View
218
Download
1
Category
Preview:
Citation preview
1
JULIANA PAIVA MARQUES LIMA ROLIM
ESTUDOS DOS EFEITOS DA TERAPIA FOTODINÂMICA ANTIMICROBIANA NA VIABILIDADE E NA EXPRESSÃO GÊNICA DE S. MUTANS EM BIOFILMES E LESÕES DE CÁRIE DENTINÁRIA
FORTALEZA
2012
UNIVERSIDADE FEDERAL DO CEARÁ CENTRO DE CIÊNCIAS DA SAÚDE
FACULDADE DE FARMÁCIA, ODONTOLOGIA E ENFERMAGEM PROGRAMA DE PÓS-‐GRADUAÇÃO EM ODONTOLOGIA
2
Juliana Paiva Marques Lima Rolim ESTUDOS DOS EFEITOS DA TERAPIA FOTODINÂMICA ANTIMICROBIANA NA VIABILIDADE E NA EXPRESSÃO GÊNICA DE S. MUTANS EM BIOFILMES E LESÕES DE CÁRIE DENTINÁRIA
Orientadora: Profa. Dra. Nádia Accioly Pinto Nogueira Co-Orientadora: Profa. Dra. Iriana Carla Junqueira Zanin dos Santos
FORTALEZA
2012
Tese apresentada ao Programa de Pós-graduação em Odontologia da Faculdade de Odontologia da Universidade Federal do Ceará como requisito parcial para obtenção do Título de Doutor em Odontologia. Área de Concentração: Clínica Odontológica
3
Dados Internacionais de Catalogação na Publicação Universidade Federal do Ceará Biblioteca de Ciências da Saúde
R653e Rolim, Juliana Paiva Marques Lima.
Estudos dos efeitos da terapia fotodinâmica antimicrobiana na viabilidade e na expressão gênica de S. mutans em biofilmes e lesões de cárie dentinária. / Juliana Paiva Marques Lima Rolim. – 2012.
108 f. : il. color., enc. ; 30 cm. Tese (doutorado) – Universidade Federal do Ceará; Centro de Ciências da Saúde;
Faculdade de Farmácia, Odontologia e Enfermagem; Departamento de Odontologia; Programa de
Pós-‐Graduação em Odontologia; Doutorado em Odontologia, Fortaleza, 2012. Área de Concentração: Clínica Odontológica. Orientação: Profa. Dra. Nádia Accioly Pinto Nogueira. Co-‐Orientação: Profa. Dra. Iriana Carla Junqueira Zanin dos Santos. 1. Fármacos Fotossensibilizantes. 2. Oxigênio Singleto. 3. Ensaio Clínico. 4. Dentina. 5.
Laser Semicondutor. I. Título.
CDD 617.672
4
5
Dedicatória À Deus, Por estar sempre comigo, principalmente nos momentos mais difíceis. Por sempre me dar força e fazer-me perceber que nenhum obstáculo é grande demais quando confiamos Nele.
Aos meus pais, Adriano Marques e Darcy Paiva, Pelo imenso amor, carinho, dedicação e apoio em todos os momentos.
Por terem formado uma família maravilhosa.
À minha irmã, Adriana Paiva, Minha paixãozinha Por me mostrar a função de uma família, amor e proteção mútua.
Ao meu esposo, Renan Rolim, por estar sempre presente, mesmo à distância em muitos momentos.
Por ser cúmplice nas minhas decisões e meu grande torcedor, Por ter o dom de tornar sereno os momentos mais turbulentos.
6
Agradecimentos Especiais
À minha orientadora, Profa. Dra. Nádia Accioly Pinto Nogueira, por sua contribuição ao meu crescimento profissional. Exemplo de competência e serenidade.
À minha co-orientadora, Profa. Dra. Iriana Carla Junqueira Zanin dos Santos pela orientação, amizade, pela confiança e incentivo dado. Por se mostrar um exemplo de pessoa e
pesquisadora a ser espelhado.
À coordenadora do Curso, Profa. Dra. Lidiany Karla Azevedo Rodrigues, pelo auxílio,
inestimável orientação direta, pela dedicação empenhada à pesquisa e contribuição a minha
formação profissional.
7
Agradecimentos
À Universidade Federal do Ceará - UFC na pessoa do Reitor Prof. Dr. Jesualdo Pereira Farias.
À Faculdade de Farmácia, Odontologia e Enfermagem, na pessoa de sua diretora
Profa. Dra. Maria Gorette Rodrigues de Queiroz.
