View
2
Download
0
Category
Preview:
Citation preview
Machine Methods forIdentifying DNA Binding Sites
Mark Kon, Yue Fan, Dustin Holloway, and Charles DeLisi
OverviewI. TF binding
Goal:
Overview
We are developing tremendous amounts of biological and DNA sequence information.
Large numbers of genomic and proteomic projects are ongoing.
There is an of biological sequence data.EXPLOSION
We need to understand basics: how to determine if a string of DNA is functional?
And if functional, what is its function?
Code a protein? Act as a regulatory site (initiating transcription of genetic information)? Act as a break point during genetic recombination?
These are very High Dimensional Problems, and often a decision (classification) mustbe made.
Identification of transcription promoter motifsThe cellular process:
The transcription process: RNA Polymerase moves down DNA molecule creating RNA copy:
Identification of transcription promoter motifs
Initiation of this process:
Identification of transcription promoter motifs
Identification of transcription promoter motifsFigure: Biology of DNA transcription. CRM is cis-regulatory module, a molecular complexcan co-activate transcription once a TF arrives.
We are dealing with the first step - the start of transcription
1. The Problem:
1. Transcription factor (or a combination of them) attaches to DNA
Identification of transcription promoter motifsFig. 1: Portion of chromosome string with TF attached to promoter region; this pattern repeated approximately 1000 times per
chromosome
2. Signals RNA polymerase to start to copy DNA to RNA at a unique location nearby( ).transcription
Identification of transcription promoter motifs3. mRNA copy of DNA is transcribed and outside necleus to ribosome
4. tRNA (transfer RNA) matches amino acids to codons in mRNA. Each amino acid has owntRNA that binds only it.
Identification of transcription promoter motifs5. Ribosome carries out construction of the protein in the exact sequence coded by the RNA.
More succinctly:
DNA pre-mRNA mRNA proteinÄ Ä ÄTranscription Splicing Translation
Note: involves transformation oftranslation
Identification of transcription promoter motifsmRNA tRNA protein.Ä Ä
Human: µ 25,000 genes 25,000 proteins determination of cellular and body functionÄ Äand structure
Identification of transcription promoter motifs
Goal:
Develop statistical and math methods for identifying DNA locations where transcriptionis initiated through attachment of transcription factors (TFs).
Important biologically, expensive experimentally.
Use statistical learning methods to identify new binding sites from examples based on DNA sequences of experimentally known ones.
Identification of transcription promoter motifs
The problem:
Of the 25,000 human genes over all 23 chromosome pairs, find promoters and the locations on them which which ap3
specfic TF attaches to.>
The mechanism of TF-gene binding is hard to solve chemically, because of itsì complexity;
Means for explicitly solving bindings (fig. 1) computationally still far offì
Identification of transcription promoter motifs
Left: DNA binding of GCM; right: binding of Fur (C. Ehmke, E. Pohl, EMBL, 2005)
Identification of transcription promoter motifs
Stanford University
Typical binding modes
basic uncertainty principle trades off between gene-TF identification accuracies vs.ì throughputs.
Identification of transcription promoter motifsMore Detail: Promoters
is a region of DNA which attracts RNA polymerase for the initiation of1. Promoter transcription.
Promoter region of DNA contains 2. regulatory sequences which attract transcription factors (TF's)
3. Regulatory sequences consist of inexactly repeating patterns (motifs).
Motifs are very similar across species - they attract specific transcription factors.4.
Identification of transcription promoter motifs
Regulatory sequences
Goals:
Identification of transcription promoter motifs Decrease cost and increase speed of TF-gene binding and binding site identification.è
Extend methodologies to other bioinformatic areasè
ì (Modeling) How should an integrated mathematical model of TF-gene interactionslook?
We are extending toolboxes for gene-TF information, focusing on information integration.
ì (Applications) How can such a model be used biologically to improve knowledge ofsystems and pathways?
ì (Ergonomics) How to allow biologists to use such inferences?
Implications:
Gene-TF associations studied here can integrate information on biochemical pathways
Identification of transcription promoter motifs using machine learning methods
Protocol for organized replacement of experimental methods with mathematical and statistical ones.
