View
4
Download
0
Category
Preview:
Citation preview
I
Effect of Knockdown of Genes Involved in the RNAi
Pathway on Root-knot Nematodes
This thesis is presented to Murdoch University for the degree of
Doctor of Philosophy
By
Sadia Iqbal
M.Sc (Hons.)
Western Australian State Agriculture Biotechnology Centre
School of Veterinary and Life Sciences
Murdoch University
Perth, Western Australia
2015
I
Declaration
I declare that this thesis is my own account of my research and contains as its main content,
work which has not been previously submitted for a degree at any tertiary educational
institution.
_____________
Sadia Iqbal
II
Abstract
Plant parasitic nematodes are economically important crop pests: of these root-knot nematodes
(Meloidogyne spp.) have the widest host range and are recognised as the most significant
nematode pests of crop plants worldwide. Current control methods have serious limitations:
natural resistance genes, chemicals and cultural practices are often not effective or are too
expensive for large scale application. An alternative control strategy chosen here was to target
and silence a conserved mechanism (RNA interference – RNAi) in the nematodes via transgenic
plants. The RNAi pathway itself was studied for its potential to provide new gene targets for
nematode control, with potentially wider applications to control of other plant nematodes.
In this study the overall aim was to undertake in silico identification of genes and ‘effectors’ of
the RNAi pathway of root-knot nematodes, to use RNAi to silence some of these target genes,
and to determine the effects on their parasitic success after both in vitro and in planta RNAi
treatments. Twenty-seven genes were identified in the RNAi pathways of M. incognita, and
selected for further study. In vitro RNAi experiments (‘soaking’ of J2 nematodes in dsRNA
homologous to the target gene) to down-regulate expression of the 27 selected genes caused
significant effects on the infectivity and development of the nematodes when they were used to
infect susceptible tomato plants. Up to a 90% reduction in infection was observed for dcr-1
targeted nematodes. Down-regulation of effectors of the miRNA pathway (drsh-1, pash-1, alg-
1, xpo-1, xpo-2) and dicer complex (drh-1, drh-3) had the greatest effect on nematode viability
and/or development.
Seven of the cloned genes (dcr-1, drh-3, vig-1, mut-7, drsh-1, pash-1, rha-1) were chosen after
in vitro screening for in planta analysis, and hairpin constructs for each were successfully
transformed into A. thaliana plants. Challenge of the heterozygous T2 transgenic plants with M.
incognita J2s exhibited significant reductions in infection parameters: 31 transgenic events of
the 7 genes showed a reduction of infection of 50% or more when compared with controls, and
the greatest reduction was 89%, for plants targeting drsh-1of M. incognita.
Another in vitro RNAi experiment targeting 7 different regions of the same gene, dcr-1, was
conducted to evaluate gene silencing in relation to different regions of the same target. The
results showed that there was variable target expression and RNAi effects depending on the
target region used, with higher impact for sequences near the 5′ end of the targeted transcript.
Targeting dcr-1 resulted in reduced nematode infection and reproduction: abnormal nematode
development was also observed.
III
This project provides new information on genes involved in small RNA pathways of M.
incognita, resulting in identification of novel targets for its control by gene silencing
technology. It also provides additional data to improve design of more effective RNAi triggers
related to the target region chosen. The in planta RNAi results generated provide further
evidence of the potential of RNAi as a nematode control strategy based on results using the
model plant A. thaliana: it is likely that these results are translatable to protect crop plants from
nematode attack in the future.
IV
List of Conferences and Publications
Stephen J. Wylie, Chao Zhang, Vicki Long, Marilyn J. Roossinck, Koh S-H, Michael G.K.
Jones, Sadia Iqbal, Hua Li. 2015. Differential responses to virus challenge of laboratory and
wild accessions of Australian species of Nicotiana, and comparative analysis of RDR1 gene
sequences. PloS one, 10(3), e0121787
Sadia Iqbal, John Fosu-Nyarko and Michael G.K. Jones. 2015. Genomes of parasitic
nematodes (Meloidogyne hapla, Meloidogyne incognita, Ascaris suum and Brugia malayi) have
a reduced complement of small RNA interference pathway genes: knockdown of some reduces
host infectivity of M. incognita. Submitted in Functional & Integrative Genomics.
Sadia Iqbal, John Fosu-Nyarko and Michael G.K. Jones. 2012. Silencing the effectors of RNA
silencing. 31st International Symposium of the European society of nematologists. Adana,
Turkey.
Sadia Iqbal, John Fosu-Nyarko and Michael G. K. Jones. 2012. Silencing the effectors of RNA
silencing. Combined Biological Sciences Meeting. Perth, Western Australia.
Sadia Iqbal, John Fosu-Nyarko and Michael G. K. Jones. 2015. RNA silencing of RNAi
effectors reduces root-knot nematode infection. Australasian Plant Pathology Society
Conference. Perth, WA.
V
VI
Table of Contents
Declaration ..................................................................................................................................... I
Abstract ......................................................................................................................................... II
List of Conferences and Publications .......................................................................................... IV
Table of Contents ........................................................................................................................ VI
Abbreviations ................................................................................................................................ X
Acknowledgement ..................................................................................................................... XII
Chapter 1 Literature review .......................................................................................................1
1.1 Introduction to nematodes ........................................................................................................2
1.1.1 Plant parasitic nematodes (PPNs) ..................................................................................3
1.1.2 Root-knot nematodes (RKNs) ........................................................................................4
1.1.3 Life cycle of RKNs ........................................................................................................5
1.1.4 Methods of PPN control .................................................................................................8
1.2 RNAi or gene silencing ..........................................................................................................10
1.2.1 RNAi mechanism .........................................................................................................12
1.3 Components of siRNA and miRNA pathways of eukaryotes ................................................15
1.3.1 Transport proteins ........................................................................................................15
1.3.2 Dicer complex ..............................................................................................................16
1.3.3 RNA-induced silencing complex (RISC) ....................................................................17
1.3.4 RNAi amplification machinery ....................................................................................19
1.3.5 RNAi inhibitors ............................................................................................................19
1.3.6 Nuclear RNAi ..............................................................................................................20
1.3.7 Argonautes ...................................................................................................................22
1.4 Applications of RNAi ............................................................................................................25
1.4.1 Development of in vitro RNAi in nematodes ..............................................................26
1.4.2 In vitro RNAi of PPN genes ........................................................................................27
VII
1.4.3 Application of virus-induced gene silencing to PPN research .....................................29
1.4.4 The potential for PPN control using RNAi ..................................................................30
1.5 Aims and objectives of this project ........................................................................................33
Chapter 2: Genome level identification and comparison of effectors of RNAi pathway of
the parasitic nematodes Meloidogyne hapla, Meloidogyne incognita, Ascaris suum and
Brugia malayi. .............................................................................................................................36
2.1 Abstract ..................................................................................................................................37
2.2 Introduction ............................................................................................................................37
2.3 Materials and methods ...........................................................................................................38
2.3.1 Identification of effectors of RNAi of C. elegans .........................................................38
2.3.2 Identification of genomic contigs of parasitic nematodes mapped to RNAi effectors of
C. elegans. ..............................................................................................................................39
2.3.3 In silico functional analysis of putative effectors of the parasitic nematodes ...............39
2.3.4 Phylogenetic analyses ...................................................................................................40
2.4 Results ....................................................................................................................................40
2.4.1 Genomic contigs and ESTs of M. incognita, M. hapla, A. suum and B. malayi with
homologies to effectors of C. elegans.....................................................................................40
2.4.2 Small RNA transport proteins .......................................................................................41
2.4.3 The Dicer and associated genes ....................................................................................43
2.4.4 RNA-induced silencing complex (RISC)......................................................................45
2.4.5 RNAi amplification .......................................................................................................46
2.4.6 RNAi inhibitors .............................................................................................................47
2.4.7 Nuclear RNAi effectors ................................................................................................50
2.4.8 Argonautes ....................................................................................................................50
2.5 Discussion ..............................................................................................................................52
Chapter 3: Identification of target genes from among sRNA pathway effectors of M.
incognita for nematode control via in vitro RNAi ...................................................................57
3.1 Abstract ..................................................................................................................................58
3.2 Introduction ............................................................................................................................59
3.3 Materials and methods ...........................................................................................................60
VIII
3.3.1 Primer design ...............................................................................................................60
3.3.2 RNA extraction ............................................................................................................61
3.3.3 Amplification of target genes .......................................................................................62
3.3.4 Cloning of amplicons into RNAi vector ......................................................................62
3.3.5 Confirmation of sequences cloned into vectors ...........................................................64
3.3.6 Synthesis of dsRNA .....................................................................................................64
3.3.7 In vitro feeding of dsRNA to nematodes .....................................................................64
3.3.8 Observation of RNAi phenotypes ................................................................................65
3.3.9 Assessment of nematode infectivity and development ................................................65
3.3.10 Gene expression of target genes .................................................................................66
3.3.11 Statistical analysis ......................................................................................................66
3.4 Results ....................................................................................................................................66
3.4.1 Phenotypic effects of in vitro RNAi of target genes ....................................................66
3.4.2 RNAi of target genes of nematodes reduces host infection .........................................69
3.4.3 RNAi effects on nematode development .....................................................................72
3.4.4 Transcript abundance after in vitro feeding .................................................................75
3.5 Discussion ..............................................................................................................................77
Chapter 4: Host-induced gene silencing of RNAi effectors confers resistance against
Meloidogyne incognita and affects development......................................................................81
4.1 Abstract ..................................................................................................................................82
4.2 Introduction ............................................................................................................................82
4.3 Materials and methods ...........................................................................................................83
4.3.1 Cloning of hairpin expression cassettes ........................................................................83
4.3.2 Cloning into the binary vector pART27........................................................................85
4.3.3 Agrobacterium tumefaciens transformation ..................................................................86
4.3.4 Plant transformation ......................................................................................................86
4.3.5 Screening for Transgenic (T1) plants:...........................................................................87
4.3.6 Screening and challenge of T2 plants ...........................................................................88
4.3.7 Nematode collection for infection .................................................................................88
IX
4.3.8 Nematode infection of transgenic plants .......................................................................88
4.3.9 Nematode development after infection .........................................................................89
4.3.10 Statistical analyses ......................................................................................................89
4.3.11 Confirmation of T-DNA insertion ..............................................................................89
4.3.12 Confirmation of transcription of nematode silencing signals .....................................90
4.4 Results ....................................................................................................................................90
4.4.1 Analysis of transgenic plants .......................................................................................90
4.4.2 Analysis of nematode infection ....................................................................................92
4.4.3 Female morphology .....................................................................................................95
4.4.4 T-DNA insertion and dsRNA transcription .................................................................96
4.5 Discussion ..............................................................................................................................97
Chapter 5: The effects of RNAi treaments with different regions of the Dicer-like gene on
the viability, parasitism and reproduction of M. incognita ..................................................100
5.1 Abstract ................................................................................................................................101
5.2 Introduction ..........................................................................................................................101
5.3 Materials and Methods .........................................................................................................102
5.3.1 Sequence analysis and Primer design ........................................................................102
5.3.2 Cloning and synthesis of dsRNAs .............................................................................103
5.3.3 In situ hybridisation ...................................................................................................103
5.3.4 dsRNA soaking ..........................................................................................................104
5.3.5 Phenotype, RNA extraction and plant infection ........................................................104
5.3.6 Analysis of infection ..................................................................................................105
5.3.7 Quantification of gene knockdown ............................................................................105
5.3.8 Statistical analysis ......................................................................................................106
5.4 Results ..................................................................................................................................107
5.4.1 Expression pattern of dcr-1 in J2 M. incognita ..........................................................107
5.4.2 RNAi phenotype for dcr-1 domains ...........................................................................107
5.4.3 Nematode infection after dcr-1 RNAi and targeted region ........................................108
5.4.4 Differential effects of target region on reproduction .................................................109
X
5.4.5 Nematode development is affected by treatment with dcr-1 RNAi ...........................110
5.4.6 Target quantification ..................................................................................................111
5.4.7 RNAi of dcr-1 affects other RNAi effectors ..............................................................112
5.4.8 Target and trigger properties affecting RNAi efficiency ...........................................114
5.5 Discussion ............................................................................................................................115
Chapter 6: General Discussion ...............................................................................................117
6.1 Overview ..............................................................................................................................118
6.2 Effectors of small RNA pathways of RKN ..........................................................................119
6.3 In vitro RNAi as a functional analysis tool for parasitic nematodes ....................................120
6.4 HIGS for RKN control .........................................................................................................121
6.5 The target region of a gene affects RNAi effectiveness ......................................................122
6.6 Future directions ..................................................................................................................123
6.7 Conclusions ..........................................................................................................................124
APPENDIX ................................................................................................................................126
References ..................................................................................................................................131
X
Abbreviations
APN Animal parasitic nematode
As Ascaris suum
ATP Adenosine tri-phosphate
Bm Brugia malayi
bp Base-pair
Ce Caenorhabditis elegans
CN Cyst nematode
Ct Cycle threshold
Cv Cultivar
DCL Dicer-like
DNA Deoxyribonucleic acid
dsRNA Double stranded RNA
Endo-RNAi Endogenous RNA interference
Exo-RNAi Exogenous RNA interference
GFP Green fluorescent protein
HIGS Host-induced gene silencing
Hp Hairpin
J1 First-stage juvenile
J2 Second-stage juvenile
J3 Third-stage juvenile
J4 Fourth-stage juvenile
Mh Meloidogyne hapla
Mi Meloidogyne incognita
miRISC micro RNA induced silencing complex
miRNA MicroRNA
mRNA Messenger RNA
nt Nucleotide
P bodies Processing bodies
PCR Polymerase chain reaction
Pi-RNA PIWI interacting RNA
PPN Plant parasitic nematode
Pre-mRNA Precursor messenger RNA
Pre-miRNA Precursor microRNA
Pri-miRNA Primary microRNA
XI
PTGS Post transcriptional gene silencing
qRT-PCR quantitative real-time polymerase chain reaction
RdRp RNA-directed RNA polymerase
RISC RNA-induced silencing complex
RKN Root-knot nematode
RNA Ribonucleic acid
RNAi RNA interference
rRNA ribosomal RNA
siRISC short interfering RNA induced silencing complex
siRNA Short interfering RNA
SNase Staphylococcol nuclease
sRNA Small RNA
VIGS Virus induced gene silencing
XII
Acknowledgement
Firstly, I would like to thank the Endeavour Awards Australia for giving me a Postgraduate
Research Scholarship to do this Ph.D. I would like to express my gratitude to my supervisors,
Professor Michael G.K. Jones and Dr John Fosu-Nyarko for all the time, guidance and
motivation they have given me. Their invaluable support and encouragement helped me in
staying positive throughout.
My sincere thanks go to everyone in SABC for their help. Special thanks to Frances Brigg for
all the sequencing help and Gordon Thompson for help with microscopy, Dave Berryman, Bee
Lay Addis and Karen Olkowski for all the support they have provided towards completing this
thesis. I would like to thank the experienced researchers Dr. Steve Wylie, Dr. Reetinder Kaur,
Dr. Vaughan Agrez, Meenu Singh and Dr. Leila Eshraghi for sharing their knowledge and
experiences which helped me in completing this project.
A big thankyou to the Ph.D students, Jo-Anne Tan, Jamie Ong, Shu Hui Koh and Elvina Lee for
their support, valuable discussions and troubleshooting advice which helped me at many steps
during this project and gave me friends for life. I would also like to thank colleagues in the Plant
Biotechnology Research Group (Fareeha Naz, Farhana Begum, Harshini Herath, Malathy
Rathinasamy, Sharmin Rahman Silvee and Vineeta Bilgi) for all the cheerful get togethers and
time we spent in the office.
And most importantly, thanks to my parents and siblings for their unconditional love and
support in my entire life. Special thanks to my husband for being there for me and helping me in
every way possible and my friends in Pakistan who supported me and became my punching
bags whenever needed during the course of this Ph.D.
XIII
Dedicated to
MY PARENTS
who have supported me in my every decision
1
Chapter 1
Literature Review
2
1.1 Introduction to nematodes
Nematodes are unsegmented roundworms which have a simple cylindrical body, generally 250
µm to 12 mm in length and 15-35 µm in width (Lambert and Bekal 2002). The phylum
Nematoda is a diverse and abundant group of metazoans with 25,000 species described so far
out of an estimated one million existing species (Bongers and Bongers 1998; Lambshead and
Boucher 2003). New sequencing technologies have made it feasible to gain insight into the
evolution, diversity and relationship of organisms, and this also applies to nematodes. Their
ecological diversity ranges from soil inhabiting nematodes to marine and terrestrial habitats, and
even to extreme environments such as the polar regions. The life span of nematodes ranges from
a few days for Caenorhabditis elegans to 15 years for the human parasitic hookworm
Necatoriasis americanus (Palmer 1955). The free-living bacteriovorous nematode C. elegans
was the first multicellular organism to have its genome sequenced. It has a genome of 100 Mbp
and ~20,000 annotated genes (C. elegans Sequencing Consortium 1998). Like other animals, C.
elegans has structures that include a digestive system, nervous system, muscles and ‘skin’,
called the cuticle. It has been used as a model organism to study various aspects of animal
biology such as the organisation of a simple nervous system, and for functional genetics,
because of the simple biology, short life span and ease of producing genetic mutants.
Based on the phylogenetic analysis of the small subunit ribosomal RNA (rRNA) gene of
nematodes, the phylum Nematoda is divided into five clades (Blaxter et al. 1998). Free-living
nematodes in soil play an important role in nutrient turnover by making them available for plant
absorption. This makes soil inhabiting free-living nematodes important indicators of soil health
(Neher 2000). Parasitic nematodes cause economic and health problems worldwide. Animal
parasitic nematodes include disease-causing worms of humans and animals parasitising both
invertebrates and vertebrates, including domestic animals, reducing their health and leading to
economic losses for production animals. The phylogenetic relationship of nematodes is
indicated in Figure 1.1.
The ecology of soil includes study of microscopic organisms like bacteria, fungi, protozoans,
with the largest animal component being nematodes. Plant parasitic nematodes (PPNs), which
have also been termed “The Invisible Enemy” are major pests of agricultural crops, and can be
found infesting crops from temperate to tropical environments: so far 4,100 species have been
described (Decraemer and Hunt 2006; Perry and Moens 2011).
3
FIGURE OMITTED
Figure 1.1: Phylogenetic relationship of nematodes based on the small subunit ribosomal RNA
gene. The five nematode clades and mode of feeding are indicated with parasitic species present
in all clades. Some important species are also indicated (Blaxter 2011).
1.1.1 Plant parasitic nematodes (PPNs)
In addition to free-living nematodes, soil inhabiting nematodes include PPNs that feed on and
parasitise plants (Decraemer and Hunt, 2006). They can infest almost all parts of plants
depending on the species: some can infest trees (Bursaphelenchus spp.) and leaves
(Aphelenchoides spp.). However, the most common nematode infestations occur in the below
ground parts of plants particularly in roots, tubers and bulbs. The life styles of PPNs can be
ecto-parasitic or endo-parasitic as defined by their feeding habit (outside or within the root
respectively), and migratory or sedentary depending on their mobility. They can have multiple
hosts (polyphagous) or may feed specifically on one or a few related species. Crops can be
infested with one or many different species of PPNs. In tropical and semi-tropical environments
it is quite clear that some form of nematode management should be undertaken to enhance
vegetable crop production, because of the pressures of nematode infestation (Sikora and
Fernandez 2005).
Migratory endoparasitic nematodes navigate their way from cell-to-cell damaging cell walls and
acquiring nutrients without inducing permanent feeding sites and most can move into and out of
the plant (Hussey and Grundler 1998). Examples of migratory nematodes include the burrowing
nematode (Radopholus spp.), root lesion nematodes (Pratylenchus spp.), pine wilt nematodes
(Bursaphelenchus spp.) and the foliar nematode (Aphelenchoides spp.). Entry into host tissues is
4
achieved using the mouth stylet and possibly by secretion of various proteins which may
include cell wall degrading enzymes.
In contrast, sedentary endoparasitic nematodes invade plant roots and modify host cells to
support long term feeding: once feeding cells are induced the nematode looses the ability to
move and feeds from these cells for the rest of its life-cycle. Examples of sedentary
endoparasitic nematodes include root-knot nematodes (Meloidogyne spp.) and cyst nematodes
(Globodera spp. and Heterodera spp). Unlike, migratory nematodes, whose feeding kill the
cells, those modified into feeding structures by sedentary nematodes remain alive and
metabolically active until the nematodes complete their life cycles. The life cycle of root-knot
nematodes (RKNs) is discussed in more detail in Section 1.1.3. Economically, the most
damaging PPNs are Meloidogyne species, commonly known as RKNs, because infested roots
develop galls or knots as a result of the feeding structures created by these nematodes (Figure
1.2).
The damage caused to world agriculture by PPNs is difficult to quantify accurately, but has
been estimated to be $125 billion per annum by Chitwood (2003), whereas the damage caused
by Meloidogyne spp. alone is estimated at about $100 billion per annum (Bird et al. 2009). This
contradiction in estimates of losses caused by PPN infestation needs to be updated using new
survey data to provide an accurate figure of the losses they cause to world agricultural
production. One aspect that confuses assessment of PPN damage is that the above ground
symptoms after nematode infection are often similar to those of plant nutrient deficiency and the
extent of damage may remain under-estimated and misdiagnosed (Hunt et al. 2005).
1.1.2 Root-knot nematodes (RKNs)
Initially reported as a root-knot disease on cucumber roots in 1855, the RKN was first described
in 1879 by Cornu. RKNs (Meloidogyne spp.) are sedentary plant endoparasites which have the
Figure 1.2: Galls resulting from infection of tomato roots by the root-knot nematode M.
incognita.
5
unique ability to modify host cells into giant cells which provide nutrients for associated
nematodes’ feeding (Jones 1981; Gheysen and Fenoll 2002). Ranked as number one in
importance out of the top 10 PPNs of the world, RKN species infest plants in all temperate and
tropical cropping areas, with 98 species described so far (Jones et al. 2013). With more than
5,500 species of plants identified as hosts, RKNs infect almost every crop grown, and hence are
considered one of the most damaging plant pests (Sasser 1980; Trudgill and Blok 2001).
Crop rotation or leaving the land fallow results in reduced nematode populations but many weed
species are hosts of RKNs, and this helps them to survive and even multiply in the absence of a
cultivated crop. The population dynamics of RKNs have been studied extensively, and threshold
levels depend on the nematode species and their virulence for infecting a particular host. On
average, any soil having 0.5-2 J2s (second-stage juveniles) per gram of soil is unlikely to
provide an optimum crop yield if susceptible. Damage thresholds range from 0.01 eggs/cm3 of
soil for M. artiellia on chickpea to 10 eggs/cm3 of soil for M. incognita on corn (Di Vito et al.
1980; Di Vito and Greco 1988).
1.1.3 Life cycle of RKNs
The life cycle of Meloidogyne spp. varies from three weeks to months depending on factors
such as species, temperature, moisture and plant host (Taylor and Sasser 1978). The normal life
cycle allows them to multiply several times during one cropping season, resulting in severe
damage to host crops. Embryos of RKNs develop as first-stage juveniles (J1s) through
embryogenesis, and moult once inside the egg to become second-stage juveniles (J2s): these
hatch from the eggs when developmental and environmental conditions are favourable (Moens
et al. 2009). In contrast to cyst nematodes (CNs) which hatch in response to root exudates or
ions such as zinc chloride, RKN J2s generally hatch in water without the aid of root exudates or
added chemicals. However, their hatching is dependent on temperature. The delayed
embryogenesis and subsequent hatching of nematodes in response to unfavourable conditions
has been termed as ‘diapause’, and occurs in some species of RKNs (de Guiran 1979; Antoniou
and Evans 1987).
Active J2s locate growing root tips by sensing gradients of compounds from root exudates and
exploring root epidermal cells to find suitable points for entry into root tissues (Curtis et al.
2009). The attraction depends on the plant species, root epidermal cells and on chemotaxis in
response to carbon dioxide gradients (Robinson 1995; Zhao et al. 2000; Rodger et al. 2003). J2s
usually penetrate the host plant at the zone of root elongation (Figure 1.3), creating access by
using their needle-like stylet, accompanied by secretion of proteins from their pharyngeal gland
cells: these may include cell wall degrading enzymes. The latter are thought to soften affected
6
cell walls and so enable the nematode to penetrate the root and migrate intercellularly, that is in
the apoplastic (cell wall) space of root tissues (Hussey and Grundler 1998; Abad et al. 2003).
The proteins secreted into the host by the infective J2s are selective in nature and appear to
embody different functions, for example degrading or modifying specific host cell wall
components to allow migration within the root, suppression of host defences and modifying
endogenous hormone levels and plant signalling pathways (Smant and Jones 2011; Haegeman
et al. 2012). Other nematode secretions targeted to cell contents are required to manipulate and
re-program cell development by inducing the formation of giant cells from immature vascular
elements (Jones and Payne 1978; Davis et al. 2004; Davis and Mitchum 2005).
FIGURE OMITTED
The secreted components which alter host cell development, down-regulate host defences and
are otherwise vital for successful parasitism are generally known as “effectors”. The number of
giant cells induced at the permanent feeding site can vary, usually in the order of five to seven
cells but can range from two to twelve. Following secretions by the nematode, individual cells
de-differentiate and enlarge by a process of repeated nuclear divisions without cytokinesis, to
become multinucleate without a prominent central vacuole (Jones and Payne 1978; Jones 1981;
Figure 1.3: Infection cycle of a root-knot nematode (N), illustrating the different stages of the
life cycle during infestation. Migration of the J2 nematodes in the cortex is followed by
turning and migration inside the endodermis (En): secretions into pro-vascular cells at the
feeding site lead to the modification of these cells to form giant cells (GCs), from which the
nematode feeds. Following moulting to reach the adult stage, eggs are secreted in a gelatinous
egg mass at the surface of the root. Other abbreviations: xylem (Xy), phloem (Ph), giant cells
(GC) (Bartlem et al. 2013).
7
Wiggers et al. 1990; Sijmons et al. 1994; Gheysen and Mitchum 2011). In principle, the
numbers of nuclei in developing giant cells should follow a geometric progression, but some
nuclei become polyploid, for example, 80 nuclei were counted in a single giant cell by Wiggers
et al. (1990), with each nucleus being polyploid. Division and expansion of adjacent cells of the
pericycle and cortex result in the formation of a gall or ‘knot’ surrounding the developing giant
cells, and this enables the giant cells to expand in size without damaging the surrounding cells
(Jones and Payne 1978; Jones 1981; Bird et al. 2009). This altered plant morphology is also
accompanied by up-regulation and down-regulation of expression of many genes in giant cells
compared to ‘normal’ plant cells, although deciding exactly the cell types with which to make
such comparisons is difficult (Jones 1981; Goverse et al. 2000; Gheysen and Fenoll 2002; Wang
et al. 2003; Baum et al. 2007). These changes in gene expression and metabolism enable the
giant cells to meet the demands of the feeding nematode throughout its life cycle. In a
susceptible host, the metabolism of the giant cells must match the nutrient demands of the
feeding nematode. This is reflected in the ‘transfer cell’ nature of giant cells, characterised by
the development of extensive wall ingrowths which increase the area of the cell membrane for
solute uptake from the apoplast to the symplast, and the many mitochondria required to supply
the energy needed for metabolic synthesis and solute transport – the associated nematode acts as
a nutrient sink, and the giant cell has to respond to removal of nutrients and maintain
homoestasis (Jones 1981; Caillaud et al. 2008). Galls induced by different species of
Meloidogyne differ in form and size, for example, more roots tend to develop from galls of M.
hapla than from galls induced by other RKNs.
In terms of nematode development, once J2s have initiated giant cells, they convert their lipid
reserves to glycogen and lose their ability to move. As feeding progresses, they undergo two
non-feeding moults at the feeding site i.e. J2 to J3 followed by J3 to J4, to become feeding
pyroform adult females (Hussey and Grundler 1998). During the non-feeding moults, they
survive on stored glycogen reserves. Reproduction is mostly by mitotic parthenogenesis
although males exist in all known species. M. hapla can reproduce by sexual reproduction and
has been used as a model system for genetic studies of RKNs (Liu and Williamson 2006; Blok
et al. 2008). In favourable conditions, several hundred eggs are laid into a gelatinous matrix by
each female on the surface of galled roots (Karssen and Moens 2006). The gelatinous matrix is
composed of glycoprotein which is transparent initially but turns dark brown with age. This
matrix protects the eggs from desiccation and has antimicrobial properties (Orion and Kritzman
1991).
The altered physiology of the vascular system of infected plants disrupts water and nutrient
uptake and translocation, resulting in loss of vigour and reduced crop yields and quality.
8
Severely infected plants become susceptible to secondary infections by soil fungi, bacteria and
viruses (Manzanilla-Lopez et al. 2004). This accelerates decay and death of the infected root
tissues.
1.1.4 Methods of PPN control
The overall aim of effective pest control is to use minimum resources to gain maximum benefit.
RKNs have wide host ranges, for example they have been reported to affect 138 weed species
which can be hosts and prevent disrupting infection cycles (Rich et al. 2009). The wide host
range of RKNs means that it is virtually impossible to eliminate them completely from a
cropping area. Methods of control include crop rotation, clean cultivation and chemicals but
application of nematicides like aldicarb, oxamyl and methyl bromide are regarded as
environmentally hazardous. Restrictions in their use imposed by governments have resulted in
the limitation or complete cessation of their use. Phytochemicals have also been evaluated as a
control strategy for PPNs, for example polythienyls from marigold species may be effective
against RKNs and root lesion nematodes (Ploeg 1999; Ploeg 2002; Ball-Coelho et al. 2003).
Species of the family Asteraceae when used as soil amendments or essential oil have been
reported to reduce reproduction of M. artiellia by up to 95.9% (Pérez et al. 2003). Lauric acid
from crown daisy repels M. incognita J2s and disrupts Mi flp18 expression, ultimately reducing
parasitism (Dong et al. 2014). Intercropping of such plants has been used to control RKNs, but
most natural compounds are too expensive to synthesise, unstable or otherwise not economical
or effective to use as control agents on a large scale.
Other approaches to PPN control include studying antagonistic compounds that can block
chemo-sensation employed by nematodes to locate host roots, but such effects are short-lived
(Perry 1994; Fioretti et al. 2002). Nitrogenous salts and ammonia released from decaying
organic matter also repel PPNs like M. incognita (Castro et al. 1991). Obligate parasites of
nematodes, such as Bacillus penetrans and Pasteuria penetrans have also been studied as
biological control agents. For RKNs, presence of Pasteuria penetrans in soil affects females
developing in the roots and reduces the production of egg masses (Bird and Brisbane 1988;
Davies et al. 2001; Davies et al. 2008). Arbuscular mycorrhizal fungi have also been studied as
potential biocontrol agents because their exudates can paralyse M. incognita J2s and reduce
their penetration by 32% when associated with tomato (Vos et al. 2012a; Vos et al. 2012b). The
non-pathogenic endophyte Fusarium oxysporum when inoculated on tomato plants induced
resistance to M. incognita, and resulted in a 45% reduction in nematode penetration (Dababat
and Sikora 2007). Some recently developed biological nematicides are available commercially,
but application in large fields and conditions which favour nematodes but not the biological
9
agent pose a problem for their effective use. Nevertheless, on a smaller horticultural scale some
can be effective.
It has been argued that the most sustainable method to control PPNs is the use of resistant plants
(Starr et al. 2002). Natural resistance in plants against sedentary PPNs is present in both dicot
and monocot plants. Various PPN resistance genes have been studied, including resistance to
RKNs, as presented in Table 1.1. However, most of these resistance genes are not broad
spectrum and are not available for all commercial crops. For example, the Mi gene of tomato
confers resistance against M. incognita and M. hapla, but is not effective against M. javanica -
virulent strains of nematodes can infect these resistant cultivars having Mi gene (Tzortzakakis
and Gowen 1996; Tzortzakakis et al. 1999; Jacquet et al. 2005; Castagnone-Sereno 2002).
Interestingly, this gene also confers resistance to some sucking insect pests (e.g. aphids and
whiteflies) as well (Rossi et al. 1998; Nombela et al. 2003). Apart from resistance genes against
RKNs, more than 100 soybean cyst nematode resistance sources have been studied, but the
genetic base of resistance is narrow and nematode populations are variable, which often allows
them to overcome natural resistance genes (Niblack et al. 2002; Shannon et al. 2004).
Nevertheless, there are natural resistance genes, often derived from related wild species, which
have been introduced through conventional breeding methods into crops to protect them against
nematodes, which have been used commercially. Examples include, potato cultivars with the H1
resistance gene derived from Solanum andigena which has been durable and effective against G.
rostochiensis (Starr et al. 2002).
Table 1.1: Resistance genes against RKNs identifed in various crops.
Gene RKN species Crop Reference
RMc1-hou M. chitwoodi
Potato
Draaistra 2006
RMc1-fen M. chitwoodi/ M. fallax
RMf-chc M. fallax
RMh-chcA,
RMh-chcB M. hapla
RMh-tar M. hapla
Mi-3 M.incognita/ M. javanica Tomato
Yaghoobi et al. 2005
Mi-1 M. spp. Vos et al. 1998
Mi-9 M. incognita/M. javanica/
M. arenaria
Veremis and Roberts
2000
Mae M. arenaria Peanut Garcia et al. 1996
Mag M. arenaria Peanut Garcia et al. 1996
Me3 M. incognita/M. javanica/
M. arenaria/M. hapla Pepper
Djian-Caporalino et al.
2001
Me4 M. arenaria
Me7 M. incognita Djian-Caporalino et al.
2007 Mech1 M. chitwoodi
10
Mech2 M. chitwoodi Berthou et al. 2003
However, transferring such resistance genes via transgenesis to related or unrelated species has
not worked well because downstream components that are required for internal signalling to
initiate the resistance response may not be compatible (Williamson 1999; Tai et al. 1999).
Another limitation of natural resistance genes is that they operate in a ‘gene-for-gene’ manner,
in which the resistance is based on recognition of a specific pathogen component or effector
(Gleason et al. 2008). It is therefore race specific. A pathogen race which lacks the recognised
compound will still be virulent, and so there is a constant battle between host and pathogen, in
which virulent resistance breaking pathotypes require a host mutation to recognise the pathogen
and initiate resistance responses. An exciting alternative approach to confer broader pest
resistance is based on ‘RNA interference’ (RNAi) or gene silencing technology, which uses a
conserved gene regulation mechanism present in eukaryotic cells to silence vital genes in the
pest, and so confer host resistance. This approach falls in the general category of ‘Host-Induced
Gene Silencing’ (HIGS). This is the strategy of nematode control studied in this thesis.
1.2 RNAi or gene silencing
RNAi is a highly conserved mechanism in eukaryotes which involves degradation of target
mRNAs using sequence specific small RNAs, resulting in a reduction of expression or ‘gene
knockdown’. This silencing is achieved via small RNA (sRNA) pathways which use both
exogenous and endogenous short interfering RNA (siRNA) and microRNA (miRNA) pathways.
These pathways (which are described in more detail later), interact to form a well balanced gene
regulation system (Lee et al. 2006).
Gene silencing in nematodes was first reported in C. elegans (Fire et al. 1998), and resulted in
the award of the Nobel Prize for Medicine in 2006 for Andrew Fire and Craig C. Mello. In
parallel studies on plants, this phenomenon was described in an attempt to down-regulate flower
colour in transgenic petunia plants, and in studies on virus infection of plants, hence was
described as ‘post transcriptional gene silencing’ (PTGS) or ‘co-suppression’ (Napoli et al.
1990; Waterhouse et al. 1998). The same phenomenon has also been found in almost all
eukaryotes including mammals (Berns et al. 2004; Silva et al. 2004), insects (Kennerdell and
Carthew 2000; Somma et al. 2002), fungi (where it was termed ‘quelling’) (Cogoni and Macino
1999; Liu et al. 2002; Forrest et al. 2004) and in unicellular organisms e.g. Plasmodium and
Trypanosoma (Ngo et al. 1998; Malhotra et al 2002).
11
MiRNAs which are involved in gene silencing generate a family of ~19-25 nucleotide (nt) long
RNAs from endogenous miRNA transcripts, and these have now been found in a wide range of
organisms, from algae to plants and humans (Bartel 2004; Griffiths-Jones et al. 2008). MiRNAs
are non coding, mostly 5′ uridine containing nucleotide sequences that regulate messenger RNA
stability and translation, and hence contribute to regulating gene expression (Chendrimada et al.
2007). Some DNA viruses have also been found to encode miRNAs (Pfeffer et al. 2004), and
miRNAs in mice have also been observed to counteract viruses by targeting viral large protein
(L protein) and phosphoproteins olso called P proteins (Otsuka et al. 2007). In humans, an
endogenous miRNA, miR-32, inhibits replication of a primate retrovirus PFV-1 (primate foamy
virus type 1); thus implying miRNAs may also have direct roles in antiviral defence (Lecellier
et al. 2005).
Apart from the PTGS reported in plants, silencing of genes at the transcription level has been
studied in great detail in C. elegans (e.g. Grishok et al. 2005). This evolutionarily conserved
mechanism may have evolved as an antiviral defence mechanism, in which viral RNA is
degraded by host RNAi machinery, and by which transposon activity can also be inhibited
(Voinnet 2001; Ketting et al. 1999; Ketting and Plasterk 2000).
In C. elegans, the first miRNA identified was lin-4, which represses the translation of lin-14, a
gene involved in developmental timing during postembryonic life stages (Lee et al. 1993;
Feinbaum and Ambros 1999). Soon after a 21 nt miRNA let-7 was discovered which affects
coordination of developmental timing, and is highly conserved and expressed in late larval
stages of C. elegans (Reinhart et al. 2000; Pasquinelli et al. 2000). It is also involved in the
maintenance of heterochromatin thus indirectly controlling epigenetic gene expression (Volpe et
al. 2002; Lippman and Martienssen 2004). A genome-wide RNAi screen identified at least 19
genes involved in the miRNA pathway of C. elegans (Parry et al. 2007). As many as 54 miRNA
families are reported as conserved in four Caenorhabditis species i.e. C. elegans, C. briggsae,
C. remanei and C. brenneri (Shi et al. 2013). In plants, miRNAs have been shown to respond to
biotic stresses such as fungal and viral infections, for example 10 miRNAs were down-regulated
in loblolly pine when infected with rust fungus, while two miRNAs were greatly up-regulated
when Turnip mosaic virus infected Brassica rapa plants (Lu et al. 2007; He et al. 2008).
Recently, 40 families of miRNAs in soybean belonging to conserved miRNA families as well as
soybean specific miRNAs have shown differential expression patterns in response to soybean
cyst nematode infection (Li et al. 2012). These studies demonstrate an essential role of miRNAs
in plant defence responses in addition to gene regulation.
12
1.2.1 RNAi mechanism
The eukaryotic RNAi pathway is triggered in response to presence of double stranded (ds)RNA.
When the dsRNA is from an external source, it is referred to as an exogenous RNAi (exo-
RNAi) pathway. This pathway also includes genes encoding miRNAs which are involved in
modifying gene expression, and maintenance of the organism’s genome in which case it is the
endogenous RNAi (endo-RNAi) pathway (Correa et al. 2010). These mechanisms form the
basis of antiviral responses, epigenetic regulation, and some responses to abiotic and biotic
stresses (Ruiz et al. 1998; Vaucheret 2006; Navarro et al. 2006). DsRNA can enter the cells via
transmembrane protein transporter channels or as a result of RNA-virus infection (Saleh et al.
2006). Once inside a cell, the dsRNA is processed by the dicer complex, which includes the
ribonuclease enzyme dicer, helicases, dsRNA binding enzymes and ‘argonaute’ proteins, and
these act together to cut long dsRNAs into ~21-25 bp siRNAs. In C. elegans, an argonaute gene
rde-1, in the dicer complex appears to contribute to separating the two strands of double
stranded siRNA (Steiner et al. 2009).
The miRNA pathway is initiated when hairpin transcripts known as primary miRNAs (pri-
miRNAs), encoded in the genome, are generated by RNA polymerase II (Lee et al. 2004).
These are 5′ capped and have 3′ polyadenylated nucleotide sequences (Bracht et al. 2004). They
are processed by the enzymes drosha and its cofactor pasha into ~70 nt precursor miRNAs (pre-
miRNA) which are then exported out of the nucleus through ‘exportin’ proteins (Lee et al.
2002; Lund et al. 2004). Pre-miRNAs are taken up by the dicer complex which cleaves the ~70
nt hairpin into ~22 bp miRNAs (Grishok et al. 2001; Lee et al. 2002). The duplex miRNAs are
unwound and mature single stranded 21 bp miRNAs are then taken up by the miRNA-induced
silencing complex (miRISC), consisting of RNA binding proteins, argonautes and nucleases
(Chan et al. 2008). Similarly, the processed duplex siRNA is unwound by an RNA-Induced
Silencing Complex (RISC) in an ATP dependent manner leading to the activation of the RISC
(Nykanen et al. 2001). With the interaction of argonautes, RNA binding proteins and helicases,
RISC functions as a transport vehicle for carrying single stranded siRNA to the respective
complementary target mRNA (Tang 2005). The sequence specific base-pairing results in
mRNA cleavage at the centre of the ~21 bp siRNA which results in degradation of the mRNA
by nucleases and so prevents its translation into a polypeptide (Elbashir et al. 2001a, Elbashir et
al. 2001b). For miRNAs, the miRISC targets the complementary mRNA, usually at the 3′
untranslated region (3′ UTR), possibly because there is less chance of dislodging miRNAs by
ribosomal activity (Ruvkun et al. 1989; Gu et al. 2009). This results in translational repression
of complementary mRNAs (Figure 1.4).
13
The miRNAs together with their mRNA targets and associated argonautes co-localise in
cytoplasmic foci called ‘processing bodies’ (P-bodies) or GW bodies (Eystathioy et al. 2003).
P-bodies are involved both in mRNA degradation and mRNA storage, from where mRNA can
return to translation when required (Liu et al. 2005; Parker and Sheth 2007).
In C. elegans, plants and fungi, there is also an amplification system for small RNAs initiated
by RNA-dependent RNA polymerases (RdRps), referred to as transitive RNAi (Calo et al.
2012; Fernandez et al. 2012; Vaistij et al. 2002). In C. elegans, target mRNA is used as a
template and sense strand as the primer for the 5′ to 3′ synthesis of more dsRNAs (Alder et al.
2003). Synthesis of secondary siRNAs has also been proposed by independent or unprimed
RdRp activity resulting in a 5′ di- or tri-phosphate product, an antisense polarity and synthesis
of sequence beyond the initial trigger dsRNA (Pak and Fire 2007; Sijen et al. 2007). These
secondary siRNAs can then associate with distinct argonautes, hence repeating and amplifying
the RNAi process (Yigit et al. 2006).
Another class of small RNAs termed pi-RNAs (PIWI-interacting RNAs) is being investigated,
but currently with poorly understood mechanism and functions. Pi-RNAs are encoded by the
genome and pre-dominantly affect the gonadal tissue of nematodes, with functions affecting
epigenetic phenomena (Ashe et al. 2012). The well co-ordinated functions of small RNA
pathways in an organism require specific effectors at different steps, which can be largely
classified into functional components.
14
FIGURE OMITTED
Figure 1.4: Core components of the RNAi pathways of C. elegans. Exogenous dsRNA enters
the cells through transport proteins (1) while endo-siRNA and pre-miRNA are coded by the
organism’s genome and exported out of the nucleus (2). Both dsRNA and pre-miRNA are
processed by the Dicer complex (3) into siRNA and miRNA in the cytoplasm. After dicer
processing, these small RNAs are taken up by the RNA-Induced Silencing Complex (RISC) (5),
unwound and guided to the target mRNA resulting in target cleavage or translational repression
(6). RNAi inhibitory proteins suppress this mechanism (4) while RNAi amplification machinery
(7) generates secondary siRNAs which amplify the silencing process (8) and initiate nuclear
RNAi which leads to transcriptional silencing (10). Cell-to cell transport of silencing signals
ensures their spread throughout the organism. (Dalzell et al. 2011).
15
1.3 Components of siRNA and miRNA pathways of eukaryotes
The proteins involved in the interacting sRNA pathways of C. elegans can be divided into
groups according to their function. These include:
1. Transport proteins which allow movement of silencing signals, dsRNAs across membranes.
2. Dicer complex which unwinds and cuts longer dsRNAs into smaller RNAs required for
interacting with a target sequence.
3. RNA-induced silencing complex (RISC) which guides the siRNA and miRNA to the target
mRNA.
4. RNAi amplification machinery that amplifies gene silencing by producing secondary
siRNAs.
5. RNAi inhibitors, which include proteins that suppress gene silencing by various mechanisms
6. Nuclear RNAi is the process where silencing signals participate in silencing the nascent
mRNA of the target gene produced in the nucleus.
7. Argonautes, a group of proteins that function at different steps of gene silencing pathway
with major function of binding RNAs and cleaving target mRNA.
1.3.1 Transport proteins
These are a group of genes which encode various proteins responsible for transporting RNAs
(long dsRNA, siRNA and miRNA) from the extracellular environment across the cell
membrane and/or the endoplasmic reticulum into the cell. This group of RNA transport proteins
also includes nuclear membrane transport proteins responsible for the transport of pre-miRNA
from the nucleus to the cytoplasm.
In C. elegans, ten genes are known to encode proteins that can transport siRNA, dsRNA and/or
miRNA between cellular compartments or cells. These are sid-1, sid-2, sid-3, rsd-2, rsd-3, rsd-
6, haf-6 and the nuclear envelope transporters xpo-1, xpo-2 and xpo-3. Sid-1 is involved in the
passive uptake of dsRNA across the cell memebrane. It functions as a channel to spread the
silencing signal in the form of dsRNA (siRNA, hpRNA etc.) through cells of different tissues in
C. elegans (Jose and Hunter 2007; Shih and Hunter 2011). The 776 amino acid long
transmembrane protein SID-1 which has an extracellular amino terminus, is expressed in all
non-neuronal cells and preferentially transports long (~500 bp) dsRNAs (Winston et al. 2002;
Feinberg and Hunter 2003). However, this protein is not involved in the export of silencing
signals from cell to cell in adjacent tissues (Jose et al. 2009). In sid-1 mutants, expression of
SID-1 from cell specific promoters results in cell specific RNAi suggesting a high affinity of
dsRNAs to SID-1 (Calixto et al. 2010). SID-2 is an intestinal transmembrane protein in C.
16
elegans which aids dsRNA uptake after feeding, enabling what is termed ‘environmental’
RNAi. When expressed in environmental RNAi defective C. briggsae, sid-2 restores the
environmental RNAi response (Winston et al. 2007). SID-2 is involved in the selective uptake
of dsRNA in an ATP- and pH-dependent manner from the gut lumen (McEwan et al. 2012).
The SID-3 protein also imports dsRNA efficiently into C. elegans cells from intestinal cells and
to internal tissues, while SID-5 associates with endosomes and is involved in the efficient
spread of silencing signals out of intestinal cells independent of SID-1 (Hinas et al. 2012).
Unlike flies and vertebrates, in which pre-miRNAs are transported out of the nucleus through
exportin-5, in C. elegans it is suggested that three exportins xpo-1, xpo-2 and xpo-3 are involved
in the miRNA pathway, in which XPO-1 mediates intra-nuclear transport of pri-miRNA and
enhanced processing of pri-miRNA to pre-miRNA (Bussing et al. 2010).
Mutants of rsd-2, rsd-3 and rsd-6 in C. elegans are able to take up dsRNA from the gut into
somatic tissues, but its spread to the germline tissue is inhibited - this indicates that these genes
are important in germline RNAi spread (Tijsterman et al. 2004). A yeast hybrid assay also
shows that the products of rsd-2 require interaction with rsd-6 to function properly (Tijsterman
et al. 2004). The RSD-3 protein contains the epsin amino-terminal homology (ENTH) motif
typical of cytosolic proteins involved in vesicle trafficking (Holstein and Oliviusson 2005). The
ATP binding cassette (ABC) transporter gene haf-6 is required for efficient RNAi of genes
expressed in germline and intestinal tissues in C. elegans (Sundaram et al. 2006). All these
different effectors are involved in systemic spread of RNAi through nematode tissues and
demonstrate the involvement of several mechanisms notably active membrane uptake, passive
membrane transport and endocytosis. After entering a cell, dsRNA is taken up by the
ribonuclease III Dicer complex for processing, and this aspect is discussed in more detail in the
following section.
1.3.2 Dicer complex
The ribonuclease III dicer enzyme is the main component of the Dicer complex in eukaryotes.
