1751-1759.
2. Xia HHX, Kalantar J, Talley NJ. Metronidazole- and clarithromycin-resistant Helicobacter pylori in
dyspeptic patients in western Sydney as determined by testing multiple isolates from different gastric
sites. Journal of Gastroenterology and Hepatology 1998; 13: 1044-1049.
3. van der Wouden EJ, de Jong A, Thijs JC, Kleibeuker JH, van Zwet AA. Subpopulations of
Helicobacter pylori are responsible for discrepancies in the outcome of nitroimidazole susceptibility
testing. Antimicrobial Agents and Chemotherapy 1999; 43: 1484-1486.
4. Weel JF, van der Hulst RW, Gerrits Y, Tytgat GN, van der Ende A, Dankert J. Heterogeneity in
susceptibility to metronidazole among Helicobacter pylori isolates from patients with gastritis or peptic
ulcer disease. Journal of Clinical Microbiology 1996; 34: 2158-2162.
5. Dore MP, Osato MS, Kwon DH, Graham DY, El-Zaatari FAK. Demonstration of unexpected
antibiotic resistance of genotypically identical Helicobacter pylori isolates. Clinical Infectious Diseases
1998; 27: 84-89.
6. Beji A, Vincent P, Darchis I, Husson MO, Cortot A, Leclerc H. Evidence of gastritis with several
Helicobacter pylori strains. Lancet 1989; 9: 1402-1403.
7. van Doorn LJ, Figueiredo C, Rossau R, Jannes G, van Asbroeck M, Sousa JC et al. Typing of
Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization. Journal of
Clinical Microbiology 1998; 36: 1271-1276.
The simultaneous presence of metronidazole susceptible and resistant colonies
137
8. Prewett EJ, Bickley J, Owen RJ, Pounder RE. DNA patterns of Helicobacter pylori isolated from
gastric antrum, body and duodenum. Gastroenterology 1992; 102: 829-833.
9. Fujimoto S, Marshall B, Blaser MJ. PCR-based restriction fragment length polymorphism typing of
Helicobacter pylori. Journal of Clinical Microbiology 1994; 32: 331-334.
10. Hirschl AM, Richter M, Makristathis A, Pruckl PM, Willinger B, Schutze K et al. Single and
multiple strain colonization in patients with Helicobacter pylori-associated gastritis: detection by
macrorestriction DNA analysis. Journal of Infectious Diseases 1994; 170: 473-475.
11. Boom R, Sol CJA, Heijtink R, Wertheim-van Dillen PME, van der Noordaa J. Rapid purification of
hepatitis B virus DNA from serum. Journal of Clinical Microbiology 1991; 29: 1804-1811.
12. Burucoa C, Lhomme V, Fauchere JL. Performance criteria of DNA fingerprinting methods for typing
Helicobacter pylori isolates: experimental results and meta-analysis. Journal of Clinical Microbiology
1999; 37: 4071-4080.
13. Lu JJ, Perng CL, Shyu RY, Chen CH, Lou Q, Chong SK et al. Comparison of five PCR methods for
detection of Helicobacter pylori DNA in gastric tissues. Journal of Clinical Microbiology 1999 ; 37:
772-774.
14. Goodwin A, Kersulyte D, Sisson G, Veldhuyzen van Zanten SJ, Berg DE, Hoffman PS .
Metronidazole resistance in Helicobacter pylori is due to null mutations in a gene (rdxA) that encodes an
oxygen-insensitive NADPH nitroreductase. Mol Microbiol 1998; 28: 383-93.
15. Hoffman PS, Goodwin A, Johnsen J, Magee K, Veldhuyzen van Zanten SJ. Metabolic activities of
metronidazole-sensitive and -resistant strains of Helicobacter pylori: repression of pyruvate
oxidoreductase and expression of isocitrate lyase activity correlate with resistance. Journal of
Bacteriology 1996; 178: 4822-4829.
16. Jenks PJ, Ferrero RL, Labigne A. The role of the rdxA gene in the evolution of metronidazole
resistance in Helicobacter pylori. Journal of Antimicrobial Chemotherapy 1999; 43: 753-758.
17. Kwon DH, Kato M, El Zaatari FA, Osato MS, Graham DY. Frame-shift mutations in NAD(P)H
flavin oxidoreductase encoding gene (frxA) from metronidazole resistant Helicobacter pylori
ATCC43504 and its involvement in metronidazole resistance. FEMS Microbiology Letters 2000; 188:
197-202.
139
Chapter 10
Summary and general conclusions.