2. Approach
Problem: find a pattern occuring in vectors in a high-dimensional space W
Here
W œ space of sequencesDNARNA
Protein
Ú ÞÛ ßÜ à
Introduction
Initial goal: discover a pattern-sensitive map
0 À W Ä œ ‘where:
œ Ö"ß "×
‘ œ real numbers
Ex: For fixed transcription factor (TF) :>
Given gene , let1
p œ œpromoter sequence of gene ...acttact...
Introduction
extrapolate
0Ð=Ñ œ" 1 >œ if binds
1 otherwise ;
from examples to determine which genes are targets of .1 >
Or: we may want to extrapolate unknown defined by0
Introduction
0Ð Ñ œp location of binding sites
(Binding sites occur as motifs of length 10 bases)µ
Such information traditionally experimental.
Can also be a classical learning problem -
Information about :0
Data = H œ Ö=3 3 3œ"8ß C ×
where
Introduction
p3 3œ 1promoter sequence of gene
C œ " 1 >3
3œ if binds with 1 if not
Extrapolate
0Ð Ñ À W Ä Þp
We seek new learning methods for such gene classification and transcription factorbinding site (TFBS) identification.
Thus problem is:
1. Given fixed TF and experimentally known gene set which it targets (i.e., to whose> Ö1 ×3 3
promoters it attaches).:3
Introduction
Can we extrapolate (e.g., through learning or Gibbs sampling) to computationally find newtargets ?1
2. Given a known set of target genes , can we determine the onÖ1 ×3 3 binding sitespromoters ? Typically -mers ( -strings) with little variation, known as .: "! "!3 motifs
Here we consider problem 2
For a given TF , our goal here is to find genes it binds and its binding site motifs.>
Equivalently: pGiven a known gene set with promoter sequences known to bindÖ1 × Ö ×3 3 3 3
>, what is an set of 10-mers (DNA subsequences of length 10) in the setoverrepresentedÖ ×p3 ?
Rationale: promoters generally have multiple copies of a motif if the are functional.
Introduction
This 'overrepresented set' of 10-mers should contain of .binding motif >
Introduction
Introduction
Position weight matrix (PWM):
Position number
EGK áX
Ô ×Ö ÙÖ ÙÕ Ø
0 0 0.1 0 0.6 .8 0.3 .2 1
represent preferred binding motif for .>
Introduction
Typical test data: often more than 1 motif per sequence:
J. Liu
Q: How to find overrepresented 10-mers?
Introduction
Current algorithms
ì Largely optimization, taking genes known to bind specific TF, and identifying DNA subsequences (sequential typically of length 5 to 15)strings of base pairs overrepresented in gene promoters.
ì Typically use Gibbs sampling, with objective of maximal alignment of sequences in known binding genes.
ì Machine learning methods for this are new
These include: both types of TF problems described above (identifying genes and gene locations)
Have capacity for processing high dimensional information-
Introduction
Introduction
We consider: Support Vector Machine (SVM)è Random forests (RF)è SVM Ensembles (SVME)è
All based on maps into feature spaces.
Plan: head-to-head comparison of substring-based kernel methods with standard motifalgorithms.
BioProspectorì AlignACEì MDSCANì
Claim: SVME and RF can find subtle motifs (binding DNA patterns) in humans(challenging task).
Introduction
Important aspect of both Gibbs and learning methods: ranking of promotersubstrings by statistical correlation with genes whose promoters bind to given TF .>
Introduction
Gibbs Sampling:
Optimally align all which bind (previous diagram).p3 >
i.e., score alignments of all (split) 12-mers (in this case) and find alignment with highestp 3score with Gibbs sampling and simulated annealing [Lawrence, Liu, 1993].
Typical pre-alignment:
Learning appoaches
3. Learning approaches
Important advantage of learning methods for TF binding site location:
Can use negative examples as well as positive examples, i.e., promoters which do and do not bind .>
Machine learning approach:
In species for fixed , obtain set of gene promotersf >
p p" 8ßá ß
likely to bind (experimental information, etc.). Note for gene we have promoter> 13
p p3 3œ Ð1 Ñ
is the promoter sequence of gene .13
Learning appoaches
In addition, find negatives, i.e., promoters to which probably does p p8" 87ßá ß > not bind.