There are four classes of dicer-like proteins in plants, two in fungi and insects and one in
humans and nematodes. The dicer protein(s) plays a major role in recognition and processing of
dsRNA. The dicer cleaves long dsRNA into small RNA duplexes with 3′ 2-nt overhangs,
bearing 5′ phosphate and 3′ hydroxy termini (Elbashir et al. 2001a). A 210 kDa protein is the
only DICER in C. elegans, and functions in exo-RNAi, endo-RNAi and miRNA pathways: it
processes long dsRNAs into ~22-23 bp long siRNAs in vitro with the requirement of ATP
hydrolysis, which is consistent with the in vivo studies (Ketting et al. 2001).
17
The crystal structure of the Dicer protein of Giardia intestinalis has been used to predict its
interaction with dsRNA and the results suggest that the PAZ domain binds to the 3′ end of
dsRNA and that the dicer protein acts as a ‘ruler’, starting from the PAZ domain, to process
long dsRNA into small RNAs (MacRae et al. 2006). In the nematode C. elegans, this complex
requires other effectors (drh-1, drh-2, drh-3, pir-1, rde-1 and rde-4) to process the dsRNA
trigger (Duchaine et al. 2006). By regulating gene expression, dcr-1 is proposed to control the
innate immune response of C. elegans against pathogens and possibly stress responses (Welker
et al. 2007).
In plants, it is generally accepted that there is a division of labour between the four dicer-like
proteins (DCLs), with DCL-2 involved in producing 22 bp stress-related siRNAs, DCL-3
producing 24 bp siRNAs is involved in RNA-directed DNA methylation and heterochromatin
formation, while DCL-4 is involved in post transcriptional gene silencing and produces 21 bp
trans-acting siRNAs (tasiRNAs). DCL-1 is involved in miRNA processing, whilst antiviral
responses mostly require action of DCL-2 and DCL-4 (Xie et al. 2004). These distinct sizes of
siRNAs (21 bp to 24 bp) have been documented as involved with different facets of silencing
i.e. short siRNAs guide mRNA degradation, whereas systemic silencing and DNA methylation
are responses to longer siRNAs (Hamilton et al. 2002). In Drosophila, Dicer-1 processes
miRNAs with the help of its cofactor Loquacious, while Dicer-2 processing results in siRNAs
(Saito et al. 2005). Dicer-2 also appears to have a downstream role where it interacts with RISC
with the aid of dsRNA-binding protein R2D2 (Liu et al. 2003).
In humans and drosophila, Drosha-1 RNaseIII enzyme processes pri-miRNAs into 70 nt stem
loop pre-miRNAs in the nucleus with the help of a cofactor Pasha-1, which is an RNA binding
protein required for the process (Lee et al. 2003; Filippov et al. 2000). In plants however, pri-
miRNAs, which are hairpin precursors encoded in the genome, are processed into < 100-900 nt
long pre-miRNAs and ultimately miRNA-miRNA duplex by DCL1 together with the proteins
HYPONASTIC LEAVES1 (HYL1) and SERRATE (SE), which catalyse this process in the
nucleus (Kurihara et al. 2006; Dong et al. 2008; Cuperus et al. 2011). These and siRNAs
processed by dicer then enter the RISC for further processing and eventual disruption of gene
expression.
1.3.3 RNA-induced silencing complex (RISC)
The RISC is one of the most important components of RNAi. In Drosophila one of its roles is in
retaining the dsRNA that enters the cell and maintaining an unprocessed pool of dsRNA (Shih
and Hunter 2011). The complex includes many gene products - helicases, argonautes and DNA
18
and RNA binding effectors. This ribonucleoprotein complex can load siRNAs (siRISC) or
miRNAs (miRISC, Tang 2005).
The RISC recognises the 2 nt overhang at the 3' end of the guide strand of siRNAs, binds and
unwinds it from the 5′ end into single-stranded RNA which then guides the RISC for mRNA
degradation (Chiu and Rana 2002; Kennedy et al. 2004). An additional feature of the plant
small RNA pathway is methylation of small RNA duplexes to protect them from degradation. In
plants, the 2′ hydroxyl group on the 3′ end is methylated by the protein HEN1 (HUA
ENHANCER 1) to prevent degradation with preference for 21-24 nt miRNAs and 23-24 nt
siRNA duplexes (Yang et al. 2006). Some plant viruses have evolved inhibitors of gene
silencing which inhibit HEN1 activity, resulting in degradation of siRNAs generated as a
defence against those viruses (Jamous et al. 2011). The thermodynamic properties of the two
ends of duplex siRNA and miRNA determine which strand will act as guide for RISC
(Khvorova et al. 2003; Schwarz et al. 2003). Complementarity with target mRNA at the 5′ end
is essential for translational repression while the 3′ end contributes to the establishment of an A-
form helix which is essential for RISC mediated target cleavage (Chiu and Rana 2003; Haley
and Zamore 2004). Gene regulation through miRNAs in plants results in both translational
repression and endonucleolytic cleavage of mRNAs (Brodersen et al. 2008; Huntzinger and
Izaurralde 2011).
The gene tsn-1, a component of the RISC complex, encodes six functional protein domains i.e.
four SNase (Staphylococcal nuclease) domains followed by a Tudor domain, which is
implicated in protein–protein interactions. A fifth SNase domain is present at the amino
terminus of the Tudor domain and this gene has nucleolytic activity (Caudy et al. 2003).
Another component of the ~250 kDa complex is vig-1 which in C. elegans immunoprecipitates
with tsn-1 protein and let-7 miRNA, indicating that it is also associated with the miRNA
pathway (Caudy et al. 2003). The endonucleolytic activity of the RISC requires the presence of
Mg2+
ions (Schwarz et al. 2004). In mammals, siRNAs behave as miRNAs if there is less
complementarity at the 3′ end (Doench et al. 2003).
The RISC also comprises of two effectors ain-1 and ain-2, which encode an M domain (M
domain of the protein GW182) thought to promote translational repression and initiate gene
silencing (Zekri et al. 2009). Insects like Drosophila, have one GW182 protein, while C.
elegans has two, out of which, AIN-1 interacts with miRISC and localizes to P-bodies (Ding et
al. 2005; Eulalio et al. 2007). The genes ain-1 and ain-2 appear to function in a redundant
manner in association with miRNA argonautes alg-1 and alg-2 to form distinct miRISC and
regulate expression of target mRNAs (Zhang et al. 2007).
19
1.3.4 RNAi amplification machinery
In C. elegans, an amplification machinery uses the target mRNA as a template to synthesise
more dsRNAs by employing RdRPs. The synthesis of dsRNA can continue beyond the initial
trigger sequence (Pak and Fire, 2007; Sijen et al., 2007). This phenomenon is also present in
plants and fungi, but has not been found in Drosophila or mammals: it has been termed
‘transitive RNAi’. Distinct secondary siRNAs are generated by individual RdRp events and can
be distinguished from primary siRNAs by the presence of di- or tri-phosphates at the 5′ end,
instead of mono-phosphate for primary siRNAs (Pak and Fire 2007; Sijen et al. 2007).
Seven genes are known to be involved in RNAi amplification in C. elegans. Two of these are
RdRps ego-1 and rrf-1. The gene ego-1 is important for fertility in C. elegans and is required for
efficient germline RNAi response (Smardon et al. 2000) whereas rrf-1 is required for efficient
RNAi in somatic tissues suggesting there are distinct roles for these two closely linked genes
(0.9 kb apart in tandem orientation) in C. elegans (Sijen et al. 2001).
Three C. elegans genes with the phenotypic designation “Suppressor with Morphological effect
on Genitalia” (smg-2, smg-5 and smg-6) are also known to contribute to amplification of RNAi,
however the specific mechanisms have not been elucidated. These SMG proteins are involved in
degrading defective mRNAs, those that code for toxic protein fragments and nonsense mediated
mRNA decay (also termed as mRNA surveillance, Pulak and Anderson 1993; Johns et al.
2007). Two recently characterised RNAi amplification genes of C. elegans, rde-10 and rde-11
are essential for accumulation of secondary siRNAs in endo and exo-RNAi pathways and act by
forming a complex that interacts with partially degraded target mRNAs (Zhang and Ruvkun
2012).
1.3.5 RNAi inhibitors
In contrast to proteins involved in RNAi amplification, a group of proteins known as RNAi
inhibitors appear to suppress RNAi in C. elegans: the loss of function of these increases
sensitivity to RNAi. So far 13 genes are reported to have a role in inhibiting RNAi directly or
indirectly. These are genes with enhanced RNAi phenotype (eri-1, eri-3, eri-5, eri-6/7, eri-9),
adenosine deaminase acting on RNA genes (adr-1, adr-2), XRN (mouse/S. cerevisiae)
ribonuclease related genes (xrn-1, xrn-2), RdRp containing (rrf-3), lin15-b, gfl-1 and zfp-2.
The nuclease domain of eri-1 is responsible for removing the 2 nt overhang by recognizing the
3′ end of siRNA, also known as 3′ exoribonucleolytic trimming, and is common to E. coli and 3′
processing of 5.8S ribosomal RNA in C. elegans (Li et al. 1998; Gabel and Ruvkun 2008). The
possible inhibition of RNAi by eri-1 is suggested because of loss of recognition by RISC and
20
instability of siRNAs without the overhangs, making them more susceptible to degradation
(Kennedy et al. 2004). The eri-3 and eri-5 genes are essential for stable interaction of eri-1 with
dcr-1, while eri-9 is involved in endogenously expressed siRNAs (Duchaine et al. 2006;
Pavelec et al. 2009). In C. elegans, two separate mRNAs eri-6 and eri-7 are trans-spliced to
form the RNAi inhibitor eri-6/7 which codes for a helicase that functions in both exo and endo-
RNAi pathways (Fischer et al. 2008). This suggests that in C. elegans, the same protein can
play overlapping roles in sRNA pathways and affect stability of interactions between other
effectors of the pathway.
The RdRp coding gene rrf-3 is also an inhibitor of RNAi in C. elegans since its silencing results
in increased efficiency of RNAi (Simmer et al. 2002). As a result, rrf-3 mutants of C. elegans
have been used in various RNAi experiments to study sensitivity of genes to RNAi.
Interestingly, ego-1 and rrf-1, also RdRps play exactly the opposite role, i.e. are involved in
RNAi amplification. Further functional protein analysis is needed to understand the contrasting
roles of this protein.
Two deaminating proteins are also involved in RNAi inhibition i.e. ADR-1 and ADR-2 in C.
elegans which suppress RNAi by deaminating dsRNA synthesised from transgenes and the
mutants of these genes are defective in chemotaxis (Knight and Bass 2002; Tonkin et al. 2002).
Similarly xrn-1 is required for embryogenesis, pointing to a role for XRN exoribonucleases in
developmental regulation (Newbury and Woollard 2004). The xrn-1 and xrn-2 genes are
involved in degradation of mRNA in P-bodies and mature miRNAs respectively, therefore
regulating miRNA homeostasis in C. elegans (Muhlrad et al. 1994; Chatterjee and Grobhans
2009).
The gfl-1 gene, a suppressor of RNAi, also has a reported role in eukaryotic transcription
(Heisel et al. 2010). The gene zfp-2 is a zinc-finger transcription factor which interacts with lin-
35Rb and acts as an RNAi inhibitor (Ceron et al. 2007). Mutants of some of these inhibitors
(eri-1, rrf-3, lin-15b) show increased viral resistance in C. elegans compared to wild-type
nematodes, indicating their powerful role in inhibiting virus-degrading small RNAs (Wilkins et
al. 2005; Schott et al. 2005). Characterisation of this group of genes in PPNs would help in
development of robust RNAi strategies for their control.
1.3.6 Nuclear RNAi
Post transcriptional gene silencing is not restricted to the cytoplasm of eukaryotic cells
(Montgomery et al. 1998). Silencing of transcripts in the nucleus or nuclear RNAi is also
responsible for heritable gene silencing in C. elegans (Burton et al. 2011). The secondary
siRNAs generated by RdRps are bound to nuclear RNAi pathway argonaute NRDE-3 (nuclear
21
RNAi defective-3) which normally resides in the cytoplasm, but once bound to the secondary
siRNAs, localises to the nucleus, and associates with the complementary nascent mRNA
together with NRDE-1 and NRDE-2 (Guang 2008). In the nucleus the NRDE-siRNA complex
interacts with another effector NRDE-2 to silence precursor mRNA (pre-mRNAs) and inhibit
RNA polymerase II transcription during the elongation phase of transcription (Guang et al.
2010). Two other effectors identified in the C. elegans nuclear RNAi pathway, nrde-1 and nrde-
4, are involved in chromatin association and methylation of histone 3 lysine 9 (H3K9me) which
is also detected in the progeny, hence the association of nuclear RNAi to heritable gene
silencing (Burkhart et al. 2011; Burton et al. 2011; Gu et al. 2012). The nrde-3 gene has also
been shown to play a role in RNAi amplification in C. elegans in which mutants are RNAi
defective and its over expression enhances RNAi (Zhuang et al. 2013). A model of nuclear
RNAi in C. elegans is presented in Figure 1.5.
FIGURE OMITTED
Figure 1.5: Model of nuclear RNAi in C. elegans. NRDE-3 binds to secondary siRNA in the
cytoplasm and transports it into the nucleus to interact with other nuclear RNAi proteins NRDE-
1 (1), NRDE-2 (2), NRDE-4 (4) to silence precursor mRNA (pre-mRNA) and inhibit RNA
polymerase II (Pol II) activity (Buckley 2013).
The gene cid-1 encodes a polymerase which in yeast is involved in RNAi dependent
heterochromatin formation and 3′ polyadenylation of mRNA in the nucleus (Stevenson and
Norbury 2006). However in C. elegans, this protein acts as a checkpoint, which in response to
DNA damage stalls cell division and cid-1 mutant nematodes show altered stress response
(Olsen et al. 2006). The ekl genes, also involved in nuclear RNAi, are classified as the
enhancers of the ksr-1 lethality because their knockdown causes a distinct rod-like larval
lethality in ksr-1 mutant C. elegans (Rocheleau et al. 2008).
22
Mutator genes mut-2, mut-7 and mut-16 are also involved in nuclear RNAi pathway in C.
elegans. The gene mut-2, also named as rde-3, codes for a polymerase β nucleotidyltransferase
which in C. elegans is essential for fertility, viability and siRNA accumulation for RNAi
induced by feeding (Chen et al. 2005). The mut-7 gene encodes a putative 3′-5′ exoribonuclease
essential for RNAi which interacts with rde-2 in C. elegans while mut-16 is involved in
transposon silencing and mutant worms are defective in RNAi (Vastenhouw et al. 2003; Tops et
al. 2005).
The RNA helicase rha-1, also a nuclear RNAi effector, is required for germline development:
RNAi of rha-1 in germ cells and its mutants have defective chromatin organization (Walstrom
et al. 2005). Three Maternal Effect Sterile (MES) proteins mes-2, mes-3 and mes-6 form a
complex which regulates germline development by repressing repetitive transgenes (Fong et al.
2002). This complex is also responsible for the epigenetic methylation of histone 3 lysine 27
(H3-K27) in adult germline and early embryos (Bender et al. 2004).
1.3.7 Argonautes
Argonautes are a large group of genes encoding proteins that have the PAZ
(Piwi/Argonaute/Zwille) and PIWI domains. They are involved in a range of small RNA
pathways and other processes including chromatin modification and stem cell fate determination
(Carmell et al. 2002). The PAZ domain binds RNA by recognizing the 2 nt 3′ overhang of
siRNAs in a sequence-independent manner (Song et al. 2004). Removal of one or both of these
overhangs reduces the binding affinity by 85-fold and >5000-fold respectively (Ma et al. 2004).
The PIWI domain of argonautes is ribonucleolytic and acts as the catalytic slicer site involved in
target slicing. The crystal structure indicates that it is an RNase H domain (Song et al. 2004;
Parker and Barford 2006).
After studying the crystal structure a model proposed for a full length argonaute of the
archaebacterium P. furiosus, suggests 3′ end of siRNA binds to the PAZ cleft and the target
mRNA is oriented so that the PIWI RNase H site cleaves it between the 11th and 12
th nucleotide
counting from the 3′ end of the guide siRNA (Figure1.6). Studies of the PIWI domain reveal
that 5′ phosphate-containing RNA is bound more tightly to the domain compared to a non
phosphorylated RNA, and this 5′ end initiates base-pairing with the target mRNA (Martinez et
al. 2002; Haley and Zamore 2004; Patel et al. 2006).
23
FIGURE OMITTED
Figure 1.6: Proposed mechanism of the slicer activity of P. furiosus argonaute on siRNAs. The
3′ end of the siRNA binds to the PAZ cleft and is oriented in a position which allows the PIWI
RNaseH to cleave the siRNA between 11th and 12
th nucleotide (Song et al. 2004)
The genome of C. elegans codes for 28 argonaute proteins whilst in Drosophila, Arabidopsis
and humans the argonaute functions are divided amongst 5, 10 and 8 orthologs respectively.
Some important argonautes in different eukaryotes and their functions are presented in Table
1.2.
Table 1.2: Argonaute orthologs, their respective functions and mutant phenotypes in model
organisms.
Argonaute Proposed function Mutant phenotype Reference
Nematodes (C. elegans)
RDE-1 Processing of duplex primary
siRNAs i.e. removal of
passenger strand from guide
strand
RNAi defective Tabara et al. 1999
Steiner et al. 2009
ALG-1 and ALG-2 Interaction with miRNAs with
functional homology to rde-1
Inhibited miRNA
processing
Grishok et al. 2001
Tops et al. 2006
ERGO-1 Homologous in function to rde-
1 in the endo-RNAi pathway
RNAi sensitive Yigit et al. 2006
CSR-1 Involved in chromosome
alignment and segregation.
Also associated with secondary
siRNAs
Sterile Yigit et al. 2006
Aoki et al. 2007
Claycomb et al. 2009
PRG-1 Required for the presence of
21U-RNA which affect
spermatogenesis transcripts
Sterile Yigit et al. 2006
Wang and Reinke
2008
SAGO-1/WAGO-8
and SAGO-2/
WAGO-6
Interaction with secondary
siRNAs
Reduced RNAi activity Yigit et al. 2006
PPW-1 Interaction with secondary
siRNAs and involved in
germline RNAi
Resistant to RNAi of
germline expressed
genes
Yigit et al. 2006
Tijsterman et al.
2002
PPW-2/WAGO-3 Exo and endo-RNAi including
transposon silencing
Resistant to germline
RNAi
Vastenhouw et al.
2003
Gu et al. 2009
F58G1.1/WAGO-4 Interaction with secondary
siRNAs and involved in
germline RNAi
Resistant to germline
RNAi
Yigit et al. 2006
Gu et al. 2009
24
C16C10.3/HRDE-1 Endogenous RNAi leading to
nuclear gene silencing in germ
cells
Heritable RNAi
deficient
Buckley et al. 2013
NRDE-3/WAGO-12 Nuclear RNAi Nuclear RNAi defective Guang et al. 2008
Plants (A. thaliana)
AGO1 Processing of pre-miRNAs and
guiding the processed miRNA
to target mRNA
Upregulation of miRNA
target gene transcripts
Baumberger and
Baulcombe 2005
Vaucheret et al. 2004
AGO2 Essential for antiviral defence Decreased antiviral
defence response
Carbonell et al. 2012
AGO3 Unknown No obvious phenotype Lobbes et al. 2006
AGO4 Involved with chromatin
silencing
Defective in DNA
methylation and
accumulation of 25 bp
siRNAs
Zilberman et al.
2003
AGO5 Binds to 21-nt miRNa and 21
and 24 nt viral siRNAs. -
Takeda et al. 2008
AGO6 Involved with RNA-directed
DNA methylation and
transcriptional gene silencing in
meristematic tissues
Suppressed RNA
silencing
Zheng et al, 2007
Eun et al. 2011
AGO7 Interaction with miRNAs to
stabilise target interaction and
tasiRNA biogenesis
Decreased tasiRNA
biogenesis. Abnormal
development.
Carbonell et al. 2012
AGO9 Involved with RNA-directed
DNA methylation
Defective gametogenesis Olmedo-Monfil et al.
2010
AGO10/PINHEAD/Z
WILLE
Interaction with miRNAs to
stabilise target interaction,
maintenance of meristematic
cells in shoot apex
Defective meristem
formation
Moussian et al. 1998
Carbonell et al. 2012
Tucker et al. 2008
Insects (D. melanogaster)
AGO-1 Involved in miRNA pathway Up-regulation of
miRNA targets and
decreased concentration
of miRNAs
Forstemann et al.
2007
Okamura et al. 2004
AGO-2 Involved in siRNA-directed
RNAi
RNAi defective embryos Forstemann et al.
2007
Okamura et al. 2004
Fungi (N. crassa)
QDE-2 siRNA processing. Involved in
processing miRNAs from pre-
miRNAs
RNAi defective Maiti et al. 2007
In a mutant screen, C. elegans argonaute functions were explored with the following findings
(Yigit et al. 2006)
1. Argonautes are involved in nematode fertility and chromosome segregation.
2. Different argonautes act at different steps in sRNA pathways.
3. Exo-RNAi and endo-RNAi pathways converge, probably on SAGO proteins, and
compete for the same resourcess.
25
Ten argonaute proteins have been identified in Arabidopsis. Unlike animals, after being
exported out of the nucleus, it is proposed that pre-miRNAs are recruited by AGO1 instead of
RISC, which carries out the slicing activity and are guided to the imperfect complementary
target mRNAs (Baumberger and Baulcombe 2005). AGO1 has a preference for small RNAs
with a 5′ terminal uridine which is a characteristic of most miRNAs. The AGO1 mutants in
Arabidopsis show up-regulation of mRNAs which are known targets of miRNAs (Vaucheret et
al. 2004; Mi et al. 2008). The 5′ terminal nucleotide of the small RNA plays a significant role in
determining which Argonaute protein they will interact with. For example, AGO2 and AGO4
preferentially interact with RNAs with a 5′ terminal adenosine while AGO5 binds small RNAs
starting with a cytosine (Mi et al. 2008). Plant viruses and pathogenic fungi have evolved
methods to hijack AGO1 of plants (e.g. Arabidopsis) to disarm the plant’s immune response and
achieve successful infection (Azevedo et al. 2010; Weiberg et al. 2013). Although argonautes
are known for their ‘slicer’ activity, they also play major roles in the miRNA pathway where
target slicing does not occur. The fact that in C. elegans, a single Dicer processes small RNAs
which are then taken up by different argonautes, while in plants Dicer processing properties
decide the specific argonaute association, indicates the diversity of the roles these proteins play
in the sRNA pathways.
1.4 Applications of RNAi
Nominated as ‘Breakthrough of the Year 2002’ by the journal Science, RNAi has since been
studied intensively, because it presents new approaches to counteract chronic diseases in
medical science, and has many potential contributions in crop improvement. Medical
applications are commonly known as ‘RNAi therapeutics’. RNAi has been shown to repress
hepatitis B viral RNA by introducing hepatocyte targeted siRNAs. Clinical trials have been
initiated for this study (Wooddell et al. 2013). RNAi has also been used to limit replication of
HIV-1 in human cells (Jacque et al. 2002; Lee et al. 2002), and antisense oligonucleotide drugs
which share the same basic principle of targeting complementary mRNA are being developed
and clinical trials are ongoing to control some forms of cancer (Gleave and Monia 2005;
Lightfoot and Hall 2012). An antisense oligo drug ‘Fomivirsen’ has now been approved by the
FDA for the treatment of Cytomegalovirus (CMV) retinitis (Grillone and Lanz 2001).
Nanoparticle encapsulated siRNAs have demonstrated to treat 100% of rehses monkeys infected
by Makona strain of Ebola indicating the potential this technology has against treating life
threatening disease outbreaks (Thi et al. 2015).
Applications of RNAi in agriculture are being explored, for example to develop new methods to
control economically damaging pests such as nematodes and aphids. In host mediated RNAi,
gene silencing results when a parasite takes up dsRNA from the host on feeding. Experimental
26
results suggest that RNAi can be effective against both chewing and sucking insect pests (Mao
et al. 2007; Thakur et al. 2014), viruses (Tenllado et al. 2004; Bonfim et al. 2007), parasitic
weeds (de Framond et al. 2007; Aly et al. 2009) and some fungi (Nowara et al. 2010; Tinoco et
al. 2010). Topical application of dsRNA has been demonstrated to have potential to control
mosquitoes (Pridgeon et al. 2008). DsRNA foliar application against Colorado potato beetle has
also shown promising results in greenhouse conditions (San Miguel and Scott 2015). Antisense
oligonucleotides are also being tested as potential pesticides and methods of delivery are being
developed to efficiently target pests (Tortora et al. 2011).
1.4.1 Development of in vitro RNAi in nematodes
After the initial experiments in which the phenomenon of RNAi was elucidated in C. elegans,
many researchers have explored the potential of this strategy for studying functional genomics.
Gene silencing in C. elegans was first achieved by injecting dsRNA into the nematodes (Fire et
al. 1998). While exploring several methods to deliver dsRNA into these nematodes, it was
established that apart from injecting dsRNAs, environmental RNAi i.e. soaking or feeding the
nematodes with dsRNA also results in specific gene silencing (Tabara et al. 1998; Maeda et al.
2001). It was then found that feeding C. elegans with bacteria expressing dsRNA
complementary to endogenous target genes also resulted in efficient RNAi, which worked very
well for epithelial cells (Timmons et al. 2001). However, the efficiency of RNAi treatments
varied from species to species (Winston et al. 2007). Nevertheless, since the discovery of RNAi,
it has been used in studies to determine gene functions by down-regulating the expression of
about 86% of the predicted genes in C. elegans, including many genes involved in the RNAi
pathway (Fraser et al. 2000; Gonczy et al. 2000; Kamath et al. 2003; Kim et al. 2005).
Significantly, in many cases the information generated from these studies can be mapped
directly across to PPNs using a comparative genomics approach.
However, some of the methods that work for C. elegans in RNAi experiments do not work the
same way for PPNs. Microinjection of dsRNA is much more difficult, and the gene mutants
available for C. elegans are not available for PPNs, and so functional genomics studies require
alternative methods to effectively knock out genes for functional studies. Nevertheless, the
wealth of functional data generated for C. elegans can in many cases be mapped across to PPNs,
and this information has provided a major new resource to study PPNs.
In considering some other aspects of RNAi in C. elegans, which provide leads for study of
PPNs, systemic transmission of a silencing signal i.e. the ability for silencing to spread through
the organism except neuronal tissue does occur in C. elegans (Fire et al. 1998). In addition, the
inheritance of RNAi induced phenotypes lasts for up to two generations, while transcriptional
27
silencing effects can persist for many generations (Grishok et al. 2000; Vastenhouw et al.
2006). Multiple gene RNAi has also been demonstrated (Geldhof et al. 2006; Tischler et al.
2006; Gouda et al. 2010), that is, simultaneous down regulation of more than one target gene. In
contrast, specifically for animal parasitic nematodes, the efficiency of RNAi also depends on the
stability and level of transcript as well as the site of gene expression. The success rate for RNAi
is greater for genes expressed in the intestine, excretory cells and amphids than in the nervous
system (Samarasinghe et al. 2011). There are now a series of successful reports of gene
knockdown using RNAi in PPNs, but insensitivity of some genes to RNAi of these pests has
also been reported (Wheeler et al. 2012).
1.4.2 In vitro RNAi of PPN genes
PPNs are relatively difficult organisms to maintain and culture, and uptake of dsRNA was
difficult to achieve, hindering study of RNAi effects initially. A significant advance came with
the demonstration by Urwin et al. (2002) that PPNs could be induced to take up exogenous
dsRNA in solution with the addition of the neurostimulant octopamine, which induces
pharyngeal pumping in J2 worms so that they take up the external solution. This method known
as ‘soaking’ works reasonably well. Other components of soaking solutions can be added to
increase the efficiency of uptake of dsRNA in feeding experiments; these are spermidine and
gelatine. Other neurostimulants such as serotonin and resorcinol have also been used to
stimulate swallowing. Serotonin appears to cause pharyngeal contractions, and resorcinol
induces pharyngeal pumping, resulting in increased uptake of fluorescein isothiocyanate (FITC)
when used as a marker for ingestion of the external solution. However, prolonged exposure to
resorcinol is deleterious to M. incognita for incubation times longer than 4 hours (Rosso et al.
2005), and root lesion nematodes clearly do not tolerate it (Tan et al. 2013). There have been a
series of studies on in vitro feeding of PPNs targeting different genes, either individually or in
combination. These are summarised in Table 1.3.
Table 1.3: A summary of RNAi studies on PPN genes via in vitro RNAi and effects on
nematode infectivity and development.
Gene description Gene name or
Symbol
Nematode
species
Phenotype/Effect Reference
C-type lectin hgctl H. glycines Reduced transcript level.
41% less infection.
Urwin et al. 2002
Major Sperm Protein msp H. glycines Reduced transcript level
Cysteine proteinase Gpcp-I G. pallida A shift in sexual fate
(21% less females)
Hgcp-I H. glycines A shift in sexual fate
(25% less females)
Esophageal gland
proteins
Mi-crt
M. incognita
65% reduction in
transcript level
Rosso et al. 2005
Mi-pg-1 30% reduction in
28
transcript level
Cuticle and egg
development
Chitin synthase M. artiellia Defective hatching Fanelli et al.,2005
Extracellular matrix
proteins
Dual oxidase M. incognita 70% reduced egg mass
production
Bakhetia et al.
2005
Multiple functions Aminopeptidase H. glycines 61% reduced infection
on soybean roots
Lilley et al. 2005
Cell wall degrading
enzyme
Β-1,4,
endoglucanase
G. rostochiensis Reduced infection Chen et al. 2005
Amphid secreted
protein
ams-1 Reduced root invasion
Parasitism 16D10 M. incognita 74-81% reduced
infection
Huang et al. 2006
Ribosomal Protein Hs-rps-23 H. glycines Lethal Alkharouf et al.
2007
Larval molting Cathepsin L
cysteine
proteinase
M. incognita 60% less infection Shingles et al.
2007
Pharyngeal gland cell
proteins
hg-eng-1, hg-
syv46
H. glycines Reduced plant infection
establishment
Bakhetia et al.
2007
hg-gp, hg-cm,
hg-pel
Increased male to female
ratio
FMRFamide-like
Neuropeptide
Gp-flp-1, Gp-
flp-6, Gp-flp-12,
Gp-flp-14 and
Gp-flp-18
G. pallida Defective locomotion,
motor dysfunction and
increased neuronal
RNAi
Kimber et al. 2007
Esophageal gland
protein (Pectate
lyase)
Mi-gsts-1 M. incognita Decreased egg mass
production and 90%
reduction in transcript
level
Dubreuil et al.
2007
Esophageal gland
protein
Hspel2 H. schachtii 50% less infection and
decreased transcript
level
Vanholme et al.
2007
Esophageal gland
protein
Hg-pel-1
H. glycines
203-fold decrease in
transcript level
Sukno et al. 2007
Hg-4E02 51-fold decrease in
transcript level
Avirulence effector Cg-1 M. javanica Increased virulence on
tomato with Mi-1
Gleason et al.
2008
Dorsal pharyngeal
gland proteins
Dg13
H. glycines
High male to female
ratio.
Bakhetia et al.
2008
Dg14 High male to female
ratio.
Dg21 High nematode
establishment and male
to female ratio.
Esophageal gland
protein
Cellulose
binding protein
M. javanica 53-58% reduction in egg
mass production
Adam et al. 2008
Muscle (motor
proteins)
Bx-myo-3 and
Bx-tmy-1 B. xylophilus
Defective locomotion Park et al. 2008
Heat shock protein Bx- hsp-1 Lethality due to heat
sensitivity
Esophageal gland
protein
(endoxylanase)
Rsxyl R. similus 53-66% reduction in
plant infection
Haegeman et al.
2009
FMRFamide-like
Neuropeptide
Gp-flp-12 G. pallida Decreased transcript
level and inhibition of
migratory ability
Dalzell et al.
2010a Mi-flp-18 M. incognita
29
Microprocessors of
miRNAs
drsh-1 and
pash-1
M. incognita Lethal and abnormal
embryo
Dalzell et al.
2010b
Cell death
programming gene
Mi-ced-9 M. incognita 40% reduction in gall
formation
Gaeta et al. 2011
Esophageal gland
protein (Calreticulin)
Micrt-1 M. incognita Reduction in transcript
and plant infection
Arguel et al. 2012
Zinc finger protein Mi-Pos-1 M. incognita 85% reduced transcript
40% reduced hatching
Matsunaga et al.
2012
FMRFamide-like
Neuropeptide
Gp-flp-32 and
Gp-flp-32R
G. pallida 55% and 75% reduction
in transcript respectively
Atkinson et al.
2013
Muscle troponin C Mg-Pat-10 M. graminicola 91.8% inhibition in
mobility
Nsengimana et al.
2013
Muscle myofilament
calponin
Mg-Unc-87 M. graminicola 87.9% inhibition in
mobility
Muscle troponin C Pzpat-10 P. zeae 3.6-fold reduction in
transcript level
Tan et al. 2013
Muscle myofilament
calponin
Ptunc-87 P. thornei 29.9-fold reduction in
transcript level.
Pharyngeal gland cell
proteins
(endoglucanase)
Pv-eng-1 P. vulnus 88-98% reduced
transcript level. 54%
reduction in
reproduction rate.
Fanelli et al. 2014
In most cases in vitro feeding studies of dsRNA for single genes have shown promising results.
On the other hand, when dsRNAs of two or more different target genes are delivered together to
nematodes, it rather surprisingly results in less target suppression compared to when individual
dsRNAs were delivered (Bakhetia et al. 2008). Major focus of previous work has focussed on
knockdown of genes thought to be essential for parasitism and to understand effector
function(s). However, there has not been much work undertaken on down-regulation of genes
involved in the RNAi pathway: the one only study reported involved RNAi of drsh-1 and pash-
1 of M. incognita (Dalzell et al. 2010b).
1.4.3 Application of virus-induced gene silencing to PPN research
In addition to soaking in dsRNA and engineering plants to deliver gene silencing triggers
(Section 1.4.5), virus-induced gene silencing (VIGS) provides an additional approach to deliver
dsRNA triggers to nematodes in a transient manner. In VIGS, a virus is used as a vector to carry
cDNA of the gene of interest. While replicating its RNA, the virus replicates the target RNA
and so generates dsRNA to the cDNA sequence. Virus infection of cells therefore delivers
dsRNA of target genes to those cells. This dsRNA is processed by the plant antiviral machinery
to generate siRNAs, and this could result in targeting mRNA of the feeding nematode. VIGS is
one way to undertake a quick analysis of functions of nematode genes when taken up from a
plant. It has also been used to silence plant genes to study their functions without going through
lengthy and time consuming process of plant transformation (Burch-Smith et al. 2006).
30
Tobacco rattle virus (TRV) carrying M. incognita troponin C and calreticulin genes when
inoculated to tobacco plants induced dsRNA and siRNA triggers. RKNs infection of those
plants showed up to 90% reduction in transcript levels in eggs and 75% in the progeny. J2
nematodes of the progeny showed 63.5% and 84% fewer galls respectively when infected on
tomato plants (Dubreuil et al. 2009). A similar strategy was adopted for the M. javanica
NULG1a gene which codes for a secretory effector protein expressed in esophageal glands. It
resulted in a reduction of nematode infection by up to 88.8% on TRV infected tomato plants
(Lin et al. 2012).
Similarly, VIGS of the M. incognita mitochondrial ATP synthase b subunit gene (MIASB) in
tomato seedlings resulted in 64% fewer galls than controls on infection. These observations
suggest that the dsRNA triggers induced by VIGS can be taken up by nematodes, and
transported from the gut to target the gene for knockdown (Huang et al. 2014). VIGS can be
used to study the effects of gene silencing on PPNs or in systems they interact with, but VIGS is
not appropriate for developing resistance on a commercial basis.
1.4.4 The potential for PPN control using RNAi
Classical breeding for pest resistance is time consuming and requires large scale screening of
gene pools to find resistant genotypes. Achieving tolerance against plant pests/parasites through
transgenics is an attractive alternative approach because of its specificity and ability to work
with genes of multiple organisms. Inherent gene silencing mechanisms in plants allow an
appropriate transgene to produce dsRNA and convert it to siRNAs. This approach has been
explored to study the potential for host induced gene silencing (HIGS) and derived resistance to
control plant pests. This makes HIGS an exciting prospect for developing resistance to PPNs,
and research results support this concept as a viable alternative to provide host resistance for
crop protection. In contrast, transcriptional silencing of the dsRNA construct has also been
reported at variable levels both within and between T3 transgenic events in transgenic
Arabidopsis against nematodes (Kyndt et al. 2013).
HIGS is being studied from a number of angles, for example to evaluate long term effects of
gene knockdown and to assess the effectiveness of different constructs and target genes. Many
of such HIGS studies have made use of the model plant Arabidopsis, because it is a host for cyst
and root-knot nematodes (Sijmons et al. 1991; Wyss and Grundler 1992). However, in addition
to studies using plants like Arabidopsis and tobacco, HIGS has also been achieved for crop
plants like soybean, tomato and potato. A summary of the results available are provided in
Table 1.4.
31
Table 1.4: A summary of experimental studies using HIGS to control PPNs.
Plant Gene targeted Nematode
species
Effect of host
delivered knockdown
Reference
Arabidopsis
Secreted peptide
(16D10)
M. incognita 63% reduction in
infection and 69-83%
reduction in egg
production
Huang et al. 2006
Secreted peptide
(16D10)
M. javanica 63% reduction in
infection and 90-93%
reduction in egg
production
Secreted peptide
(16D10)
M. arenaria 63% reduction in
infection and 84-92%
reduction in egg
production
Secreted peptide
(16D10)
M. hapla 63% reduction in
infection and 69-73%
reduction in egg
production
Arabidopsis
Secreted peptide
(16D10L)
M. chitwoodi 68-74% reduction in
egg mass production
Dinh et al. 2014
Nematode effector
(NULG1a)
M. javanica 88% reduction in
infection
Lin et al. 2012
Ubiquitin-like
protein (4G06)
H. schachtii
23-64% reduction in
developed females
Sindhu et al. 2009
Cellulose binding
protein (3B05)
12-47% reduced
infection
SKP1-like protein
(8H07)
>50% reduced
infection
Zinc finger protein
(10A06)
42% reduced infection
Nematode secreted
peptide, Hssyv46
36% reduced cyst
formation
Patel et al. 2008
Nematode secreted
peptide, Hs5D08
20% reduced cyst
formation
Nematode secreted
peptide, Hs4E02
20% reduced cyst
formation
Nematode secreted
peptide, Hs4F01
55% reduced cyst
formation
Parasitism effector
(30C02)
92% reduced cyst
formation
Hamamouch et al.
2012
Parasitism gene
(Mi8D05)
M. incognita Up to 90% reduction in
infection
Xue et al. 2013
Tobacco
SNF chromatin
remodelling
complex component
(snfc-5) M. incognita
>90% reduction in
infection
Yadav et al. 2006
Pre-mRNA splicing
factor (prp-21)
>90% reduced
infection
Putative
transcription factor
MjTis11
M. javanica Decreased transcript
level in feeding
nematodes
Fairbairn et al.
2007
FMRFamide-like
gene (flp-14) M. incognita
Up to 86% reduction in
reproduction rate
Papolu et al. 2013 FMRFamide-like
gene (flp-18)
Up to 82% reduction in
reproduction rate
Serine protease gene
(ser-1)
30% reduced egg
production
de Souza Junior et
al. 2013
32
Cysteine protease
(cpl-1)
42% reduced egg
production
Soybean
Major sperm protein
H. glycines
68% reduction in cyst
formation
Steeves et al. 2006
Ribosomal protein
3a(rps-3a)
87% reduced cyst
formation
Klink et al. 2009
Ribosomal protein 4
(rps-4)
81% reduced cyst
formation
Spliceosomal SR
protein (spk-1)
88% reduced cyst
formation
Synaptobrevin (snb-
1)
93% reduced cyst
formation
Beta subunit of the
COPI complex
(Y25)
81% reduced cyst
formation
Li et al. 2010
Pre-mRNA splicing
factor (prp-17)
79% reduction in
infection
Uncharacterised
protein (cpn-1)
95% reduction in
infection
L-Lactate
dehydrogenase
M. incognita
57% reduced infection,
77% reduction in
nematode diameter
Ibrahim et al. 2011
Mitochondrial
stress-70 protein
(2% reduction in
infection,8% reduced
nematode diameter
ATP synthase beta-
chain mitochondrial
precursor
64% reduced infection,
62% reduced nematode
diameter
Tyrosine
phosphatise
95% reduced infection,
82% reduced nematode
diameter
Tomato
Troponin C (snc)
M. incognita
59% reduced hatching
from eggs Dubreuil et al.
2009
Calreticulin (crt) No effect after
silencing. Reduced
infection by the
progeny
Dual oxidase (duox) 61% reduced infection,
52% reduction in
saccate nematodes Charlton et al. 2010
Signal peptidase
complex 3 (spc3)
52% reduction in
infection, 63%
reduction in saccate
nematodes
Subunit of 19S
regulatory complex
(rpn-7)
Up to 66.5% reduction
in infection Niu et al. 2012
Subunit of 19S
regulatory complex
(rpn-7)
50.8% reduction in egg
production
Potato Secreted peptide
(16D10L)
M. chitwoodi 44-56% reduction in
egg mass production
Dinh et al. 2014
Grape (Hairy root) 16D10 M. incognita Significant reduction
in egg production
Yang et al. 2013
33
In addition to RNAi-based transgenic resistance, alternative transgenic strategies have also been
studied. One example of these is using nematode gut protease inhibitors, for example the rice
oryzacystatin-I gene, which conferred resistance when it was transformed into tomato hairy
roots: it also strongly reduced growth and development of G. pallida (Urwin et al. 1995). A
modified rice cystatin gene (oryzacystatin-IΔD86) expressed in A. thaliana reduced growth and
fecundity of both CNs and RKNs because of inhibition of cysteine proteinase activity in the
nematode intestine (Urwin et al. 1997a). Transgenic potato lines expressing a cysteine
proteinase inhibitor from sunflower showed 8-60% resistance against G. rostochiensis and G.
pallida (Urwin et al. 2003). Although extensive research is required before commercial
implementation (Fosu-Nyarko and Jones 2015), all these transgenic resistance studies indicate
great potential of this technology for crop protection against pests, to overcome problems like
the limited genetic base of natural resistance, use of harmful chemicals and hurdles of large
scale pest control.
1.5 Aims and objectives of this project
The overall aim of this project was to extend understanding and efficiency of the HIGS
approach to control PPNs. One promising new area of study is the down-regulation of genes
encoding proteins involved in the RNAi pathway, since these might well result in lethality or
loss of function and/or ability of the nematode to parasitise its host. Arabidopsis is a host for
RKNs, and as a model plant which can be transformed readily, it was chosen as a host plant for
this study. Thus the aim of this project was to evaluate the effects of RNAi of genes involved in
the gene silencing pathway itself on the survival and parasitic ability of RKNs. Since genes of
the RNAi pathway are part of a conserved biological mechanism, the effectors of small RNA
pathways in one species could be effective targets that might be used to control a whole genus
of parasites rather than a single species.
The specific objectives of the project were:
1. To apply comparative bioinformatics and molecular tools, and information available for
C. elegans and animal parasitic nematodes, to genes involved in the RNAi pathway of
RKNs, combined with using ESTs and genomic data available for M. hapla and M.
incognita.
2. To study the effect of down-regulating expression of the identified RNAi
genes/effectors via in vitro feeding of dsRNA on the survival and/or parasitism of M.
incognita.
3. To investigate the effect of using dsRNA corresponding to different parts of an RNAi
pathway gene as a trigger for down-regulation of expression and assess the effects on
34
nematode parasitism and reproduction and relative expression of other RNAi pathway
components.
4. To investigate the possibility of controlling M. incognita via host-induced
siRNA/dsRNA of RNAi effectors.
35
The following results Chapters of this thesis are presented in the form of draft
manuscripts with the following titles, which may be modified later for publication.
Chapter 2: IQBAL, S., FOSU-NYARKO, J. & JONES M. G. K. Genome level identification
and comparison of effectors of the RNAi pathway of the parasitic nematodes Meloidogyne
hapla, Meloidogyne incognita, Ascaris suum and Brugia malayi.
Chapter 3: IQBAL, S., FOSU-NYARKO, J. & JONES M. G. K. Identification of target genes
from among sRNA pathway effectors of M. incognita for nematode control via in vitro RNAi
Chapter 4: IQBAL, S., FOSU-NYARKO, J. & JONES M. G. K. Host-induced gene silencing
of RNAi effectors confers resistance against Meloidogyne incognita and affects development.
Chapter 5: IQBAL, S., FOSU-NYARKO, J. & JONES M. G. K. The effects of RNAi
treaments with different regions of the Dicer-like gene on the viability, parasitism and
reproduction of M. incognita.
With the above format, it is the intention that ‘Introduction’ sections will be modified
for individual publication.
36
Chapter 2
Genome level identification and comparison of
effectors of RNAi pathway of the parasitic nematodes
Meloidogyne hapla, Meloidogyne incognita, Ascaris
suum and Brugia malayi.
37
Genome level identification and comparison of effectors of the RNAi
pathway of the parasitic nematodes Meloidogyne hapla, Meloidogyne
incognita, Ascaris suum and Brugia malayi.
Sadia Iqbal, John Fosu-Nyarko and Michael G.K. Jones
Plant Biotechnology Research Group, School of Veterinary and Life Sciences, WA State
Agricultural Biotechnology Centre, Murdoch University, Perth, WA 6150, Australia
2.1 Abstract
Since the discovery of RNAi as an endogenous mechanism of gene regulation in a range of
eukaryotes from unicellular organisms to mammals, it has become important to study the
underlying mechanism for this phenomenon. Because RNAi is one of the most widely used
methods for functional genomics studies, detailed information is required about the effectors
that modulate its effectiveness. The aim of this study was to identify genomic and protein
differences between the model nematode C. elegans and four parasitic nematodes i.e. Ascaris
suum, Brugia malayi, Meloidogyne hapla and Meloidogyne incognita. A further aim was to
identify the specific genomic sequence IDs coding for the genes involved in the small RNA
pathways. The results indicate interesting differences in the effectors: some are absent in
genomic sequences of parasitic nematodes, especially genes involved in the amplification and
inhibition of RNAi. There were structural differences in protein domains of effectors of the free
living and parasitic nematodes. The absence of between 38-48% of the studied effectors in the
parasitic nematodes points towards the need for detailed study of these pathways. RNAi
experiments and proteomic studies that generate information about the small RNA processes
involved in the growth and development of these parasites will help map out the RNAi pathway,
explore the viral response specific to parasitic lifestyle if any, and possibly lead to development
of more robust control strategies based on specific knowledge of RNAi for these pests.
Keywords: RNAi, miRNA pathway, genome sequence, parasitic nematodes, C. elegans.
2.2 Introduction
RNAi or post transcriptional gene silencing (PTGS) includes various small RNA pathways i.e.
exo siRNA, endo siRNA and miRNA pathways. Apart from being important in development
and regulation of gene expression, endo siRNA and miRNA pathways are responsible for
silencing viral messages and transposable elements (Ketting et al. 1999). Since the detailed
discovery of RNAi mechanisms in C. elegans, it has become a model organism to study
functional roles of various genes. Extensive studies have been conducted to understand various
38
pathways and functions using RNAi to silence different genes in C. elegans (Shelton et al.
1999; Gonczy et al. 2000; Dudley et al. 2002; Gouda et al. 2010). It was only when Urwin et al.
(2002) showed that RNAi could be induced by soaking PPNs in specific solutions containing
dsRNA that further studies using this approach demonstrated a reduction in viability,
reproduction and ultimately parasitism, depending on the genes chosen for down-regulation
(Urwin et al. 2002; Bakhetia et al. 2005; Tan et al. 2013).
In recent years, an enormous amount of data has been generated using advanced genome and
transcriptome sequencing techniques making it possible to use bioinformatics tools to study in
detail the genetics of various organisms. Belonging to the same phylum, C. elegans and
parasitic nematodes have striking anatomical similarities. However, the parasitic behaviour of
these nematodes means some genes are specific to the parasitic life style and need to be further
explored. Between 35-70% of the C. elegans genes have been reported as having homologues in
28 parasitic nematode species making it a perfect candidate to use as a model in studying
various cellular functions and pathways for which some studies have been conducted before
(Parkinson et al. 2004; Rosso et al. 2009; Dalzell et al. 2011).
The overall aim of this study was to identify genes involved in the RNAi pathway of parasitic
nematodes, and to compare and contrast the gene structures involved in these pathways between
C. elegans and parasitic nematodes and also between animal and plant parasitic nematodes.
Available genome sequences of A. suum, B. malayi, M. hapla and M.incognita were compared
to well characterized C. elegans genes involved in the RNAi pathway. This analysis led to the
identification of RNAi pathway genes in parasitic nematodes. Differences in the proteins coded
by specific genes between the different nematode genera were also explored to provide a better
understanding of the function of these genes.