À coordenadora do curso de Odontologia Prof. Dra. Fabrício Bitu Sousa.
À FUNCAP e CAPES pela concessão de bolsa de estudos.
Ao Prof. Dr. Sérgio Lima Santiago, ex-coordenador do Programa de Pós-graduação
em Odontologia da UFC, pela competente função exercida.
À Faculdade de Odontologia de Piracicaba- Universidade Estadual de Campinas, em
especial aos professores Jaime Aparecido Cury e Renata de Oliveira Mattos-Granner,
pelas contribuições fundamentais para execução de parte deste trabalho.
Ao Prof. Dr. Rafael Nobrega Stipp pela orientação e contribuição ímpar em meu
conhecimento em microbiologia e biologia molecular.
Às colegas, pós graduandas da Faculdade de Odontologia de Piracicaba-UNICAMP,
Juliana Botelho, Erika Harth e Natalia Vizoto pelos auxílios à minha pesquisa e pelo
carinho em minha temporada em Piracicaba.
Aos meus colegas da turma de doutorado Bruno Vasconcelos, Cláudio Fernandes,
Mary Anne Melo, Paula Goes, Rebecca Bastos, Vanara Passos, Ramille Lima, Daniella
Bezerra e Beatriz Neves pela boa convivência e troca de experiências.
Às minhas amigas Mary Anne Melo e Vanara Passos agradeço pela amizade,
cumplicidade e empenho nas nossas pesquisas em cada momento. Pelos momentos alegres
onde rimos juntas e pelo companheirismo mútuo nos momentos mais delicados.
8
Aos alunos de Iniciação Científica, Sarah Guedes, Bruna Melo, Camille Lacerda,
Cícero Leonardo, Felipe Marçal, Gabriela Parente, Suellen Rocha, Weslane Morais e
Francisco Filipe Carvalho pela presteza nos momentos requisitados ajudando no
encaminhamento e finalização das pesquisas.
À equipe do Laboratório de Microbiologia e Parasitologia da Universidade Federal do
Ceará em Sobral, Alrieta Texeira, Ruliglesio Rocha e Eliane Dos Santos Pereira, por
estarem sempre dispostos a ajudar, a viabilizar a pesquisa em alguns momentos e pelo esforço
em estarem presentes em todos os momentos da pesquisa desenvolvida na cidade.
À equipe do Laboratório de Bioquímica da Universidade Estadual do Ceará, na pessoa
da Profa. Dra. Maria Izabel Florindo Guedes e Dra. Márcia Marques pela disponibilidade
e oportunidade de trabalhar em seu laboratório.
Ao Laboratório de Química da Universidade Federal do Ceará, especialmente ao
professor Jackson Sousa e ao aluno de doutorado Fernando Albuquerque por nossa
parceria e troca de conhecimentos, possibilitando a realização de excelentes trabalhos.
Aos professores do curso de Pós-Graduação em Odontologia pelo meu crescimento
profissional e pessoal.
Aos funcionários do Programa de Pós-graduação em Odontologia, Lúcia Ribeiro
Marques Lustosa e Janaíne Marques Leal, pela constante disponibilidade.
À amiga e cunhada, Raquel Saraiva Rolim, meus agradecimentos pela
disponibilidade e paciência na elaboração dos esquemas gráficos.
Aos meus familiares e amigos pela compreensão às muitas horas em que tive ausente
para a dedicação ao estudo.
A todos que de maneira direta ou indireta ajudaram na concretização de mais uma
etapa em minha vida.
Meus sinceros agradecimentos!