Use as for extrapolatinglearning examples
0 À Ä œ Ö"ß "×P
on the space of promoters withP p
0Ð Ñ œ" >
p pœ if binds 1 otherwise .
Key in learning methods:
Feature map from genes into feaures feature spaceF 1 − J œ Àx
F FÐ1Ñ œ Ð Ð1ÑÑ œ − Jp x
Learning appoaches
gives relevant information now any learning algorithm can bex œ Ð1ÑF applied.
Feature space and learning methods now common in computational biology:
ì protein analysis [Leslie, et al.]ì TF binding prediction [Holloway, Kon, et al.]ì Motif finding [Vert, et al.].
Dogma of learning approaches for TF binding:
1. xChoose good feature space with features J Ð1Ñ œ ÐB ßá ß B Ñ" 6
depending on promoter of gene 1Þ
2. Re-define desired output
Learning appoaches
0Ð1Ñ Ä 0Ð Ð1ÑÑ œ 0Ðx x)
so it is defined on J
3. Learn from training data0
H œ ÖÐ ß C Ñ× Þx3 3 3
How to learn 0 À J Ä
0Ð Ñ œ" 1"
x xœ if corresponding to is a targetotherwise
from examples?
Note without feature space, would map promoter to , so0 C −p
0 Ä ß: T 1!!!
Learning appoaches
where .T œ ÖEßKßGß X×
Remark: The structure is wrong on this space; difficult to guess from examples 0 W(telephone directory problem).
String map
4. The string feature map
Given list
string AAAAAAstring AAAAACstring AAAAAGstring AAAAATstring AAAACA
1
2
3
4
5ã ã
String map
of strings of 6 base pairs. Recall is the space of promoter DNA sequences.P
Consider feature map with , with componentsx P x p xÀ Ä J , Ð Ñ œ − J
B œ =3 3# appearances of string in promoter .p
Then has 4,096 components x − J % œ Ê J œ Þ6 4,096‘
Transferring from to ; now0 œ Ð Ñp x x p
0 À J Ä Þ
Thus: maps sequence of string counts in to yes/no in .0 Jx U
With data set
String map
H œ Ö ß C ×x3 3 ,
seek function which generalizes .0 À J Ä H
Easier: find , where0 À J Ä ‘
0Ð Ñ ! 0 Ð Ñ œ "à 0Ð Ñ ! 0 Ð Ñ œ "Þx x x x if if " "
SVM approach5. SVM approach
Assume SVM kernel (similarity measure) for string feature vectors OÐ ß Ñ ß − Jx y x y
Seek
0 À J Ä ‘
with which predicts binding to gene with 0 œ 0Ð Ñ 1 œ Ð1ÑÞx x x
0 ! 0 ! L À 0 œ ! J and cases separated by hyperplane in :
SVM approach
Geometry of encoded in (nonlinear dot product).J OÐ ß Ñ œ †x y x y
Obtain
0Ð Ñ œ OÐ ß Ñ ,x x x"3
3 3! .
For linear dot product OÐ ß Ñ œ † Àx y x y
0Ð Ñ œ † , † ,Þx x x w x"3
3 3! ´
Prior SVM work6. Prior SVM gene classification work
Spectrum (string) kernels - Vert, Noble, et al.:
J œ 5 5 5 œ &feature space of -mer ( -string) counts ( ).
FspectÐ Ñ œ %x vector of length &
with position count of the -mer.3 Ð Ñ œ 3 5>2 >23F x
Conservation information: their feature vectors take phylogenetic conservation (stringconservation across species) into account.
Specifically: given promoter , consider alignmentp − T8 in S. cerevisiaec − œ 8a bT& 8 aligned array of five (matching) promoter regions of length from 5 relatedyeast species.
Prior SVM workHave 'marginalized' feature map
F Fmarg spect3 3Ð Ñ œ Ðc h h c h"
hhÑ:Ð l Ñ œ I Ð ÑŠ ‹Fspect
3
œ expected value of the spectrum kernel over possible common anscestoral sequences of the set.h
Probability distribution of h c conditioned on obtained with phylogenetic model from[Tsuda].
Effect: reinforces -mers consistent across related species (more likely 5 to be functional);
More direct way: first determine vector which labels every site of promoter byd pÐ1Ñ Ð1Ñwhether it is likely functional or not based on conservation among species.