2.3 Materials and methods
2.3.1 Identification of effectors of RNAi of C. elegans
Sequences of the effectors of the RNAi pathway of C. elegans were used as a primary source to
identify orthologues in the parasitic nematodes, because these have been more highly
characterised than those of any other species. Genes encoding 87 effectors directly involved in
siRNA and miRNA processes of C. elegans were identified from the literature (Rosso et al.
2009; Dalzell et al. 2011; Kikuchi et al. 2011). The nucleotide sequences of these genes were
retrieved from Wormbase version WS241 (http://www.wormbase.org) and the National Centre
of Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov). The effectors were
grouped together, based on their functional roles in the RNAi pathway, into: those involved in
transport of silencing triggers (e.g. dsRNA, siRNA and miRNA), the Dicer and RISC
39
complexes, amplifiers of silencing signals, RNAi inhibitors, nuclear RNAi effectors and
argonautes.
2.3.2 Identification of genomic contigs of parasitic nematodes mapped to
RNAi effectors of C. elegans.
Coding sequences (mRNA) of C. elegans effectors were used to query the NCBI dataset
containing ESTs and whole genomic sequence/contigs databases of M. incognita, M. hapla, A.
suum and B. malayi with an expected value (e-value) cut-off of 10E-5. In cases where there
were no matching genomic contigs or the e-values were not significant for the C. elegans query,
sequences of effectors of parasitic nematodes were used for further confirmation in tblastx
searches: blastn and blastx were also used where required for further analysis and these are
indicated in the results. The resulting mapped contigs were retrieved with e-values, and bit
scores as an XML file and converted to csv for further analysis. To select contigs that
represented specific effectors, all matching contigs to effectors were aligned and the best match
coding for the protein domains similar to the query was used for further analysis.
2.3.3 In silico functional analysis of putative effectors of the parasitic
nematodes
Genomic contigs of any of the parasitic nematodes identified to contain RNAi effector
sequences were further analysed using a suite of bioinformatics tools. The aim was to determine
the presence of functional domains and conserved motifs that characterise specific effectors and
to determine their homology, structural and functional conservation among parasitic nematode
groups and that of C. elegans. Functional protein domains of these contigs as well as full-length
cDNA sequences of C. elegans effectors were analysed using the NCBI Conserved Domain
Search Service (Marchler-Bauer et al. 2009, Marchler-Bauer et al. 2011) using default settings
and Pfam 27.0 programme (http://www.pfam.sanger.ac.uk) using protein sequence queries with
an e-value cut-off of 1.0 (default). In all cases, and to confirm that genomic contigs significantly
matched effectors, and in specific cases where e-values were higher than the threshold, the
tblastx search of the genomic contigs was conducted using sequences of specific functional
domains of C. elegans effectors. Multiple sequence alignments to compare matching contigs or
orthologues of effectors were done using MultAlin (Corpet 1988). To obtain open reading
frames from genomic contigs for any protein analysis, the Open Reading Frame Finder
(http://www.ncbi.nlm.nih.gov/projects/gorf) and the Translate programme at Expasy
(http://web.expasy.org/translate) were used. The exon prediction for parasitic nematode Dicer
genes was done using FGENESH (Solovyev et al. 2006) and tblastx against corresponding C.
40
elegans proteins, whilst graphics were created on the Exon-Intron Graphic Maker version 4 at
wormweb.org. Protein graphics were generated using protein sequences in Pfam 27.0.
2.3.4 Phylogenetic analyses
Multiple alignments for protein sequences using clustal W were created in MEGA version 6
(Tamura et al. 2013). Neighbour-joining trees with bootstrapping 1000 replicates were created
based on those alignments. The RdRp domain was used for analysis of RNA-dependent RNA
polymerase genes while PIWI domain was used for argonautes in all nematodes.
2.4 Results
2.4.1 Genomic contigs and ESTs of M. incognita, M. hapla, A. suum and B.
malayi with homologies to effectors of C. elegans
From the literature and database (wormbase.org version WS241) 87 genes were identified as
involved in the RNAi pathway of C. elegans, out of which two argonautes SAGO-2 (Wormbase
ID: WBGene00018921) and PPW-1 (Wormbase ID: WBGene00018921), were found to have
the same nucleotide sequence submitted in the database under different gene names.
‘Discontinued genes’ (rde-3, M03D4.6 and C06A1.4) were also omitted from the list and the
remaining 83 genes were divided into different groups based on their functions in the RNAi
pathway of C. elegans.
For the 83 selected effectors of C. elegans, the percentage of full length genes mapped to
genome contigs/scaffolds and ESTs of A. suum was 1.2% and 0.23% respectively. This
percentage was 0.66% and 0.053% for B. malayi, 3% and 0.31% for M. hapla and 1.69% and
0.34% for M incognita. Genes having homologues or coding for similar proteins within the
genome of C. elegans mapped significantly (10E-5) to a large number of contigs for each of the
four parasitic nematodes. These were the argonautes, spreading proteins haf-6 and sid-3, and the
genes encoding zinc finger domains i.e. zfp-1 and zfp-2. For M. incognita, two genes belonging
to different functional groups were present on the same contig (CABB01000055) i.e. tsn-1 and
mut-7. Some of the genes of PPNs e.g. pash-1, vig-1 and smg-6 were only identified after
alignment with animal parasitic nematode (APN) orthologues indicating that these genes were
more closely related than to those of C. elegans. The number of significantly mapped sequences
for each gene and the contig ID/Accession No. of the sequence coding protein domains for
specific effectors in parasitic nematodes are listed in supplementary Table 2.1 (Appendix).
41
2.4.2 Small RNA transport proteins
Four groups of these have been characterised in C. elegans, including those with systemic RNAi
defective phenotypes (sid-1, sid-2, sid-3, sid-5), those with RNAi spreading defective
phenotypes (rsd-2, rsd-3, rsd-6), exportins (xpo-1, xpo-2, xpo-3) and the haf-6 gene. A blastn,
blastx and tblastx analysis of the whole genome scaffold and contig sequences revealed that
three sequences of A. suum (AMPH01007595; ANBK01003199; AEUI01011716) and one of B.
malayi (AAQA01000131) had significant similarity to sid-1 of C. elegans. A further assessment
of these sequences indicated the presence of a type of sid-1 RNA channel similar to that present
in sid-1 of C. elegans. The amino acid sequence similarity is presented in Figure 2.1A. No ESTs
or genomic contigs of either M. incognita or M. hapla matched significantly to the sid-1 full
length gene sequence or the signature sequence of the SID-1 RNA protein. Also, no sequence
(ESTs or genomic contigs) for any other plant parasitic nematode at NCBI was significantly
similar to sid-1 sequence. Similarly, no contig of any of the four parasitic nematodes matched
significantly to the sid-2 gene of C. elegans. The C. elegans gene sid-3 encodes a protein
tyrosine kinase (PTK) domain together with an Src homology 3 (SH3) and a GTPase binding
domain responsible for efficiently importing dsRNA into cells (Jose et al. 2012). Protein
tyrosine kinases are the second largest family of proteins in C. elegans, with 411 identified
homologues (Plowman et al. 1999). It was therefore not surprising that a large number of
genomic contigs of all the four parasitic nematodes mapped significantly to this gene i.e. 100 for
A. suum, 59 for B. malayi, 26 for M. hapla and 30 for M. incognita. Protein domain analysis on
these contigs confirmed the absence of SH3 domain from all of those contigs. However, the
GTPase binding domain, together with the PTK domain, was found in three whole genome
sequences for A. suum (ANBK01007000; AMPH01017683; AEUI02000893), 2 for B. malayi
(AAQA01000282; CAPY01003672) and one each for each of the Meloidogyne spp.
(ABLG01000030; CABB01000892). As was the case for sid-2, no orthologues were found in
the genomic contigs of the four parasitic nematodes for sid-5.
Of the three RNAi spreading defective genes in C. elegans, sequences matching only rsd-3 were
identified for all four parasitic nematodes. Identified contigs contained the epsin amino-terminal
homology (ENTH) motif typical of the rsd-3 gene of C. elegans and cytosolic proteins of plants
which are involved in vesicle trafficking (Holstein and Oliviusson 2005). No orthologues of
rsd-2 and rsd-6 were identified in the EST and genomic contig databases for the four parasitic
nematodes considered in this study and also all other PPNs.
Contigs of A. suum, B. malayi, M. incognita and M. hapla with significant matches to the three
exportin genes of C. elegans were analysed for the presence of functional protein domains. They
were all identified in APNs but for the two RKN species only two contigs were found.
42
Functional domain analysis for M. hapla contigs ABLG01001363 and ABLG01000755
confirmed the presence of xpo-1 and xpo-2 as the two contigs had all the protein domains for
these two genes, while M. incognita contig CABB01000462 coded for xpo-2. Interestingly,
detailed analysis revealed that when two M. incognita contigs, CABB01002745 and
CABB01004119 were re-assembled, the super contig matched completely to the full length C.
elegans xpo-1 mRNA (Figure 2.1B). There was no contig found coding for the xpo-3 gene in
the two PPNs.
(A)
(B)
The haf-6 gene is a member of the ATP binding cassette (ABC) transporter gene family, and the
C. elegans genome encodes 60 proteins with ABC transporter domains (Sheps et al. 2004).
Unsurprisingly, a large number of contigs of A. suum (95), B. malayi (32), M. hapla (14) and M.
incognita (17) mapped to this gene. Parasitic nematodes such as A. suum, B. malayi and
C. elegans Xpo1
C. elegans Xpo2
C. elegans Xpo3
Mi (CABB01004119 + CABB01002745)
Mi (CABB01000462)
Mh (ABLG01001363)
Mh (ABLG01000755)
Figure 2.1: (A) Conserved signature amino acids of sid-1 RNA channel in C. elegans with
mapped contigs of A. suum (As) and B. malayi (Bm). (B) Protein domain architecture of the
three exportins of C. elegans (Ce) compared to two contigs each of the M. incognita (Mi) and
M. hapla (Mh) revealing that they are xpo-1 and xpo-2.
43
Meloidogyne spp. are known to be susceptible to environmental RNAi, and although there are
degrees of susceptibility, they seem to have a smaller but similar repertoire of genes involved in
dsRNA uptake and spread.
2.4.3 The Dicer and associated genes
The Dicer gene plays a central role in RNAi pathways of eukaryotes. For organisms which
encode only one dicer, it is responsible for processing all forms of dsRNAs into small RNAs,
including siRNAs and miRNAs. The Dicer-1 of C. elegans was used to identify, characterise
and compare the structures of dicers in the parasitic nematodes. The lengths of the predicted
pre-mRNA for both M. incognita and M. hapla dcr-1 are similar to that of C. elegans although
they have slightly more exons (Figure 2.2A).
Genomic contigs with the most sequence identity to C. elegans dcr-1 were CABB01000157
(42843 bp) for M. incognita, ABLG01001138 (50884 bp) for M. hapla, CAPY01005536
(830985 bp) for B. malayi and ANBK01006853 (13709 bp), AMPH01008524 (10740 bp) and
AEUI02001038 (51650 bp) for A. suum. The drh-1 and drh-3 genes of C. elegans have three
similar functional domains each i.e. DEXDc (DEAD-like helicase), HELICc (Helicase C-
terminal domain) and RIG-1_C-RD (C-terminal domain of RIG-1). Although the mRNA
sequences of drh-1 and drh-3 were significantly identical to contigs of the four parasitic
nematodes, functional analysis revealed striking differences in the protein domains of these
genes. Whereas these contigs had the DEXDc and HELICc domains, the RIG-1 domain was
conspicuously missing in contigs matching to drh-1 of C. elegans. In drh-1 and drh-3 of C.
elegans, there is only 24% identity between the RIG domains. A detailed analysis of whole
genome contigs of the parasitic nematodes as well as ESTs and with those of H. glycines, B.
xylophilis and H. contortus indicated that this domain is absent in available sequences of
parasitic nematodes.
Unlike rde-4 which encodes two dsRNA binding motifs and did not match significantly to
whole genome contigs of any of the four parasitic nematodes, contigs mapping to C. elegans
argonaute rde-1, were 14 for A. suum, 12 for B. malayi and four each for M. hapla and M.
incognita: nematodes have a suite of argonaute proteins as important players of gene silencing.
The only functional domain of pir-1 that is ‘Dual specificity phosphatase catalytic domain’, was
identified in six contigs of A. suum, six for B. malayi, two for M. hapla and three for M.
incognita.
44
D. melanogaster DCR1
D. melanogaster DCR2
A. thaliana DCL1
A. thaliana DCL2
A. thaliana DCL3
A. thaliana DCL4
(A)
(B)
(C)
Nematode Exons Unspliced
Gene (bp)
C. elegans dcr-1
27
8,420
M. hapla dcr-1
34
8,465
M. incognita dcr-1
35
8,393
B. malayi dcr-1
40
19,640
A. suum dcr-1
40
32,216
Figure 2.2: (A) Graphical representation of dcr-1 gene of C. elegans compared to the four
parasitic nematodes with gaps indicating intron regions (Scale=1000 bp). The seven protein
domains are DEXDc. Helicase C-Terminal (Helicase CT), Dicer Dimer, PAZ, two Ribonuclease
III C-terminal domains (Ribo III-CT) and double stranded RNA binding motif (DSRM).Whole
genomic contigs mapped to C. elegans dcr-1 were used to predict protein domain coding regions
(coloured) in the contigs of M. hapla (ABLG01001138), M. incognita (CABB01000157), B.
malayi (CAPY01005536) and A. suum (AEUI02001038; AMPH01008524; ANBK01006853).
Number of exons and the unspliced sequence length (bp) are also indicated. (B) Drosophila
melanogaster protein domain architecture for the two Dicers. (C) Differences in the protein
domain architecture between the four Arabidopsis thaliana Dicer-like (DCL) gene products.
45
The best matching contigs of A. suum (AEUI02000028), B. malayi (AAQA01000005), M. hapla
(ABLG01000521) and M. incognita (CABB01000477) to the mRNA sequence of C. elegans
Drosha (drsh-1) encode the drsh-1 specific protein domains; two Ribonuclease III C terminal
domains and a double stranded RNA binding motif (DSRM). The closest matches for the drsh-1
cofactor Pasha (pash-1) in the four parasitic nematodes had low total bit scores and coverages:
154 (15%) for A. suum, 155 (12%) for B. malayi, 161 (15%) for M. hapla and 161 (15%) for M.
incognita contigs. However, when the characterized pash-1 gene of A. suum (HQ611976) was
used as query to identify this gene in B. malayi, M. hapla and M. incognita, it mapped to the
same contigs but with better identity scores indicating they are more closely related to each
other than to C. elegans.
2.4.4 RNA-induced silencing complex (RISC)
The four known proteins that interact to form the RISC complex in C. elegans are ain-1, ain-2,
tsn-1 and vig-1. Both of the alg-1 interacting proteins ain-1 and ain-2 encode an M domain (M
domain of the protein GW182). Apart from B. malayi contig (AAQA01000363) coding for ain-
1, there were no significant matches for these two genes in any contigs or ESTs of the four
parasitic nematodes when the ain-1 coding sequence of B. malayi was used as query to search
for matches in A. suum, M. hapla and M. incognita. Significant matches were identified only for
contigs of A. suum but protein domain analysis revealed that those sequences did not code for
the M domain.
The C. elegans tsn-1 gene encodes six functional protein domains (Figure 2.3); four SNase
(Staphylococcal nuclease) domains arranged in tandem followed by a Tudor domain fused with
a fifth SNase domain at the C-terminus. These domains are not significantly identical to each
other: the second and fourth SNase domains have the highest total score of only 27%. Contigs
with high identities to the mRNA sequence of tsn-1 of C. elegans are present amongst contigs of
all the four parasitic nematodes. Protein domain analysis revealed the presence of both types of
functional domains in all the contigs but with a lower identity score for the Tudor domain of M.
hapla and M. incognita compared to that of C. elegans. There seems to be structural differences
in proteins of the different nematodes where C. elegans and M. incognita have five SNase
domains all seemingly arranged similarly. But all contigs analysed for M. hapla, B. malayi and
A. suum indicate the presence of only the four SNase domains, each missing particularly the
fifth domain fused to the Tudor domain which is present in C. elegans and M. incognita (Figure
2.3A).
The functional significance of these differences, if indeed it is the case, is not known and like
many other differences, need to be investigated further. Interestingly, the M. incognita whole
46
genome contig CABB01000055 is 63,544 bp long and encodes the functional domains of the
tsn-1 gene as well as mut-7, nuclear RNAi effector, which in C. elegans is located on a different
chromosome.
The vig-1 gene was identified in whole genome sequences of A. suum (AMPH01002339) and B.
malayi (AAQA01001685), but not for PPNs. However, when the identified vig-1 domain of this
B. malayi contig was used as a query, contig ABLG01000254 of M. hapla and contig
CABB01000081 of M. incognita were identified, but with very low identity scores. Detailed
analysis of these contigs confirmed the presence of the mRNA binding protein domain
HABP4_PAI-RBP1 similar to that of C. elegans and the animal parasitic nematodes
Schistosoma japonicum (Q5DA16) and Schistosoma mansoni (Q9N2M6).
2.4.5 RNAi amplification
Seven genes encoding proteins involved in the siRNA amplification process have been
described in C. elegans. These are ego-1, rrf-1, smg-2, smg-5, smg-6, rde-10 and rde-11. The
genes ego-1 and rrf-1 of C. elegans have only one RdRp domain (77% nucleotide similarity and
59% amino acid identity between them) are both present on chromosome I, only 0.9 kb apart
(Sijen et al. 2001). Consequently the same genomic contigs of the parasitic nematodes matched
significantly to both C. elegans rrf-1 and ego-1 (total bit scores between 497-1760); three each
for A. suum and B. malayi, two for M. hapla and four for M. incognita. All of these sequences
had the RdRp domain with the signature motif ‘DbDGD’. The full length mRNA sequences of
both genes were covered in most of contigs and scaffolds of the parasitic nematodes.
Contigs encoding genes similar to the smg-2 were found in sequences of all the four parasitic
nematodes and contained all three functional domains (AAA_30, AAA_12 and UPF1_Zn_bind)
typical of the C. elegans smg-2 gene. The C. elegans smg-6 matched with significant identities
to A. suum and B. malayi sequences. The best matching contigs for M. hapla (ABLG01000285)
C. elegans TSN1
M. incognita TSN1
M. hapla TSN1
A. suum TSN1
B. malayi TSN1
Figure 2.3: Protein domain analysis of nematode TSN1 indicating the missing
Staphylococcal nuclease (SNase) domain after the Tudor domain in M. hapla, A. suum and B.
malayi.
47
and M. incognita (CABB01000011) had insignificant e-values of 0.029 and 0.012 respectively.
However, when smg-6 coding sequence of B. malayi was used as a query, significant matches
were identified in contigs of M. incognita and M. hapla. These had the signature functional
domains present in C. elegans smg-6 namely EST1, EST1 DNA binding domain and PINsmg6
domain. No genomic contig, scaffold or EST of any of the parasitic nematodes was similar or
identical to the full length mRNA sequences of C. elegans smg-5 (or its endcoded domain PIN
smg5) or two other genes involved in RNAi amplification, rde-10 and rde-11.
2.4.6 RNAi inhibitors
Although their function is not exclusive to inhibition of RNAi, 13 such genes for which loss of
function increases the sensitivity of RNAi, have been investigated in C. elegans. These are
enhanced RNAi phenotype genes (eri-1, eri-3, eri-5, eri-6/7, eri-9), adenosine deaminase acting
on RNA genes (adr-1, adr-2), XRN (mouse/S. cerevisiae) ribonuclease related genes (xrn-1,
xrn-2), the RdRp containing genes rrf-3, lin15-b, gfl-1 and zfp-2.
The eri-1 gene in C. elegans which removes the 2 nt overhangs at 3′ ends of siRNAs thereby
restricting uptake by the RISC, has two functional domains i.e. SAP which is a putative
DNA/RNA binding domain and ERI-1, a DEDDh 3′-5′ exonuclease domain. Spliced mRNA
sequence of eri-1 mapped significantly to three contigs each for A. suum and B. malayi, one of
M. hapla and two of M. incognita. Also it appeared that contigs of B. malayi, M. hapla and M.
incognita do not encode the SAP domains (Figure 2.4A). Whether this represents a functional
difference or divergence in the gene is not known.
Only one and two contigs respectively for A. suum and B. malayi were significantly identical to
eri-5 of C. elegans: all encoded the Tudor domain typical of this gene. The tudor domain of eri-
5 is completely different in terms of amino acid sequence from the Tudor domain of ekl-1 which
is a nuclear RNAi effector and tsn-1 gene of the RISC complex. However, no contigs or ESTs
of M. hapla or M. incognita were found to encode a Tudor protein domain. In C. elegans, the
eri-6/7 mRNA is formed by trans-splicing of two pre-mRNAs eri-6 and eri-7 (Fischer et al.
2008) and encodes two P loop motifs designated as AAA_11 and AAA_12. These P loop motifs
are also present in the smg-2 gene designated as AAA_30 and AAA_12 but have different
amino acid sequences than the eri-6/7 domains. The eri-6/7 mRNA mapped significantly to A.
suum and B. malayi contigs. Out of the 83 effectors of RNAi analysed in this study, the eri-6/7
gene was the only gene not present in both Meloidogyne spp., although it was in M. hapla
(ABLG01001054). The genes eri-3 and eri-9 of C. elegans had no significant matches to any of
the four parasitic nematodes.
48
The rrf-3 gene has been reported as an inhibitor of RNAi in C. elegans and rrf-3 mutants with
enhanced sensitivity to RNAi have been used in several experiments to assess effects of
knockdown of several genes. One hypothesis is that it competes with ego-1 and rrf-1 for
components of the RNAi machinery (Simmer et al. 2002). Although C. elegans rrf-3 is quite
different from ego-1 and rrf-1 (58% and 57% identity respectively), the same contigs of the
parasitic nematodes (four for M. incognita, two for M. hapla, ten for A. suum and seven for B.
malayi) matched to all three genes. This must be because both the genes and the contigs code
for RdRp domains. To explore the identity of the RdRp domains of these genes and the contigs,
a phylogenetic tree was constructed using translated amino acid sequences of the domains.
Contigs coding for 100% identical RdRp domains were excluded, and RdRp domains of the
same genes in C. brigssae and C. ramenei were included in the analysis (Figure 2.4B). The tree
indicates close relationships of ego-1 and rrf-1 both of which are distantly related to rrf-3. One
RdRp each for A. suum (ANBK01005062) and B. malayi (CAPY01003132) clustered with rrf-3
of C. elegans whereas two each for these species clustered with the rrf-1 and ego-1 RdRps of
Caenorhabditis spp. It appears the RdRps of the PPNs are distantly related to those of the free
living nematodes. While it may be safe to suggest the presence of ego-1 and rrf-1 in the genome
of the APNs, it was not possible to distinguish the RdRps of the PPNs.
The effector gfl-1 was conserved in all four parasitic nematodes. The genes xrn-1 and xrn-2 are
5′-3′ exoribonucleases similar in their protein functional domain architecture. They code for the
same Xrn_N domains which in C. elegans has 52% similar amino acids. Both of these inhibitor
sequences mapped to significantly matching contigs of four parasitic nematodes. Two contigs
for M. incognita (CABB01001503; CABB01003205) mapped to different parts of the C.
elegans xrn-2 completing the full length gene. Further analysis suggested that APNs have both
of these RNAi inhibitors but PPNs possess one of them, which based on the e-value and total
scores was xrn-2.
The adr-1 gene of C. elegans has three functional domains i.e. two DSRM and one Adenosine-
deaminase (A_deamin) domain while adr-2 has one DSRM and one A_deamin domain which
suppresses RNAi by deaminating transgenic dsRNA. A. suum contig (AMPH01003945) that
mapped to adr-1 codes for one DSRM domain with low identity to C. elegans DSRM while the
whole genome scaffold AMPH01015223 mapped for adr-2 codes for the A_deamin domain
only. These results were similar for B. malayi contigs mapping to adr-1 and adr-2. There was
no significant match of any contig of Meloidogyne spp. to the C. elegans adr-1 or adr-2 (Figure
2.4C).
49
(A)
(B)
(C)
Figure 2.4: (A) Protein domain composition of the RNAi inhibitor ERI1 of C. elegans
compared to that of parasitic nematodes. (B) Phylogenetic analysis of the RNA-dependent
RNA-polymerase genes of C. elegans, A. suum (As), B. malayi (Bm), M. hapla (Mh) and M.
incognita (Mi). The Neighbour-joining tree was constructed based on ClustalW alignment of
RdRp domain sequences. (C) Protein domain architecture of the inhibitor gene adr-1 and adr-2
of C. elegans compared to that of the two animal parasitic nematodes.
50
C. elegans mutants of lin-15b are more sensitive to RNAi. This gene encodes a protein that
contains the THAP functional domain, which is a putative DNA-binding domain. Neither the
gene sequence nor the THAP domain matched significantly to any contig or EST of the four
parasitic nematodes. The full length mRNA of C. elegans zfp-2 mapped significantly to 40
genomic contigs of A. suum, 100 contigs of B. malayi, 17 of M. hapla and 20 of M. incognita.
The reason for this large number of matching contigs is that the zinc finger proteins are amongst
the most abundant proteins in eukaryotic genomes and are needed for stabilising other protein
structures and as part of several transcriptional factors (Haerty et al. 2008).
2.4.7 Nuclear RNAi effectors
Expressed in both the cytosol and the nucleus, 17 C. elegans genes are known to play vital roles
in the nuclear RNAi process. Eight of these were not identified from genomic contigs or ESTs
of any of the parasitic nematodes. These were the nuclear RNAi defective genes (nrde-1, nrde-2
and nrde-4), rde-2, the mutator phenotypic genes (mut-2, mut-7), mes-3 and two enhancers of
ksr-1 lethality (ekl-1 and ekl-5). Three contigs for A. suum and two for B. malayi and one each
for M. hapla and M. incognita mapped to C. elegans ekl-4 and they all encode for the gene
specific DMAP1 functional domain. For ekl-6 gene, two contigs each for the animal parasitic
nematodes mapped to C. elegans ekl-6 and encode for the DUF2435 protein domain. This gene
was not found in the contigs of PPNs.
The gene mut-7 was identified in contigs of all the four parasitic nematodes. The domain mut-7
characteristic of the gene was less identical to the one identified in contig CABB01000055 for
M. incognita. For the six effectors mut-2, mes-2, mes-6, cid-1, rha-1 and zfp-1, significantly
matching contigs of the parasitic nematodes contained all the functional domains typical of
these genes. Nuclear RNAi defective (nrde) genes in C. elegans have been associated with
heritable RNAi. Interestingly, there is no detailed study on heritable RNAi in parasitic
nematodes although there are suggestions of persistence of gene knockdown in some percentage
of root-knot nematodes in some studies.
2.4.8 Argonautes
Twenty-eight argonautes which function at different stages of the RNAi and miRNA pathways
in C. elegans have been reported (Yigit et al. 2006). Since then rde-3 has been renamed mut-2, a
nuclear RNAi effector and M03D4.6 and C06A1.4 have been designated as pseudogenes: these
were excluded from the analysis. Also during the analysis, it was found that ppw-1 and sago-2
sequences were identical, and so one was excluded leaving 24 argonaute sequences for study.
These were analysed for the presence of functional protein domains: five of them (alg-1, alg-2,
51
alg-4/tag-76, T22B3.2, T23D8.7) encode PAZ, PIWI and another domain known as DUF1785.
The C04F12.1, ZK218.8 and ZK1248.7 genes encode only the PIWI domain while the rest
(R06C7.1, F58G1.1, rde-1, C16C10.3, ppw-1/sago-2, ppw-2, sago-1, csr-1, T22H9.3, ergo-1,
prg-1, prg-2, F55A12.1, nrde-3, Y49F6A.1, C14B1.7) code for both PAZ and PIWI domains.
Using full-length sequences of the C. elegans argonautes, a total of 13, 10, 13 and 16 contigs
respectively for A. suum, B. malayi, M. hapla and M. incognita were identified with significant
alignment scores. This means 11 unique sequences for A. suum, six for B. malayi, ten for M.
hapla and 11 for M. incognita were used to analyse the presence of PAZ/PIWI domains and for
constructing phylogenetic tree with argonautes of C. elegans. As with the C. elegans genes, all
the contigs of parasitic nematodes have the conserved PIWI domain. The cladogram shows the
phylogenetic relationship between C. elegans and both parasitic groups of nematodes based on
the PIWI domain (Figure 2.5).
Based on sequence similarity, there are distinctly different sub clades for example, in clade 1,
where alg-1, alg-2 and T 23D8.7 are relatively similar to sequences of each of the parasitic
nematodes. The PIWI domains of C. elegans argonautes appear to be distantly related to those
of the four parasitic nematodes. In both clades 2 and 6, generally, sequences of the parasitic
nematodes appear more closely related to each other than those of C. elegans. There appears to
be a clear distinction in clade 3 where no argonaute of parasitic nematodes clustered with the
five C. elegans argonautes (F58G1.1, PPW2, ZK1248.7, R06C7.1, F55A12.1) that are involved
in transcriptional silencing and germline RNAi while only A. suum PIWI coded by the contig
AMPH01002307 displayed homology to the argonaute ERGO1 in the sub clade 7. Argonautes
involved in nuclear RNAi (nrde-3, C16C10.3, T22H9.3, Y49F6A.1) define a clade on their own
but do appear to be distantly homologous to one argonaute each for the four parasitic
nematodes.
52
Figure 2.5: Neighbour-Joining cladogram based on the conserved PIWI domain of all
argonaute sequences in C. elegans and four parasitic nematodes A. suum (As). B. malayi (Bm),
M. hapla (Mh) and M. incognita (Mi). Contig IDs of the sequences coding for the argonaute
proteins are indicated in parenthesis.
2.5 Discussion
The aim of the work presented in this chapter was to study the various components of the sRNA
pathways of parasitic nematodes, to explore the similarities and differences that exist when
compared to the model nematode C. elegans. The analysis shows that out of the 83 genes
described in the RNAi and miRNA pathway of C. elegans, only 49 homologous sequences were
found in the available genomic contigs of A. suum, 45 in B. malayi contigs, and 40 each in M.
hapla and M. incognita contigs, with the majority displaying conserved protein domain
architecture. Protein domain similarity and identity scores for these genes indicate that PPNs are
more similar to APNs than to C. elegans, only in relation to the whole genome sequences
analysed for RNAi pathway genes (Appendix-Supplementary Table 2.2).
1 6
2
4
3
7
5
53
Among the sequences analysed, the Dicer-1 was the most conserved protein, with its seven
domains present in all the nematodes studied. All eukaryotes displaying RNAi ability have
Dicer-like genes involved, with four classes in Arabidopsis, two in insects and fungi and one
characterised for mouse and humans. Homology studies identified differences in the functional
domains of Dicer-like genes of the five nematodes compared to those of other organisms. There
were differences in the length of the genomic sequences and the number of exons coding for the
protein. These suggest structural differences in the dicers even though they appear to encode
similar protein domains. It is possible that the distance between the PAZ and ribonuclease III
domains of the dicer protein, which is a measure of the size of siRNAs produced (MacRae et al.
2006), may be responsible for the different sizes of siRNAs generated by C. elegans (~22-23 bp,
Ketting et al. 2001) and those produced by plants (21, 22 and 24 bp for Arabidopsis). The
length of siRNAs produced by parasitic nematodes has not been investigated yet and the
identification and characterisation of sequences potentially encoding the dicer of PPNs such as
undertaken in this study, is the first step for characterising in detail the functions of dicer in
development in PPNs.
The C. elegans dicer has been associated with rde-1 and rde-4, the mutants of which
demonstrate a complete absence of RNAi response to foreign dsRNA (Tabara et al. 1999;
Tabara et al. 2002). However, these two essential genes were absent from all of the parasitic
nematodes. This indicates a possible alternative mechanism for dsRNA retention in these
nematodes for example, in Drosophila, RISC contains DCR-2 protein as part of the complex
and appears to play a role in retaining the dsRNA that enters the cell thereby maintaining an
unprocessed pool of dsRNA (Kim et al. 2007; Shih and Hunter 2011).
In plants, insects and C. elegans, the RNAi pathway delivers robust antiviral response. In C.
elegans the DRH-1 protein has a RIG-I domain which senses and binds viral single-stranded
RNA (Lu et al. 2009). This domain in vertebrates also binds to viral RNA bearing 5′-phosphates
triggering antiviral responses (Rehwinkel et al. 2010). The parasitic nematodes studied here all
lacked a detectable RIG-I domain in the drh-1 sequence. Mutation in the drh-1 in C. elegans
leads to the loss of antiviral response and it is suggested that this protein may act at the top of
the antiviral response cascade triggering an immune response (Ashe et al. 2013). This disparity
points towards an alternate mechanism for recognition of viral RNA and resulting RNAi-based
antiviral response mechanisms for this group of nematodes. Mutants of rde-1 and rde-4 in C.
elegans are more susceptible to virus replication while rrf-3 and eri-1 mutants have increased
antiviral response (Lu et al. 2005; Wilkins et al. 2005).
The orthologues of rde-1, rde-4 and rrf-3 which are involved in the antiviral defence
mechanism appear to be missing in the genomic sequences of all four parasitic nematodes.
54
These nematodes also lacked the SAP domain in the sequence coding for the gene eri-1. Yeast
assays show that the SAP domain is responsible for binding dsRNA and that ERI-1 or the SAP
domain when expressed separately do not result in dsRNA degradation (Iida et al. 2006). This
perplexing difference in the proteins affecting antiviral response in these parasitic nematodes
requires further investigation to explore their role in this pathway if any. Another possible
explanation could be that the parasitic nematodes, specifically those included in this study, live
in a confined environment i.e. inside a host and so are less exposed to hostile environments,
possibly resulting in a loss of robust antiviral defences.
Comparative analysis also showed differences for RNAi spreading genes between C. elegans
and parasitic nematodes. For PPNs, the absence of sid-1, sid-2 and other spreading proteins
seem to have no effect on dsRNA uptake by soaking which when absent in C. elegans, impairs
RNAi. This indicates that other mechanisms or unidentified genes may also be involved in this
process. It is also possible that sid-3, rsd-3 and haf-6 proteins, which are present in both of these
plant parasitic nematodes, have evolved to play the role of spreading dsRNA through tissues,
although SID-3 lacks two of the protein domains SH3 and GTPase which are involved in signal
transduction and protein binding. Effectors of the miRNA pathway seem to be more conserved
even though ain-1 and ain-2 were not found in any of the parasitic nematodes except B. malayi
in which ain-1 was present. These two proteins of the RISC machinery seem to be specific to
C. elegans only. Immunoprecipitation and microarray analysis indicates the association of these
two RISC proteins exclusively with miRNAs (Zhang et al. 2007).
In C. elegans, RNAi has been shown to persist in the next progeny, and this effect is proposed
to be dependent on amplification of a trigger (Alcazar et al. 2008). This germline amplification
effector (ego-1) is present in all the four parasitic nematodes, but the nuclear RNAi effectors
nrde-1, nrde-2 and nrde-4, which are the core components carrying out heritable RNAi in C.
elegans, were not found. The nrde-3 gene, which encodes the argonaute responsible for
localising secondary siRNAs to the nucleus, was also one of the argonautes that had low
significant matches to the argonautes of parasitic nematodes. This suggests a large divergence or
the complete absence of this effector and the possibility of absence of heritable RNAi in these
species, although this aspect has not been investigated experimentally.
Argonaute proteins show a striking contrast in numbers, with 24 in C. elegans and fewer than
half of these proteins in the parasitic nematodes. Overall there were fewer argonaute proteins
and less conservation in nuclear, germline and transcription related argonautes, which suggests
differences in these mechanisms/biological processes. It is possible that argonautes of parasitic
nematodes act as convergent points for the various processes involved, or carry out more than
one function in the sRNA pathways with the aid of other associated proteins.
55
Table 2.1 summarises the small RNA effector repertoire in C. elegans compared to the four
parasitic nematodes studied here with already published data of Pratylenchus coffeae,
Globodera pallida and Bursaphelenchus xylophilus. Despite their morphological similarities,
and more than 40% highly homologous genes to C. elegans, parasitic nematodes have a
completely different life style (Hashmi et al. 2001). The remaining 60% of the predicted genes
have probably diverged more when compared to C. elegans, or belong to a completely different
set reflecting their parasitic nature, and the requirement to counteract host defence mechanisms
for successful parasitism. The presence of eri-6/7 in M. hapla in the genome sequences and
absence of the same in sequences of the closely related M. incognita is striking if infact this is
the case, since RNAi is a conserved mechanism. Phylogenetically, M. incognita and M. hapla
belong to different clades and have different modes of reproduction (De Ley et al. 2002). M.
incognita reproduces by mitotic parthenogenesis whereas M. hapla can exhibit both mitotic and
meiotic parthenogenetic modes of reproduction (Bert et al. 2011). Since they have a more
complicated lifestyle with different moults and developmental phases, the endo-RNAi and
miRNA pathways of parasitic nematodes may be more sophisticated as was initially proposed,
when compared to that of C. elegans.
The disparities between the RNAi effectors of C. elegans and the four parasitic nematodes
studied here indicate wide differences between these nematodes at the sRNA level. Parasitic
nematodes such as PPNs can affect host gene expression, but the precise mechanisms involved
are still under intense research. The absence of 34 to 43 RNAi effectors in the genomic
sequences of parasitic nematodes compared to those present in C. elegans requires explanation
through further functional studies. A host of argonautes performing different functions in the
small RNA pathways of C. elegans, but missing in parasitic nematodes, may indicate a more
complicated mechanism and diversity of effector functions for these nematodes, and also the
possibility of involvement of as yet unidentified genes. On an evolutionary basis, C. elegans
may show high conservation of all members of a protein family with the parasitic nematodes,
but it is possible that the parasitic nematodes have more conserved protein families among
them. Another possibility for absence of sRNA pathway genes in parasitic nematodes may be
that the sequences have diverged so much that it is not possible to identify them using only
sequence-homology-based programmes.
56
Table 2.1: Comparison of the RNAi pathway genes of four parasitic nematodes with the published data
of G. pallida, B. xylophilus and P. coffeae (Cotton et al. 2014; Kikuchi et al. 2011; Burke et al. 2015).
C. elegans A. suum B. malayi M. hapla M. incognita P. coffeae G. pallida B. xylophilus
Transport proteins
xpo-1, xpo-2,
xpo-3, rsd-2,
rsd-3, rsd-6,
sid-1, sid-2,
sid-3gpb, sid-
5gpb, haf-6gpb
xpo-1, xpo-
2, xpo-3,
rsd-3, sid-1,
sid-3, haf-6
xpo-1, xpo-
2, xpo-3,
rsd-3, sid-1,
sid-3, haf-6
xpo-1, xpo-2,
rsd-2, rsd-3,
sid-3, haf-6
xpo-1, xpo-2,
rsd-2, rsd-3,
sid-3, haf-6
xpo-1, xpo-
2, rsd-3
xpo-1, xpo-2,
rsd-3,
xpo-1, xpo-2,
rsd-6
Dicer and associated proteins
dcr-1, drh-1,
drh-3, pir-1gpb,
drsh-1, pash-
1, rde-4
dcr-1, drh-1,
drh-3, pir-1,
drsh-1,
pash-1
dcr-1, drh-1,
drh-3, pir-1,
drsh-1,
pash-1
dcr-1, drh-1,
drh-3, pir-1,
drsh-1, pash-1
dcr-1, drh-1,
drh-3, pir-1,
drsh-1, pash-1
dcr-1, drh-3,
drsh-1
dcr-1, drh-3,
drsh-1, pash-
1
dcr-1, drh-1,
drh-3, drsh-1,
pash-1, rde-4
RNA Induced Silencing Complex (RISC)
ain-1, ain-2,
tsn-1, vig-1
tsn-1, vig-1 tsn-1, vig-1,
ain-1,
tsn-1, vig-1 tsn-1, vig-1 tsn-1 tsn-1, vig-1,
ain-1
RNAi Amplification
ego-1, rrf-1,
smg-2, smg-5,
smg-6, rde-
10gpb, rde-
11gpb
ego-1, rrf-1,
smg-2, smg-
6
ego-1, rrf-1,
smg-2, smg-
6
ego-1, rrf-1,
smg-2, smg-6
ego-1, rrf-1,
smg-2, smg-6
ego-1, rrf-1,
smg-2, smg-
6
ego-1, smg-
2, smg-6,
ego-1, rrf-1,
smg-2, smg-6
RNAi Inhibitors
eri-1, eri-3,
eri-5, eri-6/7,
eri-9gpb, adr-1,
adr-2, xrn-1,
xrn-2, rrf-3,
lin15-b, gfl-1,
zfp-2gpb, somi-
1gp
eri-1, eri-5,
eri-6/7, adr-
1, adr-2,
xrn-1, xrn-2,
xrn-3, gfl-1,
zfp-2
eri-1, eri-5,
eri-6/7, adr-
1, adr-2,
xrn-1, xrn-2,
xrn-3, gfl-1,
zfp-2
eri-1, eri-6/7,
xrn-2, gfl-1,
zfp-2
eri-1, xrn-2,
gfl-1, zfp-2
eri-6/7, rrf-
3, gfl-1
eri-1, xrn-2,
gfl-1
Adr-1, xrn-2,
rrf-3, gfl-1,
somi-1
Nuclear RNAi effectors
nrde-1gpb,
nrde-2 gpb,
nrde-4 gpb, rde-
2, mut-2p, mut-
7, mes-2, mes-
3, mes-6p, ekl-
1, ekl-4, ekl-5,
ekl-6, cid-1,
rha-1, zfp-1g
mut-2, mut-
7, mes-2,
mes-6, ekl-4,
ekl-6, cid-1,
rha-1, zfp-1
mut-2, mut-
7, mes-2,
mes-6, ekl-4,
ekl-6, cid-1,
rha-1, zfp-1
mut-2, mut-7,
mes-2, mes-6,
ekl-4, cid-1,
rha-1, zfp-1
mut-2, mut-7,
mes-2, mes-6,
ekl-4, cid-1,
rha-1, zfp-1
cid-1, ekl-1,
ekl-4, mes-2,
rha-1
cid-1, mes-2,
ekl-4, rha-1
Mut-7, mes-2,
mes-6, ekl-1,
ekl-4, ekl-6,
cid-1, rha-1
Argonautes
alg-1, alg-2,
alg-4/tag-76g,
T22B3.2b,
T23D8.7,
R06C7.1,
F58G1.1, rde-
1, C16C10.3,
ppw-1/sago-2,
ppw-2, sago-1,
csr-1,
T22H9.3,
ergo-1, prg-1,
prg-2,
F55A12.1,
nrde-3,
Y49F6A.1,
C14B1.7gb,
C04F12.1,
ZK218.8gp,
ZK1248.7
alg-1, alg-2,
T22B3.2,
R06C7.1,
rde-1, ergo-
1, F55A12.1,
Y49F6A.1,
C04F12.1,
ZK1248.7
alg-1, alg-
4/tag-76,
R06C7.1,
C16C10.3,
ergo-1,
C04F12.1,
alg-1, alg-
4/tag-76,
R06C7.1,
F58G1.1, csr-
1, T22H9.3,
F55A12.1,
Y49F6A.1,
C04F12.1
alg-1, alg-
4/tag-76,
R06C7.1,
F58G1.1,
C16C10.3,
F55A12.1,
C14B1.7,
C04F12.1,
ZK1248.7
alg-1, alg-2,
alg-4/tag-
76, T22B3.2,
T23D8.7,
R06C7.1,
F58G1.1,
rde-1,
C16C10.3,
ppw-1/sago-
2, ppw-2,
sago-1, csr-
1, ergo-1,
prg-1, prg-2,
F55A12.1,
nrde-3,
Y49F6A.1,
C04F12.1,
ZK1248.7
alg-1,
R06C7.1,
F58G1.1,
C16C10.3,
T22H9.3,
F55A12.1,
Y49F6A.1,
ZK1248.7
alg-1, alg-2,
T23D8.7,
R06C7.1, rde-
1, csr-1,
Y49F6A.1,
ZK1248.7
g = not determined in G. pallida, p = not determined in P. coffeae, b = not determined in B. xylophilus
57
Chapter 3
Identification of target genes from among sRNA
pathway effectors of M. incognita for nematode control
via in vitro RNAi
58
Identification of target genes from among sRNA pathway effectors of M.
incognita for nematode control via in vitro RNAi
Sadia Iqbal, John Fosu-Nyarko and Michael G.K. Jones
Plant Biotechnology Research Group, School of Veterinary and Life Sciences, WA State
Agricultural Biotechnology Centre, Murdoch University, Perth, WA 6150, Australia
3.1 Abstract
At present it is not possible to mutagenise or transform plant parasitic nematodes, therefore
functional analysis of their genes involves using RNAi, that is, delivering dsRNA/siRNA
complementary to the gene to be studied, either by in vitro soaking or via transgenic plants.
Previous studies using RNAi to probe gene function have mainly focussed on study of genes
involved in parasitism and development. In this study, 27 genes involved in the RNAi pathway
of the root-knot nematode M. incognita were subjected to in vitro RNAi assays, and their
subsequent infectivity and development was investigated after inoculation to tomato plants. In
response to soaking with dsRNA, J2s of M. incognita exhibited abnormal phenotypes after
RNAi of 25 of the genes tested: abnormal phenotypes included body curling, wavy body
movements and paralysis. On infection of tomato plants, RNAi of 12 of the genes reduced
nematode infectivity by ≥ 50%. The greatest reduction in infection (90%) was observed for
nematodes fed with dsRNA targeting dcr-1. Additionally, RNAi treatment of nematodes did
affect their development, manifested after moults by the development to adult females:
symptoms included elongated and transparent bodies compared to the normal saccate white
adult females. The results of screening target genes by soaking, and analysing the effects on
phenotype, and the longer term effects on nematode reproduction and development after
soaking and plant infection, confirm that in vitro screening is a valid approach to identify target
genes likely to be most effective in conferring nematode resistance by reducing infection and
affecting their normal development.
Keywords: In vitro RNAi, dsRNA soaking, M. incognita, RNAi pathway, nematode infection.
59
3.2 Introduction
Experiments in which gene knockdown in C. elegans was achieved via introduction of
complementary synthetic dsRNAs revolutionised nematode functional genomics (Fire et al.
1998). This strategy has since been used to study gene function in a wide range of organisms
including plants, fungi and insects (Chuang and Meyerowitz 2000; Khatri and Rajam 2007;
Tomoyasu et al. 2008). The recent availability of transcriptomic and genomic data for parasitic
nematodes has also opened doors for more extensive genomic studies of these organisms.
Unlike C. elegans, the difficulty in generating mutants, and lack of a routine method to generate
transformed parasitic nematodes meant that RNAi has to be studied by soaking/feeding
nematodes dsRNA. Being obligate parasites, PPNs do not normally feed outside their host
plants. Artificial feeding methods were therefore developed and improved with time to facilitate
ingestion of long dsRNAs or siRNAs by PPNs with the aid of neurostimulants such as
octopamine, resorcinol and serotonin which promote pharyngeal pumping and contractions
(Urwin et al. 2002; Rosso et al. 2005). There has since been limited evidence of successful
RNAi achieved by soaking without the aid of neurostimulants (Kimber et al. 2007; Park et al.
2008). Since J2 nematodes of sedentary endoparasites such as RKNs are the only potential
feeding life stage outside host plant tissues, J2s are the only viable stage to undertake
experiments using RNAi technology by inducing dsRNA ingestion. In vitro ‘soaking’ is
currently the most effective strategy to screen the potential function of genes in a manner that
bypasses the laborious and time-consuming process of plant transformation. It also provides a
quick assay to screen candidate genes for nematode control through HIGS. Soaking J2s in
dsRNA is therefore the most widely used technique for preliminary assessment of gene
knockdown in PPNs.
The function of several effectors and essential genes of sedentary and migratory groups of PPNs
have been evaluated using RNAi (reviewed in Lilley et al. 2012). In Meloidogyne spp., the
focus has been on the genes that are involved in parasitism or nematode viability, but not for
genes involved in the RNAi machinery. Therefore, the aim of this study was to assess how
silencing of small RNA pathway genes affects infectivity of the nematodes and their
development. Twenty seven genes from M. incognita identified in Chapter 2 were analysed after
soaking J2s in dsRNA from them, and phenotypes and levels of infection in tomato plants were
assessed 28 days after the soaking treatments.
60
3.3 Materials and methods
Identified protein domains for the 27 selected genes were analysed by tblastx against the
nematode database to define the predicted exon positions. The results were then used to design
primers spanning the complete protein domains.