Chapter 10
140
Summary and conclusions
In this thesis the management of dyspepsia in primary care in relation to Helicobacter pylori
(H. pylori) infection was studied. In chapter two several important issues considering the approach
of dyspepsia are discussed. It is clear that dyspepsia is not a disease but merely a cluster of
symptoms believed to originate from the gastrointestinal tract. This is probably the main reason
why a universal consensus regarding the approach of dyspepsia is still lacking. Although many
studies have evaluated strategies for dyspepsia, considerable differences exist in the definitions of
dyspepsia, hampering a reliable comparison between study results. The discovery of H. pylori has
resulted in new strategies to approach dyspepsia in primary care, based on screening for H. pylori
infection. Altogether, four main strategies for dyspepsia are currently considered: 1. Symptom
guided empirical treatment, 2. Direct referral for endoscopy, 3. Non-invasive testing for H. pylori
and subjecting the H. pylori-positive patients to endoscopy (“test-and-scope”), and 4. Non-
invasive testing for H. pylori and treatment of the infection in H. pylori-positive patients (“test-
and-treat”). Based on data derived from the literature, several key issues were identified which
have a significant impact on the cost-effectiveness of these strategies, namely: cost of endoscopy,
cost of therapy, cost of physician visit, prevalence of H. pylori in the dyspeptic population,
prevalence of peptic ulcer disease (PUD) in H. pylori positive patients, prevalence of all
underlying diseases in dyspepsia, benefit of H. pylori eradication in patients with functional
dyspepsia, and recurrence of dyspeptic symptoms in patients with (functional) dyspepsia after
treatment. After careful consideration of the literature with respect to the advantages and
disadvantages of the various strategies and the key issues mentioned above, it is concluded that at
this moment, a “test-and-treat” strategy is the most rational approach in the younger patient with
uncomplicated dyspepsia.
Chapter three reports the results of the SENSE study (Strategy: ENdoscopy versus SErolgy).
Patients who visited their general practitioner (GP) for dyspepsia could participate in the study if
the GP judged the symptoms severe enough to justify treatment with acid-suppressive drugs or an
upper endoscopy. Two hundered seventy patients fulfilling this condition were randomised to
either a serology based “test-and-treat” strategy or a prompt open-access endoscopy. The study
was performed completely in a primary care setting in the northern part of the Netherlands. After a
one year follow-up period, only 33% of the patients in the “test-and-treat” arm were eventually
referred for endoscopy. In these patients, no H. pylori associated PUD was detected. Symptom
Summary and general conclusions
141
resolution, change in quality of life, and patient satisfaction were comparable between the “test-
and-treat” patients and the patients in the prompt endoscopy arm. The “test-and-treat” patients,
however, visited their GP more frequently and were more frequently prescribed prokinetic drugs.
On the other hand, prompt endoscopy patients were more often prescribed PPI's. Altogether, the
SENSE study proved that the “test-and-treat” strategy is a save and cost-effective approach in
primary care.
Before a “test-and-treat” strategy can be savely implemented in primary care, however, several
conditions need to be fulfilled.
Firstly, reliable non-invasive testing for H. pylori has to be possible and therefore, accurate
tests are required. In chapter four, the accuracy of the recently introduced Helicobacter pylori
Stool Antigen (HpSA) test, which is based on the detection of H. pylori antigens in faecal samples
by antigen capture ELISA, was evaluated. This test showed accurate results for the detection of H.
pylori infection in untreated patients (sensitivity and specificity of 96.3% and 81.8% respectively)
when compared to a gold standard based on culture, histology, and rapid-urease testing of gastric
biopsy specimens. Both one and four weeks after cessation of therapy, however, the test failed to
detect persisting H. pylori infection (sensitivity 20.0%, specificity 95.0% (at one week), sensitivity
40.0% and specificity 95.0% (at four weeks)). These results are in contrast to the results published
by others. No adequate explanation can be given for this discrepancy. It is concluded, however,
that the HpSA test is not sufficiently reliable to monitor treatment success, at least in our hands.
Secondly, as stated before in chapter two, the cost-effectiveness of strategies based on
screening for H. pylori mainly depend on the number of patients who will clearly benefit from
anti-H. pylori therapy. As these are patients suffering from H. pylori related PUD, a decrease in
the prevalence of H. pylori related PUD will result in a decreased cost-effectiveness of the “test-
and-treat” strategy. Recently, it has been suggested that the significance of H. pylori in PUD has
been overestimated and that the decrease in H. pylori prevalence will unmask idiopathic PUD (not
related to NSAID use or H. pylori infection). In chapter five the results of all endoscopies
performed over an eigth year period in a single hospital were studied. These data revealed a
decreasing trend in the prevalence of H. pylori in PUD. The proportion of PUD ascribed to
NSAID-use increased significantly, but the proportion ascribed to idiopathic PUD remained stable
at about 10% during the study period.
Chapter 10
142
Thirdly, a “test-and-treat” strategy in primary care is only useful if patients can be effectively
treated in the absence of information on antibiotic susceptibility. Numerous studies have shown
that antibiotic resistance has a significant impact on the efficacy of anti-H. pylori regimens. In the
Netherlands, the most frequently used anti-H. pylori regimens are the triple regimens PAM
(protonpump inhibitor, amoxicillin, metronidazole), and PAC (protonpump inhibitor, amoxicillin,
clarithromycin). In chapter six we showed that in the north-eastern part of the Netherlands the
prevalence of metronidazole resistance decreased significantly from 1996 to 2001. The prevalence
of clarithromycin resistance fluctuated over this period, but no significant trend could be observed.
Interestingly, the decrease in prevalence of metronidazole resistance was accompanied by a
concurrent decrease in the number of metronidazole prescriptions in the Netherlands (precriptions
for other conditions than anti-H. pylori treatment were also included). Altogether both regimens
(PAM and PAC) had a calculated efficacy of > 80%. The efficacy of the PAM regimen is likely to
increase if the decrease in prevalence of metronidazole resistance continues, whereas the efficacy
of the PAC regimen will drop significantly after even a slight increase in the prevalence of
clarithromycin resistance.