Prior SVM workSpecifically
. Ð1Ñ œ" 3
3 œ if site is conserved among 5 yeast species0 otherwise .
Discretizing above leaves room for errors, but resulting noise reduction is useful.
Now [Vert] replace spectrum -mer) kernel by the 'relevant' kernel corresponding toÐ5feature map
Frel3 Ð ß Ñ œ 5 3h d count of 'relevant' occurrences of -mer
œ # occurrences at sites all of whose locations are relevant.
for any string .h
SVM Classifiers7. SVM-based classifiers for targets of >
Before we locate motifs, we will classify genes (wrt binding/nonbinding by ).>
Given fixed TF :>
0 À ÄX ‘
x xœ Ð1Ñ œ 1feature vector of gene
x − J œ feature space
SVM ClassifiersC œ " C œ " L À 0Ð Ñ œ ! À and cases separated by a hyperplane x
Recall for linear ,OÐ ß Ñ œ †x y x y
0Ð Ñ œ † , œ Þ ! C œ " ! C œ "
x w x œ if if
SVM Classifiers Procedure:
1. Train SVM
H œ ÖÐ ß Ñ×x y3 3 3œ"87
[use positive , negative ].8 7x x3 3
2. Find optimal w x0 œ † ,
0 1 > predicts new genes which are targets of
SVM classifier applications
Ex: Human TF WP1:
From 14 known positive genes have extrapolated much larger number of potential newtargets for investigation, and have some new implications for pathways.New high reliability targets of the WT1 are genes
RNH1 IGF2AS CD151, ,
Relation to Wilms' tumor:
WT1 involved in Wilms' Tumor (8% childhood cancers).
Genes in significant loci include oncogenes and tumor suppressors -- candidates forinvolvement in cancer progression
May explain some observed clinical and biochemical data.
SVM classifier applications
Example: chromosomal region 11p15.5 (known in Wilms' Tumor)New targets for WT1 ( ) here are tumor suppressors: Ÿ Þ!!&RNH1 IGF2AS CD151, , and .
Other regions involved in Wilms' Tumor have new target predictions:
16q, 1p36.3, 16p13.3, 17q25, and 4p16.3.
Potential binding sites can be extracted using standard motif finding algorithms (e.g.,Weeder)
SVM classifier applications
SVM classifier applications
Example: Human TF Oct4 - new target predictions fit into WNT pathway:
Example: Yeast TF's:
SVM classifier applications
Finding binding motifs
8. Finding binding site motifs
Feature space string counts:J œ
FÐ Ñ œ œ
BãBãBãB
EEEEEE
EXKGXK
KGGKXE
XXXXXX
p x
Ô ×Ö ÙÖ ÙÖ ÙÖ ÙÖ ÙÖ ÙÖ ÙÖ ÙÕ Ø
"
3
4
;
count of -mer B œ ' 33
Finding binding motifs
Better choice:
B œ ' 33 count of -mer weighted by conservation
i.e., 6-mer is weighted by which determines level of conservation of averageQ - − Ò!ß "Óposition in in closely related species.Q
How to find binding sites?
Which 6-mers best differentiate and ?B 3
0Ð Ñ œ † ,x w x
Finding binding motifs
w œ C ! C !optimized gradient vector between and cases
Finding binding motifs
Use
w œ œ f0Þ
AAãA
Ô ×Ö ÙÖ ÙÕ Ø
"
#
.
Largest components give primary direction of gradient; these are -mers which best ' differentiate and .C ! C !
Use SVM-RFE (recursive feature elimination) to iteratively reduce w to most important. Typically cut number of features each time and re-calculate recursively.w
For yeast: approx. 50-300 positive examples per gene.
Sample selection repeated 20 times with different choices of negatives (genes with high : values in yeast ChIP-chip experiments) out of 600 available.
Finding binding motifs
In each SVM run numbers of positives and negatives are equal.
Reduce from 4000 to 150 to 50 features .µ B3
1. a c t g t g 2. g t ca c t 3. t g a c t a
Best clustering:
a c t g t g
g t c a c tt g a c t a
Finding binding motifs
Now: 'unrelated' 6-mer:
t c t t t a
Ä start new cluster.