3.3.1 Primer design
Primers were designed using IDT primer quest tool to amplify coding regions of functional
protein domains of the selected genes. Two M. incognita genes involved in cuticle collagen
production (rol-6) and body wall muscle troponin C (pat-10) were also included in the
experiments as phenotypic controls. In addition, dsRNA synthesised from a GFP amplicon of
Aequorea victoria was also included in the experiments as a non-target control. Based on the
similarity to C. elegans genes, primer sequences were named after those of C. elegans, except
for the argonaute coding contig CABB01002242 which significantly matched to several C.
elegans argonautes, and was named ‘2242’ based on contig number. Primer sequences and
expected amplicon sizes are listed in Table 3.1.
Table 3.1: Primers used to amplify genes of the small RNA pathways of M. incognita.
Gene Primer 5′-3′ Protein Domain Contig ID Amplicon (bp)
RNAi and miRNA pathway gene primers
Rsd-3-F
Rsd-3-R
ATTTGCCCCTTCATCTTTTCCTC
ACTGAAACTGAACAAAAAGTTCGTG
ENTH-Epsin CABB01006346 314
Xpo-1-F
Xpo-1-R
TAAGATCGTCAAGCAAGAATG
TGAGATCTATCAGATTGTTCT C
XPO1 CABB01004119 323
Xpo-2-F Xpo-2-R
ATCTAGCTGCGCCAATAAC TGATGTTGCTGAATTTAAACC
CAS_CSE CABB01000462 587
Dcr-1-F Dcr-1-R
TTCCTGCAGGCAAAAGATTGTC GGTACTGTGCAAAATTACCATCTG
DSRBF CABB01000157 251
Drh-1-F
Drh-1-R
GTCAAGCAAGTCGCGAAG
CCCTTCTTTGAACTCTAGCA
Helicase C Terminal
domain
CABB01006008 192
Drh-3-F
Drh-3-R
GTGGTGTCATAACCAAAATGTCTG C
TTG TGC ACC AAC TGG AAG TG
DEAD CABB01002056 284
Drsh-1-F
Drsh-1-R
TAGAATTTCTTGGAGATGCTGTTG
ATCACATTGTTCAAGACCAGAATC
Ribonuclease IIIa CABB01000477 280
Pash-1-F
Pash-1-R
TCAGCATAA ACCTACTCGTG
TCGGCTTTG AATCAATTTCAAG
- CABB01004277 539
Tsn-1-F Tsn-1-R
TTCCCTATCTACAGCGTTCGC CCT CAA CAT GAT GCT TCCATATACC
Staphylococcal nuclease 4
CABB01000055 444
Vig-1-F Vig-1-R
TTTCGGTCGCGCCGTTTTG AATCTTCTCATCAGCTCCTTCGCC
HABP4_PAI-RBP1 CABB01000081 205
Smg-2-F
Smg-2-R
ATGCCATAACGATTGTCTACTC
CAAATTCTGGCCTCGGAC
P loop AAA12 CABB01008394 301
61
3.3.2 RNA extraction
RNA was extracted from freshly hatched J2s and eggs using the Trizol method (Tan et al.
2013). Nematodes were macerated in a 1.5 mL microfuge tube by shaking with stainless steel
beads (3.2mm) in a Tissue Lyzer (Qiagen, Australia) at 25 Hertz for 2 minutes. One mL of
diluted (3:1) Trizol LS reagent (Life technologies Corporation) was added to the extracted total
nucleic acids followed by chloroform purification with 200 µL of chloroform, then centrifuged
at 12,000 g for 10 minutes to separate phases. Clear supernatant was transferred to a clean 1.5
mL microfuge tube and nucleic acids were precipitated overnight by adding 1/20 volume 5M
NaCl and 2.5 volumes of 100% ethanol, followed by centrifugation at 12,000 g for 30 minutes.
The pellet was then washed with 70% ethanol, resuspended in 50 µL of RNase-free water and
subjected to 6.8 Kunits of DNaseI in solution with 10 µL of RDD buffer (RNase-Free DNase
set, Qiagen, Australia). The reaction was incubated at room temperature for 10 minutes and the
nucleic acids purified by chloroform extraction and ethanol precipitation. Resuspended RNA
Gene Primer 5′-3′ Protein Domain Contig ID Amplicon (bp)
Smg-6-F
Smg-6-R
GTATCAATTTATGTAGACGC
TGGAAATGTTCGGACAGG
PIN CABB01000011 131
Ego-1-F
Ego-1-R
CGAACTCAAGAACCTTTTTTCCG
CTGCTCGTTGATGTTTAAGTGC
RdRp CABB01000449 342
Rrf-1-F
Rrf-1-R
TATGCTGACACGCTCCTTAATTG
TCTGCCATGTAATCAAATGCATCC
RdRp CABB01000474 682
Eri-1-F Eri-1-R
GTGATTGATTTTGAATGTAGCTGTG AAGCATCATCCATTCCACAATGTTC
DEDDh 3’-5’ exonuclease domain
CABB01001883 473
Gfl-1-F
Gfl-1-R
AACAGGTTTCTCGTTGACGTCAG
TTCCTCAGAAAAACAGCAAAGGG
Yeats CABB01000795 281
Xrn-2-F Xrn-2-R
CTGTATCTCGATATGAACGG CAAGCATAATCAAGTCTGC
XRN 5’-3’ exonuclease
CABB01001503 553
Rha-1-F
Rha-1-R
TGGGTTTAAGAGGAATTTCTC
CATAAACAACATCATCAATTG
Helicase C Terminal
domain
CABB01000079 669
Mes-2-F
Mes-2-R
CCACATTTTATTGACTGTTGG
TGCGAATGAGGATATCGAGA
SET CABB01002321 258
Mes-6-F
Mes-6-R
TACAGTTGAAAAACTCATACCCC
AACTTTCAGGCCACACTC
WD40 CABB010000967 171
Mut-2-F
Mut-2-R
AACTTACAGGCACTATAATAAC
TGC TGT TGT TGT TCT TTC TTC
PAP-TUTASE CABB01003815 204
Mut-7-F
Mut-7-R
TCCAACACCAATTTT CTCAGCC
TCTGAGCAAGGCCTTTCC
Exoribonuclease
domain
CABB01000055 187
Ekl-4-F
Ekl-4-R
TCGTTGGCCTGAATATAGAC
GATTTGACAATTGGTCAAGC
DMAP1 CABB01002952 245
Alg-1-F
Alg-1-R
CGGATCGAATGACATGTC
ATTCCTGGTTGGTATCCTC
PIWI CABB01000336
476
Csr-1-F
Csr-1-R
CTGAAGTTCATCTTGAGTCA
TTGGACTCAACTACGTTC
PIWI CABB01000355 674
Ppw-2-F
Ppw-2-R
AACCGAAGTCGTCACACA
CTTTGCCGAAATTCCATGTTC
PIWI CABB01001343 661
2242-F
2242-R
GCAGCATAGTGATGTCTAG
GCCAACGCTCTTTA AGG
PIWI CABB01002242
696
Other Primers
Rol-6-F Rol-6-R
GGCTATTGCTTTTAGCGGAGC TGCCATGATCTCCCGACT TCC
Cuticle collagen-Collagen triple helix
CABB01000004 609
Pat-10-F
Pat-10-R
TTCAATCAGTCTCTCCAGCC
AATTCGACGCAGACGGCAG
Ef-hand calcium
binding motif
CABB01000228 303
hpGFP-F hpGFP-R
TAACTCGAGTCTAGATTCACTGGAGTT TACGGTACCGGATCCTAATGATCAGC
- - 524
62
was quantified (Nanodrop ND-1000 Spectrophotometer) and 500 ng used to synthesise cDNA
in a standard 20 µL reverse transcription reaction using the High capacity cDNA synthesis kit
(Applied Biosystems) following the manufacturer’s protocol without an RNase Inhibitor.
3.3.3 Amplification of target genes
Approximately 200 ng of cDNA was used for polymerase chain reactions (PCRs) in a standard
20 µL reaction with 30 cycles in a thermal cycler (Applied Biosystems 2720). The reactions
were made of 5x PCR buffer (final concentration 3mM MgCl2 and 1mM dNTPs) and 0.5 units
of Taq polymerase enzyme (Bioline). Ten picomols each of the forward and reverse primers
were added into the reaction. Cycling conditions were 95 °C for 5 minutes followed by 30
cycles of 95 °C for 30 secs; 55 °C for 30 secs; 72 °C for 30 secs and a final extension step of 7
minutes at 72 °C. To visualise the amplified product, reactions were run on a 1% agarose gel in
1x TAE alongside a 100 bp DNA marker (New England BioLabs).
3.3.4 Cloning of amplicons into RNAi vector
Although multiple domains were amplified for each gene, one domain each for 27 genes and the
three controls (rol-6, pat-10 and gfp) were cloned into pDoubler transcription vector using the
restriction sites AfeI/XhoI and KpnI. The multiple cloning site of pDoubler (Figure 3.1) is
flanked by two T7 promoter sequences and allows a cloned gene fragment to be digested out
with the T7 sequences for in vitro transcription using the enzymes, EcoR1 or NotI. All the
amplicons were first amplified with primers with the restriction sites XhoI and KpnI except for
xpo-1 and xrn-2 where AfeI was used instead of XhoI (Figure 3.1).
Following PCR amplification, the vector and amplicons were digested with 1 U of each enzyme
(New England BioLabs) per µg of DNA at 37 °C for 3-5 hours in a thermal cycler in a double
digest reaction. Digested gene fragments and linearised pDoubler were run on a 1% agarose gel,
cleaned up using the Wizard® SV Gel and PCR Clean-Up system (Promega, Australia)
according to manufacturer’s protocol and quantified using the Nanodrop spectrophotometer.
Standard 10 µL ligation reactions were set up using 50 ng of vector and a 1:3 vector to insert
ratio with 3 U of T4 DNA Ligase (New England BioLabs) and incubated at room temperature
overnight.
63
pDoubler
2617 bp
pUC Origin
HsLev-11 gene
M13-F (7 nt)
M13-R (934 nt)
Kanamycin gene
T7 promoter region
T7 promoter region
BamHI (189)
AfeI (7 7 5)
AscI (182)
AvrII (7 85)
KpnI (199)
XbaI (7 7 9)
Xho I (7 67 )
EcoRI (146)
EcoRI (827 )
NotI (137 )
NotI (834)
Figure 3.1: RNAi cloning vector pDoubler with T7 transcription sites on both sides of the
multiple cloning site (MCS). Template for dsRNA synthesis can be digested out using
restriction sites EcoR1 and Not1. An H. schachti lev11 gene is cloned in the vector to
demonstrate the map of a typical construct.
Escherichia coli JM109 cells (Promega, Australia) were used for all transformations. Cells were
made competent using the rubidium chloride method (Promega Subcloning Notebook, 2004).
Five µL of the ligation reaction for each gene was used to transform 25 µL of E. coli competent
cells using the heat shock method (Promega Technical manual No. 042). Briefly, bacteria and
ligation mix were incubated for 30 minutes on ice followed by 40 seconds at 42 °C in a water
bath. After another two minutes on ice, cells were incubated for 1.5 hours in 700 µL of LB
(Luria-Bertani) broth at 37 °C with vigorous shaking at 225 rpm. The bacterial suspension (150-
200 µL) was then plated on LB agar plates supplemented with 50 µg/mL of kanamycin
monosulfate and incubated at 37 °C for 16-18 hours. Bacterial colonies were screened by PCR
where 5 µL aliquot of a colony resuspended in 20 µL of PCR-grade water was used as DNA
template with 10 picomols of each primer M13-F (5′-TAAAACGACGGCCAGT-3′) and M13-
R (5′-CAGGAAACAGCTATGAC-3′) in a standard 20 µL reaction. PCR conditions and
analysis of amplicons were as described under Section 3.3.3 except that the number of cycles
was 25 and extension time for each cycle was one minute. The remaining 15 µL of bacterial
suspension from PCR positive colonies were grown in 5 mL LB broth supplemented with 50
µg/mL kanamycin monosulfate at 37 °C (16-18 hours) with shaking at 225 rpm. Cloned
plasmids (pDoubler with gene inserts) were recovered from 4 mL of this culture using the
Wizard® Plus SV Minipreps DNA purification system (Promega, Australia) according to
manufacturer’s protocol.
64
3.3.5 Confirmation of sequences cloned into vectors
Purified plasmid DNA was analysed by Sanger sequencing using the facilities at the Western
Australian State Agricultural Biotechnology Centre (Applied Biosystems Industries; ABI 3730
96 capillary machine). ABI BigDye terminator version 3.1 reagents was used for all reactions.
One sixteenth dilution of a full reaction was done using 3.2 picomols of M13-F or M13-R in
separate reactions with 1.75 µL of sequencing buffer, 0.5 µL of dye terminator mix and 300-500
ng of plasmid in a total volume of 10 µL. Reactions were subjected to thermal cycling at 96 °C
for 2 mins, 25 cycles of (96 °C for 10 secs, 55 °C for 5 secs; 60 °C for 4 mins) ending with a
hold at 14 °C. DNA, post-reaction, was transferred to a 600 µL microfuge tube and precipitated
by adding 1 µL of 125 mM EDTA, 1 µL of 3M sodium acetate and 30 µL of 100% ethanol.
After a brief vortex, reactions were spun down and, incubated at room temperature for 20
minutes in the dark followed by centrifugation at 13,000 rpm for 30 minutes. Supernatant was
removed and replaced with 125 µL of 70% ethanol to wash the pellet. After centrifugation for
another 5 minutes, the supernatant was discarded and pellet dried in the dark for 20 minutes
before submitting for sequencing. Sequencing results were analysed using FinchTV 1.4.0
(Perkin Elmer, Inc.). A nucleotide blast (blastn) was done in NCBI (http://www.ncbi.
nlm.nih.gov/) against whole genome sequence database of M. incognita for sequence
verification.
3.3.6 Synthesis of dsRNA
After sequence confirmation, cloned fragments with T7 sequences at the 5′ and 3′ ends were
digested out of pDoubler using EcoRI for all the sequences of the genes except dcr-1 and drsh-1
for which NotI was used as the sequences had EcoR1 sites. HiScribe T7 In vitro transcription kit
(New England BioLabs) was used to generate dsRNA from 1 µg of template for each gene in a
standard 20 µL reaction. In vitro transcription reactions were treated with DNaseI to remove
template DNA. DsRNA was purified using chloroform extraction followed by NaCl and ethanol
precipitation as described in Section 3.3.2. DNA-free dsRNA was pelleted and resuspended in
30 µL RNase-free water. After quantification (Nanodrop) it was ran on 1% agarose gel in 1x
TBE to assess the quality. The dsRNA of the respective genes was named as ‘dsgene’ for this
study.
3.3.7 In vitro feeding of dsRNA to nematodes
Freshly hatched J2s were used for all soaking experiments. Egg masses were collected from
roots of infected tomato (cv. Grosse Lisse) in water in a 1.5 mL microfuge tube. These were
washed with 2% sodium hypochlorite for 2 minutes and subsequently washed four times with
water to remove the gelatinous matrix and residual sodium hypochlorite by pelleting eggs at
65
12,000 g for 1 minute. The eggs were transferred into 5 mL tubes with 2 mL of water and
incubated at 25 °C with gentle agitation (60 rpm) for two days. Hatched J2s were collected after
passing through a 38 µm sieve which allows active M. incognita J2s to migrate through, leaving
dead nematodes and other debris. The collected nematodes were used for dsRNA soaking
experiments in 70 µL M9 buffer (3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 mL 1 M MgSO4)
containing 1 mg/mL of dsRNA supplemented with 50 mM octopamine (octopamine
hydrochloride), 3 mM spermidine (spermidine trihydrochloride) and 0.05% gelatine. All stock
solutions were made with sterile M9 buffer. Tubes containing the soaking solution with 7,000
J2s each were incubated at 25° C for 16 hours in the dark. Controls contained 1 mg/mL of dsgfp
or no dsRNA. FITC was used at a concentration of 1 mg/mL in parallel to monitor solution
uptake, supplemented with the same soaking solution without dsRNA. After 16 hours
incubation, nematodes were removed from the soaking solution washed before further
assessment and 20 µL of the soaking solution was run on a 1% agarose gel to assess dsRNA
integrity.
3.3.8 Observation of RNAi phenotypes
After 16 hours soaking in dsRNA, any effects on nematode behaviour were observed and
assessed using an Olympus BX-51 microscope. Nematodes were viewed in bright field while
FITC uptake was monitored using the FITC filter (450-480 nm). One thousand nematodes were
observed for each reaction at 4x and 10x magnifications. The control nematodes used to
compare phenotypic effects of soaking were fed no dsRNA and dsgfp. Because there was no
previous reports of RNAi phenotypes for any of the small RNA pathway genes in parasitic
nematodes, pat-10 and rol-6 were used as ‘positive’ controls. These genes are required for
cuticle and muscle development and down-regulation results in a physically observable
phenotype (Adamo et al. 2012; Nsengimana et al. 2013)
3.3.9 Assessment of nematode infectivity and development
After soaking for 16 hours, the ability of nematodes to infect plants was assessed. Tomato seeds
(cv. Grosse Lisse) were germinated on moist Whatman filter paper in 15 cm petri plates.
Germinated seedlings were transferred into white sand in 5 x 4 trays each with a capacity of 120
cm3. Ten 2 week old seedlings were infected with 400 J2s each from the dsRNA-fed and control
(dsRNA to gfp and no dsRNA) treatments. Plants were watered sparingly the first two days after
infection. Plants were grown under glasshouse conditions (25 ± 5 °C) for four weeks and then
gently uprooted and washed thoroughly with tap water to count galls formed on the roots. The
number of galls present on 6-7 plants per treatment was counted using a dissecting microscope.
The remaining 3-4 plants for each treatment were allowed to grow for another three weeks after
66
which females were extracted using fine forceps to observe morphology. After counting the
galls, roots were separated from the shoots at the collar and dried at 50-55 °C for 18 hours in a
drying oven. Dried roots were weighed and used to calculate infection severity expressed as
number of galls/gram of dry root weight. Morphological differences were observed using a
dissecting microscope and compared to those developing on plants infected with control
nematodes soaked with dsgfp or no dsRNA.
3.3.10 Gene expression of target genes
Gene knockdown was assessed on nematodes 16 hours after feeding with dsRNA. Two
thousand J2s from each feeding experiment were washed thoroughly with DEPC-treated water,
snap frozen in liquid nitrogen and stored at -80 °C to prevent RNA degradation until further
processing. RNA for these nematodes was extracted with the Trizol method followed by DNase
treatment as described in Section 3.3.2. cDNA was synthesised with 100 ng of RNA for each
treatment and amplified with gene specific primers at 30 cycles with 1 in 10 dilution of cDNA
in a 10 µL PCR reaction for a preliminary analysis of transcript produced after 16 hours of
dsRNA feeding. Reactions were run on a 2% agarose gel alongside a 100 bp DNA marker for
comparative analysis of transcript abundance. M. incognita 18S ribosomal RNA (rRNA)
primers (18S-F 5′-TAGAGGGATTTGCGGCGTTC-3′, 18S-R 5′-GGTTTACCCGCCCCTTT
CAG-3′) were used to amplify 18S transcript as normalisation control. Relative band intensity
was analysed visually in control and dsRNA-fed nematodes.
3.3.11 Statistical analysis
SPSSv20 software package (IBM Corporation, US) was used for analysis of variance (ANOVA)
and calculation of means, standard deviation and standard error. Significance between
treatments was tested at p<0.05 and pair-wise comparisons were done post-hoc using the
Tukey’s test. Microsoft Excel Analysis ToolPak was used for construction of bar charts with
error bars representing standard error for each treatment.
3.4 Results
3.4.1 Phenotypic effects of in vitro RNAi of target genes
Amplified products were sequenced and compared to the exon regions of the genomic contigs
that were used to design primers. Blastn analysis showed 100% similarity of each of the
amplified fragments to contigs of M. incognita and between 87-95% to those of M. hapla, with
perfectly complementing fragments (>25 bp) within the amplicons. When the feeding solution
was run on a 1% agarose gel there was no indication of dsRNA degradation after the 16 hour
treatments.
67
FITC uptake was observed 16 hours after feeding J2s. When eggs were present, FITC was
detected in most, suggesting that at least the outer layers were permeable to the feeding solution
(Figure 3.2). A small percentage (<10%) of nematodes soaked with either no dsRNA or dsRNA
to gfp were straight and showed little movement. In contrast, RNAi of rol-6 resulted in vigorous
movement of treated nematodes which appeared to be involuntary. Those fed with dsRNA to
pat-10 were curled and appeared paralysed.
After soaking in dsRNA, the observed phenotypes for the 27 genes studied could be divided
into three major groups: first, those with straight bodies showing little movement, mainly
restricted to the head region, with the rest of the body paralysed. This group included genes fed
with dsRNA targeting rsd-3, xpo-2, dcr-1, drh-1, pash-1, tsn-1, vig-1, ego-1, eri-1, mut-2, alg-1,
ppw-2, csr-1 and 2242. The second group consisted of J2s with wavy bodies and was typical of
J2s ingesting dsRNA of drh-3, drsh-1, rrf-1, smg-2, smg-6, xrn-2, rha-1 and ekl-4. This wavy
form seemed to be a result of some sort of paralysis, except for smg-6 for which the wavy form
was observed with jerky movements in the nematodes’ bodies. The third group consisted of J2s
curled with little movement and this was observed for nematodes fed with dsRNA of mut-7 and
xpo-1.
J2s fed dsRNA complementary to genes dcr-1, drh-1, drh-3, pash-1, vig-1, ego-1 and the
argonaute coding sequence 2242 were generally straight and paralysed, except for drh-3 which
displayed the wavy paralysed phenotype but also resulted in dead nematodes. The percentage of
dead nematodes ranged from 10% to 60% with ~60% resulting from feeding with dsRNA of
drh-1, pash-1 and 2242 while about 50% J2s fed dsego-1 and dsvig-1 were dead. Interestingly,
four out of six of these genes encoded helicases. FITC uptake by J2s and prominent phenotypes
after 16 hours of dsRNA ingestion are presented in Figure 3.2.
Seven functional groups i.e. transport proteins, dicer complexes, RISC proteins, amplification
proteins, RNAi inhibitors, nuclear RNAi proteins and argonautes were targeted by RNAi in this
experiment. The RNAi phenotypes observed were not typical of genes from any particular
group except RNAi of the four argonautes which resulted in nematodes with straight body
phenotype with paralysis 16 hours after feeding. All soaking treatments affected nematodes
phenotypically, except for nematodes treated with dsmes-2 and dsmes-6, which appeared
similar to controls. All phenotypes observed after 16 hours of feeding dsRNA complementary to
the target genes are presented in Table 3.2.
68
500 µm
No dsRNA dsxrn-2
dsdcr-1 dsego-1
dsvig-1
dsmut-7
500 µm
dstsn-1
ds2242 dsrol-6
500 µm
dsgfp
FITC
500 µm
FITC
dsalg-1
dsdrsh-1
FITC
200 µm
Figure 3.2: RNAi phenotypes of M. incognita J2s observed after 16 hours of feeding
with dsRNA of selected genes. FITC uptake was also recorded (Labelled FITC) in J2s.
Eggs in the solution also absorbed some FITC. Phenotypes presented after feeding
dsRNA to different target genes (ds‘gene’ refers to dsRNA to the target gene i.e. no
dsRNA, dsgfp, dsxrn-2, dsego-1, dsdcr-1, dsmut-7, dsvig-1, dsalg-1, dstsn-1, ds2242,
dsdrsh-1 and dsrol-6. Arrows indicate J2s with prominently different phenotypes from
the controls (controls were: no dsRNA and dsgfp).
69
Table 3.2: Phenotypes observed in J2s of M. incognita after 16 hours of soaking in dsRNA (1
mg/mL) of genes involved in the RNAi pathway.
3.4.2 RNAi of target genes of nematodes reduces host infection
Nematodes soaked in dsRNA for 16 hours were used to infect tomato plants to assess their
infectivity after treatment. Experiments were conducted in batches with respective controls and
statistical significance tested accordingly. There were significant differences in the levels of
infection between nematodes fed with dsRNA of complementary target genes and those soaked
in control solutions without dsRNA or dsRNA to gfp.
After infection with treated nematodes, tomato plants were maintained in a glass house, and
roots were harvested four weeks later. The level of infection was assessed by the number of
galls formed per gram dry root weight, to account for differences in sizes of roots masses: the
Gene J2 Phenotype
rsd-3 Straight body. Paralysed slow movement.
xpo-1 J2s inactive with curled bodies.
xpo-2 Straight body.
dcr-1 20% dead. Straight stiff body. Only head moving.
drh-1 60% dead. Straight paralysed body.
drh-3 20% of J2s dead. Wavy movement
drsh-1 Abnormally wavy rigid body with movement only in the head.
pash-1 60% dead. Straight body and non-motile.
tsn-1 Straight body. Slow movement.
vig-1 50% of J2s dead. Straight body.
rrf-1 J2s alive with slow movement. Abnormally wavy bodies.
ego-1 50% dead. Straight appearance with very slow movement.
smg-2 Wavy but stiff bodies.
smg-6 Wavy body. Faster jerky movement.
eri-1 Straight body, slow movement.
gfl-1 J2s alive with slow movement.
mut-7 Slow movement with curling bodies.
xrn-2 More wavy bodies than normal. Very slow movement.
mut-2 Straight body. Mostly alive but with slow movement.
mes-2 J2s active and similar to controls.
mes-6 J2s active and similar to controls.
rha-1 Vigorous movement. Wavy body.
ekl-4 Wavy and slow movement.
alg-1 Straight body.
ppw-2 Straight body. Slow movement.
csr-1 Straight body. Some show body curling with jerky movement
2242 60% dead. Paralysed with straight body.
rol-6 Vigorous movement. Moving faster than controls
pat-10 Wavy, slow movement. Curling body.
70
results obtained for the different treatments are presented in Figure 3.3. The lowest number of
galls observed was by nematodes fed with dsdcr-1, with a reduction of up to 90% compared to
treatments lacking dsRNA. Treatments thought to disrupt expression of the miRNA processor
complex (drsh-1, pash-1) and the RNAi inhibitor (gfl-1) resulted in ≥ 70% reduction in
infection. For the genes xpo-1, xpo-2, drh-1, vig-1 ego-1, mut-7, rha-1, 2242 and pat-10, RNAi
reduced nematode infectivity by ≥ 50%. Targets with less RNAi effect on nematodes were drh-
3, xrn-2, mut-2, mes-2, ekl-4, the three argonautes (alg-1, ppw-2, csr-1) and rol-6, with a ≥ 25%
reduction in infection. The fourth argonaute (2242) however, reduced nematode infestation by
68%. The three helicases of the dicer complex reduced infection by between 45-90%.
RNAi of the two major transport proteins for miRNA pathway xpo-1 and xpo-2 affected
nematode infectivity significantly (61% and 53% reduction respectively) unlike rsd-3 where
there was only 24% reduction in infectivity. For the group of nuclear RNAi effectors, disruption
of rha-1 function resulted in reduction in plant infection by 64%, but there was no change in
infectivity for dsmes-6 soaked nematodes. Notably, apart from ego-1, RNAi of amplification
genes (smg2, smg-6) did not seem to have significant (p<0.05) effect on nematode infectivity.
The other RdRp rrf-1 when disrupted resulted in a significant (p<0.05) increase in infection
(19%): the only gene for which this pattern (increased infection) was observed.
One important observation was that egg masses were produced earlier as compared to controls
(no dsRNA and dsgfp) for nematodes treated with dsgfl-1, dseri-1 and dsrrf-1. For these, egg
masses were observed four weeks after infection whilst controls had no egg masses (Figure
3.4A). For the feeding experiment for ego-1 and mut-7, fungal infection was observed for the
plants and the galls produced by nematodes were deformed as indicated in the Figure 3.4B. Egg
masses produced on the roots lacked the characteristic swollen gall-like appearance and number
of galls reduced by 73% for ego-1 and 20% for mut-7 (data not shown). The experiment was
repeated to further investigate the deformed galls and this time normal galls were produced for
that experiment with reduction in infection of 62% for dsego-1 and 55% for dsmut-7 (Figure
3.3).
No such deformity was observed for dsRNA treatment of the other genes used in this study.
Interestingly, for most of the genes where RNAi did not reduce infectivity of nematodes (tsn-1,
rrf-1, xpo-2, eri-1, smg-2 and smg-6), there were nevertheless phenotypic changes in the
appearance and movement of nematode 16 hours after feeding.
71
Figure 3.3: Average number of galls per gram of dry root of plants infected with dsRNA-fed nematodes. Genes belonging to seven
functional groups were targeted together with controls. (Different colours of bars represent different groups of genes of the small RNA
pathway of nematodes as indicated in the figure legend). Significance is represented by * at p<0.05 with respect to the no dsRNA control
for the separate experiments. Bars represent mean (n= 6-7) ± standard error.
72
(A)
(B)
3.4.3 RNAi effects on nematode development
dsmut-7 dsego-1
dseri-1
dsgfl-1 dsgfp No dsRNA
dsrrf-1
Figure 3.4: (A) Infection on tomato roots by M. incognita J2s after soaking without dsRNA, or
with dsgfp, dsgfl-1, dsego-1 and dsrrf-1. Egg masses are indicated by arrows on the surface of
galls produced by nematodes treated with dsgfl-1, dsego-1 and dsrrf-1 but are absent from
controls (no dsRNA and dsgfp). Eggs were stained with phloxine-B. (B) Deformed/no galls
produced by nematodes fed on dsego-1 and dsmut-7. Arrows indicate egg masses on root
surface.
73
Adult females developing in tomato roots were dissected out of galls and compared with those
of controls. Morphological differences were observed in females soaked in solutions containing
dsRNAs at the J2 stage. Females which developed from J2s previously soaked in dsdrh-3 and
dsmut-7 had elongated bodies (fusiform) instead of the wild-type spherical saccate posterior.
This kind of deformity was observed for 41% and 42% females from treatment with dsdrh-3 and
dsmut-7 respectively. For the nematodes soaked in dsvig-1 and dsmut-2, 30% and 85% of
developed females respectively were smaller than those soaked with dsgfp or no dsRNA. In
addition, developed females of J2s previously fed with dsRNA corresponding to genes with
roles in the miRNA pathway e.g. xrn-2, xpo-2, pash-1, drsh-1, and alg-1 were mostly abnormal.
In particular, RNAi of xpo-2, mut-2, rha-1 and 2242 resulted in females that were translucent
compared to those of controls that appeared pearly white (Figure 3.5). However, there was
variable number of nematodes depicting this deformity i.e. it was 100% for dsmut-2, 50% for
dsxpo-2, 75% for dsrha-1 and 30% for ds2242.
Interestingly, nematodes fed with dssmg-2 showed a wavy paralysed phenotype after soaking in
dsRNA, but no significant reduction (p<0.05) in infectivity was found. However, their
development seemed to be affected since abnormal females were present after four weeks of
infection on tomato plants (Figure 3.5). Females developing from J2s soaked in dsmut-2 were
not only deformed, but were also translucent: the J2s appeared affected after feeding and there
was a 40% reduction in infection. Severely paralysed nematodes as a result of soaking in dstsn-
1 and those resulting in abnormally wavy bodies in response to dssmg-2 and dssmg-6 showed
no reduction in plant infestation. Similarly soaking in dsRNA to smg-2, alg-1, ppw-2, csr-1 did
not result in greatest reduction in infection but abnormal female development was observed. No
relationship could be established between phenotype of J2s after dsRNA feeding, plant infection
and abnormal female development.
74
dsalg-1
2.0mm
ds2242
2.0mm
dsxpo-2
2.0mm
dsmut-2
2.0mm
dsvig-1
2.0mm
dspash-1
2.0mm
dsdrh-3
dssmg-2
2.0mm
dsrha-1
2.0mm
2.0mm
dsxrn-2
2.0mm
dsgfp
2.0mm
No dsRNA
2.0mm
Figure 3.5: M. incognita females dissected from tomato roots following infection with J2s
treated without dsRNA, and with dsgfp, dsxrn-2, dsxpo-2, dsdrh-3, dsmut-2, dsvig-1,
dssmg-2, dspash-1, dsrha-1, dsalg-1 and ds2242, seven weeks after plant infection. Arrows
point to abnormal females in different treatments compared to controls. Scale bar = 2 mm.
75
3.4.4 Transcript abundance after in vitro feeding
PCR was used to assess transcript abundance in nematodes fed by dsRNA. For this, the
nematodes from dsRNA soaking treatments which showed a reduction in infection or changes in
the morphology of adult females were further analysed. Amplification (PCR band intensity) of
target genes from cDNA made from similar amounts of RNA derived from nematodes treated
with dsRNA and no dsRNA or dsgfp were compared. Amplification of 18S rRNA transcript
was used as internal control.
It appeared that 18S rRNA gene transcription was affected by soaking in dsRNA (both up-
regulation and down-regulation was observed for dsgene and dsgfp treated nematodes) but this
was not consistent for all experiments (Figure 3.6). Furthermore, all of the genes tested seemed
to be up-regulated by dsRNA feeding, except drsh-1 and alg-1 which displayed no apparent
change in transcript abundance. The transcripts up-regulated were of the genes gfl-1, vig-1,
pash-1, xpo-2, 2242, xrn-2, mut-2, mut-7 and pat-10 with the greatest up-regulation for dsgfl-1
and dsxrn-2. To test whether this amplification was a result of dsRNA that was fed to the
nematodes and remained bound to their body and extracted during RNA extraction, primers
designed from a region of genes other than the part used to generate dsRNA were also used for
PCRs. The result was not different as there appeared to be a higher intensity of amplicons
compared to those of the controls. Some genes could not be amplified from the cDNAs of J2s
fed with no dsRNA, dsgfp and dsRNA of some genes even when the PCR cycles were increased
to 35: these included cDNAs of J2s fed with dsRNAs of dcr-1, rol-6, rha-1, csr-1 and ppw-2
(Figure 3.6). Expression of 18S rRNA for these was high and appeared as bright bands after 30
cycles. The same primers when tested against cDNA extracted from mixed stage nematodes
amplified the gene products. This implies that the expression of these genes was very low in M.
incognita J2 stage nematodes, and so was not readily detected from the amount of template
cDNA used in the PCRs.
76
Figure 3.6: RT-PCR amplification of target genes in control and dsRNA-fed J2s with respective gene
specific primers and 18S rRNA primers.
dsRNA
treatment
18S rRNA primer
Gene specific primer
No dsRNA dsgfp dsgene No dsRNA dsgfp dsgene
drsh-1
dcr-1
No amplification
gfl-1
vig-1
pash-1
alg-1
xpo-2
2242
xrn-2
mut-2
mut-7
pat-10
rol-6
No amplification
rha-1
No amplification
csr-1
No amplification
ppw-2
No amplification
77
3.5 Discussion
The primary aim of this study was to assess infectivity and development of M. incognita J2s
following treatment with dsRNA of genes involved in the small RNA pathway. For the 27 genes
used, the ones for which there were definite phenotypes after soaking were mut-7 (curling
body), rol-6 (vigorous uncontrollable movement), vig-1, tsn-1, ego-1, dcr-1 and the four
argonautes (straight paralysed body). The straight phenotype displayed by the J2s after 16 hours
of soaking in dsRNA for most of the genes might also be related to the stress imparted by gene
knockdown treatment rather than a direct effect of RNAi of the target gene, since some J2s in
control reactions (no dsRNA and dsgfp) also showed this phenotype. It is possible that
continued stimulated feeding and gene knockdown could overwhelm the RNAi machinery, and
this could contribute towards treated nematodes going into a ‘state of rest’, hence inactive and
straight. Similar straight phenotypes have been reported before as a result of long term exposure
(7 days) to dsRNA corresponding to the neurotransmitter FMRFamide-like peptides, but not
when the same treatment was short-term (24-48 hour) for Globodera pallida (Kimber et al.
2007). Genes involved in the RNAi pathway of nematodes are also related to developmental
regulation (Zhuang and Hunter 2012). A disruption of these mechanisms possibly induces stress
apart from that imparted by dsRNA soaking, which is phenotypically expressed as
inactivity/paralysis.
Several published reports suggest that in vitro dsRNA feeding can be transient. Recovery of
nematodes within 24 hours after washing to remove the soaking solution has been reported for
other nematode species as well, such as Meloidogyne graminicola (Nsengimana et al. 2013),
and after 24 hours soaking for Pratylenchus coffeae, in which the recovery rate for pat-10
transcript was double that of unc-87 after 24 hours soaking with dsRNA (Joseph et al. 2012).
For M. incognita, down-regulated calreticulin and polygalacturonase genes recovered at
different rates after RNAi treatments (Rosso et al. 2005). In this study, in agreement with these
observations, seemingly inactive nematodes were subsequently able to infect plants, with no
difference in gall formation compared to controls – one such example is the gene tsn-1. This
implicates recovery of the J2s following in vitro treatment, and that they were not dead even
though they were inactive after soaking.
Plant infection after soaking for 16 hours was variable: it depended very much on the gene that
was being silenced. The possible reason why the greatest reduction in infectivity after soaking
with dsdcr-1 and dsdrsh-1 was observed may be because dcr-1 is the only dicer-like gene in
nematodes, and it is responsible for all small RNA processing, and drsh-1 is the microprocessor
78
for miRNAs before they exit the nucleus so any disruption may affect the overall health of the
organism because of disrupted gene regulation. The infectivity of nematodes after different
treatments could also be affected by factors such as the recovery rate of transcript for the
particular gene, possible presence of multigene families and actual importance of the tested gene
in nematode metabolism. Nevertheless, the results in general show pronounced reduction in
infectivity after soaking, and developmental abnormalities in adult females. Since the greatest
effects were found for genes associated with the miRNA pathway, it may be that after treatment,
longer times were required for the nematode to completely recover. In case of Heterodera
glycines, J2s took 5 to 15 days to recover post dsRNA treatment (Bakhetia et al. 2007).
The formation of giant cells and galls in host plants follows a defined and specific pathway
(Jones and Goto 2011). If the metabolism of J2 nematodes is disrupted as a result of down-
regulation of a gene in a vital pathway, then it is perhaps not surprising that such disturbances
can be manifested in abnormalities in the host response to nematode feeding, resulting in both
abnormal development of nematodes, and abnormal plant responses, manifested by changes in
gall formation, and probably giant cell size and function. The deformed galls observed after
RNAi treatment for ego-1 and mut-7 may therefore be a consequence of silencing of vital
nematode genes in its ability to interact with plant cells, so affecting gall development. The fact
that when this particular experiment was repeated the same result was not obtained may be a
result of seasonal variability of plants or experimental variation of in vitro RNAi, as has been
previously reported for the animal parasitic nematode Ostertagia ostertagi (Visser et al. 2006),
and seasonal differences can affect nematode metabolism, as found for the migratory plant
parasite Pratylenchus vulnus (Britton 2001). Another factor was that in the case where normal
galls were not formed after RNAi treatment there was some fungal infection. This may be co-
incidental or causal.
Adult females that exhibited abnormal development were found after RNAi treatment of J2s for
10 of the 27 genes tested here. Since the miRNA pathway is important in controlling gene
expression, disturbing the balance of the miRNA pathway genes can have an array of knock-on
effects on other gene products (i.e. enzymes) involved in many metabolic pathways of treated
nematodes, such as those involved in moulting, reproduction etc, and such effects might also
explain the early egg mass production after some treatments. Formation of a translucent body is
a strong indicator of affected development and/or poor nutrition of treated nematodes, and
would be accompanied by reduced viability and reproduction fitness. Failure to develop the
typical saccate body shape by M. incognita adult females after in vitro RNAi treatments of J2s
is not new, for example this phenomenon was found for dsRNA treatment targeting a gene
encoding cathepsin L cysteine proteinase in M. incognita (Shingles et al. 2007). However, the
79
translucency of adult females as described here has only been reported in nematodes feeding on
plants producing dsRNA complementary to nematode splicing factor and integrase genes
(Yadav et al. 2006). There may be a pattern in terms of pathways, since the genes targeted by
Yadav et al. (2006) disrupted similar essential cellular processes involved in gene regulation,
and here the translucent appearance of adult females was largely found after RNAi of genes
involved in the miRNA pathway (xpo-2, pash-1, alg-1, xrn-2).
A feature that deserves more study is that, after soaking in dsRNA of target genes followed by
washing and transfer to wild-type tomato plants, a reduction of infection and abnormal
phenotypes of adult females was found. However, despite the abnormal phenotypes, after
soaking in dsRNA, there was not a reduction in transcript abundance, in fact transcript
abundance increased. This phenomenon, that is, an initial increase in transcript level, has also
been found in some instances after RNAi soaking treatments, and it appears to reflect a
feedback mechanism similar to that in the miRNA pathway (Bakhetia et al. 2008). Since the
miRNA pathway is an important component of the regulation of gene expression, some possible
explanations for this phenomenon can be suggested. It may be that in response to perturbations
caused by RNAi treatment, there is a rapid response to increase transcription of targeted genes.
Alternatively, a higher concentration of dsRNA may be required to reduce transcript levels. The
concentration of dsRNA/siRNA required to knockdown a gene probably depends on a number
of factors, such as the specific target and sequence chosen, whether it is part of a multi-gene
family, and whether there are alternative compensatory pathways, as well as differences
between different nematode species (reviewed in Lilley et al. 2012). Regardless of the reports in
which in vitro RNAi effects were temporary (i.e. there was a rapid recovery after treatment), in
other research, concentrations of as low as 0.1 mg/mL have been reported as effective, for
example in knockdown of FMRFamide-like peptides (FLPs) in Globodera pallida, and the
effect increased with increase in RNA concentration (Kimber et al. 2007). The most probable
explanation for an increase in the target mRNA after soaking in dsRNA to that target, is that the
dsRNA concentration (1 mg/mL) used in the experiments initiated a feedback mechanism for
gene regulation which resulted first in a reduction in the presence of target gene mRNA,
followed by a stimulation of transcription of the target gene, but during the recovery phase and
subsequent plant infection, the secondary siRNAs produced by the nematode itself through the
RNAi amplification system then reduced the transcript levels, and so affected and disturbed
growth and development. For other target genes, there are many reports of a reduction of
transcript level long after soaking treatment. For example, in M. incognita the greatest reduction
in target message was observed 20 hours after a four hour dsRNA treatment for the gene Mi-crt,
and the greatest silencing was found 44 hours after soaking for the gene Mi-pg-1 (Rosso et al.
2005).
80
The 18S rRNA gene is often used as a consistent reference gene or ‘housekeeping gene’ for
normalisation of comparative transcript analysis in many systems (e.g. Goidin et al. 2001; Bas
et al. 2004). Although its expression may be stable in other animal systems, this gene shows
variable expression levels under certain experimental conditions (Nelissen et al. 2010; De Santis
et al. 2011). In our experiments, inconsistencies in the expression of 18S rRNA genes may be
attributed to the different proportions of live nematodes in different treatments that were used
for RNA extraction, or a response to imbalance in gene regulation caused by dsRNA treatment
targeting RNAi pathway genes themselves.
In conclusion, in vitro RNAi of genes involved in the small RNA pathway of M. incognita J2s,
after soaking treatment and transfer to tomato plants, resulted in reduced viability and
infectivity, and deformities in adult females that developed. Some treated M. incognita J2s were
able to recover from the stress of soaking in dsRNA and were able to infect and feed in host
plants. RNAi of genes involved in the miRNA pathway (drsh-1, pash-1, xpo-2, alg-1, xrn-2)
and helicases of the Dicer complex (dcr-1, drh-1, drh-3) seemed to have comparatively higher
impact on disrupting nematode infectivity and development, hence these genes may be the best
targets to progress for study of plant-delivered dsRNA. The RNAi screens of target genes
undertaken here show that if target genes are to be pre-screened by soaking in homologous
dsRNA, optimisation of conditions is required for factors such as the concentration of the
dsRNA used, the particular target gene and sequence used, whether there is a ‘recovery’
phenomenon after treatment. One variable is that for host-delivered dsRNA, the concentration
present in cells is not known, or the effect of long term delivery of dsRNA. Nevertheless
dsRNA treatments for target genes still provides a valuable filter to decide which targets to
choose to take forward for in planta RNAi studies for nematode control.
81
Chapter 4
Host-induced gene silencing of RNAi effectors confers
resistance against Meloidogyne incognita and affects
development
82
Host-induced gene silencing of RNAi effectors confers resistance against
Meloidogyne incognita and affects development
Sadia Iqbal, John Fosu-Nyarko and Michael G.K. Jones
Plant Biotechnology Research Group, School of Veterinary and Life Sciences, WA State
Agricultural Biotechnology Centre, Murdoch University, Perth, WA 6150, Australia
4.1 Abstract
RKNs (Meloidogyne spp.) have broad host range and are the most damaging PPNs. In planta
RNAi provides a potential method of delivery of dsRNA for silencing or reducing specific gene
expression. The transgenic plants generated for these experiments transcribed hairpin (hp) RNA
corresponding to nematode genes from different steps of the RNAi pathway. These were part of
the dicer complex (dcr-1, drh-3), microprocessors (drsh-1, pash-1), nuclear RNAi effectors
(mut-7, rha-1) and the RISC gene vig-1. Expression of hp RNA in these plants reduced
nematode infestation by up to 89% for drsh-1, 76% for mut-7, 74% for drh-3, 71% for dcr-1,
66% for rha-1 and 64% each for pash-1 and vig-1. Host-delivered RNAi also impaired normal
development of nematodes resulting in smaller sized and fusiform females. These results
indicate that longer-term delivery of dsRNA throughout the nematode’s life cycle induces RNAi
of these genes, which significantly affects the nematodes’ ability to enter, migrate in and form
feeding cells in host plant roots, and to develop normally. As a result the target genes studied
could be used as targets for developing resistance in crop plants.
Keywords: Host-induced gene silencing, RNAi pathway, root-knot nematodes, transgenic
plants, nematode control.
4.2 Introduction
Root-knot nematodes establish a sophisticated relationship with cells of host plants in that they
are able to modify the host’s metabolism and establish giant cells at a feeding site. Currently,
there is no one environmentally safe and economically feasible method to control PPNs and
especially RKNs, whose control has been described as a “never ending battle” (Sikora and
Fernandez 2005). HIGS has been studied in a number of plant host-pest/pathogen situations,
including VIGS or incorporation of a transgene producing a hairpin trigger which is processed
into siRNAs by the plant RNAi machinery (reviewed in Dutta et al. 2014).
Arabidopsis thaliana is a good subject for plant transformation studies because of its rapid life
cycle, diploid genetics, its well characterised small genome (125 Mbp) and the fact that it is
83
relatively easy for generating mutants and transgenic plants. Although it is not the best host
plant for cyst and root-knot nematodes, nevertheless the nematodes can complete their life
cycles on Arabidopsis, making it a suitable system for study of the biology of infection of these
nematodes (Sijmons et al. 1991). As a result, Arabidopsis has become a standard host plant to
study host-delivered RNAi to root-knot nematodes: most research using this system has been on
genes involved in nematode parasitism and development.
In Chapter 3, the effects of dsRNA treatment of 27 genes involved in the RNAi and miRNA
pathways of RKNs were assessed using the ‘soaking’ method. From this work, 11 genes that
caused the greatest reduction in infection of tomato plants after dsRNA treatment, and/or
abnormal adult female morphology were chosen for plant-mediated RNAi to study the longer
term effects of continuous ingestion by M. incognita of dsRNA from giant cells.
4.3 Materials and methods
4.3.1 Cloning of hairpin expression cassettes
The genes chosen for HIGS were dcr-1, drh-3, vig-1, ego-1, mut-7, drsh-1, pash-1, rha-1, alg-1,
2242 and rol-6. The non-target gene gfp and an empty vector with no gene were also used as
controls. The nematode gene sequences and gfp were analysed with the software ‘dsCheck’ to
identify potential off-target effects in the host plant A. thaliana (Naito et al. 2005).
Cloning vector pCleaver provided by Dr. John Fosu-Nyarko was used to prepare the hairpin
expression cassette. pCleaver is a 4 Kbp vector which makes it easier to manipulate through
cloning cycles because of the small size (Figure 4.1). The hairpin cassette in pCleaver has a
constitutively expressing Cauliflower Mosaic Virus (CaMV) 35S promoter and a Nopaline
Synthase (NOS) terminator sequence. The vector confers resistance to the antibiotic kanamycin
in bacteria. Sense and antisense fragments were cloned in tandem, separated by a bean catalase
gene intron (190 bp) between the promoter and terminator sequences, in a two-step process.
Restriction digestion, ligation, transformation, PCR conditions and plasmid purification were
done as described in Section 3.3.4.