The second part of the thesis focussed on genetic differences between H. pylori strains. These
genetic differences have been hold responsible for the differences in clinical outcome. Several
virulence factors have been identified in H. pylori, like the vacA gene which encodes for the
vacuolating cytotoxin, the cagA gene responsible for the production of the CagA protein, and the
iceA gene, which is expressed at contact with gastric epithelial cells. In chapter seven, we have
studied the association between these virulence factors and various clinical outcomes (PUD, gastro
oesophageal reflux disease (GERD) and gastritis only). The results of this study showed that many
patients (over 20%) harboured a mixture of H. pylori strains. PUD patients were most frequently
infected with an H. pylori strain of the s1 vacA genotype or a strain which carried the cagA gene.
On the other hand, patients with GERD, were most frequently colonized by a strain lacking both
the cagA and the iceA1 gene. This finding supports the hypothesis that more virulent H. pylori
strains may protect against the development of GERD. It was concluded that virulence factors are
indeed associated with specific clinical outcomes. Whether the detection of these virulence factors
is significant in a clinical setting, however, needs further exploration. If so, a reliable non-invasive
test to detect the presence of these virulence factors in dyspeptic patients would be essential.
Chapter eight reports the results of a study evaluating the accuracy of the CagA rapid test (Orion).
Summary and general conclusions
143
It has been claimed that this test enables the accurate detection of CagA-antibodies in serum
samples by an easy to perform immunochromatographic test, showing results within 10 minutes.
We compared the CagA rapid test (Orion) to a surrogate gold standard based on a combination of
PCR based cagA gene detection in gastric biopsies and the OroVax recombinant based ELISA for
the detection of serum antibodies. The gold standard was considered positive if both PCR and
OroVax recombinant based ELISA were positive. In other cases, the gold standard was considered
negative. This gold standard was chosen, as it is well known that the presence of the cagA gene
does not always result in the transcription of this gene. Without transcription serological antibodies
may be absent. On the other hand, persisting CagA-antibodies after a previously cleared H. pylori
infection may result in a positive CagA rapid test (Orion), whereas the PCR results are negative.
Compared to the surrogate gold standard, the CagA rapid test (Orion) showed a sensitivity and a
specificity of 96.8% and 95.4% respectively. Finally, in chapter nine the results are reported of an
extensive study performed on biopsy specimens of nine patients in whom both metronidazole
susceptible and resistant H. pylori bacteria had been demonstrated. The question was whether
these patients were colonized by two different H. pylori strains or by a single strain, part of which
became resistant. The second hypothesis appeared to be true as eight patients harboured only a
single H. pylori strain, part of which was sensitive and part of which was resistant to
metronidazole. In one patient, the presence of two different strains could be demonstrated, but both
strains were in part susceptible and resistent to metronidazole. Based on these data it is concluded
that the occurence of metronidazole resistant and metronidazole susceptible bacteria within one
single biopsy specimen does not imply the presence of a multiple strain infection with one
resistant and one susceptible strain.
General conclusions
The discovery of the role of H. pylori in several diseases of the upper alimentary tract has
resulted in new strategies to approach uncomplicated dyspepsia. Several authors have suggested
that an approach based on screening for H. pylori may be more rational than the common strategy
of empirical treatment with acid-suppressive drugs. This suggestion is supported by both decision
analytic studies and clinical studies, among which the SENSE study described in this thesis.
Moreover, most studies suggest that such an approach, especially the “test-and-treat” strategy, may
be more cost-effective. In contrast to most other clinical studies, the SENSE study was completely
Chapter 10
144
performed in a primary care setting. It showed that in primary care a “test-and-treat” strategy is
safe, is more cost-effective than a prompt endoscopy approach, and results in comparable
symptom resolution.
Implementation of the “test-and-treat” strategy in primary care is feasible, as accurate non-
invasive tests to diagnose H. pylori infection are available. Moreover, given the current levels of
antibiotic resistance, treatment of H. pylori infection with the usual PAC or PAM regimens should
result in acceptable success rates (>80%), even in the abscence of information on antibiotic
susceptibility. Monitoring of antibiotic resistance in H. pylori, however, remains mandatory, as
even a slight increase in the prevalence of clarithromycin resistance will result in a sharp drop in
cure rates if the PAC regimen is used.
Any strategy for dyspepsia that is based on non-invasive detection of H. pylori is critically
dependent on the prevalence of H. pylori in the dyspeptic population. At a low prevalence, the
positive predicitive value of any test for H. pylori will drop below an acceptable level, prohibiting
the implementation of a “test-and-treat” strategy. Moreover, if the prevalence of H. pylori in the
dyspeptic population is to low, conditions unrelated to H. pylori infection (among which idiopathic
PUD) are more likely to be the cause of dyspepsia. In our view, however, the current prevalence of
H. pylori in the dyspeptic population (>30% in the SENSE study) still justifies a “test-and-treat”
approach of uncomplicated dyspepsia in primary care. It is feasible, safe and cost-effective. The
prevalence of H. pylori infection, however, is rapidly decreasing in the Western world, and it is
likely that empirical treatment with acid suppression will eventually become more cost-effective
than the “test-and-treat” strategy. As the prevalence of H. pylori is strongly associated with age
this may already be true for the very young dyspeptic patient.
The virulence of the infecting H. pylori strain is probably related to the clinical outcome of the
infection. However, as the most virulent strains at the same time seem to cause PUD and protect
against GERD, it is unlikely that the non-invasive detection of virulence factors will contribute to
the clinical decision to treat or not to treat an infected patient, even though accurate tests are
available. Finally, it should be stressed that prompt endoscopy is the only acceptable approach of
any patient presenting with alarm symptoms.