9
O Senhor é minha fortaleza e meu escudo;
nele confia meu coração”
(Sl 28:7)
10
RESUMO
A aplicação da Terapia Fotodinâmica Antimicrobiana - TFA na Odontologia surge como um
tratamento eficaz na redução das populações microbianas presentes nos biofilmes orais e nas
lesões de cárie dental. Nesse contexto, os objetivos desse trabalho são: a)comparar o potencial
antimicrobiano da TFA utilizando diferentes fotossensibilizadores e determinar a capacidade
de produção de oxigênio singlete para cada um deles (capítulo 1); b) determinar o grau de
penetração do corante azul de orto toluidina em dentina desmineralizada in vitro e in situ
utilizando a microscopia confocal Raman (capítulo 2); c) avaliar o potencial antimicrobiano
da TFA e sua habilidade de alterar a expressão dos genes gtfB, gtfC, gbpB e luxS em biofilmes
orais de Streptococcus mutans formados in vitro (capítulo 3); d) investigar, através de um
ensaio clínico, a performance da TFA utilizando a associação do azul de orto toluidina e um
diodo emissor de luz (capítulo 4). Como abordagens metodológicas foram realizados estudos
in vitro, in situ e um ensaio clínico. Como resultados, observou-se que o azul de orto toluidina
foi o único fotossensibilizador que reduziu significantemente as contagens de S. mutans
(p<0,05). Contudo, a geração de oxigênio singlete não teve relação direta com a atividade
bactericida da TFA (capítulo 1). Há difusão do azul de orto toluidina em dentina sadia e
desmineralizada in vitro e in situ, embora o grau de desmineralização não tenha alterado o
nível de penetração do fotossensibilizador (capítulo 2). Embora a TFA tenha sido efetiva na
morte de biofilmes de S. mutans formados in vitro, a alteração nos genes de virulência foi
somente observada para luxS, um gene relacionado ao estresse oxidativo (capítulo 3).
Finalmente, os resultados do ensaio clínico demostraram que lesões de cárie dentinária
profundas apresentam diminuição na microbiota cariogênica quando tratadas com a TFA
(capítulo 4). Em resumo, a terapia antimicrobiana fotodinâmica é efetiva em cultura
planctônica e biofilmes de S. mutans, o fototossensibilizador utilizado é capaz de penetrar em
dentina desmineralizada in vitro e in situ, a TFA altera a expressão de gene relacionado à
formação de biofilme e reduz significativamente a microbiota in vivo. Contudo protocolos
clínicos seguros devem ser estabelecidos para que sua utilização clínica possa ser indicada.
Palavras-chave: S. mutans, biofilme dentário, cárie dentinária, expressão de genes, terapia
fotodinâmica antimicrobiana.
11
ABSTRACT The application of Antimicrobial Photodynamic Therapy (PACT) in dentistry
emerged as an effective treatment in reducing microbial populations present in oral
biofilms and dental caries lesions. In this context, the objectives of this work are: a) to
compare the antimicrobial effect of photodynamic therapy using different
photosensitizers and evaluate the production of singlet oxygen for each of them
(chapter 1), b) to determine the penetration degree of toluidine blue ortho dye (TBO)
in in vitro and in situ demineralized dentin using confocal Raman microspectroscopy
(chapter 2), c) to evaluate the antimicrobial effect of photodynamic therapy and its
ability to alter the expression of genes gtfB, gtfC, gbpB and luxS in Streptococcus
mutans oral biofilms formed in vitro (Chapter 3), d) to investigate the performance of
PACT by the association of toluidine blue ortho and a light emitting diode using a
clinical trial (chapter 4). As methodological approaches, in vitro, in situ and clinical
studies were performed. The results showed that the TBO was the only
photosensitizer, which significantly reduced the counts of S. mutans (p < 0.05).
However, the singlet oxygen generation was not directly related to the bactericidal
activity of PACT (Chapter 1). The TBO penetration profiles in sound and
demineralized dentin in vitro and in situ were similar, besides different degrees of
demineralization (chapter 2). While PACT has been effective in killing S. mutans
biofilms formed in vitro, the change in virulence genes was observed only for luxS, a
oxidative stress related gene (chapter 3). Finally, the results of clinical trial
demonstrated that dentin caries lesions showed a decrease in the cariogenic microflora
when treated with PACT (Chapter 4). In summary, antimicrobial photodynamic
therapy is effective to kill S. mutans both as planktonic culture as well as biofilm, the
photosensitizer used is able to penetrate into demineralized dentin in vitro and in situ,
PACT can alter the expression of biofilm formation associated genes, and
significantly reduce the in vivo microflora. However safe clinical protocols should be
established for clinical use may be indicated.