Result: Typically obtain 4 significant clusters, each with a probability weight materixµ(PWM) representing probabilitity distribution of bases in each cluster position.
Finding binding motifs
G. D. Stormo, DNA Binding Sites: Representation and Discovery
Bioinformatics 16 16-23,2000
Formation of PWM
Finding binding motifs
Clusters scored using combination of
entropy scores = how atypical the string is and
hitting scores = counts of above-threshold matches to PWM along candidate promoter .p3
Precisely hitting ratio score for a PWM is defined as
HR# hits on positive genes# hits on negative genes
œ
in a pair of positive and negative gene samples of same size.
Finding binding motifs
Clustering algorithm: Assume is current set of clustersG
Initial step: { , , } string -mer) set to be aligned, ordered by weight in W œ = = á ß = œ Ð5 Þ" # 8 wG œ ÞemptyStep 0: Form a new cluster from . Delete from .= = W" "
Step 1: If empty, then quit. Otherwise, pick out the string with the highest weight.W œ B − WStep : Compute the scores of the string from Step 1 w.r.t. each of the current clusters in . If2 B Gthe highest score is greater than the addition threshold (threshold1 in the code), go to step 3(addition step). If the highest score is less than the new cluster threshold (threshold2 in the code),go to . Otherwise, go to step step4 5Step (addition step): Add string into the cluster producing the highest score, and delete from3 B BW W œ W I. Let . Go to .step 3'Step 3' (deletion step): Examine each element in the cluster being updated in step 3 by computingthe score of this element w.r.t. the PWM of this cluster. If the score is smaller than the deletingthreshold, move this string back into .WStep : Form a new cluster in from string , and delete string from . Let . Go to4 G B B W W œ W Istep 1.Step : Move string into the Exceptional set . Go to step 1.5 B I
Clustering algorithm
Finding binding motifs
Overall strategy:
Finding binding motifs
Typical results for 4 TF's:
Name #pos YeastGenome (Transfac) BioProspector SVM
YBR049C 186CGGGTRR AAGAAGARGTTACCCG TACCCGG CYTCTTCTT
GG C
YDL020C 134 GGTG
CGGGTAA
CGGGTAA
GCAAAGGCGGGTAA CC GGTTTCCCCG TSGCCACCSGGTTTCCCCG AAGAAGAGG
YDL056W 207 ACGCGTTACATA AR YTGCGACT GYYTTCTTSGGTTGG SAAGAARRC
YDL10
GGTGGCR
ACGCGT
6C 69 SGTGCGSYGYG ATCCTCGAGTT CSCCACGTGGGGACTCACAATC CCGCTGCAGCGGCACTTACAAC CCCGGG
Table: A sample of yeast transcription factors analyzed. # pos is number of positive examples for TF. Selected motifs to the right are in order of priority.
Finding binding motifs
Example: Results in yeast -
BioProspector SVMTop 1 to 3 1 1 to 3
Ungapped (34) 15 16 16 24Gapped (10) 4 5 3 5
Table: Motif performance on YeastGenome TF's (Transfac + random) betweenBioProspector and SVM.
'Top' # hits of top motif PWM in yeastgenomeœ '1 to 3' hits in top 3 PWMœ
Remark: We note there are cross-validated multiple clusters (motifs) correlated with agiven TF .>
Finding binding motifs
Biological interpretation: Note there is only one motif (with small variations) per TF.
Additional motifs must represent targets of other TF's in the same gene 'transcriptionmodule', i.e., cascade of TF activations and resulting new TF productions.
Thus a multiple set of TF's involved in a single transcription module. Genes in this> ßá ß >" <
module are activated in a coordinated way by the TF's.
Result: Confounding of motif finding - positive genes often share more than one TF.
Random forests
9. Random Forests
Random forests
Portraits of Statisticians
Same learning approach - use feature space
string count space.J œ
Again high-dimensional (around 4,000 dimensions if use 4-, 5-, and 6-mer counts withJpruning).
Note: It is not necessary or useful to use -mers Some just all 5 Þ confound the counts, e.g., simple but highly repetetive -mers 5 such as . Thus pruning of -mers is appropriate.EEEEEE 5
Best to remove these initially.
Random forests
Have:
J ® œ Þ
BBãB
xÔ ×Ö ÙÖ ÙÕ Ø
"
#
.