145
Chapter 11
Samenvatting en algemene conclusies.
146
Samenvatting en algemene conclusies
Dit proefschrift beschrijft het onderzoek naar de benadering van dyspepsie in de
huisartspraktijk in relatie tot een infectie met Helicobacter pylori (H. pylori). In hoofdstuk twee
worden enkele belangrijke punten besproken voor wat betreft de benadering van dyspepsie. Het is
duidelijk dat dyspepsie geen specifieke aandoening is, maar eerder een verzameling van
symptomen waarvan gedacht wordt dat ze ontstaan vanuit het bovenste deel van het
maagdarmkanaal. Dit is waarschijnlijk de belangrijkste reden waarom er nog steeds geen algemene
overeenstemming bestaat over de benadering van dyspepsie. Hoewel veel studies verschillende
benaderingsstrategieën voor dyspepsie hebben onderzocht, zijn er grote verschillen in de gebruikte
definitie van dyspepsie, het geen een betrouwbare vergelijking van de verschillende studies
bemoeilijkt. De ontdekking van H. pylori heeft nieuwe strategieën voor de benadering van
dyspepsie in de huisartspraktijk mogelijk gemaakt die gebaseerd zijn op screening voor de
aanwezigheid van een H. pylori infectie. De belangrijkste strategieën op dit moment zijn : 1. Een
proefbehandeling op geleide van de klachten, 2. Direkte verwijzing voor een gastroduodenoscopie,
3. Niet-invasief testen voor H. pylori infectie waarbij alleen de positieve patiënten direkt worden
verwezen voor een gastroduodenoscopie (“test-and-scope”), en 4. Niet-invasief testen voor H.
pylori infectie waarbij positieve patiënten direkt een anti-H. pylori behandeling krijgen
voorgeschreven (“test-and-treat”). Uit de literatuur over dit onderwerp blijkt dat enkele factoren
een sleutelrol spelen voor wat betreft de kosten-effectiviteit van de verschillende strategieën,
namelijk : de kosten van een gastroduodenoscopie, de kosten van een behandeling, de kosten van
een huisartsconsult, de prevalentie van H. pylori infectie in dyspeptische patiënten, de prevalentie
van peptische ulcera in H. pylori positieve patiënten, de prevalentie van de verschillende
aandoeningen die dyspepsie kunnen veroorzaken, het nut van H. pylori eradicatie in patiënten met
functionele dyspepsie, en het aantal patiënten met recidiverende (functionele) klachten na
behandeling. Na zorgvuldige bestudering van de gegevens uit de literatuur en de genoemde
sleutelfactoren is de conclusie dat op dit moment een “test-and-treat” strategie de meest rationele
benadering is voor patiënten met dyspepsie in de huisartspraktijk.
In hoofdstuk drie worden de resultaten van de SENSE studie (Strategy : ENdoscopy versus
SErology) beschreven. Patiënten die hun huisarts bezochten wegens dyspeptische klachten konden
aan de studie deelnemen indien de huisarts de klachten ernstig genoeg vond om een
proefbehandeling met zuurremmers te starten of de patiënt voor een gastroduodenoscopie te
Sammenvatting en algemene conclusies
147
verwijzen. Tweehonderdzeventig patiënten die aan deze criteria voldeden zijn uiteindelijk
gerandomiseerd in een groep die volgens de “test-and-treat” strategie werd benaderd en een groep
die direkt voor een gastroduodenoscopie werd verwezen (“direkte scopie”). De studie werd
volledig in Noord-Nederlandse huisartspraktijken uitgevoerd. Na een vervolgperiode van één jaar
bleek dat slechts 33% van de patiënten in de “test-and-treat” groep alsnog voor een
gastroduodenoscopie was verwezen. Tijdens de gastroduodenoscopie werd in geen van deze
patiënten een H. pylori gerelateerd peptisch ulcus gevonden. Na één jaar was de mate van het
verdwijnen van de dyspeptische symptomen, de verandering in kwaliteit van leven en de
tevredenheid van de patiënten vergelijkbaar in beide studiegroepen. De patiënten in de “test-and-
treat” groep bezochten significant vaker de huisarts tijdens de studieperiode en kregen vaker
prokinetica voorgeschreven. Aan de andere kant kregen patiënten in de “direkte scopie” groep
vaker protonpompremmers voorgeschreven. Samengevat heeft de SENSE studie laten zien dat een
“test-and-treat” strategie veilig en kosten-effectief kan zijn voor de benadering van patiënten met
dyspepsie in de huisartspraktijk.
Voordat een “test-and-treat” strategie veilig en probleemloos kan worden ingevoerd in de
huisartspraktijk moet aan enkele voorwaarden zijn voldaan.