Briefly, for each target gene, the 5′− 3′ (sense) fragments were digested out of pDoubler using
the enzymes XhoI and KpnI, except for xpo-1, xrn-2 and gfp for which AfeI was used with KpnI
and ligated to pCleaver linearised by the same restriction enzymes. After ligation, E. coli JM109
was transformed with the DNA using the heat shock method (Section 3.3.4). Colonies were
grown on selection media i.e. LB and 50 µg/mL of kanamycin monosulfate. Colony PCR using
the primers S35S (5′-GATTGATGTGACATCTCCACTGA-3′) and SIntron (5′-TCATCATC
ATCATAGACACACGA-3′) was done to select positively transformed colonies which were
84
then cultured in 5 mL LB broth with 50 µg/mL kanamycin. The cloning vector pCleaver with
restriction enzyme sites and primer positions is presented in Figure 4.1.
Figure 4.1: pCleaver cloning vector. Restriction enzyme sites and primer positions are
indicated. MCS (A) and MCS (B) are multiple cloning sites for ligating target sequences in 5′−
3′ and 3′− 5′ orientations.
Plasmid DNA was purified from cultures and restriction digestion with XhoI and PstI used to
confirm successful cloning. This vector with ligated sense fragment was then linearised using
XbaI and BamHI and the 3′− 5′ antisense fragments of the target genes digested out of pDoubler
with the same restriction enzymes was ligated to the vector. For gfp antisense cloning, the
restriction sites used were AvrII and AscI. After transformation and culture on selective media,
colonies were screened by PCR using primers ASIntron (5′-TCGTGTGTCTATGATGATGA
TGA-3′) and ASNosA (5′-CATCTCATAAATAACGTCATGCATT-3′). PCR positive colonies
were cultured in LB broth with kanamycin (50 µg/mL) overnight and plasmid DNA purified.
The DNA was digested with NotI to confirm successful cloning and to ligate the hairpin cassette
to a binary vector.
Vectors with both sense and antisense fragments of target genes ligated were sequenced as
described in Section 3.3.5. The primers used for sequencing were SIntron and ASIntron in
separate reactions. Sequencing results were analysed using FinchTV 1.4.0 (Perkin Elmer, Inc.)
85
and MultAlin alignment software (Corpet 1988). After confirming the correct orientation of the
gene fragments, the hairpin expression cassette was transformed into the binary vector pART27.
4.3.2 Cloning into the binary vector pART27
The binary vector pART27 was used for plant transformations (Gleave 1992). The hairpin
cassette from pCleaver for the nematode genes, gfp and gene-free control were digested out
using NotI and ligated to NotI linearised, dephosphorylated pART27. Antarctic phosphatase
(New England BioLabs) was used for dephosphorylation. Five units of enzyme per 1.5 µg of
NotI digested vector DNA was incubated at 37 °C for 30 minutes followed by deactivation at 65
°C for 5 minutes. Ligated vectors were transformed into E. coli JM109 as described in section
3.3.4 and cultured on selective media containing LB and 100 µg/mL of spectinomycin
dihydrochloride. Colony PCRs were done using the primers 35SART (5′-GTCTTGATGAGAC
CTGCTGCGTA-3′) and SP6 (5′-CATACGATTTAGGTGACACTATAGA-3′). The 35SART
primer binds in the 35S promoter sequence of the hairpin cassette while SP6 binds near the right
border of the vector pART27 (Figure 4.2).
A confirmatory digest of cloned, purified plasmid DNA was done with the enzyme SalI to
confirm the presence of insert. Confirmed plasmid DNA was then used to transform
Agrobacterium tumefaciens for plant transformations.
Figure 4.2: Map of the vector pART27. Primer binding sites and restriction enzyme sites are
indicated.
86
4.3.3 Agrobacterium tumefaciens transformation
Agrobacterium tumefaciens strain GV3101 was prepared using the calcium chloride method
(Sambrook and Russell 2001). Briefly, 250 µL of overnight culture of A. tumefaciens was used
to inoculate 100 mL LB broth in a 500 mL flask. The culture was incubated on a shaker at 28°C
in the dark until OD600 reached 0.8 after which the flask was chilled on ice for 10 minutes. The
culture was transferred to 50 mL centrifuge tubes and centrifuged at 4 °C for 30 minutes at
3,000 g. Supernatant was discarded and pellet was resuspended in 1 mL of sterile 20 mM
calcium chloride at 4 °C. Aliquots of 50 µL were dispensed in pre-chilled eppendorf tubes, snap
frozen and stored at -80 °C. All transformations were done with 50 µL of competent cells and
500 ng of plasmid DNA using the heat shock method. Briefly, competent cells were thawed on
ice and vector DNA was added followed by a further incubation of 20 minutes on ice. The cells
were then incubated at 37 °C for 5 minutes in a water bath. One mL of LB was added and
incubated for 3 hours in the dark at 28 °C with shaking (200 rpm). After 3 hours, an aliquot
(150-200 µL) of this culture was plated on LB media containing 100 µg/mL of spectinomycin
dihydrochloride and 25 µg/mL rifampicin. Bacteria were allowed to grow for 2 days at 28 °C
after which colonies were picked and resuspended in 20 µL PCR water. After initial failure to
obtain an amplicon using 5 µL of this bacterial suspension as template in PCR, the same
suspension was heated at 96 °C for 10 minutes prior to adding the PCR reaction master mix.
35SART and SP6 primers were used for these PCRs with the following cycling conditions:
initial denaturation at 96 °C for 2 mins; 25 cycles of 96 °C for 30 secs, 55 °C for 30 secs and 72
°C for 30 secs and an extension step at 72 °C for 7 mins. Amplicons were visualised on a 1%
agarose gel. Positive colonies were cultured in 5 mL LB broth supplemented with 100 µg/mL of
spectinomycin dihydrochloride and 25 µg/mL rifampicin.
4.3.4 Plant transformation
Arabidopsis thaliana ecotype Columbia-0 was used for transformation using the floral dip
method (Bent et al. 2006). Arabidopsis seeds were grown in the glasshouse under controlled
conditions (22 ± 5 °C and 16 hours light) in trays. The soil mix was prepared with 1 part
Murdoch mix (composted pine bark: coarse river sand: coco peat in a 2:2:1 ratio) and 1 part
Richgro seed & cutting mix with fertilizers and minerals i.e. Grower’s blue (60 g), Osmocote
(60 g), dolomite (20 g) and calcium carbonate (15 g) added per 40 L of soil mix. After
germination, the plants were transferred to plastic cups (200 mL) with holes at the base. First
flowering heads were cut off to encourage growth of multiple heads which were then subjected
to floral dip transformation.
87
To prepare A. tumefaciens inoculum, 100 mL of LB supplemented with 100 mg/L
spectinomycin dihydrochloride and 25 mg/L rifampicin was inoculated with 2 mL of a stock
bacterial culture and incubated at 28 °C in the dark until the OD600 was 0.1-0.2. Bacterial cells
were pelleted by centrifugation and resuspended in an equal volume of 5% sucrose. Ten to
fifteen plants for each construct were used for transformation. Silwet-77 surfactant was added at
a concentration of 0.05% before dipping florets into this solution for 10-15 seconds. Plants were
covered with clear plastic for one day to maintain humidity and then grown and watered as
normal until siliques were matured and dry. At this stage, watering of the plants was stopped
and brown paper bags were used to cover the siliques. Completely dried siliques were cut off at
the base of flowering stems and stored in paper bags until threshed. After threshing, seeds were
passed through a 2 mm sieve and collected in 5 mL plastic tubes for storage.
4.3.5 Screening for Transgenic (T1) plants
Seeds collected from transformed plants were sterilised by the vapour-phase surface sterilisation
method (Bent et al. 2006). Seeds were transferred to 2 mL microfuge tubes to about 50 µL
packed volume and placed in a rack upright with lids open in a desiccator in the fumehood. At
the centre of the desiccator was a glass bottle containing 100 mL of 12.5% sodium hypochlorite.
Four mL of hydrochloric acid was slowly poured into the glass container after which the
desiccator lid was closed. After 12-14 hours, the lid was slightly opened in the fumehood to
allow gas to escape for 20 minutes. The rack was then transferred to a laminar flow cabinet and
the tubes left open for 30 minutes to remove residual fumes.
Seeds were then spread with 0.4% agar on MS media plates (1/2 Murashige and Skoog basal
medium with Gamborg vitamins, 3% sucrose, 0.8% Agar) supplemented with 50 µg/mL of
kanamycin monosulfate to screen for transformed plants. After initial incubation at 4 °C in the
dark for two days to break dormancy, the plates were placed in a growth chamber (Conviron
ATC40) with controlled conditions (16 hour light @150 µmol/m2/s, 40% RH and 23 ± 2 °C).
After screening for at least three weeks, plants that survived were transferred to 200 mL plastic
cups containing soil mix. These plants were grown in the same growth chamber. Once the plants
just started to bolt, ‘Aracons’ with transparent plastic tubes (height: 60 cm) with holes for
ventilation were placed in every cup to prevent cross fertilisation and guide dried seeds to fall
into the Aracon container. When bolts and pods were completely dry, seeds were collected by
cutting the bolts at the base and inverting the Aracon assembly into a paper bag. Seeds were
sieved and collected into 5 mL sterile plastic tubes.
88
4.3.6 Screening and challenge of T2 plants
Seeds from T1 plants packed in 50 µL volume were sterilised as described previously. They
were then spread on MS medium plates as described for T1 plants and incubated at 4 °C for two
days. A control plate spread with wild-type seeds on medium with kanamycin was also
prepared. Seedlings were allowed to grow at optimum growth conditions (23 °C and 16 hour
light) until plantlets on control plates were dead, and clear selection was observed for transgenic
plants.
Plants were then transferred to 56-well trays (well capacity: 65 cm3) containing soil and placed
in the growth chamber (23 ± 2 °C, 16 hour light @150 µE/m2/s and 40% RH). After initial
acclimatisation of plants in soil and growing for another week, each plant was infected with 200
active J2s of M. incognita extracted from tomato plant roots.
4.3.7 Nematode collection for infection
J2s of M. incognita were extracted from roots of heavily infested tomato plants (cv. Grosse
Lisse) and the plant’s rhizosphere, using a mist apparatus as described by Tan et al. (2013).
Briefly, two layers of coffee filters containing root and soil material were placed on a sieve in
funnel and sprayed for 10 seconds with a fine mist every 10 minutes for two days. Nematodes
which passed through the filters to the lower part of the mist apparatus in the tubing were
collected in a 240 mL glass bottle.
The bottle was placed on lab bench for 4-5 hours to allow the nematodes to settle. Excess water
was removed using a vacuum pump and the nematodes cleaned using the sucrose gradient
method (Amin et al. 2014). Sucrose gradient columns were made with 3 mL of 50% sucrose
solution at the bottom carefully overlaid with 4 mL of 10% sucrose solution in a 14 mL tube.
Nematodes suspended in water (4 mL) were carefully poured on top of the column and
centrifuged for 15 minutes at 2,150 g with slow deceleration so as not to disturb phases.
A layer of clean J2s was formed at the junction of 50% and 10% sucrose solutions, which was
carefully pipetted out and poured onto a 10 µm filter. One litre of sterile water was passed
through this sieve to wash sucrose off the J2s, which were then collected for plant infection.
4.3.8 Nematode infection of transgenic plants
Two hundred active J2s were used to infect transgenic Arabidopsis plants (4 to 10 events for
each target gene) by pipetting water containing nematodes on four sides of each plant root ~1
inch deep in the soil. Fourteen uniform replicate plants were infected for each transgenic event
and 20 for wild-type plants. Plants were watered sparingly for two days following nematode
89
infection. Four weeks after infection, plants were uprooted and roots were thoroughly washed to
eliminate soil particles. Galls were counted for 10-11 plants per transgenic event (16 for wild-
type) using a dissecting microscope. Roots separated at the collar were dried in an oven for 16-
18 hours at 55 °C and weighed afterwards. The number of galls per gram dry root weight was
calculated for each plant.
4.3.9 Nematode development after infection
Three to four plants for each transgenic event were uprooted after five weeks of infection and
females were dissected out of the galls. These were stained with acid fuschin to study
morphological differences between nematodes feeding on transgenic plants and those on
controls. After collecting females in water in a 1.5 mL microfuge tube, they were centrifuged
for 30 sec at 500 g. Water was removed by pipetting and 200 µL acid fuschin staining solution
was added. The tube was incubated at 95 °C for 2 minutes with gentle agitation and centrifuged
again at 500 g for 30 seconds to remove the staining solution. Stained females were washed 2
times with water and viewed on a glass slide under bright field view (Olympus BX-51
microscope) with 4x and 10x magnification.
4.3.10 Statistical analyses
Analysis of variance (ANOVA) was done for comparison between treatments and calculation of
means, standard deviation and standard error in the statistical software package SPSSv20 (IBM
Corporation, US) Significance between treatments and pair-wise comparisons were done using
Tukey’s test at a significance level of 0.05. Microsoft Excel Analysis ToolPak was used for
construction of bar charts.
4.3.11 Confirmation of T-DNA insertion
Four transgenic events per gene were selected for PCR to confirm integration of target DNA
into the Arabidopsis genome. Leaf samples were collected from three plants of each event for
DNA extraction using the CTAB method. About 100 mg of plant sample was transferred to 1.5
mL microfuge tube with three 3.2 mm stainless steel beads (Qiagen, Australia). Tubes were
frozen in liquid nitrogen and the leaves ground to fine powder using a Tissue Lyzer (Qiagen,
Australia) at 20 Hertz for 2 minutes. One mL of pre-heated (65 °C) CTAB buffer (2% CTAB,
100 mM Tris-HCl, 20 mM EDTA, 1.4 M NaCl, pH 5.0 and freshly added 1% PVP and 2% 2-
marcaptoethanol) was added to each tube and vortexed for 2 minutes. Tubes were incubated at
65 °C for 30 minutes and then centrifuged at 14,000 g for 2 minutes. Supernatant was collected
in a 2 mL microfuge tube and equal volume of chloroform:isoamyl alcohol (24:1) was added,
the emulsion vortexed for 1 minute and then centrifuged for 2 minutes at 12,000 g to separate
90
phases. The aqueous layer was collected in a clean microfuge tube, 1/10th volume of 7.5 mM
Ammonium acetate and 2 volumes of 100% ethanol were added and precipitated overnight at 4
°C, after which the tubes were centrifuged at 16,000 g for 15 minutes to pellet the nucleic acids.
The supernatant was discarded and the pellet washed with 70% ethanol, dried and later
resuspended in 100 µL of sterile water.
Resuspended DNA was quantified using a Nanodrop spectrophotometer, and 100-200 ng of this
DNA was used in standard 20 µL PCR reactions. Primers used were NptII-F (5′-TGCTCCTGC
CGAGAAAGTAT-3′) and NptII-R (5′-AATATCACGGGTAGCCAACG-3′) to amplify a 364
bp fragment of the nptII gene in the binary vector. Amplicons were visualised on a 1% agarose
gel.
4.3.12 Confirmation of transcription of nematode silencing signals
RNA extraction was done with the Trizol method and treated with DNaseI as described
previously for nematodes in Section 3.3.2, except that 1 mL of diluted Trizol LS reagent was
used. After drying, the pellet was resuspended in 80 µL of sterile water from which 500 ng was
used to synthesise cDNA using the High capacity cDNA synthesis kit (Applied Biosystems) in a
20 µL reaction. One in ten dilutions of this cDNA were used in 20 µL PCR reactions using the
nematode gene specific primers with the following cycling conditions: initial denaturation at 96
°C for 5 mins; 30 cycles of 96 °C for 30 sec, 55 °C for 30 secs and 72 °C for 1 min and an
extension step at 72 °C for 7 mins. Amplicons were visualised on a 1% agarose gel.
4.4 Results
4.4.1 Analysis of transgenic plants
After floral dip of Arabidopsis plants, the seeds were screened for selection of transformants.
The transformation efficiency varied for the different constructs used. Table 4.1 shows the
number of events that survived kanamycin screening for three weeks for both T1 and T2
generations. In the second screening some lines appeared to be non-transformed, and none of
the selected transformants survived for the genes ego-1, alg-1, 2242, rol-6 or the null vector.
The genes in the RNAi pathway are conserved genes across eukaryotes and there were
mismatches between the M. incognita gene sequences used for transformation and those of A.
thaliana, but there were no continuous matches of 18-21 bp for any of the genes studied. No
phenotypic differences were observed for the plants transformed with the nematode sequences
used or with gfp. Healthy dry seeds were produced by all events (T1 and T2). Screening of T1
plants on plates and plants growing in cups with the Aracon assembly are shown in Figure 4.3.
91
Table 4.1: The number of transgenic events of A. thaliana that survived after kanamycin
screening. All of the harvested seeds were screened at the T1 generation, while for T2 a
maximum of 10 events per construct were screened.
M. incognita
gene
No. of T1
transformed
events
No. of T2
transformed
events
M.
incognita
gene
No. of T1
transformed
events
No. of T2
transformed
events
dcr-1 23 9 rha-1 18 10
drh-3 14 10 alg-1 3 0
vig-1 8 4 2242 0 -
ego-1 3 0 rol-6 1 0
mut-7 8 5 gfp control 13 9
drsh-1 12 10 Null vector 4 0
pash-1 6 5
(A) (B)
Figure 4.3: Kanamycin screening of T1 transgenic events. (A) Transformed events (T1)
growing on kanamycin selection for three weeks. (B) Plastic cups with one transgenic event
(T1) in each, with an Aracon assembly to prevent cross fertilisation and easy seed collection.
92
Screening for T2 generation plants revealed that there must have been some false positives
among selected T1 events, since the following putative events did not yield viable plants when
selected on kanamycin a second time: ego-1, alg-1, 2242, rol-6 and null vector.
After the second screening, the T2 events that grew well and were used for nematode challenge
were transformed with the constructs targeting dcr-1, drh-3, vig-1, mut-7, drsh-1, pash-1, rha-1
and gfp vector. Since this generation was still segregating, a 3:1 ratio of transformed to non-
transformed lines was evident on some plates (Figure 4.4). Wild-type seeds on control plates did
not survive the kanamycin screening. Antibiotic screening and plants growing in trays after
infection are presented in Figure 4.4.
4.4.2 Analysis of nematode infection
Between 10-11 plants were analysed for infection from each transgenic line. With as many as an
average of 2,300 galls per gram of dry root weight, wild-type plants were clearly highly
susceptibility to infection by M. incognita. There was no significant difference in the average
number of galls/g dry root between the gfp transgenic events analysed (p<0.05). Also infection
levels were not significantly different from the infection levels on wild-type control plants
(Figure 4.5).
From the dicer complex group of genes, transgenic events were analysed for dcr-1 and drh-3.
Significantly reduced infection was observed for all nine hpdcr-1 events when compared to
wild-type or hpgfp events (p<0.05). For five out of the nine events there was reduced nematode
infestation, by 50% or more, with the greatest reduction of 71% (event 8) (Figure 4.5). The
lowest reduction in infestation was 35% for hpdcr-1 events. Similarly, there was significantly
reduced infestation in all events of hpdrh-3 plants (p<0.05). However, the range of reduction in
(A)
(B)
(C)
Figure 4.4: Kanamycin screening of T2 transgenic plants. (A) Antibiotic screening of T2 plants. (B)
Control plate with wild-type seedlings that did not survive kanamycin screening. (C) Transgenic
plants growing in 56-well trays after nematode infection.
93
infection was better than dcr-1 events: ranging from 42-74% and with seven of the ten events
showing reduced nematode infection by 50% or more while three were 70% less than controls.
All transgenic events expressing hpRNA corresponding to the gene drsh-1 and its co-factor
pash-1 reduced nematode infection significantly (p<0.05). The infection reduction for the 10
events of drsh-1 was between 30-89%: eight of the events exhibited a reduction of >50%. This
group of transgenic events also showed most variation for the average number of galls/g dry
root between events. The five events expressing hppash-1 were all significantly less infested
than controls, by as much as 64%. The highest infested line from this group had 30% fewer
galls/g dry root than controls (Figure 4.5).
Two other groups of RNAi effectors were targeted through host-delivered silencing signals. The
RISC effector vig-1 when targeted reduced infection significantly (p<0.05). Four lines tested for
nematode infection showed a reduction in infection of 38-64% compared to controls (Figure
4.5). Five transgenic events for the nuclear RNAi gene mut-7 were also tested for nematode
susceptibility. Four of the events showed significantly reduced infection compared to controls,
while one of the events (event 3) was not significantly different because of the variation in
replicates even though the infection reduced by 38%. The transgenic events targeting nuclear
RNAi effector rha-1 also showed significantly reduced infestation for 9 of the 10 events tested.
The reduction in plant infestation targeting this gene was in the range of 33-69% (Figure 4.5).
With the exception of two (one for mut-7 and one for rha-1), transgenic events carrying hp of all
7 genes studied had significantly reduced nematode infestation compared to the controls
(p<0.05). Sequences from genes of the microprocessor complex and dicer complex appeared to
be the most effective in reducing nematode infestation through HIGS. Overall, strongest
reduction in infestation of the T2 generation of A. thaliana plants was an 89% reduction in
nematode infestation. This correlates quite well with results from soaking experiments.
94
(A) (B)
(C) (D)
(E) (F)
(G) (H)
Figure 4.5: Nematode infection, as measured by the number of galls per gram dry weight of root
tissue, compared to controls (A) hpgfp events, (B), hpdcr-1 events, (C) hpdrh-3 events, (D) hpdrsh-1
events, (E) hppash-1 events, (F) hpvig-1 events, (G) hpmut-7 events and (H) hprha-1 events.
Comparisons are based on average number of galls/ gram of dry root weight for replicate plants (n =
9 to 16) between wild-type and transgenic events (means ± standard error). Bars having different
letters indicate significant differences (p<0.05).
95
4.4.3 Female morphology
Adult female nematodes were dissected from plant roots five weeks after infection. Three events
for each hpRNAi vector were selected for this. The females extracted from transgenic plants
exhibited three abnormal phenotypes when compared to controls. These were smaller size,
elongated (fusiform) body shape and a transparent, sickly appearance. The females extracted
from plants with hpRNA targeting the dicer complex and miRNA processing genes were
smaller in size than those extracted from control wild-type and hpgfp transgenic plants. This
small size of adult female nematodes was most prominent for drh-3, drsh-1, pash-1 and rha-1
targeting plants, where nematodes were smaller in diameter at the posterior end compared to
saccate large females produced in roots of wild-type and hpgfp plants (Figure 4.6).
The types of changes in adult nematode morphology are shown in Figure 4.6 for nematodes
feeding on transgenic plants targeting drh-3, pash-1, mut-7 and rha-1. The highest percentage of
nematodes with modified phenotypes was found for pash-1 targeting lines in which 65% of the
extracted females were fusiform or elongated. The percentage was 62% for rha-1 targeted
nematodes, and for targets against drh-3 and drsh-1 the elongated phenotype was 56% and 46%
respectively.
The transparent appearance of nematodes was observed for those feeding on plants producing
dcr-1, drsh-1, pash-1 and vig-1 silencing signals. Clearly these nematodes did not make egg
masses and had impaired reproduction. Fusiform and transparent phenotypes were also evident
for nematodes infecting plants producing targets against vig-1 and pash-1. Although the
percentage of nematodes with transparent bodies was low, only about 5% for vig-1 and pash-1
treatments, nevertheless none of the nematodes growing on control plants showed this
phenotype.
96
hpgfp hpgfp Wt Wt
hpdcr-1 hpdrh-3
hpdrsh-1 hppash-1 hpvig-1
hpdcr-1 hpdcr-1 hpdrh-3
hpdrsh-1 hppash-1
hpvig-1 hpmut-7 hpmut-7 hprha-1 hprha-1
4.4.4 T-DNA insertion and dsRNA transcription
A 364 bp fragment of the nptII gene was amplified from DNA extracted from different
transgenic lines. Four events displaying significantly lower infection (p<0.05) for each
transgene were chosen for PCRs and RT-PCRs. Figure 4.7A shows the bands amplified from
the DNA of all the events tested, which confirmed the transgenic status of the plants and
successful T-DNA insertion in the plants challenged with nematodes.
To confirm RNA transcription in the same events, RT-PCRs were done with gene specific
primers on the plant-derived RNA. Amplified bands are shown in Figure 4.7B. The intensity of
the bands was different for different transgenic events. The specific nematode genes could not
be amplified from two of the transgenic lines i.e. for one line each of dcr-1 and pash-1.
Figure 4.6: Adult females dissected from wild-type (Wt) and hpRNA transgenic A. thaliana
plants five weeks after infection. Nematodes were stained with acid fuschin. Scale bar:
500µm.
97
4.5 Discussion
In this study, A. thaliana plants were successfully engineered to constitutively express dsRNA
targeting 7 different genes affecting the RKN M. incognita. HIGS in this study resulted in a
significant reduction in infection for all targets, and also defects in nematode development for
some targets. There were no apparent phenotypic effects in any of the transgenic Arabidopsis
plants, although there could be other less obvious changes. There were no significant
differences in the level of infection between wild-type and dsgfp producing control plants,
indicating that there was no effect on nematode parasitism of plant transformation in itself. In
contrast, all of the host-delivered triggers significantly impaired the ability of nematodes to
infect, produce galls and reproduce on transgenic plant roots.
One aspect considered at the start of RNAi studies for nematode control was a concern that the
size of dsRNA molecules might prevent their uptake. However, this does not seem to be a
problem, since M. incognita J2s have been shown to be able to take up 800 bp dsRNA targeting
the cathepsin L-cysteine gene from solution, and from plants they are able to take up 28 kDa
GFP protein (Urwin et al. 1997b; Shingles et al. 2007). In this study, the size of the dsRNA
sequences used to generate transgenic lines was between 187-669 bp, and the results clearly
indicate that dsRNA had been taken up, since all treatments reduced nematode infestation
significantly. Different band intensities of amplified DNA (PCR and RT-PCR) possibly point to
different levels of hpRNA produced in different transgenic lines. This aspect can be investigated
further by analysis of gene copy number and quantitative transcript analysis of homozygous
lines of the next generation of these plants.
Resistance to nematode infestation varied with the gene being targeted through HIGS. There
were also differences in responses to different events of the same transgene. This is a common
phenomenon encountered with different events for most transgenic plant experiments. There are
various factors which cause this variation, and these include gene copy number of inserts, the
site of insertion, and flanking sequences, and all influence the level of transgene expression,
M hpdcr-1 hpdrh-3 hpvig-1 hpmut-7 hpdrsh-1 hppash-1 hprha-1 hpgfp
A
B
Figure 4.7: (A) Amplified nptII gene fragment from genomic DNA of four events for each hpRNAi
vector. (B) Amplified nematode-specific transcript from transgenic lines using RT-PCR. M = 100bp
DNA ladder.
98
which translates into different efficiencies of events to amplify the silencing triggers, and
deliver them via the feeding tube to the feeding nematode. An additional factor which may
increase the standard deviations observed may be the presence of both homozygous and
heterozygous plants in the analysed material. Unless, a gene copy number analysis is done for
identifying homozygous single copy insert plants, it is difficult to rank the target genes
confidently in order of effectiveness. Nonetheless, the events tested still reduced nematode
infection success significantly, and the range of responses for different events of the same gene
reflects some of the factors discussed above.
The nematode genes targeted in this study are involved in the endogenous gene regulation
system which may affect nematode developmental pathways. A similar transparent appearance
following host-delivered RNAi has been reported before by Yadav et al. (2006) who suggested
it was caused by a lack of gut granules. However this is interpreted, it is clear that such
nematodes are extremely unhealthy. It is also significant that developing eggs can normally be
seen inside the female body, but this was not the case for the transparent females. Therefore,
reproduction was either non-existent or substantially reduced for these females. Similarly,
nematodes exhibiting a fusiform (elongated) body may result from delayed growth or defective
moulting. Challenge of several generations of nematode on these plants will give a good idea on
the magnitude of such effects on nematode development and reproduction, and also provide
information on whether such effects are stable or amplified through generations.
In considering what genes might be appropriate to use as targets for nematode control via HIGS,
evidence is now accumulating, at least for RKNs, that many different types of targets can be
chosen. Other work has tended to focus on genes involved in parasitism in relation to nematode
entry and migration in root tissues, avoiding host defences, or genes required for giant cell
induction and function. In the work undertaken here, it is clear that apart from genes involved in
parasitism and development, those involved in gene regulation such as the RNAi pathway are
also suitable target genes for nematode control, especially since down-regulation is likely
directly or indirectly to affect a wide range of biochemical and metabolic pathways. Similarly,
highly deleterious effects have been reported for genes involved in mRNA metabolism for both
in vitro soaking (95% lethality) and host-delivered silencing (88% reduced infection) in RNAi
studies on H. glycines (Alkharouf et al. 2007; Klink et al. 2009).
It is interesting to point out that drsh-1 targeting plants impaired nematode infectivity by more
than its co-factor pash-1, but when nematode development was analysed, RNAi of pash-1
seemed to have more deleterious effects than that of drsh-1. This suggests that a combinatorial
host-delivered knockdown approach for these genes might result in higher impact, disrupting
both infectivity and development of RKNs.
99
The seven M. incognita genes transformed into plants in this study show high similarity to M.
hapla orthologous sequences. This homology was between 90-94% with stretches (>25 bp) of
sequences matching perfectly except for vig-1. With this degree of homology in common target
genes, it is possible that the transgenic plants generated for resistance to M. incognita could also
be resistant to M. hapla. Such cross-resistance is entirely possible since plant-derived RNAi of
Mi16D10 reduced egg production per gram root for four species of RKN (M. incognita, M.
javanica, M. arenaria, and M. hapla), by between 69% and 93% (Huang et al. 2006).
Another possibility also exists that using data from transgenic plants to identify the most
effective targets for silencing in root-knot nematodes: it may be possible to deliver dsRNA
stabilised in some way and sprayed onto plants. This approach would avoid the issues of
acceptance of transgenic plants, and could well be applied to control of other above ground
pests through topical dsRNA application. Some success from this approach has been reported
for pests like the diamondback moth and citrus psyllid (Gong et al. 2013; Killiny et al. 2014).
Knowledge gained from experiments using Arabidopsis on control of PPNs should be
translatable for application in commercial crops for example for soybean, HIGS reduced the
damage caused by soybean cyst nematode by up to 67% (Matthews et al. 2014). An important
aspect in relation to commercial application is the selection of transgene sequence used, which
should have absolutely no off-targets, either for the host plant or non-target organisms. It is only
really possible to ensure that this is the case once full genomic sequences are available for the
crop plant of interest, and for other species that might encounter that crop. Nevertheless, for
obligate parasites such as PPNs, RNAi technology is a powerful tool for reverse genetics
studies, and can be used to probe mechanisms underlying parasitism and development.
100
Chapter 5
The effects of RNAi treaments with different regions of
the Dicer-like gene on the viability, parasitism and
reproduction of M. incognita
101
The effects of RNAi treaments with different regions of the Dicer-like gene
on the viability, parasitism and reproduction of M. incognita
Sadia Iqbal, John Fosu-Nyarko and Michael G.K. Jones
Plant Biotechnology Research Group, School of Veterinary and Life Sciences, WA State
Agricultural Biotechnology Centre, Murdoch University, Perth, WA 6150, Australia
5.1 Abstract
RNAi is a gene regulation mechanism which has homologous functional genes in eukaryotes.
The ribonuclease Dicer-like enzyme plays an essential role in RNA recognition and processing
of dsRNAs into siRNAs/miRNAs, which act downstream in the sRNA pathways. The only
dicer-like gene of nematodes, dcr-1 has been characterised in C. elegans but not in parasitic
nematodes. In this study the aim was to down-regulate the expression of the dcr-1 of M.
incognita, targeting seven different mRNA regions of this gene separately, to investigate the
effects on nematode infectivity and reproduction. The pattern of expression of dcr-1 in the
nematode and the effect of its down-regulation on other genes of the pathway were also
assessed. The dcr-1 expression was detected predominantly in the intestine and body wall,
whilst the level of reduction in host plant infection and reproduction depended on the region of
target mRNA chosen for silencing, with most reduction found for the region closest to the 5′ end
of the gene which also showed down-regulation of gene expression. Different triggers also had
differential effects on subsequent gene expression, as assessed by quantitative RT-PCR. The
effects were not linked to GC content of trigger or target secondary structure, although low
positional entropy and high base-pair probability was detected for target gene sequences which
were less effective. The in vitro RNAi of dcr-1 in these experiments led to altered expression of
other genes of the pathway and reduction in nematode infection and reproduction.
Keywords: Dicer, RNAi pathway, plant parasitic nematode, target mRNA region, in vitro
RNAi.
5.2 Introduction
Processing of dsRNA into siRNAs is carried out by the endonuclease enzyme dicer. There are
different classes of dicer-like genes in different organisms, but it seems to be an essential feature
of the RNAi pathway. It is regarded as the convergence point for various sRNA pathways in
nematodes. Dicer-1 has been characterised in detail in C. elegans using mutants, and is known
to be involved in generating ~22-23 bp siRNAs, and in developmental timing and innate
102
immunity (Ketting et al. 2001; Iatsenko et al. 2013). It has also been studied in detail in Giardia
intestinalis, including its protein domain architecture, crystal structure and mechanism of action
(MacRae et al. 2006). Post-translational modification of the dicer gene product has been
demonstrated in C. elegans and humans, and this has been suggested as a requirement for
division of labour in the small RNA pathways (Sawh and Duchaine 2013). However, the dicer
gene/complex has not been studied in anywhere near the same detail in any PPN.
The efficiency of dsRNA mediated gene silencing appears to be affected by the region of target
gene transcript chosen for synthesis of dsRNA (Sukno et al. 2007; Arguel et al. 2012). The dcr-
1 gene in nematodes is relatively large, and is made up of a series of different protein domain
coding regions. In the experiments described here, the effects of using sequences from different
domains of the dcr-1 of M. incognita as triggers in silencing this gene was examined. The
expression pattern of M. incognita dcr-1 and effects of its silencing on RNAi effectors was also
studied. Subsequent ability of treated nematodes to parasitise plants and to reproduce was
reduced indicating the importance of dicer gene for development of the nematode.
5.3 Materials and methods
5.3.1 Sequence analysis and primer design
C. elegans Dicer-1 sequence was retrieved from wormbase (www.wormbase.org) and used to
identify a genomic contig (CABB01000157) of M. incognita from NCBI as described in
Chapter 2. Seven primer pairs were designed to amplify sequences potentially encoding the
seven protein domains identified previously (Chapter 2). Primer sequences, their position on the
genomic contig and their respective amplicon lengths are indicated in Table 5.1.
Table 5.1: Primers used to amplify seven protein domain coding regions of M. incognita dcr-1
gene. Domain names and amplicon sizes are indicated.
ID Primer 5′− 3′ Flanked
Domain
Amplicon
(bp)
Position on
contig
MiDcr1HelATPB-F
MiDcr1HelATPB-R
TTGATGTAACAACCTCTGGGA
AATTCAAGGTTGAATTACTTGATCG
DEAD-like
Helicase
125 19818-19945
MiDcr1HelCT-F
MiDcr1HelCT-R
CTTGAATAAATGAACGAAAGTCCATC
AGACAGGCGATGAAGATAGG
Helicase C
terminal
181 17995-18177
MiDcr1DSRBF-F
MiDcr1DSRBF-R
TTCCTGCAGGCAAAAGATTGTC
GGTACTGTGCAAAATTACCATCTG
Dicer Dimer 251 17326-17519
MiDcr1PAZ-F
MiDcr1PAZ-R
CATTCTAGCAGATGTATGGTCAAC
GAATCTCCAACTACACCTTCAGATG
PAZ 272 16037-16182
MiDcr1RiboC1-F
MiDcr1RiboC1-R
CATGTGGATCGAATTTAAGTGTTTC
CATTGACAACTTCGAGTGCTG
Ribonuclease
III
228 13597-13881
MiDcr1RiboC2-F
MiDcr1RiboC2-R
ACAGAAATTAACAAACTTTTCGACC
TTAGCGTTTGGAATTCCTTGG
Ribonuclease
III
233 12434-12738
MiDcr1DSRM-F
MiDcr1DSRM-R
TCCAATTTTCTTAAATGTTGAAGTGC
TTGGAACGAAAATTAGAAACAGGC
Double
Stranded RNA
binding domain
139 11897-12039
103
5.3.2 Cloning and synthesis of dsRNAs
Restriction enzyme sites for XhoI and KpnI were added to the primers and M. incognita cDNA
from mixed stages was used as template to amplify gene fragments as described previously
(Section 3.3.3). Amplicons were purified from 1% agarose gel using the Wizard® SV Gel and
PCR Clean-Up system (Promega, Australia) according to manufacturer’s protocol and
quantified with a Nanodrop spectrophotometer. The seven gene fragments were then cloned into
the transcription vector pDoubler after ligation. Transformation with E. coli and PCR colony
screening was done as described in Section 3.3.4. Plasmid purification and sequencing were
done as described in Section 3.3.5 using the primers M13-F and M13-R in separate reactions.
DNA template for dsRNA synthesis for all gene fragments and gfp for use as control was
generated using PCR with the primer T7 (5′-TAATACGACTCACTATAGGG-3′) in a standard
20 µL reaction. After clean-up, 1 µg of each template was used to synthesise dsRNA
corresponding to gfp (dsgfp) and the seven dcr-1 regions: DEAD-like helicase (dsD1), helicase
C terminal (dsD2), dicer dimer (dsD3), PAZ (dsD4), the two ribonuclease III domains (dsD5
and dsD6) and double stranded RNA binding domain (dsD7) using HiScribe T7 in vitro
transcription kit (New England BioLabs). Synthesised dsRNA was digested with DNase I and
run on 1% agarose gel after purification to assess integrity.
5.3.3 In situ hybridisation
In situ hybridisation of mRNA was done to study expression pattern for M. incognita dcr-1
according to the protocol described by De Boer et al. (1998) using the DIG labelling and
detection kit (Roche Life Science). Probe templates (sense and antisense Ribonuclease III
coding region RiboC1) were digested from pDoubler using the enzymes XhoI/NotI and
KpnI/NotI and one microgram of this template was used in separate T7 initiated transcription
reactions for probe synthesis. In addition to the ribonucleotides ATP (10 mM), CTP (10 mM),
GTP (10 mM) and UTP (6.5 mM), digoxigenin-11-UTP (3.5 mM) was added in the reaction to
label single stranded RNA and incubated at 37 °C for 8 hours. RNA was purified by lithium
chloride precipitation and ran on 1% agarose gel to assess integrity.
Freshly hatched J2s of M. incognita packed in a 30 µL volume were collected in a 1.5 mL tube
by centrifugation at 1,200 g for 2 minutes and fixed in 2% paraformaldehyde in M9 buffer for
18 hours at 4 °C, followed by an incubation of 4 hours at 22 °C. Nematodes were pelleted,
pipetted on to a glass slide and cut into sections using a 32 gauge syringe needle. After
collecting nematode sections in the tube by washing with M9 buffer, they were digested with
proteinase K (0.5 mg/mL in M9 buffer) at 22 °C for 20 minutes. After removing the solution,
104
nematodes were frozen on dry ice and incubated for 1 minute each in methanol and acetone
respectively followed by rehydration at 22 °C for 20 minutes in 20% acetone.
At this stage, nematodes were divided equally into two tubes and pre-hybridised for 1 hour at 50
°C in the hybridisation buffer which contained 50% deionised formamide, 4x SSC, 2% SDS,
1% blocking reagent, 0.1x maleic acid buffer, 0.2 mg/mL Ficoll 400, 0.2 mg/mL PVP, 0.2
mg/mL bovine serum albumin, 1 mM EDTA, 0.2 mg/mL fish sperm DNA and 0.15 mg/mL
yeast tRNA. Nematode sections were hybridised with the riboprobe (300 ng/mL) in fresh
hybridisation buffer at 50 °C overnight in separate reactions for sense and antisense probes.
J2 sections were then washed three times with 4x SSC at 50 °C for 15 minutes each followed by
a 10 minute wash at 37 °C with NTE buffer (0.5 M NaCl, 10 mM Tris-HCl, 1 mM EDTA; pH
8.0). Un-hybridised probe was digested using RNase A (60 µg/mL in NTE buffer) at 37 °C for 1
hour followed by three washes at 50 °C with 0.1x SSC, 0.1% SDS. Detection of hybridisation
was done at 22 °C, where nematodes were washed in maleic acid buffer and incubated in 1%
blocking solution in maleic acid buffer. After labelling for 2 hours in alkaline phosphatase anti-
digoxigenin Fab fragments diluted (1:1000) in blocking solution, nematodes were washed three
times (15 minutes each) with maleic acid buffer with Tween-20 (0.05%). Following another
wash with detection buffer, nematode sections were stained with nitroblue tetrazolium (337
µg/mL) and 5-bromo-4-chloro-3-indolyl phosphate (175 µg/mL) in 250 µL of detection buffer
without agitation at 5 °C overnight. Staining was stopped by washing with water two times and
nematodes were observed with a microscope (Olympus BX-51) under bright field view.
5.3.4 DsRNA soaking
Seven thousand freshly hatched M. incognita J2s were fed with dsRNA derived from each of
the seven dicer fragments. Dsgfp and no dsRNA reactions were set up as controls. FITC (1
mg/mL) was added in a separate reaction to monitor solution uptake. Reactions were composed
of M9 buffer with 1 mg/mL dsRNA, 50 mM octopamine, 3 mM spermidine, and 0.05%
gelatine. Nematodes in soaking solution were incubated at 25 °C for 16 hours.
5.3.5 RNAi phenotypes, RNA extraction and plant infection
After 16 hours of incubation in dsRNA, nematodes were harvested from the solution, washed
with clean water and observed under a microscope as described previously (Section 3.3.8). The
soaking solution was run on a 1% agarose gel to assess dsRNA integrity after soaking with
nematode J2s. After 16 hours of soaking, two thousand J2s were washed with DEPC-treated
water and snap frozen in liquid nitrogen for RNA extraction. For each dsRNA feeding
105
treatment, ten tomato seedlings (cv. Grosse Lisse) were infected with 400 dsRNA-fed J2s to
assess infectivity.
5.3.6 Analysis of infection
After four weeks of infection, seven plants from each feeding treatment were carefully
uprooted, the roots washed gently, and observed under a dissecting microscope. The number of
galls present on the roots was counted for each treatment. To stain egg masses, roots were
treated with phloxine B by dipping the roots in the solution for five minutes after which they
were washed by dipping in clean water three to four times. Roots were pat-dried with a paper
towel and egg masses counted using a dissecting microscope. Root systems were then separated
from the stem at the collar, dried at 55 °C for 18 hours and weighed. The level of infection was
expressed as the number of galls and number of egg masses per gram of dry root weight.
After a further growth for three weeks, the remaining three plants for each treatment were
uprooted and the roots washed thoroughly. Adult female nematodes were dissected out of the
roots and stained with acid fuschin as described in Section 4.3.9. Adult females from plants
infected with treated nematodes were observed under the microscope (Olympus BX-51) under
bright field, and their appearance compared with those of controls.
5.3.7 Quantification of gene knockdown
After RNA extraction and DNaseI treatment, total RNA from dsRNA-fed nematodes was
purified and quantified using the Nanodrop. From each treatment, 500 ng RNA was used to
synthesise cDNA using the High capacity cDNA synthesis kit (Applied Biosystems) following
the manufacturer’s protocol.
One microlitre of this cDNA was used to quantify gene expression using qPCR assays. M.
incognita Actin (Accession no. BE225475) was used as internal control, while for the gene dcr-
1, qPCR primers designed from the region of the gene not included in any of the dsRNAs fed to
nematodes were used for all the seven dcr-1 targeting dsRNAs (Table 5.2). Transcript
abundance for three other RNAi effectors i.e. drsh-1, alg-1 and mut-2 was also tested. Primers
used are presented in Table 5.2. GoTaq® qPCR 2x master mix (Promega Corporation,
Australia) was used for all reactions in a Corbett RotorGene Quantitative Thermal Cycler
(Qiagen Pty Ltd., Australia) with five picomols each of the forward and reverse primers.
Cycling conditions were 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 55 °C for
60 s. All reactions were done in triplicates.
106
Table 5.2: Primers used for quantitative RT-PCR assays. Amplicon lengths are indicated.
Relative gene expression was determined using the ∆∆CT method. Mean Ct value and standard
deviation was calculated using Rotor-Gene Q Series Software 1.7. Normalised CT value (∆CT)
relative to endogenous gene expression was calculated as described in Livak and Schmittgen
2001.
ΔCT of treatment= (Mean CT of target – Mean CT of Actin)
ΔCT of control= (Mean CT of target – Mean CT of Actin)
The calibrated value (ΔΔCT) was calculated by
ΔΔCT = (ΔCT of treatment - ΔCT of control)
Fold change in transcript expression relative to endogenous control was calculated as
Fold change = 2-(ΔΔC
T)
Relative change in gene expression was presented as fold change calculated with baseline
expression as 1.
5.3.8 Statistical analysis
The statistical software SPSSv20 (IBM Corporation, US) was used for data analysis. Nematode
infection and reproduction data was analysed using ANOVA and Tukey’s test for significance
analysis and comparison of means (p<0.05). For statistical analysis of qPCR data, Kruskal-
Wallis one-way analysis of variance was done to test significance at p<0.05 and 95%
confidence interval. Microsoft Excel Analysis ToolPak was used for construction of bar charts.
ID Primer 5′-3′ Amplicon
(bp)
qMiActin-F
qMiActin-R
TTGATGTAACAACCTCTGGGA
AATTCAAGGTTGAATTACTTGATCG
125
qMiDcr1-F
qMiDcr1-R
TCGTCGGGTGTTTGTGAATTA
ACATCCTCTTTCTGCAACTCTT
147
qMiDrsh1-F
qMiDrsh1-R
CAAGTGAATATCTTTACAAACAATTTCC
CCT GTG GAATAACCAAATATTTAACC
140
qMiAlg1-F
qMiAlg1-R
GGAATGCCAATTCAAGGTCAA
GCCAGGAAGTACAACACAAAC
129
qMiMut2-F
qMiMut2-R
CGACGATTGGCTTGCATTATT
GTTGATTGGCGTGTTCGTTTA
84
107
5.4 Results
5.4.1 Expression pattern of dcr-1 in J2 M. incognita
Both the antisense probe and sense control were used for DIG labelling of M. incognita J2s in
separate reactions. No signal was detected for nematode sections hybridised with the sense
probe. For the antisense labelled probe, the localisation of transcript appeared to be
predominantly in the intestine. There also appeared to be some expression along the nematode
body wall (Figure 5.1).
5.4.2 RNAi phenotypes after dsRNA soaking
J2 nematodes were soaked in solutions containing the seven dsRNA (dsD1 to dsD7), and with
dsgfp and without dsRNA for 16 hours. After soaking, 20 µL (20 µg dsRNA) of solution was
run on a gel to assess the integrity of the dsRNA after nematode soaking/feeding activity. No
apparent degradation of dsRNA was observed in any of the soaking solutions as sharp bands
were present for all dsRNAs visualised (Figure 5.2A).
When nematodes were studied under the microscope after 16 hours soaking, control J2s (no
dsRNA and dsgfp) were active and moved normally. The pattern of FITC fluorescence indicated
that the external solution had been taken up by the nematodes, and had spread throughout the
body (Figure 5.2B).
In contrast, J2s soaked in dsRNA targeting dcr-1 were inactive and straight, with slow
movement in the head region, whilst the lower body appeared paralysed. This phenotype was
consistent for each of the nematode dsRNA treatments targeting the 7 dcr-1 domains (Figure
5.2F).
(C)
BW
BW
BH
WB
BW
BW
(B)
I
(A)
Figure 5.1: Expression pattern of dcr-1 in M. incognita J2 nematodes as indicated by in situ
hybridisation. (A): Sense probe hybridisation shows no staining. (B): Staining observed in the
intestine (I). (C): Nematode body wall (BW) stained after antisense hybridisation. Scale bar =
50 µm.
108
5.4.3 Nematode infection after dcr-1 RNAi
After 16 hours soaking in dsRNA, nematodes were then used to infect tomato plants. Four
weeks after infection, galls present on the roots were counted to assess the effects of RNAi on
host parasitism. No apparent differences were observed in gall morphology between controls
(soaked with no dsRNA or with dsgfp), and dcr-1 dsRNA-fed nematodes. There was also no
significant (p<0.05) difference between the number of galls/g of dry root for plants infected
with nematodes given control treatments. However, there were significant differences in the
number of galls/g dry root for four of the dcr-1 targeting treatments when compared to the
controls. These were for dsD1, dsD2, dsD3 and dsD7. The other three silencing triggers (dsD4,
dsD5 and dsD6) did not result in a significant reduction in the number of galls/g dry root on
tomato plants (Figure 5.3).