Keywords: S. mutans, dental biofilm, dental caries, genes expression,
antimicrobial photodynamic therapy
12
SUMÁRIO
RESUMO
ABSTRACT
1. INTRODUÇÃO GERAL
13
2. PROPOSIÇÃO
20
3. CAPÍTULOS
21
3.1. CAPÍTULO 1 23 The antimicrobial activity of photodynamic therapy against Streptococcus mutans using different photosensitizers
3.2. CAPÍTULO 2 45 Confocal Raman study of photosensitizer penetration in artificially dentin caries lesions
3.3 CAPÍTULO 3 62 Gene Expression of S. mutans Biofilms Submitted to Photodynamic Therapy
3.4 CAPÍTULO 4 79 Antimicrobial effect of Photodynamic therapy in treatment of deep caries lesions in adults: randomized clinical trial
4. CONCLUSÕES GERAIS
93
REFERÊNCIAS GERAIS
94
APÊNDICES
106
ANEXOS 108
13
1. INTRODUÇÃO GERAL
Em 1684, Van Leeuwenhoek descreveu um fenômeno microbiológico no qual
organismos são capazes de aderir e crescer em superfícies, apresentando habilidades
para desenvolver mecanismos específicos para sua fixação inicial, a fim de se
organizar em uma estrutura de comunidade e ecossistema (COSTERNON; GEESEY;
CHENG, 1978). A associação entre os micro-organismos em uma superfície recebe o
nome de biofilme, que é caracterizado pela presença de uma população microbiana
organizada e envolvida por uma matriz de polissacarídeos que responde a sinais
físicos e químicos do meio ambiente local (COSTERTON et al., 1995;
COSTERTON; STEWART; GREENBERG, 1999).
Em adição às respostas a esses sinais, as bactérias regulam diversos processos
fisiológicos dependentes da densidade celular, fenômeno este chamado de quorum-
sensing (LI et al., 2002). Bactérias em biofilmes se desenvolvem de uma forma
controlada por estes mecanismos de sinalização intercelular, pois constantemente são
capazes de secretar baixos níveis desses sinais intercelulares e detectá-los através de
receptores correspondentes (MILLER; BASSLER, 2001). Os receptores não
desencadeiam quaisquer alterações comportamentais até que existam bactérias
suficientes para permitir que as concentrações de sinais excedam um limiar crítico.
Assim, modificações das condições ambientais são transmitidas entre as células,
provocando alterações na expressão de diversos genes (CVITKOVITCH; LI; ELLEN,
2003). O crescimento dos micro-organismos na forma de biofilmes se caracteriza
quando este fenômeno ocorre e as bactérias passam a responder por adoção de um
comportamento comum.
Na cavidade oral, a complexa interação bacteriana resulta na formação de um
biofilme de multiespécie conhecido como biofilme dental que é composta por mais de
1000 espécies diferentes, metade das quais são cultiváveis (TEN CATE, 2006).
Imediatamente após a limpeza da superfície dentária por escovação ou profilaxia
profissional, há uma deposição de uma camada acelular sobre os dentes conhecida
como película adquirida e sobre esta, as primeiras bactérias iniciam o processo de
colonização (NYVAD, 1993). Após o crescimento desses primeiros colonizadores, o
14
microambiente local torna-se susceptível à sobrevivência de outras espécies em um
processo conhecido como sucessão microbiana.
Os Streptococcus spp. são o principal grupo de bactérias colonizadoras (70-
80%) iniciais da biofilme dental, alguns dos gêneros menos predominantes podem ter
interacções físicas ou metabólica com os estreptococos como exemplo Veillonella
spp. Além disso, a presença de Neisseria spp. e Rothia spp., contrasta com a presença
de espécies anaeróbicas, tais como Porphyromonas spp. e Prevotella spp (DIAZ et
al., 2005). Os Actinomyces spp. tornam-se predominantes após 2 horas da formação
do biofilme e Streptococcus oralis e Streptococcus mitis após 6 horas (LI et al.,
2004). Além desses colonizadores, Eubacterium spp., Treponema spp. e
Fusobacterium nucleatum servem como uma ponte entre colonizadores iniciais e
tardios (KOLENBRANDER et al., 2002).
Dentre os micro-organismos orais, os estreptococos do grupo mutans
(particularmente S. mutans e S. sobrinus) são considerados os principais agentes
etiológicos da cárie dentária e, juntamente com os lactobacilos, estão envolvidos com
a progressão da doença (BADET; THEBAUD, 2008). Entre os fatores de virulência
de S. mutans destacam-se sua capacidade de adesão à superfície dentária, sua
capacidade de produzir ácido a partir de carboidratos da dieta (acidogenicidade) e sua
habilidade em tolerar ambientes de baixo pH (aciduricidade) (BAEHNI; TAKEUCHI,
2003; LEMOS; ABRANCHES; BURNE, 2005).