Allereerst moet het mogelijk zijn een H. pylori infectie door middel van niet-invasieve
methoden aan te tonen, waarvoor betrouwbare H. pylori testen noodzakelijk zijn. In hoofdstuk vier
wordt de recent geintroduceerde Helicobacter pylori Stool Antigeen test (HpSA test), die
gebaseerd is op het aantonen van H. pylori antigenen in de ontlasting door middel van “stool
capture ELISA”, geëvalueerd. Het bleek dat deze nieuwe test ten opzichte van de gouden
standaard die gebaseerd was op het testen van maagbiopten door middel van kweek, histologie en
ureasetest, betrouwbaar de aanwezigheid van een H. pylori infectie detecteerde in patiënten die
nooit eerder behandeld waren voor deze infectie (sensitiviteit en specificiteit van respectivelijk
96.3% en 81.8%). De HpSA test bleek niet erg betrouwbaar een persisterende H. pylori infectie te
detecteren in patiënten die één of vier weken eerder een anti-H. pylori behandeling hadden
voltooid (sensitiviteit en specificiteit respectievelijk 20.0% en 95.0% (na één week) en 40.0% en
95.0% (na vier weken). Deze resultaten komen niet overeen met de resultaten die door anderen
gepubliceerd zijn. Daarvoor is geen goede verklaring te geven. Het is echter onze mening, dat op
dit moment de HpSA test onvoldoende betrouwbaar is om in onze patiëntenpopulatie het succes
van een anti-H. pylori behandeling te controleren.
148
Ten tweede, zoals al eerder aangegeven in hoofdstuk twee, hangt de kosten-effectiviteit van
strategieën die gebaseerd zijn op screening voor H. pylori sterk af van het aantal patiënten dat
gunstig reageert op anti-H. pylori behandeling. Omdat dit meestal patiënten zullen zijn met een
peptisch ulcus, zal een afname van het aantal patiënten met een H. pylori gerelateerd peptisch
ulcus leiden tot een lagere kosten-effectiviteit van de “test-and-treat” strategie. Kort geleden is
gesuggereerd dat de rol van H. pylori bij peptische ulcera overschat wordt en dat de afnemende
prevalentie van H. pylori infecties kan leiden tot een ontmaskering van idiopathische peptische
ulcera (waarbij een H. pylori infectie noch NSAID gebruik aantoonbaar zijn). In hoofdstuk vijf
worden de resultaten beschreven van een onderzoek naar de bevindingen van alle gastro-
duodenoscopiën die verricht zijn tijdens een acht jaar durende periode in het Bethesda ziekenhuis
in Hoogeveen. Deze data laten inderdaad zien dat er een significante afnemende tendens is van het
aantal H. pylori geassocieerde peptische ulcera. De trend ging gepaard met een toenemend aantal
NSAID-gerelateerde peptische ulcera. De prevalentie van idiopathische ulcera bleef ongeveer
gelijk op 10% gedurende de studie periode.
Ten derde, een “test-and-treat” strategie in de huisartspraktijk kan alleen succesvol uitgevoerd
worden indien er tevens een effectieve behandelingsmogelijkheid is, zelfs als er geen informatie
beschikbaar is over de gevoeligheid van de H. pylori stam. Veel studies hebben aangetoond dat
resistentie tegen antibiotica een significante negatieve invloed heeft op de effectiviteit van anti-H.
pylori behandelingen. De meest voorgeschreven anti-H. pylori behandelingen in Nederland zijn de
tripel-behandelingen PAM (een combinatie van een protonpompremmer, amoxicilline en
metronidazol) en PAC (een combinatie van een protonpompremmer, amoxicilline en
clarithromycine). Hoofdstuk zes laat zien dat in Noord-Nederland de prevalentie van
metronidazol-resistentie siginificant daalde gedurende de periode 1996 - 2001. De prevalentie van
clarithromycine-resistentie fluctueerde gedurende deze periode, zonder dat er een trend
aantoonbaar was. Het was opvallend dat de dalende tendens in de prevalentie van metronidazol-
resistentie samen viel met een afname in het aantal voorschriften voor metronidazol in Nederland
(inclusief metronidazolvoorschriften voor andere aandoeningen dan H. pylori infectie).
Samengevat hadden beide tripel-behandelingen (PAM en PAC) een berekende effectiviteit van
> 80%. Het is aannemelijk dat de effectiviteit van de PAM-behandeling verder zal toenemen
indien de prevalentie van metronidazol-resistentie verder zal dalen. Daarentegen zal bij een
Sammenvatting en algemene conclusies
149
geringe toename van de prevalentie van clarithromycine-resistentie de effectiviteit van de PAC-
behandeling onder de 80% zakken.