(A) M 1 2 3 4 5 6 7 8 9
dsRNA
FITC
200 µm
(B)
S FITC
S
(D) (E) (F)
No
dsRNA
dsgfp dsdcr-1
(C)
Figure 5.2 (A): Feeding solution run on gel showing that the dsRNA was not degraded after
incubation with nematodes for 16 hours. M = 100bp DNA ladder; Lanes 1 to 7: dsD1 to dsD7,
Lane 8: dsgfp, Lane 9: No dsRNA. (B and C): FITC uptake by nematodes after soaking for
16 hours. Fluorescence is visible in the gut and at the stylet (S). J2s after 16 hours soaking
without dsRNA (D), with dsgfp (E). (F): Representative phenotype of J2s after 16 hours
soaking with any of the seven dsRNAs targeting M. incognita dcr-1. The one depicted in the
figure is after feeding the domain Dicer dimer (dsD3).
109
Figure 5.3: Average (Mean ± Standard error) number of galls produced per gram dry weight of
tomato roots by the nematodes soaked without dsRNA, with dsgfp and the seven dcr-1 targeting
dsRNAs. Significance with respect to the no dsRNA control is indicated by * (p<0.05).
The largest reduction in the number of galls/g dry root was recorded for the dsRNA treatment
targeting the 5′ terminal region of dcr-1 mRNA (dsD1). It reduced infection by up to 61%.
DsD2 reduced infection by 37% while dsD3 affected nematode infection by 35%. The dsRNA
dsD7 targeting the region closer to the 3′ terminal end of mRNA again reduced infection
significantly, by up to 46%. Therefore, out of the 7 dsRNA triggers, four were able to reduce
parasitic success significantly and reduced nematode establishment on plant roots.
5.4.4 Differential effects of dsRNA to different target region on reproduction
To assess the effects of dcr-1 RNAi on nematode reproduction, the number of egg masses was
counted for individual plant roots after staining with phloxine B, and egg masses per gram dry
root weight were calculated. There was no significant difference between the egg masses
produced by nematode treatments without dsRNA and with dsgfp. When dsRNA to the three
mRNA regions at the 5′ end of dcr-1 transcript (i.e. by dsD1, dsD2 and dsD3), were fed to
nematodes, reproduction was affected significantly, with the highest impact delivered by dsD1
where 67% reduction was observed in egg mass production (Figure 5.4). Egg mass production
in nematodes treated with dsD2 and dsD3 was reduced by 48% (dsD2) and 56% (dsD3)
respectively (Figure 5.4).
110
Figure 5.4: Average (Mean ± Standard error) number of egg masses produced per gram dry
weight of tomato roots by nematodes treated with no dsRNA, with dsgfp and with the seven
dcr-1 targeting dsRNAs. Significance (p<0.05) with respect to no dsRNA control is indicated by
*.
The nematodes fed with dsD4, dsD5 and dsD6 did not show any significant change in egg mass
production (p<0.05). Egg mass production was reduced for nematodes that were soaked with
dsD7, but this reduction was not statistically significant (p<0.05) when compared to controls (no
dsRNA and dsgfp).
5.4.5 Nematode development is affected by dcr-1 RNAi
After seven weeks infection of tomato roots, adult female nematodes were dissected from the
roots, stained with acid fuschin, and observed under the microscope. Although the same gene
was targeted for all treatments, there were differences in morphology of the mature females
developed from J2s treated with dsRNAs corresponding to the different segments of the dcr-1
mRNA. Nematodes soaked with dsD1, dsD2, dsD3, dsD6 and dsD7 developed into smaller size
females compared to the controls (Figure 5.4).
This phenotype was very obvious for females developed from J2s fed on dsD1, dsD2, and dsD6.
The percentage of mature females with the characteristic smaller size was 53% for dsD1, 57%
for dsD2 and 51% for dsD6. About 5% of each of the females developed from J2s previously
fed dsD1, dsD2, dsD4, dsD6 and dsD7 were transparent to varying degrees.
111
5.4.6 Target quantification
Transcript abundance of dcr-1 in J2s was assessed after 16 hours soaking in dsRNA (Figure
5.6). Expression of dcr-1 in no dsRNA-treated nematodes was taken as the baseline for analysis.
For analysis of variance, the assumption for Levenes Statistics was not met for the data so the
non parametric Kruskal-Wallis test was done to analyse significant differences between
treatments. Significant differences were found between transcript abundance for the seven dcr-1
dsRNA and dsgfp treated nematodes. The three targets at the 5′ end of dcr-1 mRNA resulted in
down regulation of gene expression although it was variable for the different targets. Highest
decrease in transcript level was observed for the dsRNA (dsD1) targeting the first domain
coding region (DEAD-like Helicase).
DsD5 and dsD7 treatments showed the largest increase in expression; followed by the similar
up-regulation resulting from soaking with dsD4 and dsD6. With the exception of dsD5, up-
No dsRNA dsgfp dsD1
dsD2 dsD3 dsD4
dsD5 dsD7 dsD6
Figure 5.5: Adult M. incognita females dissected from tomato roots. Nematode (J2)
treatments were: no dsRNA, dsgfp and seven dsRNAs (dsD1 to dsD7) targeting the dcr-1
gene before infection. Females were stained with acid fuschin. Scale bar = 500 µm.
112
regulation of the dcr-1 transcript resulting from soaking increased for dsRNA corresponding to
sequences distal to the 5′ end of the gene. Surprisingly, dsgfp ingestion also resulted in up-
regulation of dcr-1 transcript in nematodes after 16 hours.
Figure 5.6: Relative quantification of transcript abundance for nematodes treated with dsgfp
and dsRNA targeting different regions of M. incognita dcr-1 transcript. Gene expression for the
no dsRNA control was used for data normalisation, and is represented by the baseline value of
zero. All treatments were significantly different from the no dsRNA treatment (p<0.05).
5.4.7 RNAi of dcr-1 affects other RNAi effectors
To investigate how changes in dcr-1 expression affected expression of other RNAi effectors, the
expression of three other RNAi effectors (drsh-1, alg-1 and mut-2) was quantified in dcr-1
targeted nematodes, and those fed with dsgfp. For this experiment, nematodes fed with dsD1
and dsD5 were chosen because they represented the extremes of expression of dcr-1 treatments.
Expression of these four genes in nematodes fed with dsgfp were also assessed. Expression in
control treatment with no dsRNA was used to normalise expression of the target genes.
Relative transcript abundance is presented as fold change in gene expression (Figure 5.7). Data
was normalised against actin as an endogenous transcript control. The results show that dcr-1
transcript expression was up-regulated when dsgfp was fed to nematodes. The other three
components of the pathway also showed change in transcript abundance i.e. increase in drsh-1
but decrease in expression of both alg-1 and mut-2. However, the two fragments targeting the
dcr-1 transcript at different regions generated different transcript levels for the RNAi effectors.
The transcript expression of dcr-1 in response to dsD1 was 53% less than the control whereas
for dsD5 it increased by 2 folds after 16 hours treatment.
113
The transcripts for drsh-1, alg-1 and mut-2 were also affected by the two triggers. With the
down-regulation of dcr-1 in response to dsD1, drsh-1 expression increased by 27% (0.27 folds)
of the normal level while in response to dsD5 this gene was down-regulated by 56% (Figure
5.7B,C).
The genes alg-1 and mut-2 were down-regulated in response to dicer targeting triggers more
than in response to dsgfp feeding. Interestingly, drsh-1 expression showed an inverse
relationship with dcr-1 expression when dcr-1 was being targeted by dsRNA (i.e. drsh-1
Figure 5.7: Relative gene expression of three RNAi effector genes after nematodes were
treated with dsgfp and dsdcr-1. The zero or baseline indicates expression in the no dsRNA
treatment. (A): Expression level of dcr-1, drsh-1, alg-1 and mut-2 in dsgfp fed nematodes.
(B and C): Relative expression pattern of dcr-1 and other RNAi pathway genes (drsh-1, alg-
1 and mut-2) in nematodes fed with dsD1 and dsD5 respectively.
114
upresulated when dcr-1 down-regulated and vice versa) but was up-regulated when dcr-1 was
upregulated in response to dsgfp feeding (Figure 5.7).
5.4.8 Target and trigger properties affecting RNAi efficiency
The dsRNA targeted to 5′ end of the target mRNA produced the greatest effect on nematode
viability and reproduction. To further understand the different results from targeting the same
gene with different triggers, the seven dsRNA triggers were analysed for their GC percentage.
The GC percentage of the dsRNAs used was between 30.9% and 37.7%, with dsRNA lengths in
the range of 125-272 bp (Figure 5.8A). No relationship could be established between trigger
GC% and reduction in infection. Reduction in infection was in agreement with transcript
reduction for the three triggers near the 5′ of the target mRNA. To examine if the RNAi
efficiency was affected by the secondary structure of target mRNA, secondary structure of the
Midcr-1 mRNA (predicted from the contig CABB01000157 in Chapter 2) was constructed
using the RNAfold Web server (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi). The predicted
structure for the dsRNA targeted regions is provided in Figure 5.8B.
(A)
(B)
Figure 5.8 (A): GC percentage and length of dsRNA targeting the seven regions of M.
incognita dcr-1 gene. (B): Secondary structure of dcr-1 mRNA predicted by the program
RNAfold. The seven target locations are indicated with respective dsRNAs.
115
It was not possible to correlate the secondary structure of the mRNA at regions used for dsRNA
synthesis to the effects of RNAi they induced, although a low positional entropy and higher
base-pair probability was calculated by the program for the region upstream of dsD4 (data not
shown). Interestingly, predicted secondary structures of the regions for dsD1 and dsD7 both of
which significantly affected nematode infection ability but showed opposite transcript
abundance, were in close proximity to each other (Figure 5.8B).
5.5 Discussion
In this study, dsRNA treatments designed to reduce expression of the dcr-1 gene did effectively
reduce infection levels and reproductive success of M. incognita. However, the extent of the
response also depended on the target region used for dsRNA in the soaking treatment. The three
triggers near the 5′ end of the dcr-1 transcript significantly reduced gene expression, nematode
infection, reproduction and development. This result is in agreement with the data published by
Arguel et al. (2012), who also found differential effects on target expression to dsRNA
treatments of the Calreticulin gene in response to different triggers in M. incognita. The GC% of
the regions targeted was similar; therefore other mechanistic or thermodynamic properties of
target RNA, such as accessibility and disruption energy, may be involved. Target accessibility
has been reported to play a role on efficiency of RNAi and contribute to its efficiency by up to
40% (Shao et al. 2007). However, the length of the dsRNA sequence used did appear important,
since longer dsRNA sequences seemed to have a lower effect on infection.
Interestingly, the trend of transcript change seems to correlate with the reduced infection and
reproduction of nematodes. This data also correlated with the quantitative gene expression data
for which gene silencing was observed for the same three targets for which the most reduction
in infection was observed. For the trigger dsD7, nematode infection reduced significantly but
transcript down-regulation was not observed. although up-regulated at the time of quantification
of transcript but possibly it did reduced later as reported for M. incognita genes where highest
silencing was observed 20 hours after washing nematodes off a four hour dsRNA treatment for
the gene Mi-crt while highest silencing was achieved after 44 hours for the gene Mi-pg-1 (Rosso
et al. 2005). The dcr-1 mutants in C. elegans have been reported as sterile and development
defective (Grishok et al. 2001). Developmental defects were observed for the parasitic
nematode M. incognita in this experiment too.
A clear finding of this study is that the RNAi pathway is activated when dsRNA enters the cells
as the dcr-1 mRNA was up-regulated along with drsh-1 while alg-1 and mut-2 were down-
regulated. The expression of these three seems to be affected by RNAi of dicer probably
because they play a role in the gene regulation cascade in an attempt to return to the optimum
116
balance of transcripts for the pathway. A complete gene expression profile for RNAi effectors
will probably contribute to understanding the role of each in this mechanism.
From previous studies, it seems that RNAi processes can exhibit a bi-phasic effect i.e. initial up-
regulation followed by down-regulation (Rosse et al. 2005; Arguel et al. 2012). However, in
this experiment the time of gene quantification (after 16 hours) showed both down-regulation
and up-regulation depending on the region of the gene targeted. The developmental defects
observed for dsD6 and dsD7 and infection reduction for dsD7 targeted nematodes possibly
resulted in response to down-regulation in gene expression at a later stage which then affected
nematode infection, reproduction and development.
In conclusion, RNAi of M. incognita dcr-1 affects nematode viability, parasitism and
reproduction. The role of the dicer in the RNAi cascade is very important and disturbing its
stability results in imbalance in the mechanism and possibly the activation of the miRNA
pathway to counteract the imbalance through altered gene regulation.
117
Chapter 6
General Discussion
118
6.1 Overview
In the work presented in this thesis, the RNAi pathway of the root-knot nematode M. incognita
has been studied in detail, together with that of other parasitic nematodes, with a focus on PPNs.
The overall aim of these studies was to determine the potential for genes in the RNAi pathways
as possible targets for nematode control. The knowledge generated could also be applied more
broadly to control other PPNs. Experiments were conducted to meet the following specific
research objectives (Chapter 1), which were
1. To apply comparative bioinformatics and molecular tools, and information available for
C. elegans and animal parasitic nematodes, to genes involved in the RNAi and miRNA
pathways of RKNs, combined with using ESTs and genomic data available for M. hapla
and M. incognita.
2. To study the effect of down-regulating expression of the identified RNAi
genes/effectors via in vitro feeding of dsRNA on the survival and/or parasitism of M.
incognita.
3. To investigate the effect of using dsRNA corresponding to different parts of an RNAi
pathway gene for down-regulation of expression and assess the effects on nematode
parasitism and reproduction and relative expression of other RNAi pathway
components.
4. To investigate the possibility of controlling M. incognita via host-induced
siRNA/dsRNA of RNAi effectors.
All these specific aims have been addressed successfully, with the generation of new
information for each of the aims.
In summary, considerable differences were found in the repertoire of RNAi pathway
components present in parasitic nematodes compared to those found in the free-living model
nematode C. elegans. There were also differences in domain organisation of some genes.
Twenty seven effectors of RNAi were cloned and targeted through in vitro feeding of dsRNA to
J2s of M. incognita and their infection and development was assessed. The results showed that
there was up to 90% reduction in infection after targeting the dcr-1 gene. The effects of
silencing other components of the RNAi pathways also resulted in reduced nematode
119
reproduction, depending on the target gene and other factors. One observation was that RNAi of
components of the miRNA pathway resulted in significantly impaired nematode development.
Transgenic plants expressing dsRNA to a subset of target genes identified from in vitro soaking
experiments had reduced nematode infection, with a reduction in infection of up to 89%. All the
transformed plants expressing target gene dsRNA exhibited reduced nematode infection by 50%
or more (based on 31 events of 7 genes). Adult female nematodes that did develop on transgenic
plants showed abnormal development, and the results obtained provide some priority gene
targets for further progression for nematode control.
DsRNA targeted to different regions of the dcr-1 gene affected J2s to different extents, with
triggers closer to the 5′ end of the gene being more effective as evidenced by reduced transcript
level, fewer nematodes infecting roots and reproducing. In further studies, it was also found that
in vitro RNAi of dcr-1 also affected expression of other genes in the RNAi pathway, suggesting
that the expression of several other non-targeted genes could be affected, and so by targeting
expression of a single gene more profound effects on nematode viability may result. Some of
these aspects are discussed in more detail below.
6.2 Effectors of small RNA pathways of RKN
The first objective of this project was to identify genes involved in the RNAi pathway of RKNs
using ESTs and genomic data available for M. hapla and M. incognita. The availability of
whole genome sequences of M. incognita and M. hapla made it possible to confirm domain
architecture of genes compared to C. elegans and to those of the animal parasitic nematodes A.
suum and B. malayi. Apart from the identification of genes found in these nematodes, this study
also showed that there were some disparities in comparison to previously published literature on
this subject (Rosso et al. 2009; Dalzell et al. 2011). Such differences may be partially attributed
to the stringency used and differences between the various data analysis software packages used
in the analyses.
The two Meloidogyne spp. seem to lack genes present in the RNAi pathway of C. elegans, these
relate to RNAi spreading, inhibitors, argonautes and genes involved in heritable RNAi.
Differences in functional domains were also found between species. Despite these differences,
the considerable body of literature now published on RNAi in relation to root-knot nematodes
provides clear evidence of a robust functional RNAi mechanism in these species, backed by in
vitro feeding data or from HIGS (reviewed in Lilley et al. 2012). In C. elegans, RNAi can
persist over several generations, through inheritance of nrde-3 associated siRNAs and histone 3
lysine 9 methylation marks on the target gene locus, while heritable transcriptional silencing has
120
been reported in the absence of trigger, which depended on the target gene used (Burton et al.
2011; Vastenhouw et al. 2006). Although the heritability of RNAi has not been investigated in
parasitic nematodes, there is some evidence for persistent down-regulation of an in vitro
targeted gene over generations for M. incognita (Gleason et al. 2008). This down-regulation
aided in plant infection and may be an epigenetic effect as a result of selection pressure and not
inherited RNAi as reported for C. elegans. This indicates that functional studies should be done
to explore the possibility that RNAi in PPNs might be heritable, and should be combined with
study of the functions of the genes drh-1, eri-1, tsn-1, which show differences in domain coding
regions with C. elegans orthologs.
6.3 In vitro RNAi as a functional analysis tool for parasitic nematodes
RNAi in C. elegans has predominantly been used as a tool to study functional genomics, but for
parasitic nematodes it has been used more to probe parasitism genes to increase understanding
of nematode-plant interactions, and to investigate the potential to use RNAi as a strategy for
nematode control. The second objective of this research was to study the effect of down-
regulating expression of genes in the RNAi pathways identified in the first part of the work, via
soaking with dsRNA, on survival and/or parasitism of M. incognita.
The results obtained in general are in agreement with similar studies on target knock-down and
reduced infection levels after dsRNA soaking. The observation that there can be an initial
increase in transcript level has also been observed after RNAi in PPNs (Rosso et al. 2005;
Bakhetia et al. 2008). This observation suggests that nematode metabolism responds to
perturbation of individual components of a pathway, and that there is active gene regulation
which responds to altered transcript levels. Up-regulation of the targeted transcript was
observed for 9 out of 16 tested genes in this study, and this suggests that down-regulation of
components of the RNAi pathways is not straight forward, and that to some extent, expression
levels compensate for perturbations in the pathway. It may be that higher trigger concentrations
might be more effective in knocking down genes for which up-regulation was found after
treatment, but responses to RNAi do not necessarily improve with increase in trigger
concentration: in some cases lower concentrations of dsRNA in soaking solutions are more
effective than higher concentrations (Sukno et al. 2007).
One issue to consider is that in vitro RNAi is a transient process, and may not reflect the longer
term effects of down-regulating a particular gene on a continuous basis. Nevertheless, it is a
valuable tool to provide an initial assessment of the effects of gene knockdown of potential
target genes in PPNs. In support of this argument, RNAi of a high proportion of the genes
studied did result in reduced infection and in developmental defects of adult females, indicating
121
that soaking in dsRNA can induce long lasting effects. Added to the factors considered, there
are a range of variables in the experimental conditions used in soaking experiments, such as the
optimum time of soaking, when down–regulation of a target gene actually occurs after dsRNA
ingestion, the target gene itself and the regions selected to generate dsRNA. Nevertheless, in
vitro RNAi screening of a larger number of target genes does enable the screening out of the
best prospective candidate genes from pathways studied. From this screen a subset of priority
targets were chosen, and progressed to study their effects on nematode infection and
reproduction with delivery of dsRNA via transgenic plants, i.e. by HIGS.
6.4 HIGS for RKN control
To investigate the possibility of controlling M. incognita damage via HIGS using RNAi
pathway effectors/genes as targets, transgenic A. thaliana plants were generated expressing
hpRNA to seven genes selected from the in vitro screen of 27 initial genes identified in the
pathway. Although there was some variability in the results, nematode infection was
significantly lower in plants expressing dsRNA than in control plants for events of all seven
genes tested. The greatest reduction in infection of 89% was for the target gene drsh-1.
In considering why reduction in infection after in vitro RNAi of a target gene does not
necessarily translate quantitatively for host-delivered RNAi, the most obvious explanation is
that the amount of trigger ingested by the nematodes in the two situations differs both
quantitatively and qualitatively. In soaking experiments, 1 µg/µL of dsRNA is present in the
external solution, whereas in host-delivered dsRNA it is not clear how much dsRNA is ingested
by the feeding nematode. In addition, the dsRNA in plant cells is likely to have been pre-
processed by the plant’s RNAi machinery, to generate the spectrum of siRNAs that are normally
present in plant cells. Higher concentrations of dsRNA provided in vitro sometimes increases
the gene silencing effect, but in other cases it does not. Perhaps higher concentration of dsRNA
can overwhelm the nematode RNAi pathway, but they can sometimes recover after the soaking
period. It is probable that transgenic plants deliver a lower concentration of dsRNA, over a
much longer time period, but in the form of pre-processed siRNAs. A better understanding of
the events that occur in transgenic plants requires further study to analyse the siRNA levels in
them, and whether the siRNAs that a nematode would generate itself from long dsRNAs differ
from those processed by the host plant. The HIGS studies undertaken in this research were done
in a growth chamber under controlled conditions. Host-delivered RNAi of the same gene might
act differently in field conditions, where plants may combat multiple stresses simultaneously.
Both short-term RNAi and long-term RNAi affected nematode development considerably,
indicating lack of complete recovery of nematodes from the effects of RNAi.
122
The fact that a 400 bp hpRNA corresponding to gfp expressed via a root specific promoter
silenced GFP expression in shoots of Arabidopsis plants (Liang et al. 2012) suggests that long
dsRNAs are processed to siRNAs, and that the silencing signals can be transported around the
plant. However, in the absence of a target message sequence in plant cells there is no
amplification of the signal.
The transgenic plants challenged with nematodes were heterozygous because of time
constraints. A better measure of the extent of HIGS would have been obtained from the next
generation of transgenic plants, challenging only those that were homozygous for the transgene.
Nevertheless, this study indicates that clear results can be obtained using heterozygous plants,
since there were clear reductions in infection success and modified development of adult
females. The knowledge generated should now be applied and tested in commercial crop species
to further determine their potential to reduce nematode infection. In many cases crop plants
have been selected for some level of resistance to RKNs, and so additional resistance conferred
above that present in the most resistant genotypes available, could result in very effective
control. That a reduction in nematode infection of 89% was found for the target drsh-1 suggests
it would be a very good candidate to add to existing resistance in commercial genotypes, and
could result in effective control of M. incognita in commercial agriculture.
6.5 The target region of a gene affects RNAi effectiveness
The effectiveness of RNAi depends on factors such as sequence composition and target region
chosen. This aspect was studied using targets for dcr-1 gene, which has a series of distinct
functional domains. Differences in the reduction of gene expression and infection after using
different regions from this gene were evident. These did not correlate with GC content, and so
other factors must explain this result. One explanation is that not all target sequences chosen
were equally effective in generating siRNAs, and this resulted in dfferential transcript
abundances after RNAi treatments. A similar result has been reported, that is different transcript
abundance after using different sequences from the same gene (Sukno et al. 2007; Arguel et al.
2012). Whether this efficiency depends on target thermodynamics or trigger composition
requires further investigation through more in vitro screens of genes. Another feature is that
after dsRNA soaking down-regulation in the dcr-1 transcript was observed using qRT-PCR for
the target regions close to the 5′ end of mRNA. That is, the target sequence expression was
down-regulated after soaking for 16 hours for those regions but up-regulated for other target
regions. The regulation of each target gene chosen may be different, and so this kind of
observation indicates another level of complexity that needs to be understood before the most
effective silencing of target genes can be achieved.
123
In the initial feeding experiment for RNAi of dcr-1, infection was reduced by 90% (Chapter 3).
However, when more detailed studies were done on this target gene (Chapter 5), the level of
reduction of infection was lower. This is not a surprising result since there are many comments
in the literature that relate variable or inconsistent results for RNAi of PPNs. Explanations range
from experimental variables such as seasonal variation of plants or nematodes, as noted for both
the root lesion nematode P. vulnus and for M. incognita (Britton 2001; Arguel et al. 2012).
It should be noted that the experiments for this study were done in spring, which is the
beginning of active season for M. incognita, while the first dcr-1 RNAi experiments were done
during autumn when the nematodes are less active. It is therefore possible that during spring and
summer, nematodes are more resilient to RNAi and can recover more quickly from its effect.
Regardless of the differences in response, the treatments even though transient, disturbed the
gene regulation machinery enough to lower infection, reduce reproduction and cause defective
development.
6.6 Future directions
The construction of plant transformation vectors for all the 27 genes cloned is a useful resource
which can be used to facilitate future HIGS studies in plants after transformation to express
hpRNA. In addition, the transgenic Arabidopsis plants could be taken to subsequent
generations, and analysed further such that only plants with homozygous single copy inserts are
used to study responses to nematode challenge more precisely. The transgenic plants can also be
used to study transcription and processing of foreign RNA to quantify the amount of gene
silencing signals (long dsRNA/siRNAs) produced. This will add knowledge on the
amount/concentration of triggers delivered to the parasite, and which plant derived siRNAs are
most effective for silencing targets in nematodes.
A further question that can be addressed is the stability of RNAi based resistance in following
generations. Under selection pressure, PPNs can overcome natural resistance genes, for example
virulent resistance-breaking strains of H. glycines develop when highly resistant soybean
cultivars are grown (Zheng and Chen 2011). The question for RNAi-based resistance is whether
it will be durable in a field situation or not. Although there is evidence for long term expression
of an RNAi-based trait for resistance to potato virus Y (P. Waterhouse, personal
communication), a transgene can be methylated to reduce its expression, and a mutation that can
by-pass the control could also be selected for in nematode populations. These possibilities are
no different from what can happen for any transgenic trait or indeed after application of
chemical pesticides, and is not necessarily limited to RNAi-based traits. Nevertheless this aspect
needs further study.
124
In C. elegans long dsRNA is diced into ~22-23 bp siRNAs, while for M. incognita, synthetic 21
bp siRNAs have demonstrated to confer efficient gene knockdown (Arguel et al. 2012). In
contrast, the predominant siRNAs generated in plants is 21 bp, with 22 bp and 24 bp siRNAs
also produced. Thus there may be an imbalance in the sizes of siRNAs produced by plants on
processing long dsRNA, and the preferred product used for gene silencing in nematodes. The in
vivo siRNA dicing process of long dsRNAs in PPNs requires further investigation. However,
recently a possible solution to this question has become evident. That is, plastids in plants, being
derived from cyanobacteria, lack the ability to process long dsRNAs. In the report by Zhang et
al. (2015), who were studying control of Colorado potato beetle by gene silencing, these authors
claimed 100% control through providing long dsRNA via plants with transformed plastids. The
two factors here are that there are many copies of plastid DNA in each plastid, and many
plastids in each cell. This ingestion of cells with transformed plastids provides large amounts of
long dsRNA, which can then be processed by the pest machinery rather than the plant RNAi
machinery. A similar approach, targeting root plastids, could increase the effectiveness of host-
delivered RNAi against PPNs, although the possible filtering properties of feeding tubes formed
by root-knot and cyst nematodes might prevent ingestion of plastids.
Another new tool that has emerged is ‘genome editing’. It can be used as a tool for functional
genomics studies and to silence expression of a targeted gene in a plant, possibly without
insertion of any external sequence. Such plants should be regarded as mutants by regulators,
rather than as genetically modified (GM) plants (Fosu-Nyarko and Jones 2015). At present this
is limited to editing the plant genome, and cannot be used to edit a nematode genome via a
plant. If genome editing were used for nematode control, a converse situation needs to be
addressed, that is, discovery of plant susceptibility genes to nematode infection, which could be
silenced by genome editing, so conferring resistance.
For an RNAi approach for nematode resistance to be commercialised, there are a number of
policy and regulatory hurdles, followed by issues of public acceptance, and other aspects such
as patenting and the costs associated with implementation. These aspects are discussed in detail
by Fosu-Nyarko and Jones (2015).
6.7 Conclusions
Significant new knowledge was generated in the work presented here in relation to the RNAi
pathway of M. incognita and the reduction of infection of the RKN M. incognita achieved by
down-regulating genes involved in the RNAi pathway. When miRNA pathway genes were
targeted, nematode development was profoundly affected, and this suggests that target genes
taken from this pathway could provide new candidates for an RNAi based control strategy.
125
Measurement of changes in target gene expression after soaking experiments showed that RNAi
targeted genes were up-regulated after soaking, but when soaked nematodes were used to infect
plants, the expression might subsequently be down–regulated since nematode infection,
reproduction and development could be reduced.
Using seven priority gene targets identified from soaking experiments, host-delivered dsRNA
was investigated using transgenic Arabidopsis plants, which constitutively expressed hpRNA
targeting M. incognita dcr-1, drh-3, vig-1, mut-7, drsh-1, pash-1, rha-1 genes. The response to
nematode infection of these transgenic plants was one of reduced nematode infection and
reproduction. Although due to time constraints, the plants screened for nematode responses
were not all homozygous for the hpRNA transgenes, significant reduction in infection was
observed in this segregating generation for events of all the genes tested.
After soaking treatments of 16 hours, in some cases there was a clear phenotype (paralysis,
abnormal wavy movement etc), yet from 9 out of 16 genes tested there was up-regulation of
expression of the targeted gene. Maybe the soaking procedure resulted in overloading the RNAi
machinery of the J2s, or compensatory responses in transcription of pathway genes occurred
which also affected expression of down-stream genes. The period of 16 hours or more for
soaking is commonly used, but perhaps a shorter period of soaking might be more effective.
Overall, the screening of many target genes by soaking in dsRNA followed by plant infection is
a valid strategy to identify candidate genes most likely to be effective in conferring improved
resistance in transgenic plants expressing hpRNAs, although the correlation is not exact.
Differences may relate to the form of the dsRNA ingested by nematodes on soaking or from
transgenic plants.
Different responses to nematode infection found when using dsRNA from different regions of
the dcr-1 gene also demonstrates that the exact sequence of a target gene used is critical: not all
sequences generate the same intensity of siRNAs in plants or the same level of gene silencing.
A better understanding of the principles which underlie this phenomenon is needed to select the
best target sequences, i.e. those most likely to cause the strongest reduction in target gene
expression. The potential for development of improved resistance to RKNs via transgenic plants
is supported by the work undertaken in this thesis, but it also highlights aspects of the
mechanisms involved that are not yet fully understood.
126
APPENDIX Supplementary Table 2.1: Number of significantly mapped contigs for the four parasitic nematodes to C.
elegans genes with the contig IDs of the sequence coding for the respective effector protein.
C. elegans
Gene
No. of significant matches (Contig ID of gene coding sequence)
A.suum B. malayi M. hapla M. incognita
Spreading Proteins
sid-1 3 (ANBK01003199
AMPH01007595
AEUI02000078)
2 (AAQA01000131) - -
sid-3 100(ANBK01007000) 59(AAQA01000282) 26 (ABLG01000030) 30 (CABB01000892)
rsd-3 6 (AMPH01006102) 4 (CAPY01004512) 3 (ABLG01000350) 6 (CABB01006346)
xpo-1 6 (AEUI02000555) 2 (CAPY01003870) 1 (ABLG01001363)
3 (CABB01004119
CABB01002745)
xpo-2 6 (AMPH01015976
AEUI02000107)
3 (CAPY01001063) 1 (ABLG01000755) 1 (CABB01000462)
xpo-3 5 (AMPH01020037) 2 (CAPY01005588) - -
haf-6 90 (AMPH01011416) 30 (CAPY01002522) 14 (ABLG01001289) 17 (CABB01001990)
Dicer and Associated Genes
dcr-1 22 (ANBK01006853
AMPH01008524
AEUI02001038)
5 (CAPY01005536) 3 (ABLG01001138) 3 (CABB01000157)
drh-1 12 (AEUI02001000) 7 (AAQA01001229) 5 (ABLG01000164) 8 (CABB01006008)
drh-3 10 (AEUI02000457) 5 (AAQA01000086) 4 (ABLG01000567) 4 (CABB01002056
CABB01002184)
pir-1 13 (AMPH01008932) 6 (AAQA01002333) 2 (ABLG01002012) 4 (CABB01007043)
drsh-1 8 (AEUI02000028) 3 (AAQA01000005) 1 (ABLG01000521) 1 (CABB01000477)
pash-1 5 (AAQA01000310) 1 (ABLG01000935) 1 (CABB01004277)
RISC
ain-1 - 6 (AAQA01000363) - -
tsn-1 4 (ANBK01000604) 3 (AAQA01000346) 1 (ABLG01000878) 3 (CABB01000055)
vig-1 3 (AMPH01002339) 2 (AAQA01001685) 1 (ABLG01000254) 1 (CABB01000081)
RNAi Amplification
smg-2 5 (AMPH01007249) 6 (CAPY01005799) 3 (ABLG01000485) 15 (CABB01000694
CABB01008394)
smg-6 3 (AMPH01018798) 2 (AAQA01000011) 2 (ABLG01000285) 1 (CABB01000011)
ego-1 12 (AMPH01018474) 7 (CAPY01002544) 2 (ABLG01000591) 4 (CABB01000449)
rrf-1 AMPH01008866 CAPY01004404 ABLG01001448 CABB01000474
RNAi Suppressors
eri-1 3 (AMPH01004548) 5 (AAQA01000082) 1 (ABLG01000828) 2 (CABB01001883)
eri-5 8 (AMPH01019550) 1 (AAQA01007053) - -
eri-6/7 6 (ANBK01005918) 4 (AAQA01000760) 2 (ABLG01001054) -
rrf-3 10 (ANBK01005062) 7 (CAPY01003132) - -
gfl-1 8 (ANBK01002547) 4 (CAPY01002536) 1 (ABLG01000591) 1 (CABB01000795)
xrn-1 10 (AMPH01008093) 4 (CAPY01002459) - -
xrn-2 9 (AEUI02001203) 5 (AAQA01000030) 1 (ABLG01000657) 2 (CABB01001503
CABB01003205)
adr-1 3 (AMPH01003945) 4 (CAPY01001829) - -
adr-2 3 (AMPH01015223) 4 (AAQA01003201) - -
zfp-2 40 (ANBK01002640) 100
(AAQA01001012)
17 (ABLG01000194) 20 (CABB01002475)
127
C. elegans
Gene
No. of significant matches (Contig ID of gene coding sequence)
A.suum B. malayi M. hapla M. incognita
Nuclear RNAi effectors
mut-7 3 (AMPH01001240) 2 (CAPY01005167) 1 (ABLG01000582) CABB01000055
cid-1 7 (AMPH01013268) 2(AAQA01000021) 3 (ABLG01001487) 8 (CABB01002392)
ekl-4 4 (ANBK01004956) 4 (CAPY01005796) 1 (ABLG01000886) 1 (CABB01002952)
mes-2 7 (ANBK01002478) 4 (CAPY01005273) 2 (ABLG01001056) 4 (CABB01002321)
mes-6 3 (ANBK01006945) 2 (CAPY01003620) 1 (ABLG01000753) 1 (CABB010000967)
rha-1 42 (ANBK01001125) 25
(AAQA01000377)
9 (ABLG01000200) 20 (CABB01000079)
ekl-6 2 (ANBK01003842) 2 (CAPY01005521) - -
mut-2 16 (AMPH01013881) 4 (CAPY01003131) 4 (ABLG01000108) 10 (CABB01002462)
zfp-1 10 (ANBK01000381) 6
(AAQA01000140)
2 (ABLG01000109) 2 (CABB01000945)
Argonautes
PAZ,
PIWI and
DUF1785 (alg-1, alg-
2, alg-
4/tag-76,
T22B3.2,
T23D8.7)
ANBK01003974
AEUI02000475
AEUI02000675
CAPY01000537
CABB01000336
PAZ and
PIWI (R06C7.1,
F58G1.1,
rde-1,
C16C10.3,
ppw-
1/sago-2,
ppw-2,
sago-1,
csr-1,
T22H9.3,
ergo-1,
prg-1, prg-
2,
F55A12.1,
nrde-3,
Y49F6A.1,
C14B1.7)
AMPH01030278
AMPH01002307
ANBK01003950
AMPH01020161
AMPH01003096
AEUI02000283
CAPY01004823
AAQA01000069
ABLG01001935
ABLG01001452
ABLG01000197
ABLG01000685
ABLG01001306
CABB01002242
CABB01000355
CABB01001343
CABB01000488
CABB01002924
CABB01000184
CABB01000681
CABB01000079
CABB01000330
PIWI
(C04F12.1,
ZK218.8
and
ZK1248.7)
AEUI02000059
ANBK01006280
CAPY01002834
CAPY01005262
ABLG01002012
ABLG01001620
ABLG01000816
CABB01000426
128
Supplementary Table 2.2: Similarity of protein domains of the RNAi pathways genes of C.
elegans (Ce) to four parasitic nematodes M. incognita (Mi), M. hapla (Mh), A. suum (As) and B.
malayi (Bm) based on query coverage and total scores.
Gene (Ce) tblastx Domains % Similarity with Ce Total
Score(Coverage)
%Similarity with Ce Total
Score(Coverage)
Mi Mh As Bm
Transport Proteins
sid-1 Sid-1RNA channel - - 254(34)
254(34)
226(30)
158(28)
sid-2 No Domain - - - -
sid-3 Tyrosine kinase domain 724(69) 644(74) 805(67) 790(71)
SH3 - - - -
GTPase binding - - - -
sid-5 No Domain - - - -
rsd-2 Rsd-2 - - - -
rsd-3 ENTH-Epsin 292(79) 229(78) 402(94) 287(83)
rsd-6 Tudor - - - -
xpo-1 IBN-N
Xpo1 379(96) 384(96) 313(67) 241(72)
CRM1 667(79) 798(93) 862(93) 681(93)
xpo-2 IBN-N 43.9(47) 43(47)
CSE 297(65) 360(71) 545(92) 445(72)
CAS-CSE1 44.6(32) 42.8(21) 391(65) 456(79)
xpo-3 Xpo1 - - 133(53) 257(65)
haf-6 ABC membrane 107(39) 465(87) 490(98)
ATP binding domain 860(92) 863(90) 897(88) 388(78)
Dicer and associated genes rde-4 DSRM - - - -
pash-1 WW 144(81)- As* 144(81)-As* 337(100)-As*
DS RBD 197(77)-As* 215(80)-As* 601(87)-As*
drh-1 DEXDc 204(34) 190(50) 263(57) 189(62)
HELICc 234(75) 231(75) 182(71) 205(61)
RIG-I_C-RD - - - -
drh-3 DEXDc 140(62) 234(79) 224(89) 245(95)
HELICc 124(54) 98.7(54) 115(54) 154(54)
RIG-I_C-RD 473(83)-Mh* 51(69)-Mh* 53(53)- Mh*
drsh-1 RiboIIIa 238(100) 240(100) 236(100) 325(100)
RiboIIIb 305(92) 313(92) 181(81) 264(94)
DSRM 146(92) 196(61) 156(61) 148(61)
dcr-1 Hel ATP-B 256(80) 185(55) 374(97) 406(92)
Helic-CT 74.8(75) 73.9(67) 131(60) 126(62)
DS-RBF 216(90) 293(92) 293(92) 222(91)
PAZ 292(76) 286(70) 519(71) 526(82)
RiboC1 416(79) 392(82) 432(80) 419(79)
RiboC2 521(83) 474(88) 496(94) 487(98)
DSRM 171(100) 108(100) 112(100) 146(100)
pir-1 Dual specificity
phosphatase
190(84) 168(74) 218(86) 321(91)
129
Gene (Ce) tblastx Domains % Similarity with Ce
Total score(Coverage)
%Similarity of Ce
with APN Total
score(Coverage)
Mi Mh As Bm
RISC ain-1 M domain - - - 54.4(29)
ain-2 M domain - - - -
tsn-1 SNc1 488(85) 382(85) 337(91) 425(91)
SNc2 367(84) 491(84) 507(90) 423(84)
SNc3 292(79) 323(80) 320(77) 376(90)
SNc4 244(90) 280(90) 366(96) 268(93)
Tudor 64.3(51) 63.4(53) 246(97) 329(92)
SNc5 36.2(36) - - -
vig-1 HABP4_PAI-RBP1 65.4(19)-
Bm*
33.1(9)-
Bm*
114(38) 140(65)
RNAi Amplification smg-2 UPF1_Zn_
bind
554(97) 362(97) 374(95) 346(95)
P loop AAA_30 445(95) 525(96) 629(100) 578(98)
P loop AAA_12 758(100) 838(100) 903(98) 883(98)
smg-5 PIN Smg5 - - - -
smg-6 EST1 80.5 (64)-
Bm*
99.9(80)-
Bm*
136 (98) 112(82)
EST1 DNA Bind 103(28)-
Bm
80(29)-
Bm
70.7(19) 155(40)
PIN Smg6 64.5(50)-
Bm*
38.6(22)-
Bm*
58.2(31) 104(62)
ego-1 RdRp 1240(72) 1030(79) 1457(85) 814(38)
482(32)
rrf-1 RdRp 831(56) 1146(75) 1298(85) 1253(82)
rde-10 Maelstrom - - - -
rde-11 No Domain - - - -
RNAi Suppressors Eri-1 411(95) 280(87) 337(83) 327(83)
eri-3 No domain - - - -
eri-5 Tudor - - 118(61) 71.8(56)
eri-6/7 P loop AAA_11 - 33.6(17) 47.8(20) 116(37)
P loop AAA_12 - 144(57) 41.8(11) 157(37)
eri-9 Zc3h12a-like
Ribonuclease NYN
domain
- - - -
rrf-3 RdRp - - 1379(79) 1510(75)
gfl-1 Yeats 229(95) 226(93) 426(97) 526(99)
xrn-1 XRN-N - - 968(100) 44.1(16)
xrn-2 XRN-N 1709(47) 2565(77) 2709(83) 2285(75)
adr-1 DSRM1 - - -
DSRM2 - - 37.7(45) 67.7(46)
A. Deamin - - 125(42) 137(44)
adr-2 DSRM - - - -
A. Deamin - - 255(54) 119(39)
lin-15b THAP - - - -
zfp-2 Zn finger Domains 343(50) 515(63) 542(67) 457(48)
130
Gene (Ce) tblastx Domains % Similarity with Ce
Total score(Coverage)
%Similarity of Ce
with APN Total
score(Coverage)
Mi Mh As Bm
Nuclear RNAi Effectors mut-7 Mut-7 36.8(7) 109(19) 178(38) 172(43)
cid-1 PAP & PAPtutase 331(15) 358(11) 412(37) 448(19)
ekl-1 Tudor1 - - - -
Tudor2 - - - -
ekl-4 DMAP1 177(58) 112(46) 232(50) 342(48)
mes-2 COG2940 214(75) 216(75) 222(68) 375(65)
SET 177(91) 181(91) 131(83) 211(75)
mes-3 No Domain - - - -
mes-6 WD40 31.8(19) 100(24) 70.4(55) 239(38)
rha-1 DSRM1 125(97) 124(97) 102(100) 104(91)
DSRM2 38.6(35) 38.6(35) 66.9(75) 35(60)
DEAD 492(98) 442(95) 604(99) 424(99)
HelCT 402(93) 248(93) 416(97) 249(94)
HA2 162(95) 166(95) 194(92) 159(91)
OB NTP 254(97) 294(97) 245(98) 288(89)
ekl-6 DUF2435 - - 45.1(40) 48.7(38)
zfp-1 Zfp-1 domains 286(40) 266(41) 513(82)
645(80)
mut-2 PAP &
NT_PAP_TUTase
213(26) 115(15) 149(40)
181(20)
ekl-5 7TM-GPCR-Srn - - - -
mut-16 No Domain - - - -
rde-2 No Domain - - - -
nrde-1 No Domain - - - -
nrde-2 DUF1777 - - - -
Nrde-2 - - - -
nrde-4 No Domain - - - -
131
References
Abad P, Favery B, Rosso M-N, Castagnone-Sereno P (2003) Root-knot nematode parasitism and host
response: molecular basis of a sophisticated interaction. Molecular Plant Pathology 4 (4):217-
224. doi:10.1046/j.1364-3703.2003.00170.x
Adam MAM, Phillips MS, Jones JT, Blok VC (2008) Characterisation of the cellulose-binding protein
Mj-cbp-1 of the root knot nematode, Meloidogyne javanica. Physiological and Molecular Plant
Pathology 72 (1–3):21-28. doi:http://dx.doi.org/10.1016/j.pmpp.2008.05.002
Adamo A, Woglar A, Silva N, Penkner A, Jantsch V, La Volpe A (2012) Transgene-mediated
cosuppression and RNA interference enhance germ-line apoptosis in Caenorhabditis elegans.
Proceedings of the National Academy of Sciences 109 (9):3440-3445. doi:10.1073/pnas.
1107390109
Alcazar RM, Lin R, Fire AZ (2008) Transmission dynamics of heritable silencing induced by double-
stranded RNA in Caenorhabditis elegans. Genetics 180 (3):1275-1288. doi:10.1534/genetics.
108.089433
Alder MN, Dames S, Gaudet J, Mango SE (2003) Gene silencing in Caenorhabditis elegans by transitive
RNA interference. RNA 9 (1):25-32. doi:10.1261/rna.2650903
Alkharouf NW, Klink VP, Matthews BF (2007) Identification of Heterodera glycines (soybean cyst
nematode [SCN]) cDNA sequences with high identity to those of Caenorhabditis elegans having
lethal mutant or RNAi phenotypes. Experimental Parasitology 115 (3):247-258.
doi:http://dx.doi.org/10.1016/j.exppara. 2006.09.009
Aly R, Cholakh H, Joel DM, Leibman D, Steinitz B, Zelcer A, Naglis A, Yarden O, Gal-On A (2009)
Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca
through the production of homologous dsRNA sequences in the host plant. Plant Biotechnology
Journal 7 (6):487-498. doi:10.1111/j.1467-7652.2009.00418.x
Amin ANN, Hayashi S, Bartlem DG (2014) Robust in vitro assay system for quantitative analysis of
parasitic root-knot nematode infestation using Lotus japonicus. Journal of Bioscience and
Bioengineering 118 (2):205-213. doi:http://dx.doi.org/10.1016/j.jbiosc.2014.01.006
Antoniou M, Evans AAF (1987) Diapause in Meloidogyne naasi eggs. The effect of constant temperature
incubation on subsequent hatch. Nematologica 33:186-198
Aoki K, Moriguchi H, Yoshioka T, Okawa K, Tabara H (2007) In vitro analyses of the production and
activity of secondary small interfering RNAs in C. elegans. The EMBO Journal 26:5007
Arguel M-J, Jaouannet M, Magliano M, Abad P, Rosso MN (2012) siRNAs trigger efficient silencing of a
parasitism gene in plant parasitic root-knot nematodes. Genes 3 (3):391-408
Ashe A, Bélicard T, Le Pen J, Sarkies P, Frézal L, Lehrbach NJ, Félix M-A, Miska EA (2013) A deletion
polymorphism in the Caenorhabditis elegans RIG-I homolog disables viral RNA dicing and
antiviral immunity. eLife 2:e00994. doi:10.7554/eLife.00994
Ashe A, Sapetschnig A, Weick E-M, Mitchell J, Bagijn MP, Cording AC, Doebley A-L, Goldstein LD,
Lehrbach NJ, Le Pen J, Pintacuda G, Sakaguchi A, Sarkies P, Ahmed S, Miska EA (2012)
piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans. Cell
150 (1):88-99. doi:10.1016/j.cell.2012.06.018
Atkinson LE, Stevenson M, McCoy CJ, Marks NJ, Fleming C, Zamanian M, Day TA, Kimber MJ, Maule
AG, Mousley A (2013) flp-32 ligand/receptor silencing phenocopy faster plant pathogenic
nematodes. PLoS Pathogens 9 (2):e1003169. doi:10.1371/journal.ppat.1003169
Azevedo J, Garcia D, Pontier D, Ohnesorge S, Yu A, Garcia S, Braun L, Bergdoll M, Hakimi MA,
Lagrange T, Voinnet O (2010) Argonaute quenching and global changes in Dicer homeostasis
caused by a pathogen-encoded GW repeat protein. Genes & Development 24 (9):904-915.
doi:10.1101/gad.1908710
Bakhetia M, Charlton W, Atkinson HJ, McPherson MJ (2005) RNA interference of dual oxidase in the
plant nematode Meloidogyne incognita. Molecular Plant-Microbe Interactions 18 (10):1099-
1106. doi:10.1094/MPMI-18-1099
Bakhetia M, Urwin P, Atkinson H (2008) Characterisation by RNAi of pioneer genes expressed in the
dorsal pharyngeal gland cell of Heterodera glycines and the effects of combinatorial RNAi.