Goal: again find significant features differentiating and examples.B 3
Strategy: As usual - first form a classifier which predicts and ; then find what variables (strings) it actually uses and make the largest difference.
Such strings are motif candidates.
Here: form decision trees to form a random forest:5 ¸ .È
Random forests
Forest consists of decision trees .X ßá ß X" 5
Train trees on bootstrap samples from the dataset
H œ Ö ß C ×x3 3 3
Then provide new feature vector .x
Random forests
Classification
0 Ð Ñ ¸ C −" x
determined by a vote of the trees (bagging classifier).5
Advantages: accurate, easy to use (Breiman software), fast, robust
Disadvantages: difficult to interpret
How to combine results?
RF is a bagging algorithm: Take a vote of trees: majority rules
Random forests
General features:
If original feature vector has features , forming feature space x − . E ßá ßE J À‘." .
♦ Random selection of features made from all features , , ;7 ¸ . ÖE × E E ßá EÈ3 " # .4œ"
74
the associated feature space is .J ß " Ÿ 5 Ÿ O5
(Often # trees is large; e.g., O œ O œ &!!ÑÞ
♦ For each split in a tree based on a given variable, choose the variable by informationcontent, e.g.,
RF: information content
Information content for the above node R À
MÐRÑ œ lWlLÐWÑ lW lLÐW Ñ lW lLÐW ÑßP P V V
where
lWl œ lW l œ PßV Winput sample size; size of subclasses of PßV
LÐWÑ œ W œ : :Shannon entropy of "3œ„"
3 # 3log
with
: œ TÐG lWÑ œ G Ws3 3 3proportion of class in sample .
[can also split according to , another criterion]Gini index
Thus "variablity" or "lack of full information" in the probabilities .LÐWÑ œ :3
RF: information content
MÐRÑ œ R Þ"information from node "
For each variable , average over all splits in all trees involving this variable to findE3
average information content ; use this to determine value of .L ÐWÑ Eav 3
(a) Rank all variables according to information contentE3
RF: information content
(b) For each use only the first variables. Select which minimizes error:8 8 8 8" " "
Geurts, et al.
RF: importance scores
Now use cross-validation to independently determine importances of variables:
Use RF variable importance score:
Each tree has 1/3 variables left 'out of bag' (i.e., unused in X3
bootstrap training sample).
Use out of bag variables (different group for each tree) to test variable importance independently:
Add noise to each variable and check decrement in classification accuracy.
The 'cross-validation' aspect of this sampling gives much better accuarcy:
RF: importance scores
Table - motif recognition for 26 Transfac motifs in MacIsaac database
Top 1 Top 3RF 13 14BioProspector 11 13
Total: 26 TF's Data: K. MacIsaac, T. Wang, D. B. Gordon, D. Gifford, G. Stormo, and E. Fraenkel, "An improved map of conserved regulatory sites for Saccharomyces erevisiae," BMC Bioinformatics, 2006
SVM Ensembles10. SVM Ensemble (SVME) - a new bagging algorithm
Ensemble (forest) of SVM - same bagging principle and variable imporance sampling principles.
Performance: Similar to RF but with differing strengths in different sample elements.
Thus complementation of RF by SVME can be useful. Here on same 26 TF's:
Top 1 Top 3RF 13 14SVME 10 15SVME - Poisson Normalization 15 16BioProspector 11 13
Poisson normalization in addition to SVME works best.
SVM Ensembles Poisson normalization: normalize -mer counts to lie between 05 B3
and 1 by composing with cumulative distribution function of Poisson distribution.
Based on Premise: There will be more uniform variation (in fact close to a uniform distribution) on [0 for the normalized -ß "Ó 5 mer counts, assuming original counts are Poisson.
Further work11. Further TF-gene binding work
As mentioned, functional components of DNA (e.g., TF binding sites) are conservedamong closely related species. Combination of conservation information into machinelearning methods is planned.
Plan also to include physical chemistry information on the promoters, including numbersfor promoter twisting, curvature, and melting temperature, all of which are correlated withmotif locations.
Further workReference:
Portraits of Statisticians: http://www.york.ac.uk/depts/maths/histstat/people/welcome.htm
Recommended