Het tweede deel van dit proefschrift richt zich met name op genetische verschillen tussen
H. pylori stammen. Deze genetische verschillen worden mede verantwoordelijk gehouden voor de
verschillen in symptomen en ziektebeelden die veroorzaakt kunnen worden door een een H. pylori
infectie. Verschillende virulentiefactoren van H. pylori zijn aangetoond, zoals het vacA gen wat
codeert voor het vacuolating cytotoxine, het cagA gen wat verantwoordelijk is voor de produktie
van het CagA eiwit, en het iceA gen dat tot expressie komt na contact met maagepitheelcellen. In
hoofdstuk zeven hebben wij het verband tussen deze virulentiefactoren en de verschillende
ziektebeelden bestudeerd (peptisch ulcus, refluxziekte en maagslijmvliesontsteking). De resultaten
van deze studie lieten zien dat een groot gedeelte van de patiënten (meer dan 20%) geinfecteerd is
met meerdere H. pylori stammen. Patiënten met een peptisch ulcus bleken meestal geinfecteerd te
zijn door een H. pylori stam met het s1 vacA genotype of een stam dat het cagA gen bezat. Aan de
andere kant waren patiënten met refluxziekte meestal geinfecteerd met een H. pylori stam waarin
zowel het cagA als het iceA1 gen afwezig waren Deze bevinding ondersteunt de hypothese dat
virulente H. pylori stammen beschermen tegen het ontwikkelen van refluxziekte. Concluderend
kan gezegd worden dat virulentiefactoren van H. pylori inderdaad geassocieerd zijn met het
uiteindelijke ziektebeeld. Of deze virulentiefactoren ook gebruikt kunnen worden in de dagelijkse
klinische praktijk moet nog verder onderzocht worden. Een betrouwbare niet-invasieve methode
om de aanwezigheid van verschillende virulentiefactoren aan te tonen zou een nuttige aanvulling
zijn om de associatie tussen virulentiefactoren en ziektebeelden verder te bestuderen. Hoofdstuk
acht beschrijft de resultaten van een studie die de betrouwbaarheid van de CagA rapid test (Orion)
evalueerde. Deze test zou op betrouwbare wijze binnen tien minuten door middel van een
immuunchromatografische test de aanwezigheid van antilichamen tegen het CagA eiwit in
serummonsters kunnen detecteren. Wij hebben de CagA rapid test (Orion) vergeleken met een
surrogaat gouden standaard gebaseerd op een combinatie van een PCR op het cagA gen in
maagbiopten en de OroVax recombinant test, gebaseerd op het aantonen van antilichamen in
serum door middel van de ELISA techniek. De gouden standaard werd als positief beschouwd
indien zowel de cagA PCR als de OroVax recombinant test positief waren. Andere combinaties
werden als negatief beschouwd. Deze gouden standaard werd gekozen omdat het bekend is dat de
aanwezigheid van het cagA gen niet altijd betekent dat dit gen ook tot expressie komt. Zonder
150
expressie van het gen zal er ook geen immuunrespons op gang komen. Aan de andere kant kunnen
antilichamen tegen het CagA eiwit blijven circuleren ondanks een succesvol behandelde infectie.
Hierdoor kunnen de CagA rapid test (Orion) en de OroVax recombinant test positief blijven,
terwijl de cagA PCR negatief blijkt. In vergelijking met de surrogaat gouden standaard toonde de
CagA rapid test (Orion) een sensitiviteit en specificiteit van respectievelijk 96.8% en 95.4%. Als
laatste worden in hoofdstuk negen de resultaten gepresenteerd van een studie op negen biopten van
negen patiënten die een H. pylori infectie bleken te hebben met zowel metronidazol gevoelige als
resistente H. pylori bacteriën. De vraag was of deze patiënten geinfecteerd waren met twee
verschillende H. pylori stammen of dat ze geinfecteerd waren met één enkele H. pylori stam
waarvan een gedeelte resistent was geworden tegen metronidazol. De tweede stelling bleek waar te
zijn aangezien acht van de negen patiënten één enkele H. pylori stam bij zich droegen, waarvan
een gedeelte resistent was tegen metronidazol. De overgebleven patiënt bleek gekoloniseerd te zijn
met twee verschillende H. pylori stammen die beiden deels gevoelig en deels resistent waren tegen
metronidazol. Uitgaande van deze resultaten werd geconcludeerd dat de aanwezigheid van zowel
metronidazol gevoelige als resistente H. pylori fenotypen in één patiënt niet automatisch betekent
dat deze patiënt ook geinfecteerd is met twee verschillende H. pylori stammen waarvan er één
gevoelig is voor metronidazol en de andere resistent is voor metronidazol.
Algemene conclusies
De ontdekking van de belangrijke rol van H. pylori in verschillende aandoeningen van de
bovenste tractus digestivus heeft geleid tot nieuwe benaderingsmogelijkheden van de patiënt met
ongecompliceerde dyspepsie in de huisartspraktijk. Enkele auteurs hebben gesuggereerd dat een
benadering gebaseerd op screening voor H. pylori waarschijnlijk rationeler is dan de huidige
strategie bestaande uit een proefbehandeling met zuurremmers. Deze suggestie wordt ondersteund
door zowel analytische studies als door klinische studies, waaronder de SENSE studie die in dit
proefschrift wordt beschreven. Daarnaast blijkt uit de meeste studies dat een screeningsstrategie,
en met name de “test-and-treat” strategie, mogelijk meer kosten-effectief is. In tegenstelling tot de
meeste andere studies is de SENSE studie volledig in de eerste lijn uitgevoerd. Uit de SENSE
studie is gebleken dat een “test-and-treat” strategie veilig is, meer kosten-effectief is dan, en tot
een zelfde mate van reductie van symptomen leidt als een strategie waarbij alle patiënten direkt
voor een gastroduodenoscopie worden verwezen.
Sammenvatting en algemene conclusies
151
Het toepassen van een “test-and-treat” strategie in de huisartspraktijk is mogelijk aangezien er
betrouwbare, niet-invasieve testen beschikbaar zijn om een H. pylori infectie aan te tonen.
Daarnaast is gebleken dat gezien de huidige prevalenties van antibioticaresistentie in H. pylori een
behandeling met de meest voorgeschreven kuren (PAM en PAC tripel-kuren) in meer dan 80%
van de patiënten leidt tot eradicatie van H. pylori. Het controleren van de prevalentie van
antibioticaresistentie blijft echter noodzakelijk omdat slechts een kleine toename in de prevalentie
van clarithromycine-resistentie al leidt tot een aanzienlijke reductie van de effectiviteit van de
PAC behandeling.