International Journal for Parasitology 38 (13):1589-1597. doi:http://dx.doi.org/10.1016/j.
ijpara.2008.05.003
Bakhetia M, Urwin PE, Atkinson HJ (2007) qPCR Analysis and RNAi define pharyngeal gland cell-
expressed genes of Heterodera glycines required for initial interactions with the host. Molecular
Plant-Microbe Interactions 20 (3):306-312. doi:10.1094/MPMI-20-3-0306
132
Ball-Coelho B, Bruin AJ, Roy RC, Riga E (2003) Forage pearl millet and marigold as rotation crops for
biological control of root-lesion nematodes in potato. Agronomy Journal 95 (2):282-292.
doi:10.2134/agronj2003.2820
Bartel DP (2004) MicroRNAs. Cell 116 (2):281-297. doi:10.1016/S0092-8674(04)00045-5
Bartlem DG, Jones MGK, Hammes UZ (2013) Vascularization and nutrient delivery at root-knot
nematode feeding sites in host roots. Journal of Experimental Botany. doi:10.1093/jxb/ert415
Bas A, Forsberg G, Hammarström S, Hammarström ML (2004) Utility of the housekeeping genes 18S
rRNA, β-Actin and Glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time
quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in
human T lymphocytes. Scandinavian Journal of Immunology 59 (6):566-573.
doi:10.1111/j.0300-9475.2004.01440.x
Baum TJ, Hussey RS, Davis EL (2007) Root-knot and cyst nematode parasitism genes: The molecular
basis of plant parasitism. In: Setlow J (ed) Genetic Engineering, vol 28. Genetic Engineering.
Springer US, pp 17-43. doi:10.1007/978-0-387-34504-8_2
Baumberger N, Baulcombe DC (2005) Arabidopsis ARGONAUTE1 is an RNA slicer that selectively
recruits microRNAs and short interfering RNAs. Proceedings of the National Academy of
Sciences of the United States of America 102 (33):11928-11933. doi:10.1073/pnas.0505461102
Bender LB, Cao R, Zhang Y, Strome S (2004) The MES-2/MES-3/MES-6 complex and regulation of
histone H3 methylation in C. elegans. Current Biology 14 (18):1639-1643.
doi:10.1016/j.cub.2004.08.062
Bent A (2006) Arabidopsis thaliana floral dip transformation method. In: Wang K (ed) Agrobacterium
Protocols, vol 343. Methods in Molecular Biology. Humana Press, pp 87-104. doi:10.1385/1-
59745-130-4:87
Berns K, Hijmans EM, Mullenders J, Brummelkamp TR, Velds A, Heimerikx M, Kerkhoven RM,
Madiredjo M, Nijkamp W, Weigelt B, Agami R, Ge W, Cavet G, Linsley PS, Beijersbergen RL,
Bernards R (2004) A large-scale RNAi screen in human cells identifies new components of the
p53 pathway. Nature 428 (6981):431-437. doi:http://www.nature.com/nature/journal/v428/
n6981/suppinfo/nature02371_S1.html
Bert W, Karssen G, Helder J (2011) Phylogeny and evolution of nematodes. In: Jones JT, Gheysen G,
Fenoll C (eds) Genomics and Molecular Genetics of Plant-Nematode Interactions. Springer
Netherlands, pp 45-59. doi:10.1007/978-94-007-0434-3_3
Berthou F, Palloix A, Mugniéry D (2003) Characterisation of virulence in populations of Meloidogyne
chitwoodi and evidence for a resistance gene in pepper Capsicum annuum L. line PM 217.
Nematology 5 (3):383-390. doi:doi:10.1163/156854103769224377
Bird AF, Brisbane PG (1988) The influence of Pasteuria penetrans in field soils on the reproduction of
root-knot nematodes. Revue Nematol 11 (1):75-81
Bird DM, Williamson VM, Abad PM, McCarter J, Danchin EGJ, Castagnone-Sereno P, Opperman CH
(2009) The genomes of root-knot nematodes. Annual Review of Phytopathology 47:333
Blaxter M (2011) Nematodes: The worm and its relatives. PLoS Biology 9 (4):e1001050.
doi:10.1371/journal.pbio.1001050
Blaxter ML, De Ley P, Garey JR, Liu LX, Scheldeman P, Vierstraete A, Vanfleteren JR, Mackey LY,
Dorris M, Frisse LM, Vida JT, Thomas WK (1998) A molecular evolutionary framework for the
phylum Nematoda. Nature 392 (6671):71-75
Blok VC, Jones JT, Phillips MS, Trudgill DL (2008) Parasitism genes and host range disparities in
biotrophic nematodes: the conundrum of polyphagy versus specialisation. BioEssays 30 (3):249-
259. doi:10.1002/bies.20717
Bonfim K, Faria JC, Nogueira EOPL, Mendes ÉA, Aragão FJL (2007) RNAi-mediated resistance to bean
golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris). Molecular
Plant-Microbe Interactions 20 (6):717-726. doi:10.1094/MPMI-20-6-0717
Bongers T, Bongers M (1998) Functional diversity of nematodes. Applied Soil Ecology 10 (3):239-251.
doi:http://dx.doi.org/10.1016/S0929-1393(98)00123-1
Bracht J, Hunter S, Eachus R, Weeks P, Pasquinelli AE (2004) Trans-splicing and polyadenylation of let-
7 microRNA primary transcripts. RNA 10 (10):1586-1594. doi:10.1261/rna.7122604
Britton MT (2001) Analysis of the genomics of Pratylenchus vulnus, a plant parasitic nematode, and its
interaction with walnut roots. PhD thesis. University of California, Davis
Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, Dunoyer P, Yamamoto YY, Sieburth L,
Voinnet O (2008) Widespread translational inhibition by plant miRNAs and siRNAs. Science
320 (5880):1185-1190. doi:10.1126/science.1159151
Buckley B (2013) Genetic regulation of RNAi inheritance in the C. elegans germ line. PhD thesis.
University of Wisconsin-Madison,
133
Burch-Smith TM, Schiff M, Liu Y, Dinesh-Kumar SP (2006) Efficient Virus-Induced Gene Silencing in
Arabidopsis. Plant Physiology 142 (1):21-27. doi:10.1104/pp.106.084624
Burke M, Scholl EH, Bird DM, Schaff JE, Colman SD, Crowell R, Diener S, Gordon O, Graham S,
Wang X, Windham E, Wright GM, Opperman CH (2015) The plant parasite Pratylenchus
coffeae carries a minimal nematode genome. Nematology 17 (6):621-637.
doi:doi:10.1163/15685411-00002901
Burkhart KB, Guang S, Buckley BA, Wong L, Bochner AF, Kennedy S (2011) A pre-mRNA–associating
factor links endogenous siRNAs to chromatin regulation. PLoS Genetics 7 (8):e1002249.
doi:10.1371/journal.pgen.1002249
Burton NO, Burkhart KB, Kennedy S (2011) Nuclear RNAi maintains heritable gene silencing in
Caenorhabditis elegans. Proceedings of the National Academy of Sciences 108 (49):19683-
19688. doi:10.1073/pnas.1113310108
Büssing I, Yang J-S, Lai EC, Großhans H (2010) The nuclear export receptor XPO-1 supports primary
miRNA processing in C. elegans and Drosophila. The EMBO Journal 29 (11):1830-1839.
doi:10.1038/emboj.2010.82
Caillaud M-C, Dubreuil G, Quentin M, Perfus-Barbeoch L, Lecomte P (2008) Root-knot nematodes
manipulate plant cell functions during a compatible interaction. Journal of Plant Physiology
165:104
Calixto A, Chelur D, Topalidou I, Chen X, Chalfie M (2010) Enhanced neuronal RNAi in C. elegans
using SID-1. Nature methods 7 (7):554-559. doi:10.1038/nmeth.1463
Calo S, Nicolás FE, Vila A, Torres-Martínez S, Ruiz-Vázquez RM (2012) Two distinct RNA-dependent
RNA polymerases are required for initiation and amplification of RNA silencing in the basal
fungus Mucor circinelloides. Molecular Microbiology 83 (2):379-394. doi:10.1111/j.1365-
2958.2011.07939.x
Carbonell A, Fahlgren N, Garcia-Ruiz H, Gilbert KB, Montgomery TA, Nguyen T, Cuperus JT,
Carrington JC (2012) Functional analysis of three Arabidopsis ARGONAUTES using slicer-
defective mutants. The Plant Cell 24 (9):3613-3629. doi:10.1105/tpc.112.099945
Carmell MA, Xuan Z, Zhang MQ, Hannon GJ (2002) The Argonaute family: tentacles that reach into
RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes & Development
16 (21):2733-2742. doi:10.1101/gad.1026102
Castagnone-Sereno P (2002) Genetic variability of nematodes: a threat to the durability of plant resistance
genes? Euphytica 124 (2):193-199. doi:10.1023/A:1015682500495
Castro CE, McKinney HE, Lux S (1991) Plant protection with inorganic ions. Journal of Nematology 23
(4):409-413
Caudy AA, Ketting RF, Hammond SM, Denli AM, Bathoorn AMP, Tops BBJ, Silva JM, Myers MM,
Hannon GJ, Plasterk RHA (2003) A micrococcal nuclease homologue in RNAi effector
complexes. Nature 425 (6956):411-414. doi:http://www.nature.com/nature/journal/v425/n6956/
suppinfo/nature01956_S1.html
Ceron J, Rual J-F, Chandra A, Dupuy D, Vidal M, van den Heuvel S (2007) Large-scale RNAi screens
identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing-
related components with synMuv B activity. BMC Developmental Biology 7 (1):30
Chan S-P, Ramaswamy G, Choi E-Y, Slack FJ (2008) Identification of specific let-7 microRNA binding
complexes in Caenorhabditis elegans. RNA 14 (10):2104-2114. doi:10.1261/rna.551208
Charlton WL, Harel HYM, Bakhetia M, Hibbard JK, Atkinson HJ, McPherson MJ (2010) Additive
effects of plant expressed double-stranded RNAs on root-knot nematode development.
International Journal for Parasitology 40 (7):855-864. doi:http://dx.doi.org/10.1016/j.
ijpara.2010.01.003
Chatterjee S, Grobhans H (2009) Active turnover modulates mature microRNA activity in
Caenorhabditis elegans. Nature 461 (7263):546-549. doi:http://www.nature.com/nature/journal/
v461/n7263/suppinfo/nature08349_S1.html
Chen C-CG, Simard MJ, Tabara H, Brownell DR, McCollough JA, Mello CC (2005) A member of the
polymerase β nucleotidyltransferase superfamily is required for RNA interference in C. elegans.
Current Biology 15 (4):378-383. doi:http://dx.doi.org/10.1016/j.cub.2005.01.009
Chendrimada TP, Finn KJ, Ji X, Baillat D, Gregory RI, Liebhaber SA, Pasquinelli AE, Shiekhattar R
(2007) MicroRNA silencing through RISC recruitment of eIF6. Nature 447 (7146):823-828.
doi:http://www.nature.com/nature/journal/v447/n7146/suppinfo/nature05841_S1.html
Chitwood DJ (2003) Research on plant parasitic nematode biology conducted by the United States
Department of Agriculture–Agricultural Research Service. Pest Management sScience 59 (6-
7):748-753
134
Chiu Y-L, Rana TM (2002) RNAi in human cells. Molecular Cell 10 (3):549-561. doi:10.1016/S1097-
2765(02)00652-4
Chiu Y-L, Rana TM (2003) siRNA function in RNAi: A chemical modification analysis. RNA 9
(9):1034-1048. doi:10.1261/rna.5103703
Chuang C-F, Meyerowitz EM (2000) Specific and heritable genetic interference by double-stranded RNA
in Arabidopsis thaliana. Proceedings of the National Academy of Sciences 97 (9):4985-4990.
doi:10.1073/pnas.060034297
Claycomb JM, Batista PJ, Pang KM, Gu W, Vasale JJ, van Wolfswinkel JC, Chaves DA, Shirayama M,
Mitani S, Ketting RF, Conte D, Mello CC (2009) The Argonaute CSR-1 and its 22G-RNA co-
factors target germline genes and are required for holocentric chromosome segregation. Cell 139
(1):123-134. doi:10.1016/j.cell.2009.09.014
Cogoni C, Macino G (1999) Gene silencing in Neurospora crassa requires a protein homologous to
RNA-dependent RNA polymerase. Nature 399 (6732):166-169
Consortium TCeS (1998) Genome Sequence of the Nematode C. elegans: A Platform for Investigating
Biology. Science 282 (5396):2012-2018. doi:10.1126/science.282.5396.2012
Cornu M (1879) Etudes sur le Phylloxera vastatrix. Memoires Presentes par Divers Savants a l'Academie
des Sciences, Institut France 26:163-175
Corpet F (1988) Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research 16
(22):10881-10890. doi:10.1093/nar/16.22.10881
Corrêa RL, Steiner FA, Berezikov E, Ketting RF (2010) MicroRNA–directed siRNA biogenesis in
Caenorhabditis elegans. PLoS Genetics 6 (4):e1000903. doi:10.1371/journal.pgen.1000903
Cotton JA, Lilley CJ, Jones LM, Kikuchi T, Reid AJ, Thorpe P, Tsai IJ, Beasley H, Blok V, Cock PJA,
den Akker SE-v, Holroyd N, Hunt M, Mantelin S, Naghra H, Pain A, Palomares-Rius JE,
Zarowiecki M, Berriman M, Jones JT, Urwin PE (2014) The genome and life-stage specific
transcriptomes of Globodera pallida elucidate key aspects of plant parasitism by a cyst
nematode. Genome Biology 15 (3):R43-R43. doi:10.1186/gb-2014-15-3-r43
Cuperus JT, Fahlgren N, Carrington JC (2011) Evolution and functional diversification of miRNA genes.
The Plant Cell 23 (2):431-442. doi:10.1105/tpc.110.082784
Curtis RHC, Robinson AF, Perry RN (2009) Hatch and location. In: Perry RN, Moens M, Starr JL (eds)
Root-knot nematodes. CABI Publishing, Wallingford, UK, pp 139-162
Dababat AA, Sikora AR (2007) Induced resistance by the mutualistic endophyte, Fusarium oxysporum
strain 162, toward Meloidogyne incognita on tomato. Biocontrol Science and Technology 17
(9):969-975. doi:10.1080/09583150701582057
Dalzell JJ, McMaster S, Fleming CC, Maule AG (2010a) Short interfering RNA-mediated gene silencing
in Globodera pallida and Meloidogyne incognita infective stage juveniles. International Journal
for Parasitology 40 (1):91-100. doi:http://dx.doi.org/10.1016/j.ijpara.2009.07.003
Dalzell JJ, McVeigh P, Warnock ND, Mitreva M, Bird DM, Abad P, Fleming CC, Day TA, Mousley A,
Marks NJ, Maule AG (2011) RNAi effector diversity in nematodes. PLoS Neglected Tropical
Diseases 5 (6):e1176. doi:10.1371/journal.pntd.0001176
Dalzell JJ, Warnock ND, Stevenson MA, Mousley A, Fleming CC, Maule AG (2010b) Short interfering
RNA-mediated knockdown of drosha and pasha in undifferentiated Meloidogyne incognita eggs
leads to irregular growth and embryonic lethality. International Journal for Parasitology 40
(11):1303-1310. doi:http://dx.doi.org/10.1016/j.ijpara.2010.03.010
Davies KG, Fargette M, Balla G, Daudi A, Duponnois R, Gowen SR, Mateille T, Phillips MS, Sawadogo
A, Trivino C, Vouyoukalou E, Trudgill D (2001) Cuticle heterogeneity as exhibited by Pasteuria
spore attachment is not linked to the phylogeny of parthenogenetic root-knot nematodes
(Meloidogyne spp.). Parasitology 122 (01):111-120. doi:doi:10.1017/S0031182000006958
Davies KG, Rowe JA, Williamson VM (2008) Inter- and intra-specific cuticle variation between
amphimictic and parthenogenetic species of root-knot nematode (Meloidogyne spp.) as revealed
by a bacterial parasite (Pasteuria penetrans). International Journal for Parasitology 38 (7):851-
859. doi:http://dx.doi.org/10.1016/j.ijpara.2007.11.007
Davis EL, Hussey RS, Baum TJ (2004) Getting to the roots of parasitism by nematodes. Trends in
Parasitology 20 (3):134-141. doi:10.1016/j.pt.2004.01.005
Davis EL, Mitchum MG (2005) Nematodes. Sophisticated parasites of legumes. Plant Physiology 137
(4):1182-1188. doi:10.1104/pp.104.054973
de Boer JM, Yan Y, Smant G, Davis EL, Baum TJ (1998) In-situ hybridization to messenger RNA in
Heterodera glycines. Journal of Nematology 30 (3):309-312
de Framond A, Rich PJ, McMillan J, Ejeta G (2007) Effects of Striga parasitism of transgenic maize
armed with RNAi constructs targeting essential S. asiatica genes. In: Integrating new
135
technologies for Striga control: towards ending the witch-hunt. World Scientific, Hackensack
NJ, pp 185-196
de Guiran G (1979) A necessary diapause in root-knot nematodes. Observations on its distribution and
inheritance in Meloidogyne incognita. Revue Nematol 2 (2):223-231
De Ley IT, De Ley P, Vierstraete A, Karssen G, Moens M, Vanfleteren J (2002) Phylogenetic Analyses
of Meloidogyne Small Subunit rDNA. Journal of Nematology 34 (4):319-327
De Santis C, Smith-Keune C, Jerry DR (2011) Normalizing RT-qPCR data: are we getting the right
answers? An appraisal of normalization approaches and internal reference genes from a case
study in the finfish Lates calcarifer. Marine Biotechnology 13 (2):170-180. doi:10.1007/s10126-
010-9277-z
de Souza Júnior A, José D, Ramos Coelho R, Tristan Lourenço I, da Rocha FR, Barbosa Viana AA, Lima
Pepino de Macedo L, Mattar da Silva MC, Gomes Carneiro RM, Engler G, de Almeida-Engler J,
Grossi-de-Sa MF (2013) Knocking-down Meloidogyne incognita proteases by plant-delivered
dsRNA has negative pleiotropic effect on nematode vigor. PLoS ONE 8 (12):e85364.
doi:10.1371/journal. pone.0085364
Decraemer W, Hunt DJ (2006) Structure and classification. In: Perry RN, Moens M (eds) Plant
nematology. CABI, Oxfordshire, pp 4-32
Di Vito M, Greco N (1988) The relationship between initial population densities of Meloidogyne artiellia
and yield of winter and spring chickpea. Nematologia Mediterranea 16:163-166
Di Vito M, Vovlas N, Inserra RN (1980) Influence of Meloidogyne incognita on growth of corn pots.
Plant Disease 64:1025-1026
Ding L, Spencer A, Morita K, Han M (2005) The developmental timing regulator AIN-1 interacts with
miRISCs and may target the argonaute protein ALG-1 to cytoplasmic p bodies in C. elegans.
Molecular Cell 19 (4):437-447. doi:10.1016/j.molcel.2005.07.013
Dinh PTY, Brown CR, Elling AA (2014) RNA Interference of effector gene Mc16D10L confers
resistance against Meloidogyne chitwoodi in Arabidopsis and Potato. Phytopathology 104
(10):1098-1106. doi:10.1094/PHYTO-03-14-0063-R
Djian-Caporalino C, Fazari A, Arguel MJ, Vernie T, VandeCasteele C, Faure I, Brunoud G, Pijarowski L,
Palloix A, Lefebvre V, Abad P (2007) Root-knot nematode (Meloidogyne spp.) Me resistance
genes in pepper (Capsicum annuum L.) are clustered on the P9 chromosome. Theoretical and
Applied Genetics 114 (3):473-486. doi:10.1007/s00122-006-0447-3
Djian-Caporalino C, Pijarowski L, Fazari A, Samson M, Gaveau L, O’Byrne C, Lefebvre V, Caranta C,
Palloix A, Abad P (2001) High-resolution genetic mapping of the pepper (Capsicum annuum L.)
resistance loci Me3 and Me4 conferring heat-stable resistance to root-knot nematodes
(Meloidogyne spp.). Theoretical and Applied Genetics 103 (4):592-600. doi:10.1007/
PL00002914
Doench JG, Petersen CP, Sharp PA (2003) siRNAs can function as miRNAs. Genes & Development 17
(4):438-442. doi:10.1101/gad.1064703
Dong L, Li X, Huang L, Gao Y, Zhong L, Zheng Y, Zuo Y (2014) Lauric acid in crown daisy root
exudate potently regulates root-knot nematode chemotaxis and disrupts Mi-flp-18 expression to
block infection. Journal of Experimental Botany 65 (1):131-141. doi:10.1093/jxb/ert356
Dong Z, Han M-H, Fedoroff N (2008) The RNA-binding proteins HYL1 and SE promote accurate in
vitro processing of pri-miRNA by DCL1. Proceedings of the National Academy of Sciences of
the United States of America 105 (29):9970-9975. doi:10.1073/pnas.0803356105
Draaistra J (2006) Genetic analysis of root-knot nematode resistance in potato. Wageningen University
and Research centre, Wageningen
Dubreuil G, Magliano M, Deleury E, Abad P, Rosso MN (2007) Transcriptome analysis of root-knot
nematode functions induced in the early stages of parasitism*. New Phytologist 176 (2):426-436.
doi:10.1111/j.1469-8137.2007.02181.x
Dubreuil G, Magliano M, Dubrana MP, Lozano J, Lecomte P, Favery B, Abad P, Rosso MN (2009)
Tobacco rattle virus mediates gene silencing in a plant parasitic root-knot nematode. Journal of
Experimental Botany. doi:10.1093/jxb/erp237
Duchaine TF, Wohlschlegel JA, Kennedy S, Bei Y, Conte Jr D, Pang K, Brownell DR, Harding S, Mitani
S, Ruvkun G, Yates Iii JR, Mello CC (2006) Functional proteomics reveals the biochemical
niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways. Cell 124 (2):343-354.
doi:http://dx.doi.org/ 10.1016/j.cell.2005.11.036
Dudley NR, Labbé J-C, Goldstein B (2002) Using RNA interference to identify genes required for RNA
interference. Proceedings of the National Academy of Sciences 99 (7):4191-4196.
doi:10.1073/pnas. 062605199
136
Dutta TK, Banakar P, Rao U (2014) The status of RNAi-based transgenic research in plant nematology.
Frontiers in Microbiology 5:760. doi:10.3389/fmicb.2014.00760
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001a) Duplexes of 21-nucleotide
RNAs mediate RNA interference in cultured mammalian cells. Nature 411 (6836):494-498
Elbashir SM, Martinez J, Patkaniowska A, Lendeckel W, Tuschl T (2001b) Functional anatomy of
siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. The EMBO
Journal 20 (23):6877-6888. doi:10.1093/emboj/20.23.6877
Eulalio A, Behm-Ansmant I, Schweizer D, Izaurralde E (2007) P-body formation is a consequence, not
the cause, of RNA-mediated gene silencing. Molecular and Cellular Biology 27 (11):3970-3981.
doi:10.1128/MCB.00128-07
Eun C, Lorkovic ZJ, Naumann U, Long Q, Havecker ER, Simon SA, Meyers BC, Matzke AJM, Matzke
M (2011) AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root
meristems in Arabidopsis thaliana. PLoS ONE 6 (10):e25730. doi:10.1371/journal.
pone.0025730
Eystathioy T, Jakymiw A, Chan EK, SÉRaphin B, Cougot N, Fritzler MJ (2003) The GW182 protein
colocalizes with mRNA degradation associated proteins hDcp1 and hLSm4 in cytoplasmic GW
bodies. RNA 9 (10):1171-1173. doi:10.1261/rna.5810203
Fairbairn D, Cavallaro A, Bernard M, Mahalinga-Iyer J, Graham M, Botella J (2007) Host-delivered
RNAi: an effective strategy to silence genes in plant parasitic nematodes. Planta 226:1525
Fanelli E, Di Vito M, Jones JT, De Giorgi C (2005) Analysis of chitin synthase function in a plant
parasitic nematode, Meloidogyne artiellia, using RNAi. Gene 349:87
Fanelli E, Troccoli A, Picardi E, Pousis C, De Luca F (2014) Molecular characterization and functional
analysis of four β-1,4-endoglucanases from the root-lesion nematode Pratylenchus vulnus. Plant
Pathology 63 (6):1436-1445. doi:10.1111/ppa.12222
Feinbaum R, Ambros V (1999) The timing of lin-4RNA accumulation controls the timing of
postembryonic developmental events in Caenorhabditis elegans. Developmental Biology 210
(1):87-95. doi:http://dx.doi.org/10.1006/dbio.1999.9272
Feinberg EH, Hunter CP (2003) Transport of dsRNA into cells by the transmembrane protein SID-1.
Science (New York) 301 (5639):1545-1547
Fernandez EQ, Moyer DL, Maiyuran S, Labaro A, Brody H (2012) Vector-initiated transitive RNA
interference in the filamentous fungus Aspergillus oryzae. Fungal Genetics and Biology 49
(4):294-301. doi:http://dx.doi.org/10.1016/j.fgb.2012.01.011
Filippov V, Solovyev V, Filippova M, Gill SS (2000) A novel type of RNase III family proteins in
eukaryotes. Gene 245 (1):213-221. doi:http://dx.doi.org/10.1016/S0378-1119(99)00571-5
Fioretti L, Porter A, Haydock PJ, Curtis R (2002) Monoclonal antibodies reactive with secreted–excreted
products from the amphids and the cuticle surface of Globodera pallida affect nematode
movement and delay invasion of potato roots. International Journal for Parasitology 32
(14):1709-1718. doi:http://dx.doi.org/10.1016/S0020-7519(02)00178-9
Fire A, Xu SQ, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans. Nature 391 (6669):806-811.
doi:http://www.nature.com/nature/journal/v391/n6669/suppinfo/391806a0_S1.html
Fischer SEJ, Butler MD, Pan Q, Ruvkun G (2008) Trans-splicing in C. elegans generates the negative
RNAi regulator ERI-6/7. Nature 455 (7212):491-496. doi:http://www.nature.com/nature/journal/
v455/n7212/suppinfo/nature07274_S1.html
Fong Y, Bender L, Wang W, Strome S (2002) Regulation of the different chromatin states of autosomes
and X chromosomes in the germ line of C. elegans. Science (New York, NY) 296 (5576):2235-
2238. doi:10.1126/science.1070790
Forrest EC, Cogoni C, Macino G (2004) The RNA-dependent RNA polymerase, QDE-1, is a rate-limiting
factor in post-transcriptional gene silencing in Neurospora crassa. Nucleic Acids Research 32
(7):2123-2128. doi:10.1093/nar/gkh530
Förstemann K, Horwich MD, Wee LM, Tomari Y, Zamore PD (2007) Drosophila microRNAs are sorted
into functionally distinct Argonaute protein complexes after their production by Dicer-1. Cell
130 (2):287-297. doi:10.1016/j.cell.2007.05.056
Fosu-Nyarko J, Jones MGK (2015) Application of biotechnology for nematode control in crop plants. In:
Advances in Botanical Research, vol 73. pp 339-376
Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J (2000) Functional
genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408
(6810):325-330. doi:http://www.nature.com/nature/journal/v408/n6810/suppinfo/408325a0
_S1.html
137
Gabel HW, Ruvkun G (2008) The exonuclease ERI-1 has a conserved dual role in 5.8S rRNA processing
and RNAi. Nature structural & molecular biology 15 (5):531-533. doi:10.1038/nsmb.1411
Gaeta RT, Bahaji A, Polack GW, Alderon-Urrea AC (2011) Effects of ced-9 dsRNA on Caenorhabditis
elegans and Meloidogyne incognita. American Journal of Agricultural and Biological Sciences 6
(1):19-28
Garcia GM, Stalker HT, Shroeder E, Kochert G (1996) Identification of RAPD, SCAR, and RFLP
markers tightly linked to nematode resistance genes introgressed from Arachis cardenasii into
Arachis hypogaea. Genome 39 (5):836-845
Geldhof P, Molloy C, Knox DP (2006) Combinatorial RNAi on intestinal cathepsin B-like proteinases in
Caenorhabditis elegans questions the perception of their role in nematode biology. Molecular
and Biochemical Parasitology 145 (1):128-132. doi:http://dx.doi.org/10.1016/j.molbiopara.2005.
09.016
Gheysen G, Fenoll C (2002) Gene expression in nematode feeding sites. Annual Review of
Phytopathology 40:191
Gheysen G, Mitchum MG (2011) How nematodes manipulate plant development pathways for infection.
Current Opinion in Plant Biology 14 (4):415-421. doi:http://dx.doi.org/10.1016/j.pbi.2011.03.
012
Gleason CA, Liu QL, Williamson VM (2008) Silencing a candidate nematode effector gene
corresponding to the tomato resistance gene Mi-1 leads to acquisition of virulence. Molecular
Plant-Microbe Interactions 21:576
Gleave AP (1992) A versatile binary vector system with a T-DNA organisational structure conducive to
efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 20
(6):1203-1207. doi:10.1007/BF00028910
Gleave ME, Monia BP (2005) Antisense therapy for cancer. Nature Reviews Cancer 5 (6):468-479
Goidin D, Mamessier A, Staquet M-J, Schmitt D, Berthier-Vergnes O (2001) Ribosomal 18S RNA
prevails over Glyceraldehyde-3-phosphate dehydrogenase and β-Actin genes as internal standard
for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell
subpopulations. Analytical Biochemistry 295 (1):17-21. doi:http://dx.doi.org/10.1006/abio.2001.
5171
Gonczy P, Echeverri C, Oegema K, Coulson A, Jones SJM, Copley RR, Duperon J, Oegema J, Brehm M,
Cassin E, Hannak E, Kirkham M, Pichler S, Flohrs K, Goessen A, Leidel S, Alleaume A-M,
Martin C, Ozlu N, Bork P, Hyman AA (2000) Functional genomic analysis of cell division in C.
elegans using RNAi of genes on chromosome III. Nature 408 (6810):331-336.
doi:http://www.nature.com/nature/journal/v408/n6810/suppinfo/408331a0_S1.html
Gong L, Chen Y, Hu Z, Hu M (2013) Testing insecticidal activity of novel chemically synthesized siRNA
against Plutella xylostella under laboratory and field conditions. PLoS ONE 8 (5):e62990.
doi:10.1371/journal.pone.0062990
Gouda K, Matsunaga Y, Iwasaki T, Kawano T (2010) An altered method of feeding RNAi that knocks
down multiple genes simultaneously in the nematode Caenorhabditis elegans. Bioscience,
Biotechnology, and Biochemistry 74 (11):2361-2365. doi:10.1271/bbb.100579
Goverse A, de Almeida Engler J, Verhees J, van der Krol S, Helder J, Gheysen G (2000) Cell cycle
activation by plant parasitic nematodes. Plant Molecular Biology 43 (5-6):747-761.
doi:10.1023/A:1006367126077
Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ (2008) miRBase: tools for microRNA genomics.
Nucleic Acids Research 36 (Database issue):D154-D158. doi:10.1093/nar/gkm952
Grillone LR, Lanz R (2001) "Formivirsen". Drugs Today (Barc) 37 (4):245-255
Grishok A, Pasquinelli AE, Conte D, Li N, Parrish S, Ha I, Baillie DL, Fire A, Ruvkun G, Mello CC
(2001) Genes and mechanisms related to RNA interference regulate expression of the small
temporal RNAs that control C. elegans developmental timing. Cell 106 (1):23-34.
doi:http://dx.doi.org/10.1016/S0092-8674(01)00431-7
Grishok A, Sinskey JL, Sharp PA (2005) Transcriptional silencing of a transgene by RNAi in the soma of
C. elegans. Genes & Development 19 (6):683-696. doi:10.1101/gad.1247705
Grishok A, Tabara H, Mello C (2000) Genetic requirements for inheritance of RNAi in C. elegans.
Science 287 (5462):2494-2497
Gu S, Jin L, Zhang F, Sarnow P, Kay MA (2009) The biological basis for microRNA target restriction to
the 3' untranslated region in mammalian mRNAs. Nature Structural & Molecular Biology 16
(2):144-150. doi:10.1038/nsmb.1552
Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A (2012) Amplification of siRNA in
Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9
methylation footprint. Nature Genetics 44 (2):157-164
138
Guang S, Bochner AF, Burkhart KB, Burton N, Pavelec DM, Kennedy S (2010) Small regulatory RNAs
inhibit RNA polymerase II during the elongation phase of transcription. Nature 465
(7301):1097-1101. doi:http://www.nature.com/nature/journal/v465/n7301/suppinfo/nature09095
_S1.html
Guang S, Bochner AF, Pavelec DM, Burkhart KB, Harding S, Lachowiec J, Kennedy S (2008) An
Argonaute transports siRNAs from the cytoplasm to the nucleus. Science (New York, NY) 321
(5888):537-541. doi:10.1126/science.1157647
Haegeman A, Mantelin S, Jones JT, Gheysen G (2012) Functional roles of effectors of plant-parasitic
nematodes. Gene 492 (1):19-31. doi:http://dx.doi.org/10.1016/j.gene.2011.10.040
Haegeman A, Vanholme B, Gheysen G (2009) Characterization of a putative endoxylanase in the
migratory plant-parasitic nematode Radopholus similis. Molecular Plant Pathology 10 (3):389-
401. doi:10.1111/j. 1364-3703.2009.00539.x
Haerty W, Artieri C, Khezri N, Singh R, Gupta B (2008) Comparative analysis of function and interaction
of transcription factors in nematodes: Extensive conservation of orthology coupled to rapid
sequence evolution. BMC Genomics 9 (1):1-16. doi:10.1186/1471-2164-9-399
Haley B, Zamore PD (2004) Kinetic analysis of the RNAi enzyme complex. Nature Structural &
Molecular Biology 11 (7):599-606. doi:http://www.nature.com/nsmb/journal/v11/n7/suppinfo/
nsmb780_S1.html
Hamamouch N, Li C, Hewezi T, Baum TJ, Mitchum MG, Hussey RS, Vodkin LO, Davis EL (2012) The
interaction of the novel 30C02 cyst nematode effector protein with a plant β-1,3-endoglucanase
may suppress host defence to promote parasitism. Journal of Experimental Botany.
doi:10.1093/jxb/ers058
Hamilton A, Voinnet O, Chappell L, Baulcombe D (2002) Two classes of short interfering RNA in RNA
silencing. The EMBO Journal 21 (17):4671-4679. doi:10.1093/emboj/cdf464
Hashmi S, Tawe W, Lustigman S (2001) Caenorhabditis elegans and the study of gene function in
parasites. Trends in Parasitology 17 (8):387-393. doi:http://dx.doi.org/10.1016/S1471-4922(01)
01986-9
He X-F, Fang Y-Y, Feng L, Guo H-S (2008) Characterization of conserved and novel microRNAs and
their targets, including a TuMV-induced TIR–NBS–LRR class R gene-derived novel miRNA in
Brassica. FEBS Letters 582 (16):2445-2452. doi:http://dx.doi.org/10.1016/j.febslet.2008.06.011
Heisel S, Habel N, Schuetz N, Ruggieri A, Meese E (2010) The YEATS family member GAS41 interacts
with the general transcription factor TFIIF. BMC Molecular Biology 11 (1):53
Hinas A, Wright AJ, Hunter CP (2012) SID-5 is an endosome-associated protein required for efficient
systemic rnai in C. elegans. Current Biology 22 (20):1938-1943. doi:10.1016/j.cub.2012.08.020
Holstein SEH, Oliviusson P (2005) Sequence analysis of Arabidopsis thaliana E/ANTH-domain-
containing proteins: membrane tethers of the clathrin-dependent vesicle budding machinery.
Protoplasma 226 (1-2):13-21. doi:10.1007/s00709-005-0105-7
Huang G, Allen R, Davis EL, Baum TJ, Hussey RS (2006) Engineering broad root-knot resistance in
transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism
gene. Proceedings of the National Academy of Sciences 103 (39):14302-14306.
doi:10.1073/pnas.0604698103
Huang Y, Mei M, Mao Z, Lv S, Zhou J, Chen S, Xie B (2014) Molecular cloning and virus-induced gene
silencing of MiASB in the southern root-knot nematode, Meloidogyne incognita. European
Journal of Plant Pathology 138 (1):181-193. doi:10.1007/s10658-013-0321-5
Hunt DJ, Luc M, Manzanilla-Lopez RH, Luc M (2005) Identification, morphology and biology of plant
parasitic nematodes. In: Luc MS, Sikora SA, Bridge J (eds) Plant Parasitic Nematodes in
Subtropical and Tropical Agriculture. CAB International, Wallingford, UK,
Huntzinger E, Izaurralde E (2011) Gene silencing by microRNAs: contributions of translational
repression and mRNA decay. Nature Reviews Genetics 12 (2):99-110
Hussey RS, Grundler FMW (1998) Nematode parasitism of plants. In: Perry RN, Wright DJ (eds) The
Physiology and Biochemistry of free-living and plant-parasitic nematodes. CABI Publishing,
UK, pp 213-243
Iatsenko I, Sinha A, Rödelsperger C, Sommer RJ (2013) New role for DCR-1/Dicer in Caenorhabditis
elegans innate immunity against the highly virulent bacterium Bacillus thuringiensis DB27.
Infection and Immunity 81 (10):3942-3957. doi:10.1128/IAI.00700-13
Ibrahim HM, Alkharouf NW, Meyer SL, Aly MA, Gamal El-Din AEKY, Hussein EH, Matthews BF
(2011) Post-transcriptional gene silencing of root-knot nematode in transformed soybean roots.
Experimental Parasitology 127 (1):90 - 99
139
Iida T, Kawaguchi R, Nakayama J-i (2006) Conserved ribonuclease, eri1, negatively regulates
heterochromatin assembly in fission yeast. Current Biology 16 (14):1459-1464.
doi:10.1016/j.cub.2006.05.061
Jacque J-M, Triques K, Stevenson M (2002) Modulation of HIV-1 replication by RNA interference.
Nature 418 (6896):435-438
Jacquet M, Bpngiovanni M, Martinez M, Verschave P, Wajnberg E, Castagnone-Sereno P (2005)
Variation in resistance to the root-knot nematode Meloidogyne incognita in tomato genotypes
bearing the Mi gene. Plant Pathology 54:93-99
Jamous RM, Boonrod K, Fuellgrabe MW, Ali-Shtayeh MS, Krczal G, Wassenegger M (2011) The helper
component-proteinase of the Zucchini yellow mosaic virus inhibits the Hua Enhancer 1
methyltransferase activity in vitro. Journal of General Virology 92 (9):2222-2226. doi:10.1099/
vir.0.031534-0
Johns L, Grimson A, Kuchma SL, Newman CL, Anderson P (2007) Caenorhabditis elegans SMG-2
selectively marks mRNAs containing premature translation termination codons. Molecular and
Cellular Biology 27 (16):5630-5638. doi:10.1128/mcb.00410-07
Jones JT, Haegeman A, Danchin EGJ, Gaur HS, Helder J, Jones MGK, Kikuchi T, Manzanilla-López R,
Palomares-Rius JE, Wesemael WML, Perry RN (2013) Top 10 plant-parasitic nematodes in
molecular plant pathology. Molecular Plant Pathology 14 (9):946-961. doi:10.1111/mpp.12057
Jones MGK (1981) Host cell responses to endoparasitic nematode attack: structure and function of giant
cells and syncytia*. Annals of Applied Biology 97 (3):353-372. doi:10.1111/j.1744-
7348.1981.tb05122.x
Jones MGK, Goto DB (2011) Root-knot nematodes and giant cells. In: Jones JT, G. G, C. F (eds)
Genomics and Molecular Genetics of Plant Nematode Interactions. Springer, pp 83-100
Jones MGK, Payne HL (1978) Early stages of nematode-induced giant-cell formation in roots of
Impatiens balsamina. Journal of Nematology 10 (1):70-84
Jose AM, Hunter CP (2007) Transport of sequence-specific RNA interference information between cells.
Annual Review of Genetics 41 (1):305-330. doi:10.1146/annurev.genet.41.110306.130216
Jose AM, Kim YA, Leal-Ekman S, Hunter CP (2012) Conserved tyrosine kinase promotes the import of
silencing RNA into Caenorhabditis elegans cells. Proceedings of the National Academy of
Sciences USA 109 (36):14520-14525. doi:10.1073/pnas.1201153109
Jose AM, Smith JJ, Hunter CP (2009) Export of RNA silencing from C. elegans tissues does not require
the RNA channel SID-1. Proceedings of the National Academy of Sciences USA 106:2283
Joseph S, Gheysen G, Subramaniam K (2012) RNA interference in Pratylenchus coffeae: knock down of
Pc-pat-10 and Pc-unc-87 impedes migration. Molecular and Biochemical Parasitology 186
(1):51-59. doi:http://dx.doi.org/10.1016/j.molbiopara.2012.09.009
Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, Kanapin A, Le Bot N, Moreno S,
Sohrmann M, Welchman DP, Zipperlen P, Ahringer J (2003) Systematic functional analysis of
the Caenorhabditis elegans genome using RNAi. Nature 421 (6920):231 - 237
Karssen G, Moeans M (2006) Root-knot nematodes. In: Perry RN, Moeans M (eds) Plant Nematology.
CABI Publishing, Wallingford, UK, pp 59-90
Kennedy S, Wang D, Ruvkun G (2004) A conserved siRNA-degrading RNase negatively regulates RNA
interference in C. elegans. Nature 427 (6975):645-649. doi:http://www.nature.com/nature/
journal/v427/n6975/suppinfo/nature02302_S1.html
Kennerdell JR, Carthew RW (2000) Heritable gene silencing in Drosophila using double-stranded RNA.
Nature Biotechnology 18 (8):896-898
Ketting RF, Fischer SEJ, Bernstein E, Sijen T, Hannon GJ, Plasterk RHA (2001) Dicer functions in RNA
interference and in synthesis of small RNA involved in developmental timing in C. elegans.
Genes & Development 15 (20):2654-2659. doi:10.1101/gad.927801
Ketting RF, Haverkamp THA, van Luenen HGAM, Plasterk RHA (1999) mut-7 of C. elegans, required
for transposon silencing and RNA interference, is a homolog of werner syndrome helicase and
RNaseD. Cell 99 (2):133-141. doi:http://dx.doi.org/10.1016/S0092-8674(00)81645-1
Ketting RF, Plasterk RHA (2000) A genetic link between co-suppression and RNA interference in C.
elegans. Nature 404 (6775):296-298
Khatri M, Rajam MV (2007) Targeting polyamines of Aspergillus nidulans by siRNA specific to fungal
ornithine decarboxylase gene. Medical Mycology 45 (3):211-220. doi:doi:10.1080/
136937806011 58779
Khvorova A, Reynolds A, Jayasena SD (2003) Functional siRNAs and miRNAs exhibit strand bias. Cell
115 (2):209-216. doi:10.1016/S0092-8674(03)00801-8
Kikuchi T, Cotton JA, Dalzell JJ, Hasegawa K, Kanzaki N, McVeigh P, Takanashi T, Tsai IJ, Assefa SA,
Cock PJA, Otto TD, Hunt M, Reid AJ, Sanchez-Flores A, Tsuchihara K, Yokoi T, Larsson MC,
140
Miwa J, Maule AG, Sahashi N, Jones JT, Berriman M (2011) Genomic Insights into the Origin
of Parasitism in the Emerging Plant Pathogen Bursaphelenchus xylophilus. PLoS Pathogens 7
(9):e1002219. doi:10.1371/journal.ppat.1002219
Killiny N, Hajeri S, Tiwari S, Gowda S, Stelinski LL (2014) Double-stranded RNA uptake through
topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance
in Diaphorina citri. PLoS ONE 9 (10):e110536. doi:10.1371/journal.pone.0110536
Kim JK, Gabel HW, Kamath RS, Tewari M, Pasquinelli A, Rual J-F, Kennedy S, Dybbs M, Bertin N,
Kaplan JM, Vidal M, Ruvkun G (2005) Functional genomic analysis of RNA interference in C.
elegans. Science 308 (5725):1164-1167. doi:10.1126/science.1109267
Kim K, Lee YS, Carthew RW (2007) Conversion of pre-RISC to holo-RISC by Ago2 during assembly of
RNAi complexes. RNA 13 (1):22-29. doi:10.1261/rna.283207
Kimber MJ, McKinney S, McMaster S, Day TA, Fleming CC, Maule AG (2007) flp gene disruption in a
parasitic nematode reveals motor dysfunction and unusual neuronal sensitivity to RNA
interference. The FASEB Journal 21 (4):1233-1243. doi:10.1096/fj.06-7343com
Klink VP, Kim K-H, Martins V, MacDonald MH, Beard HS, Alkharouf NW, Lee S-K, Park S-C,
Matthews BF (2009) A correlation between host-mediated expression of parasite genes as
tandem inverted repeats and abrogation of development of female Heterodera glycines cyst
formation during infection of Glycine max. Planta 230 (1):53 - 71
Knight SW, Bass BL (2002) The role of rna editing by ADARs in RNAi. Molecular Cell 10 (4):809-817.
doi:10.1016/S1097-2765(02)00649-4
Kurihara Y, Takashi Y, Watanabe Y (2006) The interaction between DCL1 and HYL1 is important for
efficient and precise processing of pri-miRNA in plant microRNA biogenesis. RNA 12 (2):206-
212. doi:10.1261/rna.2146906
Kyndt T, Li H, Vanholme B, Gheysen G (2013) Transcriptional silencing of RNAi constructs against
nematode genes in Arabidopsis. Nematology 15:519-528
Lambert K, Bekal S (2002) Introduction to plant-parasitic nematodes. The Plant Health Instructor.
University of Illinois, Department of Crop Sciences, Urbana, IL. doi: 10.1094/PHI-I-2002-1218-
01
Lambshead PJD, Boucher G (2003) Marine nematode deep-sea biodiversity – hyperdiverse or hype?
Journal of Biogeography 30 (4):475-485. doi:10.1046/j.1365-2699.2003.00843.x
Lecellier CH, Dunoyer P, Arar K, Lehmann-Che J, Eyquem S, Himber C, Saïb A, Voinnet O (2005) A
cellular microRNA mediates antiviral defense in human cells. Science (New York) 308
(5721):557-560
Lee NS, Dohjima T, Bauer G, Li H, Li M-J, Ehsani A, Salvaterra P, Rossi J (2002) Expression of small
interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nature Biotechnology
20 (5):500-505
Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs
with antisense complementarity to lin-14. Cell 75 (5):843-854. doi:10.1016/0092-8674(93)
90529-Y
Lee RC, HAMMELL CM, AMBROS V (2006) Interacting endogenous and exogenous RNAi pathways
in Caenorhabditis elegans. RNA 12 (4):589-597. doi:10.1261/rna.2231506
Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S, Kim VN (2003) The
nuclear RNase III Drosha initiates microRNA processing. Nature 425 (6956):415-419.
doi:http://www.nature.com/nature/journal/v425/n6956/suppinfo/nature01957_S1.html
Lee Y, Kim M, Han J, Yeom K-H, Lee S, Baek SH, Kim VN (2004) MicroRNA genes are transcribed by
RNA polymerase II. The EMBO Journal 23 (20):4051-4060. doi:10.1038/sj.emboj.7600385
Li J, Todd TC, Oakley TR, Lee J, Trick HN (2010) Host-derived suppression of nematode reproductive
and fitness genes decreases fecundity of Heterodera glycines Ichinohe. Planta 232 (3):775 - 785
Li X, Wang X, Zhang S, Liu D, Duan Y, Dong W (2012) Identification of soybean MicroRNAs involved
in soybean cyst nematode infection by deep sequencing. PLoS ONE 7 (6):e39650. doi:10.1371/
journal.pone.0039650
Li Z, Pandit S, Deutscher MP (1998) 3′ Exoribonucleolytic trimming is a common feature of the
maturation of small, stable RNAs in Escherichia coli. Proceedings of the National Academy of
Sciences 95 (6):2856-2861
Liang D, White RG, Waterhouse PM (2012) Gene silencing in arabidopsis spreads from the root to the
shoot, through a gating barrier, by template-dependent, nonvascular, cell-to-cell movement.