De effectiviteit van iedere H. pylori screeningsstrategie voor de benadering van dyspepsie is
grotendeels afhankelijk van de prevalentie van H. pylori in de populatie. Bij een lage prevalentie
wordt de positief voorspellende waarde onacceptabel laag, waardoor een “test-and-treat” strategie
praktisch niet meer uitvoerbaar is. Daarnaast zullen andere aandoeningen relatief vaker de oorzaak
van de klachten worden indien de prevalentie van H. pylori infectie in dyspeptische patiënten daalt
(waaronder onder andere idiopathische peptische ulcera). Het mag evenwel gesteld worden dat de
huidige prevalentie van H. pylori infectie (>30% in de SENSE studie) een “test-and-treat” strategie
rechtvaardigt voor de benadering van patiënten met ongecompliceerde dyspepsie in de
huisartspraktijk. Deze strategie blijkt uitvoerbaar en is kosten-effectief. De prevalentie van
H. pylori infectie is echter sterk aan het dalen in de Westerse wereld en het is waarschijnlijk dat
een proefbehandeling met zuurremmers uiteindelijk kosten-effectiever wordt dan een “test-and-
treat” strategie. De kans op een H. pylori infectie is sterk afhankelijk van de leeftijd van de patiënt
en neemt toe naarmate de patiënt ouder is. Daarom is een proefbehandeling met zuurremmers voor
zeer jonge patiënten met dyspepsie waarschijnlijk al kosten-effectiever dan een “test-and-treat”
strategie.
Het ziektebeeld dat een H. pylori infectie veroorzaakt is afhankelijk van de virulentie van de H.
pylori stam. Gezien het feit dat virulente H. pylori stammen enerzijds geassocieerd zijn met
peptische ulcera, maar anderzijds mogelijk een beschermende rol spelen tegen refluxziekte, is het
onwaarschijnlijk dat niet-invasieve testen voor het aantonen van virulentiefactoren een
doorslaggevende rol zullen gaan spelen in de beslissing een patiënt wel of niet te behandelen. Als
laatste blijft het belangrijk te benadrukken dat direkte verwijzing voor gastroduodenoscopie de
enige goede benadering blijft voor dyspeptische patiënten die zich presenteren met
alarmsymptomen.
153
Dankwoord
Promo-veren zijn de veren van een ander waarmee een promovendus een dagje mag pronken.
Zo zou eigenlijk de omschrijving moeten luiden van het begrip “promoveren”. Hoewel ik erg trots
ben op het werkje dat hier nu voor u ligt besef ik mij terdege dat ik dit resultaat nooit bereikt zou
kunnen hebben zonder de inspanning van vele anderen.
Allereerst wil ik Jaap Thijs en Ton van Zwet bedanken. Vele jaren geleden hebben zij zich al
vastgebeten in Helicobacter pylori. Het onderzoek dat zij destijds verrichtten vormt nu de basis
voor alweer het derde proefschrift in de reeks Thijs, van Zwet & Helicobacter pylori. Jaap, jouw
heldere manier van redeneren en formuleren beschouw ik nog steeds als de “gouden standaard”.
Hoewel jouw nauwkeurige en perfectionistische instelling destijds niet altijd in dank werd
afgenomen, ben ik langzaam aan in gaan zien dat dit de enige correcte houding is om wetenschap
te beoefenen. Hopelijk kan ik deze standaard vasthouden. Ton, jij symboliseerde de “Yan”-helft
van de co-promotoren. Jouw enthousiasme en optimisme om nieuwe wegen in te slaan en jouw
vermogen om kogels door kerken te schieten en schepen achter ons te verbranden heeft ertoe
geleid dat we niet nog steeds met het eerste artikel bezig zijn, maar het uiteindelijk tot acht
artikelen hebben geschopt ! Hopelijk heb ik een deel van jouw optimisme en besluitvaardigheid
over kunnen nemen.
Tevens wil ik prof. Kleibeuker bedanken. Als na veel wikken en wegen in Hoogeveen besloten
werd dat een artikel gesubmit kon gaan worden was het altijd prettig dat u de laatste puntjes op de
i kon zetten. Ook op de momenten dat ik eindeloos met kleine details worstelde wist u mij weer de
grote lijnen te laten zien.
Prof. Degener, mijn andere promotor, wil ik ook graag bedanken. Hoewel het proefschrift met
name gebaseerd is op gastroenterologische aspecten van Helicobacter pylori en dyspepsie waren
uw adviezen vanuit de microbiologische hoek zeer waardevol.
Ook Albertine de Jong ben ik veel dank verschuldigd. Albertine, vooral in de eerste jaren van
mijn promotieonderzoek heb jij ontelbare Helicobacter kweken verricht en PCRs gedraaid. Nooit
was jij te beroerd om weer met een portie maagbiopten naar het Streeklaboratorium in Groningen
te reizen om ze vervolgens binnenste buiten te keren op zoek naar de Helicobactertjes. Langzaam
leek het Helicobacter pylori project ook de hele research afdeling van het Streeklaboratorium te
besmetten. Met name Mirjam Kooistra-Smid en Cees van Slochteren hebben meerdere steentjes
bijgedragen aan dit proefschrift, waarvoor mijn dank. Enkele analisten van de dependance van het
154
Streeklaboratorium in Hoogeveen wil ik ook graag met name noemen. Joseph Nanuru, Djoeke
Kelly, Marriëtte Borggreve en Corrie Borger hartelijk dank voor het zo nauwkeurig bijhouden en
bewaken van de Helicobacter pylori isolaten.
Verder wil ik Egbert-Jan van der Wouden bedanken. Tijdens de eerste twee jaar van mijn
promotie, waarbij wij op één kamer zaten, heb jij mij het nodige over Helicobacter geleerd.
Achteraf gezien ben ik ervan overtuigd dat het rendement van onze langdurige discussies over
Helicobacter daarna nooit meer overtroffen is door de vele uren zelfstudie. Ook Michiel Wulfelle
heeft een belangrijke bijdrage geleverd aan het plezierige gevoel dat ik krijg als ik aan de
“Hoogeveense” periode terug denk. Samen met Egbert-Jan hebben wij regelmatig in Hoogeveen
en Groningen de wetenschap, het darwinisme, de politiek, en andere onzin bediscussiëerd onder
het genot van een koud glas “Murphy's Red”. En dan heb ik het nog niet eens over de vele
“game”-uren waarin we tijdelijk andere organismen op de korrel namen.
Dank ben ik ook verschuldigd aan Ingrid Barkema, de secretaresse van Jaap Thijs. Jouw
vrolijke instelling en behulpzaamheid heeft onze samenwerking altijd erg plezierig gemaakt.
Daarnaast wil ik alle andere secretaresses van de Interne bedanken met name Joma Kaal, Janke
Warnders, Marike Kats en Ineke Zandvliet. Na enkele uren Helicobacter artikelen kauwen was het
altijd erg fijn om weer eens op een gewone boterham te kauwen en te horen dat er nog meer in het
leven is dan Helicobacter pylori.
De SENSE studie was nooit mogelijk geweest zonder de 56 huisartsen die bereid waren een
deel van hun tijd en patiënten te investeren in onze studie. Het moet erg moeilijk geweest zijn om
patiënten bereid te vinden mee te doen aan een studie waarbij zij kans hebben een maagonderzoek
te ondergaan. Desalniettemin is het uiteindelijk toch gelukt 291 patiënten in te sluiten. Hartelijk
dank voor deze enorme prestatie ! Ook de gastroenterologen Marco Oudkerk Pool en Jan Mark
Götz hebben een belangrijke bijdrage geleverd aan de SENSE studie. Daarnaast wisten zij mij
altijd weer een hart onder de riem te steken in tijden dat de inclusie moeizaam verliep.
Aventis Pharma, met name Martijn Gerretsen, wordt hartelijk bedankt voor de financiele
ondersteuning van het hele promotieonderzoek. Op een geheel vrijblijvende, maar altijd
geinteresseerde en behulpzame manier hebben zij het SENSE project vanaf de zijlijn begeleid.
Een persoon die zeker niet mag ontbreken in mijn dankwoord is Hans Kuster. Hans, jij hebt
een onmiskenbaar vermogen om andere mensen te enthousiasmeren en ik kan je vertellen dat het
effect niet alleen in Rotterdam waarneembaar is maar zelfs tot in Hoogeveen te voelen is.
155
Uiteraard moet ik eigenlijk mijn dank betuigen aan vrijwel de hele Amsterdamse en inmiddels
Rotterdamse Helicobacter pylori groep. Leo Smeets, het was aangenaam om samen met jou een
artikel te schrijven. Monique Gerrits en Raymond Pot, bedankt voor het verrichten van
ververschillende laboratorium bepalingen. Verder wil ik de vaste congres club (Arnoud van Vliet,
Ramon de Jonge, Nicolette de Vries en Jetta Bijlsma) bedanken voor de interessante discussies op
aangename locaties. Hopelijk kunnen we deze traditie in iedere geval voortzetten op de
voorjaarsvergaderingen van de NVMM.
Leen-Jan van Doorn wil ik bedanken voor de zeer plezierige en constructieve samenwerking
tijdens het schrijven van mijn eerste artikel. Zonder jouw relevante commentaren was het zeker
niet gelukt het artikel in zo'n goed blad gepubliceerd te krijgen. Wim Sluiter wil ik bedanken voor
de solide statistische analyse van het SENSE artikel. De beoordelingscommissie : prof. dr. E.J.
Kuipers, prof. dr. H.A. Verbrugh en prof. dr. J.B.M.J. Jansen wil ik bedanken voor hun bereidheid
mijn proefschrift te beoordelen.
Naast mensen die direkt betrokken zijn bij je dagelijkse werkzaamheden zijn andere mensen
minstens even belangrijk om je op af te reageren en “je batterij weer op te laden”. Constantijn,
Anneke, Robert, Evelien, Oscar, Annelies en Martin enorm bedankt voor jullie ondersteuning,
motivering en interesse gedurende al die jaren.
Tot slot wil ik mijn familie bedanken, mijn ouders, Marike, Wynand, Roel en Antoinette.
Door jullie wist ik mij steeds gesteund en jullie gaven mij goede raad als ik daarom vroeg.
Als allerlaatste, maar wel als meest belangrijke wil ik Charlie Kraan bedanken. Jij bent de
afgelopen jaren mijn steun en toeverlaat geweest in goede en slechte tijden en hopelijk wil jij dat
nog lange tijd blijven.
Bedankt !
Niek Arents
Arts-assistent Medische Microbiologie
Academisch Ziekenhuis Groningen
Postbus 30001
9700 RB Groningen
e-mail : n.l.a.arents@mmb.azg.nl
Recommended