Plant Physiology 159 (3):984-1000. doi:10.1104/pp.112.197129
Lightfoot HL, Hall J (2012) Target mRNA inhibition by oligonucleotide drugs in man. Nucleic Acids
Research 40 (21):10585-10595. doi:10.1093/nar/gks861
141
Lilley CJ, Davies LJ, Urwin PE (2012) RNA interference in plant parasitic nematodes: a summary of the
current status. Parasitology 139 (Special Issue 05):630-640. doi:10.1017/S0031182011002071
Lilley CJ, Goodchild SA, Atkinson HJ, Urwin PE (2005) Cloning and characterization of a Heterodera
glycines aminopeptidase cDNA. Int J Parasitol 35:1577
Lin B, Zhuo K, Wu P, Cui R, Zhang L-H, Liao J (2012) A novel effector protein, MJ-NULG1a, targeted
to giant cell nuclei plays a role in Meloidogyne javanica parasitism. Molecular Plant-Microbe
Interactions 26 (1):55-66. doi:10.1094/MPMI-05-12-0114-FI
Lippman Z, Martienssen R (2004) The role of RNA interference in heterochromatic silencing. Nature 431
(7006):364-370
Liu H, Cottrell TR, Pierini LM, Goldman WE, Doering TL (2002) RNA interference in the pathogenic
fungus Cryptococcus neoformans. Genetics 160 (2):463-470
Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R (2005) MicroRNA-dependent localization of targeted
mRNAs to mammalian P-bodies. Nature Cell Biology 7 (7):719-723. doi:10.1038/ncb1274
Liu Q, Rand TA, Kalidas S, Du F, Kim H-E, Smith DP, Wang X (2003) R2D2, a bridge between the
initiation and effector steps of the Drosophila RNAi pathway. Science 301 (5641):1921-1925.
doi:10.1126/ science.1088710
Liu QL, Williamson VM (2006) Host-specific pathogenicity and genome differences between inbred
strains of Meloidogyne hapla. Journal of Nematology 38 (1):158-164
Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time
Quantitative PCR and the 2−ΔΔCT Method. Methods 25 (4):402-408. doi:http://dx.doi.org/
10.1006/meth.2001.1262
Lobbes D, Rallapalli G, Schmidt DD, Martin C, Clarke J (2006) SERRATE: a new player on the plant
microRNA scene. EMBO reports 7 (10):1052-1058. doi:10.1038/sj.embor.7400806
Lu R, Maduro M, Li F, Li HW, Broitman-Maduro G, Li WX, Ding SW (2005) Animal virus replication
and RNAi-mediated antiviral silencing in Caenorhabditis elegans. Nature 436 (7053):1040-1043
Lu R, Yigit E, Li W-X, Ding S-W (2009) An RIG-I-Like RNA helicase mediates antiviral rnai
downstream of viral sirna biogenesis in Caenorhabditis elegans. PLoS Pathogens 5
(2):e1000286. doi:10.1371/journal. ppat.1000286
Lu S, Sun Y-H, Amerson H, Chiang VL (2007) MicroRNAs in loblolly pine (Pinus taeda L.) and their
association with fusiform rust gall development. The Plant Journal 51 (6):1077-1098.
doi:10.1111/j. 1365-313X.2007.03208.x
Lund E, Güttinger S, Calado A, Dahlberg JE, Kutay U (2004) Nuclear export of microRNA precursors.
Science 303 (5654):95-98. doi:10.1126/science.1090599
Ma J-B, Ye K, Patel DJ (2004) Structural basis for overhang-specific small interfering RNA recognition
by the PAZ domain. Nature 429 (6989):318-322. doi:http://www.nature.com/nature/journal/
v429/n6989/suppinfo/nature02519_S1.html
MacRae IJ, Zhou K, Li F, Repic A, Brooks AN, Cande WZ, Adams PD, Doudna JA (2006) Structural
basis for double-stranded RNA processing by dicer. Science 311 (5758):195-198.
doi:10.1126/science.1121638
Maeda I, Kohara Y, Yamamoto M, Sugimoto A (2001) Large-scale analysis of gene function in
Caenorhabditis elegans by high-throughput RNAi. Current Biology 11 (3):171-176.
doi:10.1016/S0960-9822(01) 00052-5
Maiti M, Lee H-C, Liu Y (2007) QIP, a putative exonuclease, interacts with the Neurospora Argonaute
protein and facilitates conversion of duplex siRNA into single strands. Genes & Development 21
(5):590-600. doi:10.1101/gad.1497607
Malhotra P, Dasaradhi PVN, Kumar A, Mohmmed A, Agrawal N, Bhatnagar RK, Chauhan VS (2002)
Double-stranded RNA-mediated gene silencing of cysteine proteases (falcipain-1 and -2) of
Plasmodium falciparum. Molecular Microbiology 45 (5):1245-1254. doi:10.1046/j.1365-
2958.2002.03105.x
Manzanilla-Lopez R, Evans K, Bridge J (2004) Plant diseases caused by nematodes. In: Cheng ZX, Chen
SY, Dickson DW (eds) Nematology Advances and Perspectives vol 2: Nematode Management
and Utilization. CABI Publishing, Wallingford, UK, pp 637-716
Mao Y-B, Cai W-J, Wang J-W, Hong G-J, Tao X-Y, Wang L-J, Huang Y-P, Chen X-Y (2007) Silencing
a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance
of gossypol. Nature Biotechnology 25 (11):1307-1313. doi:http://www.nature.com/nbt/journal/
v25/n11/suppinfo/nbt1352_S1.html
Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer
RC, Gonzales NR, Gwadz M, He S, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Liebert CA,
Liu C, Lu F, Lu S, Marchler GH, Mullokandov M, Song JS, Tasneem A, Thanki N, Yamashita
RA, Zhang D, Zhang N, Bryant SH (2009) CDD: specific functional annotation with the
142
Conserved Domain Database. Nucleic Acids Research 37 (suppl 1):D205-D210.
doi:10.1093/nar/gkn845
Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY,
Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CrJ, Lu F,
Marchler GH, Mullokandov M, Omelchenko MV, Robertson CL, Song JS, Thanki N, Yamashita
RA, Zhang D, Zhang N, Zheng C, Bryant SH (2011) CDD: a Conserved Domain Database for
the functional annotation of proteins. Nucleic Acids Research 39 (suppl 1):D225-D229.
doi:10.1093/nar/gkq1189
Martinez J, Patkaniowska A, Urlaub H, Lührmann R, Tuschl T (2002) Single-stranded antisense siRNAs
guide target RNA cleavage in RNAi. Cell 110 (5):563-574. doi:10.1016/S0092-8674(02)00908-
X
Matsunaga Y, Kawano K, Iwasaki T, Kawano T (2012) RNA Interference-mediated growth control of the
southern root-knot nematode Meloidogyne incognita. Bioscience, Biotechnology, and
Biochemistry 76 (2):378-380. doi:10.1271/bbb.110661
Matthews B, Beard H, Brewer E, Kabir S, MacDonald M, Youssef R (2014) Arabidopsis genes, AtNPR1,
AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines)
when overexpressed in transgenic soybean roots. BMC Plant Biology 14 (1):96
McEwan DL, Weisman AS, Hunter CP (2012) Uptake of extracellular double-stranded RNA by SID-2.
Molecular Cell 47 (5):746-754. doi:http://dx.doi.org/10.1016/j.molcel.2012.07.014
Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, Chen S, Hannon GJ, Qi Y
(2008) Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5′
terminal nucleotide. Cell 133 (1):116-127. doi:10.1016/j.cell.2008.02.034
Moens M, Perry RN, Starr JL (2009) Meloidogyne species – A diverse group of novel and important plant
parasites. In: Perry RN, Moeans M, Starr JL (eds) Root-knot nematodes. CABI International,
Cambridge, MA (USA), pp 1-17
Montgomery MK, Xu SQ, Fire A (1998) RNA as a target of double-stranded RNA-mediated genetic
interference in Caenorhabditis elegans. Proceedings of the National Academy of Sciences 95
(26):15502-15507. doi:10.1073/pnas.95.26.15502
Moussian B, Schoof H, Haecker A, Jürgens G, Laux T (1998) Role of the ZWILLE gene in the regulation
of central shoot meristem cell fate during Arabidopsis embryogenesis. The EMBO Journal 17
(6):1799-1809. doi:10.1093/emboj/17.6.1799
Muhlrad D, Decker CJ, Parker R (1994) Deadenylation of the unstable mRNA encoded by the yeast
MFA2 gene leads to decapping followed by 5'-->3' digestion of the transcript. Genes &
Development 8 (7):855-866. doi:10.1101/gad.8.7.855
Naito Y, Yamada T, Matsumiya T, Ui-Tei K, Saigo K, Morishita S (2005) dsCheck: highly sensitive off-
target search software for double-stranded RNA-mediated RNA interference. Nucleic Acids
Research 33 (Web Server issue):W589-W591. doi:10.1093/nar/gki419
Napoli C, Lemieux C, Jorgensen R (1990) Introduction of a chimeric chalcone synthase gene into petunia
results in reversible co-suppression of homologous genes in trans. The Plant Cell 2 (4):279-289
Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones JDG (2006) A plant
miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312
(5772):436-439. doi:10.1126/science.1126088
Neher DA (2000) Nematode communities as ecological indicators of agroecosystem health. In:
Agroecosystem Sustainability. Advances in Agroecology. CRC Press, pp 105-120.
doi:doi:10.1201/9781420041514 .ch710.1201/9781420041514.ch7
Nelissen K, Smeets K, Mulder M, Hendriks JJA, Ameloot M (2010) Selection of reference genes for gene
expression studies in rat oligodendrocytes using quantitative real time PCR. Journal of
Neuroscience Methods 187 (1):78-83. doi:http://dx.doi.org/10.1016/j.jneumeth.2009.12.018
Newbury S, Woollard A (2004) The 5′–3′ exoribonuclease xrn-1 is essential for ventral epithelial
enclosure during C. elegans embryogenesis. RNA 10 (1):59-65. doi:10.1261/rna.2195504
Ngô H, Tschudi C, Gull K, Ullu E (1998) Double-stranded RNA induces mRNA degradation in
Trypanosoma brucei. Proceedings of the National Academy of Sciences of the United States of
America 95 (25):14687-14692
Niblack T, Arelli P, Noel G, Opperman C, Orf J, Schmitt D, Shannon J, Tylka G (2002) A revised
classification scheme for genetically diverse populations of Heterodera glycines. Journal of
Nematology 34 (4):279 - 288
Niu J, Jian H, Xu J, Chen C, Guo Q, Liu Q, Guo Y (2012) RNAi silencing of the Meloidogyne incognita
Rpn7 gene reduces nematode parasitic success. European Journal of Plant Pathology 134
(1):131-144. doi:10.1007/s10658-012-9971-y
143
Nombela G, Williamson VM, Muñiz M (2003) The root-knot nematode resistance gene Mi-1.2 of tomato
is responsible for resistance against the whitefly Bemisia tabaci. Molecular Plant-Microbe
Interactions 16 (7):645-649. doi:10.1094/MPMI.2003.16.7.645
Nowara D, Gay A, Lacomme C, Shaw J, Ridout C, Douchkov D, Hensel G, Kumlehn J, Schweizer P
(2010) HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria
graminis. The Plant Cell 22 (9):3130-3141. doi:10.1105/tpc.110.077040
Nsengimana J, Bauters L, Haegeman A, Gheysen G (2013) Silencing of Mg-pat-10 and Mg-unc-87 in the
plant parasitic nematode Meloidogyne graminicola using siRNAs. Agriculture 3 (3):567-578
Nykänen A, Haley B, Zamore PD (2001) ATP Requirements and small interfering RNA structure in the
RNA interference pathway. Cell 107 (3):309-321. doi:http://dx.doi.org/10.1016/S0092-
8674(01)00547-5
Okamura K, Ishizuka A, Siomi H, Siomi MC (2004) Distinct roles for Argonaute proteins in small RNA-
directed RNA cleavage pathways. Genes & Development 18 (14):1655-1666. doi:10.1101/gad.
1210204
Olmedo-Monfil V, Duran-Figueroa N, Arteaga-Vazquez M, Demesa-Arevalo E, Autran D, Grimanelli D,
Slotkin RK, Martienssen RA, Vielle-Calzada J-P (2010) Control of female gamete formation by
a small RNA pathway in Arabidopsis. Nature 464 (7288):628-632.
doi:http://www.nature.com/nature/ journal/v464/n7288/suppinfo/nature08828_S1.html
Olsen A, Vantipalli MC, Lithgow GJ (2006) Checkpoint proteins control survival of the postmitotic cells
in Caenorhabditis elegans. Science (New York, NY) 312 (5778):1381-1385. doi:10.1126/
science.1124981
Orion D, Kritzman G (1991) Antimicrobial activity of Meloidogyne javanica gelatinous matrix. Revue
Nematol 14 (4):481-483
Otsuka M, Jing Q, Georgel P, New L, Chen J, Mols J, Kang YJ, Jiang Z, Du X, Cook R, Das SC, Pattnaik
AK, Beutler B, Han J (2007) Hypersusceptibility to vesicular stomatitis virus infection in dicer1-
deficient mice is due to impaired miR24 and miR93 expression. Immunity 27 (1):123-134.
doi:http://dx.doi.org/ 10.1016/j.immuni.2007.05.014
Pak J, Fire A (2007) Distinct populations of primary and secondary effectors during RNAi in C. elegans.
Science 315 (5809):241-244. doi:10.1126/science.1132839
Palmer ED (1955) Course of egg output over a 15 year period in a case of experimentally induced
Necatoriasis Americanus, in the absence of hyperinfection. The American Journal of Tropical
Medicine and Hygiene 4 (4):756-757
Papolu PK, Gantasala NP, Kamaraju D, Banakar P, Sreevathsa R, Rao U (2013) Utility of host delivered
RNAi of two FMRF amide like peptides, flp-14 and flp-18, for the management of root knot
nematode, Meloidogyne incognita. PLoS ONE 8 (11):e80603. doi:10.1371/journal.pone.0080603
Park J, Lee K, Lee S-J, Oh W-S, Jeong P-Y (2008) The efficiency of RNA interference in
Bursaphelenchus xylophilus. Molecules and Cells 26:81
Parker JS, Barford D (2006) Argonaute: a scaffold for the function of short regulatory RNAs. Trends in
Biochemical Sciences 31 (11):622-630. doi:http://dx.doi.org/10.1016/j.tibs.2006.09.010
Parker R, Sheth U (2007) P Bodies and the control of mRNA translation and degradation. Molecular Cell
25 (5):635-646. doi:http://dx.doi.org/10.1016/j.molcel.2007.02.011
Parry DH, Xu J, Ruvkun G (2007) A whole-genome RNAi screen for C. elegans miRNA pathway genes.
Current biology : CB 17 (23):2013-2022. doi:10.1016/j.cub.2007.10.058
Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Maller B, Hayward DC, Ball EE,
Degnan B, Muller P, Spring J, Srinivasan A, Fishman M, Finnerty J, Corbo J, Levine M, Leahy
P, Davidson E, Ruvkun G (2000) Conservation of the sequence and temporal expression of let-7
heterochronic regulatory RNA. Nature 408 (6808):86-89
Patel DJ, Ma J-B, Yuan Y-R, Ye K, Pei Y, Kuryavyi V, Malinina L, Meister G, Tuschl T (2006)
Structural biology of RNA silencing and its functional implications. Cold Spring Harbor
Symposia on Quantitative Biology 71:81-93. doi:10.1101/sqb.2006.71.053
Patel N, Hamamouch N, Li C, Hussey R, Mitchum M, Baum T, Wang X, Davis EL (2008) Similarity and
functional analyses of expressed parasitism genes in Heterodera schachtii and Heterodera
glycines. Journal of Nematology 40 (4):299-310
Pavelec DM, Lachowiec J, Duchaine TF, Smith HE, Kennedy S (2009) Requirement for the ERI/DICER
complex in endogenous RNA interference and sperm development in Caenorhabditis elegans.
Genetics 183 (4):1283-1295. doi:10.1534/genetics.109.108134
Pérez MP, Navas-Cortés JA, Pascual-Villalobos MJ, Castillo P (2003) Nematicidal activity of essential
oils and organic amendments from Asteraceae against root-knot nematodes. Plant Pathology 52
(3):395-401. doi:10.1046/j.1365-3059.2003.00859.x
144
Perry RN (1994) Studies on nematode sensory perception as a basis for novel control strategies. Paper
presented at the Sixth International Congress of Phytopathology,
Perry RN, Moens M (2011) Introduction to plant-parasitic nematodes; modes of parasitism. In: Jones JT,
Gheysen L, Fenoll C (eds) Genomics and Molecular Genetics of Plant–Nematode Interactions.
Springer, Heidelberg, pp 3-20
Pfeffer S, Zavolan M, Grässer FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C,
Tuschl T (2004) Identification of virus-encoded microRNAs. Science 304 (5671):734-736.
doi:10.1126/science.1096781
Ploeg AT (1999) Greenhouse studies on the effect of marigolds (Tagetes spp.) on four meloidogyne
species. Journal of Nematology 31 (1):62-69
Ploeg AT (2002) Effects of selected marigold varieties on root-knot nematodes and tomato and melon
yields. Plant Disease 86 (5):505-508. doi:10.1094/PDIS.2002.86.5.505
Plowman GD, Sudarsanam S, Bingham J, Whyte D, Hunter T (1999) The protein kinases of
Caenorhabditis elegans: A model for signal transduction in multicellular organisms. Proceedings
of the National Academy of Sciences 96 (24):13603-13610. doi:10.1073/pnas.96.24.13603
Pridgeon JW, Zhao L, Becnel JJ, Strickman DA, Clark GG, Linthicum KJ (2008) Topically applied
double-stranded RNA kills female adults of Aedes aegypti. Journal of Medical Entomology 45
(3). doi:10.1603/0022-2585(2008)45[414:TAADRK]2.0.CO;2
Promega subcloning notebook (2004) Promega corporation. pp 46-48. doi https://au.promega.com/
resources/product-guides-and-selectors/subcloning-notebook
Promega Technical Manual No. 042. (2009) pGEM-T and pGEM-T easy vector systems. doi:
https://www.promega.com/~/media/files/resources/protocols/technical%20manuals/0/pgem-
t%20and %20pgem-t%20easy%20vector%20systems%20protocol.pdf
Pulak R, Anderson P (1993) mRNA surveillance by the Caenorhabditis elegans smg genes. Genes &
Development 7 (10):1885-1897. doi:10.1101/gad.7.10.1885
Rehwinkel J, Tan CP, Goubau D, Schulz O, Pichlmair A, Bier K, Robb N, Vreede F, Barclay W, Fodor
E, Reis e Sousa C (2010) RIG-I detects viral genomic RNA during negative-strand RNA virus
infection. Cell 140 (3):397-408. doi:http://dx.doi.org/10.1016/j.cell.2010.01.020
Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Horvitz HR, Ruvkun G
(2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans.
Nature 403 (6772):901-906
Rich JR, Brito JA, Kaur R, Ferrell JA (2009) Weed species as hosts of Meloidogyne: a review.
Nematropica 39 (2):157-185
Robinson AF (1995) Optimal release rates for attracting Meloidogyne incognita, Rotylenchulus
reniformis, and other nematodes to carbon dioxide in sand. Journal of Nematology 27 (1):42-50
Rocheleau CE, Cullison K, Huang K, Bernstein Y, Spilker AC, Sundaram MV (2008) The
Caenorhabditis elegans ekl (enhancer of ksr-1 lethality) genes include putative components of a
germline small RNA pathway. Genetics 178 (3):1431-1443. doi:10.1534/genetics.107.084608
Rodger S, Bengough AG, Griffiths BS, Stubbs V, Young IM (2003) Does the presence of detached root
border cells of Zea mays alter the activity of the pathogenic nematode Meloidogyne incognita?
Phytopathology 93 (9):1111-1114. doi:10.1094/PHYTO.2003.93.9.1111
Rossi M, Goggin FL, Milligan SB, Kaloshian I, Ullman DE, Williamson VM (1998) The nematode
resistance gene Mi of tomato confers resistance against the potato aphid. Proceedings of the
National Academy of Sciences of the United States of America 95 (17):9750-9754
Rosso MN, Dubrana MP, Cimbolini N, Jaubert S, Abad P (2005) Application of RNA interference to
root-knot nematode genes encoding esophageal gland proteins. Molecular Plant-Microbe
Interactions 18 (7):615-620. doi:10.1094/MPMI-18-0615
Rosso MN, Jones JT, Abad P (2009) RNAi and functional genomics in plant parasitic nematodes. Annual
Review of Phytopathology 47 (1):207-232. doi:doi:10.1146/annurev.phyto.112408.132605
Ruiz MT, Voinnet O, Baulcombe DC (1998) Initiation and maintenance of virus-induced gene silencing.
The Plant Cell 10 (6):937-946
Ruvkun G, Ambros V, Coulson A, Waterston R, Sulston J, Horvitz HR (1989) Molecular genetics of the
Caenorhabditis elegans heterochronic gene lin-14. Genetics 121 (3):501-516
Saito K, Ishizuka A, Siomi H, Siomi MC (2005) Processing of pre-microRNAs by the Dicer-1–
loquacious complex in drosophila cells. PLoS Biology 3 (7):e235.
doi:10.1371/journal.pbio.0030235
Saleh M-C, van Rij RP, Hekele A, Gillis A, Foley E, O'Farrell PH, Andino R (2006) The endocytic
pathway mediates cell entry of dsRNA to induce RNAi silencing. Nature Cell Biology 8 (8):793-
802. doi:http://www.nature.com/ncb/journal/v8/n8/suppinfo/ncb1439_S1.html
145
Samarasinghe B, Knox DP, Britton C (2011) Factors affecting susceptibility to RNA interference in
Haemonchus contortus and in vivo silencing of an H11 aminopeptidase gene. International
Journal for Parasitology 41 (1):51-59. doi:http://dx.doi.org/10.1016/j.ijpara.2010.07.005
Sambrook J, Russell DW (2001) Molecular cloning. A laboratory manual. 3rd edn. Cold Spring Harbor
laboratory, Cold Spring Harbor, New York
San Miguel K, Scott JG (2015) The next generation of insecticides: dsRNA is stable as a foliar-applied
insecticide. Pest Management Science doi:10.1002/ps.4056
Sasser JN (1980) Root-knot nematodes: a global menace to crop production. Plant Disease 64:36-41
Sawh AN, Duchaine TF (2013) A truncated form of dicer tilts the balance of RNA interference pathways.
Cell Reports 4 (3):454-463. doi:http://dx.doi.org/10.1016/j.celrep.2013.07.013
Schott DH, Cureton DK, Whelan SP, Hunter CP (2005) An antiviral role for the RNA interference
machinery in Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the
United States of America 102 (51):18420-18424. doi:10.1073/pnas.0507123102
Schwarz DS, Hutvágner G, Du T, Xu Z, Aronin N, Zamore PD (2003) Asymmetry in the assembly of the
RNAi enzyme complex. Cell 115 (2):199-208. doi:http://dx.doi.org/10.1016/S00928674(03)
00759-1
Schwarz DS, Tomari Y, Zamore PD (2004) The RNA-induced silencing complex is a Mg2+-dependent
endonuclease. Current Biology 14 (9):787-791. doi:http://dx.doi.org/10.1016/j.cub.2004.03.008
Shannon JG, Arelli PR, Young LD (2004) Breeding for resistance and tolerance. In: Schmitt DP, Wrather
JA, Riggs RD (eds) Biology and management of soybean cyst nematode. 2nd
edn. Schmitt &
Associates of Marceline, Marceline, MO, pp 155-180
Shao Y, Chan CY, Maliyekkel A, Lawrence CE, Roninson IB, Ding Y (2007) Effect of target secondary
structure on RNAi efficiency. RNA 13 (10):1631-1640. doi:10.1261/rna.546207
Shelton CA, Carter JC, Ellis GC, Bowerman B (1999) The nonmuscle myosin regulatory light chain gene
mlc-4 Is required for cytokinesis, anterior-posterior polarity, and body morphology during
Caenorhabditis elegans embryogenesis. The Journal of Cell Biology 146 (2):439-451.
doi:10.1083/jcb.146.2.439
Sheps JA, Ralph S, Zhao Z, Baillie DL, Ling V (2004) The ABC transporter gene family of
Caenorhabditis elegans has implications for the evolutionary dynamics of multidrug resistance
in eukaryotes. Genome Biology 5 (3):R15-R15
Shi Z, Montgomery TA, Qi Y, Ruvkun G (2013) High-throughput sequencing reveals extraordinary
fluidity of miRNA, piRNA, and siRNA pathways in nematodes. Genome Research 23 (3):497-
508. doi:10.1101/gr.149112.112
Shih JD, Hunter CP (2011) SID-1 is a dsRNA-selective dsRNA-gated channel. RNA 17 (6):1057-1065.
doi:10.1261/rna.2596511
Shingles J, Lilley CJ, Atkinson HJ, Urwin PE (2007) Meloidogyne incognita: molecular and biochemical
characterisation of a cathepsin L cysteine proteinase and the effect on parasitism following
RNAi. Experimental Parasitology 115 (2):114-120. doi:http://dx.doi.org/10.1016/j.exppara.
2006.07.008
Sijen T, Fleenor J, Simmer F, Thijssen KL, Parrish S, Timmons L, Plasterk RHA, Fire A (2001) On the
role of RNA amplification in dsRNA-triggered gene silencing. Cell 107 (4):465-476.
doi:http://dx.doi.org/10.1016/S0092-8674(01)00576-1
Sijen T, Steiner FA, Thijssen KL, Plasterk RHA (2007) Secondary siRNAs result from unprimed RNA
synthesis and form a distinct class. Science 315:244
Sijmons PC, Atkinson HJ, Wyss U (1994) Parasitic strategies of root nematodes and associated host cell
responses. Annual Review of Phytopathology 32 (1):235-259. doi:doi:10.1146/annurev.
py.32.090194.001315
Sijmons PC, Grundler FMW, von Mende N, Burrows PR, Wyss U (1991) Arabidopsis thaliana as a new
model host for plant-parasitic nematodes. The Plant Journal 1 (2):245-254. doi:10.1111/j.1365-
313X.1991 .00245.x
Sikora RA, Fernandez A (2005) Nematode parasites of vegatables. In: Luc M, Sikora RA, Bridge J (eds)
Plant parasitic nematodes in subtropical and tropical agriculture. 2nd
edn. CABI, Wallingford,
UK., pp 319-392
Silva J, Chang K, Hannon GJ, Rivas FV (2004) RNA-interference-based functional genomics in
mammalian cells: reverse genetics coming of age. Oncogene 23 (51):8401-8409
Simmer F, Tijsterman M, Parrish S, Koushika SP, Nonet ML, Fire A, Ahringer J, Plasterk RHA (2002)
Loss of the putative RNA-directed RNA polymerase rrf-3 makes C. elegans hypersensitive to
RNAi. Current Biology 12 (15):1317-1319. doi:http://dx.doi.org/10.1016/S0960-
9822(02)01041-2
146
Sindhu AS, Maier TR, Mitchum MG, Hussey RS, Davis EL, Baum TJ (2009) Effective and specific in
planta RNAi in cyst nematodes: expression interference of four parasitism genes reduces
parasitic success. Journal of Experimental Botany 60 (1):315-324. doi:10.1093/jxb/ern289
Smant G, Jones J (2011) Suppression of plant defences by nematodes. In: Jones J, Gheysen G, Fenoll C
(eds) Genomics and molecular genetics of plant-nematode interactions. Springer Netherlands, pp
273-286. doi:10.1007/978-94-007-0434-3_13
Smardon A, Spoerke JM, Stacey SC, Klein ME, Mackin N, Maine EM (2000) EGO-1 is related to RNA-
directed RNA polymerase and functions in germ-line development and RNA interference in C.
elegans. Current biology : CB 10 (4):169-178
Solovyev V, Kosarev P, Seledsov I, Vorobyev D (2006) Automatic annotation of eukaryotic genes,
pseudogenes and promoters. Genome Biology 7 (Suppl 1):S10
Somma MP, Fasulo B, Cenci G, Cundari E, Gatti M (2002) Molecular dissection of cytokinesis by RNA
interference in drosophila cultured cells. Molecular Biology of the Cell 13 (7):2448-2460.
doi:10.1091/mbc.01-12-0589
Song J-J, Smith SK, Hannon GJ, Joshua-Tor L (2004) Crystal structure of argonaute and its implications
for RISC slicer activity. Science 305 (5689):1434-1437. doi:10.1126/science.1102514
Starr JL, Bridge J, Cook R (2002) Resistance to plant-parasitic nematodes: history, current use and future
potential. In: Plant resistance to parasitic nematodes. CAB International, Wallingford, pp 1-22
Steeves RM, Todd TC, Essig JS, Trick HN (2006) Transgenic soybeans expressing siRNAs specific to a
major sperm protein gene suppress Heterodera glycines reproduction. Functional Plant Biology
33 (11):991-999. doi:http://dx.doi.org/10.1071/FP06130
Steiner FA, Okihara KL, Hoogstrate SW, Sijen T, Ketting RF (2009) RDE-1 slicer activity is required
only for passenger-strand cleavage during RNAi in Caenorhabditis elegans. Nature Structural &
Molecular Biology 16 (2):207-211. doi:http://www.nature.com/nsmb/journal/v16/n2/
suppinfo/nsmb. 1541_S1.html
Stevenson AL, Norbury CJ (2006) The Cid1 family of non-canonical poly(A) polymerases. Yeast 23
(13):991-1000. doi:10.1002/yea.1408
Sukno SA, McCuiston J, Wong M-Y, Wang X, Thon MR, Hussey R, Baum T, Davis E (2007)
Quantitative detection of double-stranded RNA-mediated gene silencing of parasitism genes in
Heterodera glycines. Journal of Nematology 39 (2):145-152
Sundaram P, Echalier B, Han W, Hull D, Timmons L (2006) ATP-binding cassette transporters are
required for efficient RNA interference in Caenorhabditis elegans. Molecular Biology of the
Cell 17 (8):3678-3688. doi:10.1091/mbc.E06-03-0192
Tabara H, Grishok A, Mello CC (1998) RNAi in C. elegans: Soaking in the genome sequence. Science
282 (5388):430-431. doi:10.1126/science.282.5388.430
Tabara H, Sarkissian M, Kelly WG, Fleenor J, Grishok A, Timmons L, Fire A, Mello CC (1999) The rde-
1 Gene, RNA interference, and transposon silencing in C. elegans. Cell 99 (2):123-132.
doi:http://dx.doi.org/10.1016/S0092-8674(00)81644-X
Tabara H, Yigit E, Siomi H, Mello CC (2002) The dsRNA binding protein RDE-4 interacts with RDE-1,
DCR-1, and a DExH-box helicase to direct RNAi in C. elegans. Cell 109 (7):861-871.
doi:http://dx.doi.org/ 10.1016/S0092-8674(02)00793-6
Tai TH, Dahlbeck D, Clark ET, Gajiwala P, Pasion R, Whalen MC, Stall RE, Staskawicz BJ (1999)
Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.
Proceedings of the National Academy of Sciences 96 (24):14153-14158.
doi:10.1073/pnas.96.24.14153
Takeda A, Iwasaki S, Watanabe T, Utsumi M, Watanabe Y (2008) The mechanism selecting the guide
strand from small RNA duplexes is different among argonaute proteins. Plant and Cell
Physiology 49 (4):493-500. doi:10.1093/pcp/pcn043
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics
analysis version 6.0. Molecular Biology and Evolution 30 (12):2725-2729.
doi:10.1093/molbev/mst197
Tan J-ACH, Jones MGK, Fosu-Nyarko J (2013) Gene silencing in root lesion nematodes (Pratylenchus
spp.) significantly reduces reproduction in a plant host. Experimental Parasitology 133 (2):166-
178. doi:http://dx.doi.org/10.1016/j.exppara.2012.11.011
Tang G (2005) siRNA and miRNA: an insight into RISCs. Trends in Biochemical Sciences 30 (2):106-
114. doi:http://dx.doi.org/10.1016/j.tibs.2004.12.007
Taylor AL, Sasser JN, Pathology NCSUDoP, Development USAfI, Project IM (1978) Biology,
Identification and Control of Root-knot Nematodes (Meloidogyne Species). Department of Plant
Pathology, North Carolina State University and the United States Agency for International
Development,
147
Tenllado F, Llave C, Ramón J (2004) RNA interference as a new biotechnological tool for the control of
virus diseases in plants. Virus Research 102 (1):85-96.
doi:http://dx.doi.org/10.1016/j.virusres.2004.01.019
Thakur N, Upadhyay SK, Verma PC, Chandrashekar K, Tuli R, Singh PK (2014) Enhanced whitefly
resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.
PLoS ONE 9 (3):e87235. doi:10.1371/journal.pone.0087235
Thi EP, Mire CE, Lee ACH, Geisbert JB, Zhou JZ, Agans KN, Snead NM, Deer DJ, Barnard TR, Fenton
KA, MacLachlan I, Geisbert TW (2015) Lipid nanoparticle siRNA treatment of Ebola-virus-
Makona-infected nonhuman primates. Nature 521 (7552):362-365. doi:10.1038/nature14442
Tijsterman M, Ketting RF, Okihara KL, Sijen T, Plasterk RHA (2002) RNA helicase MUT-14-dependent
gene silencing triggered in C. elegans by short antisense RNAs. Science 295 (5555):694-697.
doi:10.1126/science.1067534
Tijsterman M, May RC, Simmer F, Okihara KL, Plasterk RHA (2004) Genes required for systemic RNA
interference in Caenorhabditis elegans. Current Biology 14 (2):111-116. doi:http://dx.doi.org
/10.1016/j.cub.2003.12.029
Timmons L, Court DL, Fire A (2001) Ingestion of bacterially expressed dsRNAs can produce specific
and potent genetic interference in Caenorhabditis elegans. Gene 263 (1–2):103-112.
doi:http://dx.doi.org/ 10.1016/S0378-1119(00)00579-5
Tinoco MLP, Dias BBA, Dall'Astta RC, Pamphile JA, Aragão FJL (2010) In vivo trans-specific gene
silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biology 8:27-
27. doi:10.1186/1741-7007-8-27
Tischler J, Lehner B, Chen N, Fraser AG (2006) Combinatorial RNA interference in Caenorhabditis
elegans reveals that redundancy between gene duplicates can be maintained for more than 80
million years of evolution. Genome Biology 7 (8):R69-R69. doi:10.1186/gb-2006-7-8-r69
Tomoyasu Y, Miller SC, Tomita S, Schoppmeier M, Grossmann D, Bucher G (2008) Exploring systemic
RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium. Genome
Biology 9 (1):R10-R10. doi:10.1186/gb-2008-9-1-r10
Tonkin LA, Saccomanno L, Morse DP, Brodigan T, Krause M, Bass BL (2002) RNA editing by ADARs
is important for normal behavior in Caenorhabditis elegans. The EMBO Journal 21 (22):6025-
6035. doi:10.1093/emboj/cdf607
Tops BBJ, Plasterk RHA, Ketting RF (2006) The Caenorhabditis elegans argonautes ALG-1 and ALG-2:
almost identical yet different. Cold Spring Harbor Symposia on Quantitative Biology 71:189-
194. doi:10.1101/sqb.2006.71.035
Tops BBJ, Tabara H, Sijen T, Simmer F, Mello CC, Plasterk RHA, Ketting RF (2005) RDE-2 interacts
with MUT-7 to mediate RNA interference in Caenorhabditis elegans. Nucleic Acids Research
33 (1):347-355. doi:10.1093/nar/gki183
Tortora A, Grimaldi MR, Ruggiero A, Filippini L, Apone F, Colucci MG (2011) Inactivated
microorganisms containing double-strand RNA molecules (dsRNA), their use as pesticides and
methods for their preparation. Google Patents,
Trudgill DL, Blok VC (2001) Apomictic, polyphagous root-knot nematodes: exceptionally successful and
damaging biotrophic root pathogens. Annual Review of Phytopathology 39 (1):53-77.
doi:doi:10.1146/annurev.phyto.39.1.53
Tucker MR, Hinze A, Tucker EJ, Takada S, Jürgens G, Laux T (2008) Vascular signalling mediated by
ZWILLE potentiates WUSCHEL function during shoot meristem stem cell development in the
Arabidopsis embryo. Development 135 (17):2839-2843. doi:10.1242/dev.023648
Tzortzakakis E, Blok V, Phillips M, Trudgill D (1999) Variation in root-knot nematode (Meloidogyne
spp.) in Crete in relation to control with resistant tomato and pepper. Nematology 1 (5):499-506.
doi:doi:10.1163/156854199508496
Tzortzakakis EA, Gowen SR (1996) Occurrence of a resistance breaking pathotype of Meloidogyne
javanica on tomatoes in Crete, Greece. Fundamental and Applied Nematology 19 (3):283-288
Urwin PE, Atkinson HJ, Waller DA, McPherson MJ (1995) Engineered oryzacystatin-I expressed in
transgenic hairy roots confers resistance to Globodera pallida. The Plant Journal 8 (1):121-131.
doi:10.1046/j. 1365-313X.1995.08010121.x
Urwin PE, Green J, Atkinson HJ (2003) Expression of a plant cystatin confers partial resistance to
Globodera, full resistance is achieved by pyramiding a cystatin with natural resistance.
Molecular Breeding 12 (3):263-269. doi:10.1023/A:1026352620308
Urwin PE, Lilley CJ, Atkinson HJ (2002) Ingestion of double-stranded RNA by preparasitic juvenile cyst
nematodes leads to RNA interference. Molecular Plant-Microbe Interactions 15:747
148
Urwin PE, Lilley CJ, McPherson MJ, Atkinson HJ (1997a) Resistance to both cyst and root-knot
nematodes conferred by transgenic Arabidopsis expressing a modified plant cystatin. The Plant
Journal 12 (2):455-461. doi:10.1046/j.1365-313X.1997.12020455.x
Urwin PE, Møller SG, Lilley CJ, McPherson MJ, Atkinson HJ (1997b) Continual green-fluorescent
protein monitoring of cauliflower mosaic virus 35S promoter activity in nematode-induced
feeding cells in Arabidopsis thaliana. Molecular Plant-Microbe Interactions 10 (3):394-400.
doi:10.1094/MPMI.1997 .10.3.394
Vaistij FE, Jones L, Baulcombe DC (2002) Spreading of RNA targeting and DNA methylation in RNA
silencing requires transcription of the target gene and a putative RNA-dependent RNA
polymerase. The Plant Cell Online 14 (4):857-867. doi:10.1105/tpc.010480
Vanholme B, Van Thuyne W, Vanhouteghem K, De Meutter JAN, Cannoot B, Gheysen G (2007)
Molecular characterization and functional importance of pectate lyase secreted by the cyst
nematode Heterodera schachtii. Molecular Plant Pathology 8 (3):267-278. doi:10.1111/j.1364-
3703.2007.00392.x
Vastenhouw NL, Brunschwig K, Okihara KL, Muller F, Tijsterman M, Plasterk RHA (2006) Gene
expression: long-term gene silencing by RNAi. Nature 442 (7105):882-882.
doi:http://www.nature.com/nature/ journal/v442/n7105/suppinfo/442882a_S1.html
Vastenhouw NL, Fischer SEJ, Robert VJP, Thijssen KL, Fraser AG, Kamath RS, Ahringer J, Plasterk
RHA (2003) A genome-wide screen identifies 27 genes involved in transposon silencing in C.
elegans. Current Biology 13 (15):1311-1316. doi:http://dx.doi.org/10.1016/S0960-
9822(03)00539-6
Vaucheret H (2006) Post-transcriptional small RNA pathways in plants: mechanisms and regulations.
Genes & Development 20 (7):759-771. doi:10.1101/gad.1410506
Vaucheret H, Vazquez F, Crété P, Bartel DP (2004) The action of ARGONAUTE1 in the miRNA
pathway and its regulation by the miRNA pathway are crucial for plant development. Genes &
Development 18 (10):1187-1197. doi:10.1101/gad.1201404
Veremis JC, Roberts PA (2000) Diversity of heat-stable genotype specific resistance to Meloidogyne in
Maranon races of Lycopersicon peruvianum complex. Euphytica 111 (1):9-16. doi:10.1023/A:
1003776201585
Visser A, Geldhof P, De Maere V, Knox DP, Vercruysse J, Claerebout E (2006) Efficacy and specificity
of RNA interference in larval life-stages of Ostertagia ostertagi. Parasitology 133 (06):777-783.
doi:doi:10.1017/S0031182006001004
Voinnet O (2001) RNA silencing as a plant immune system against viruses. Trends in Genetics 17
(8):449-459. doi:10.1016/S0168-9525(01)02367-8
Volpe TA, Kidner C, Hall IM, Teng G, Grewal SIS, Martienssen RA (2002) Regulation of
heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297
(5588):1833-1837. doi:10.1126/science.1074973
Vos C, Claerhout S, Mkandawire R, Panis B, De Waele D, Elsen A (2012a) Arbuscular mycorrhizal fungi
reduce root-knot nematode penetration through altered root exudation of their host. Plant Soil
354 (1-2):335-345. doi:10.1007/s11104-011-1070-x
Vos C, Geerinckx K, Mkandawire R, Panis B, De Waele D, Elsen A (2012b) Arbuscular mycorrhizal
fungi affect both penetration and further life stage development of root-knot nematodes in
tomato. Mycorrhiza 22 (2):157-163. doi:10.1007/s00572-011-0422-y
Vos P, Simons G, Jesse T, Wijbrandi J, Heinen L, Hogers R, Frijters A, Groenendijk J, Diergaarde P,
Reijans M, Fierens-Onstenk J, Both Md, Peleman J, Liharska T, Hontelez J, ZabeauMarc (1998)
The tomato Mi-1 gene confers resistance to both root-knot nematodes and potato aphids. Nature
Biotechnology 16 (13):1365-1369
Walstrom KM, Schmidt D, Bean CJ, Kelly WG (2005) RNA helicase A is important for germline
transcriptional control, proliferation, and meiosis in C. elegans. Mechanisms of Development
122 (5):707-720. doi:http://dx.doi.org/10.1016/j.mod.2004.12.002
Wang G, Reinke V (2008) A C. elegans Piwi, PRG-1, regulates 21U-RNAs during spermatogenesis.
Current Biology : CB 18 (12):861-867. doi:10.1016/j.cub.2008.05.009
Wang Z, Potter RH, Jones MGK (2003) Differential display analysis of gene expression in the cytoplasm
of giant cells induced in tomato roots by Meloidogyne javanica. Molecular Plant Pathology 4
(5):361-371. doi:10.1046/j.1364-3703.2003.00184.x
Waterhouse PM, Graham MW, Wang M-B (1998) Virus resistance and gene silencing in plants can be
induced by simultaneous expression of sense and antisense RNA. Proceedings of the National
Academy of Sciences 95 (23):13959-13964. doi:10.1073/pnas.95.23.13959
149
Weiberg A, Wang M, Lin F-M, Zhao H, Zhang Z, Kaloshian I, Huang H-D, Jin H (2013) Fungal small
RNAs suppress plant immunity by hijacking host RNA interference pathways. Science 342
(6154):118-123. doi:10.1126/science.1239705
Welker NC, Habig JW, Bass BL (2007) Genes misregulated in C. elegans deficient in Dicer, RDE-4, or
RDE-1 are enriched for innate immunity genes. RNA 13 (7):1090-1102. doi:10.1261/rna.542107
Wheeler D, Darby BJ, Todd TC, Herman MA (2012) Several Grassland soil nematode species are
insensitive to RNA-mediated interference. Journal of Nematology 44 (1):92-101
Wiggers RJ, Starr JL, Price HJ (1990) DNA content and variation in chromosome number in plant cells
affected by Meloidogyne incognita and M. arenaria. Phytopathology 80:1391-1395
Wilkins C, Dishongh R, Moore SC, Whitt MA, Chow M, Machaca K (2005) RNA interference is an
antiviral defence mechanism in Caenorhabditis elegans. Nature 436 (7053):1044-1047
Williamson VM (1999) Plant nematode resistance genes. Current Opinion in Plant Biology 2:327-331
Winston WM, Molodowitch C, Hunter CP (2002) Systemic RNAi in C. elegans requires the putative
transmembrane protein SID-1. Science 295 (5564):2456-2459. doi:10.1126/science.1068836
Winston WM, Sutherlin M, Wright AJ, Feinberg EH, Hunter CP (2007) Caenorhabditis elegans SID-2 is
required for environmental RNA interference. Proceedings of the National Academy of Sciences
of the United States of America 104 (25):10565-10570. doi:10.1073/pnas.0611282104
Wooddell CI, Rozema DB, Hossbach M, John M, Hamilton HL, Chu Q, Hegge JO, Klein JJ, Wakefield
DH, Oropeza CE, Deckert J, Roehl I, Jahn-Hofmann K, Hadwiger P, Vornlocher H-P,
McLachlan A, Lewis DL (2013) Hepatocyte-targeted RNAi therapeutics for the treatment of
chronic hepatitis B virus infection. Molecular Therapy 21 (5):973-985. doi:10.1038/mt.2013.31
Wyss U, Grundler FMW (1992) Seminar: Heterodera schachtii and Arabidopsis thaliana, a model host-
parasite interaction. Nematologica 38 (1):488-493. doi:doi:10.1163/187529292X00450
Xie Z, Johansen LK, Gustafson AM, Kasschau KD, Lellis AD, Zilberman D, Jacobsen SE, Carrington JC
(2004) Genetic and functional diversification of small RNA pathways in plants. PLoS Biol 2
(5):e104. doi:10.1371/journal.pbio.0020104
Xue B, Hamamouch N, Li C, Huang G, Hussey RS, Baum TJ, Davis EL (2013) The 8D05 parasitism
gene of Meloidogyne incognita is required for successful infection of host roots. Phytopathology
103 (2):175-181. doi:10.1094/PHYTO-07-12-0173-R
Yadav BC, Veluthambi K, Subramaniam K (2006) Host-generated double stranded RNA induces RNAi
in plant-parasitic nematodes and protects the host from infection. Molecular and Biochemical
Parasitology 148:219
Yaghoobi J, Yates JL, Williamson VM (2005) Fine mapping of the nematode resistance gene Mi-3 in
Solanum peruvianum and construction of a S. lycopersicum DNA contig spanning the locus. Mol
Genet Genomics 274 (1):60-69. doi:10.1007/s00438-005-1149-2
Yang Y, Jittayasothorn Y, Chronis D, Wang X, Cousins P, Zhong G-Y (2013) Molecular characteristics
and efficacy of 16D10 siRNAs in inhibiting root-knot nematode infection in transgenic grape
hairy roots. PLoS ONE 8 (7):e69463. doi:10.1371/journal.pone.0069463
Yang Z, Ebright YW, Yu B, Chen X (2006) HEN1 recognizes 21–24 nt small RNA duplexes and deposits
a methyl group onto the 2′ OH of the 3′ terminal nucleotide. Nucleic Acids Research 34 (2):667-
675. doi:10.1093/nar/gkj474
Yigit E, Batista PJ, Bei Y, Pang KM, Chen C-CG, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello
CC (2006) Analysis of the C. elegans argonaute family reveals that distinct argonautes act
sequentially during RNAi. Cell 127 (4):747-757. doi:http://dx.doi.org/10.1016/j.cell.2006.09.033
Zekri L, Huntzinger E, Heimstädt S, Izaurralde E (2009) The silencing domain of GW182 interacts with
PABPC1 to promote translational repression and degradation of microRNA targets and is
required for target release. Molecular and Cellular Biology 29 (23):6220-6231.
doi:10.1128/mcb.01081-09
Zhang C, Ruvkun G (2012) New insights into siRNA amplification and RNAi. RNA Biology 9 (8):1045-
1049. doi:10.4161/rna.21246
Zhang J, Khan SA, Hasse C, Ruf S, Heckel DG, Bock R (2015) Full crop protection from an insect pest
by expression of long double-stranded RNAs in plastids. Science 347 (6225):991-994.
doi:10.1126/ science.1261680
Zhang L, Ding L, Cheung TH, Dong M-Q, Chen J, Sewell AK, Liu X, Yates Iii JR, Han M (2007)
Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their
interactions with GW182 proteins AIN-1 and AIN-2. Molecular Cell 28 (4):598-613.
doi:http://dx.doi.org/10.1016/ j.molcel.2007.09.014
Zhao X, Schmitt M, Hawes MC (2000) Species-dependent effects of border cell and root tip exudates on
nematode behavior. Phytopathology 90 (11):1239-1245. doi:10.1094/PHYTO.2000.90.11.1239
150
Zheng JW, Chen SY (2011) Estimation of virulence type and level of soybean cyst nematode field
populations in response to resistant cultivars. Journal of Entomology and Nematology 3 (3):37-
43
Zheng X, Zhu J, Kapoor A, Zhu J-K (2007) Role of Arabidopsis AGO6 in siRNA accumulation, DNA
methylation and transcriptional gene silencing. The EMBO Journal 26 (6):1691-1701.
doi:10.1038/sj. emboj.7601603
Zhuang JJ, Banse SA, Hunter CP (2013) The nuclear argonaute NRDE-3 contributes to transitive RNAi
in Caenorhabditis elegans. Genetics 194 (1):117-131. doi:10.1534/genetics.113.149765
Zhuang JJ, Hunter CP (2012) The influence of competition among C. elegans small RNA pathways on
development. Genes 3 (4):671-685
Zilberman D, Cao X, Jacobsen SE (2003) ARGONAUTE4 control of locus-specific siRNA accumulation
and DNA and histone methylation. Science 299 (5607):716-719. doi:10.1126/science.1079695
Recommended