Além de uma diversificada população microbiana, o biofilme oral também é
composto por uma complexa matriz que serve como esqueleto tridimensional
conferindo propriedades viscoelásticas e aumento da resistência ao cisalhamento
(LAWRENCE et al., 2003; LERICHE; SIBILLE; CARPENTIER, 2000;
SUTHERLAND, 2001). A formação da matriz do biofilme dental ocorre
principalmente através da síntese de glucanos solúveis (dextrano) e insolúveis em
água (mutano) a partir da sacarose via atividade catalítica das enzimas
glucosiltransferases (Gtfs) (GOODMAN; GAO, 2000; CURY et al., 2000) produzidas
por estreptococos do grupo mutans. Os glucanos são considerados o fator de maior
contribuição para adesão dos S. mutans à superfície dentária e sua agregação às
demais células bacterianas (BOWEN, 1997; HAYACIBARA et al., 2004; KOPEC;
VACCA-SMITH) por promoverem sítios específicos de ligação favorecendo a
colonização bacteriana na superfície dentária e a coagregação microbiana,
15
contribuindo, assim, para o desenvolvimento do biofilme em espessura (SCHILLING;
BOWEN, 1992; YAMASHITA et al., 1993).
As enzimas glucosiltransferase, GtfB, GtfC e GtfD são codificadas pelos
genes gtfB, gtfC e gtfD, respectivamente (WUNDER; BOWEN, 1999; LI; BURNE,
2001; TAMESADA; KAWABATA, 2004). As enzimas GtfB e GtfC produzem
principalmente glucanos insolúveis em água, GtfC também está envolvida na
produção de glucanos solúveis e o gene gtfD, que codifica a enzima GtfD, resulta na
formação de moléculas solúveis em água (AOKI et al., 1986; HANADA; PUCCI et
al., 1987; KURAMITSU, 1989; YAMASHITA et al., 1993; FUJIWARA et al., 1996;
FUJIWARA et al., 2002). Assim, as enzimas GtfB e GtfC têm papel fundamental
tanto na adesão e acúmulo de micro-organismos na superfície dentária como na
estabilização da matriz de polissacarídeos extracelulares que é responsável pela
integridade estrutural do biofilme dental (BURNE, 1998; BANAS; VICKERMAN,
2003). Estudos utilizando cepas mutantes não codificadoras dos genes gtfB e gtfC
demonstraram diminuição na formação de polissacarídeos extracelular e portanto, na
habilidade de S. mutans em formar biofilmes maduros in vitro (TSUMORI;
KURAMITSU, 1997; THUMNHEER et al., 2006).
Outros componentes também estão envolvidos na virulência dos S. Mutans,
participando da manutenção da arquitetura do biofilme por proporcionar em união
bacteriana às moléculas extracelulares de glucano. As proteínas ligadoras de glucano
(Glucan-binding proteins) são um grupo de proteínas de superfície (GbpA, GbpB,
GbpC, GbpD) que apresentam afinidade aos glucanos insolúveis (BANAS;
VICKERMAN, 2003). GbpB é codificada pelo gene gbpB e tem um papel importante
na virulência desse microrganismo, sendo um componente essencial na formação do
biofilme dependente de sacarose e na sua cariogenicidade (MATTOS-GRANER et
al., 2001; WEN et al., 2010). Duque et al., 2011 demonstraram que a baixa
expressão de gbpB altera claramente o processo inicial de formação do biofilme
dependente de sacarose. Estudos evidenciam também que S. mutans possui uma via
de sinalização mediada por LuxS que afeta a formação de biofilme (WEN; BURNE,
2002; WEN et al., 2005). LuxS é uma enzima que está envolvida na resposta aos
sinais intercelulares por estar envolvida na síntese do autoindutor 2 (AI-2), a mais
predominante molécula sinalizadora interespécies (CAMILLI; BASSLER, 2006). A
enzima LuxS tem um importante papel na aderência e desenvolvimento do biofilme
16
dental, na capacidade de tolerância bacteriana ao estresse ácido e oxidativo, e na
produção de bacteriocina (MERRITT et al., 2003, 2005; YOSHIDA et al., 2005;
WEN; BURNE, 2004, 2011). Desta forma, sinais mediados por LuxS têm importante
papel no desenvolvimento e organização do biofilme, tendo um importante impacto
na patogênese do biofilme dental.
A prevenção da cárie dentária requer, dentre outros fatores, como remoção
mecânica do biofilme, o controle desses patógenos existentes no biofilme oral.
Estudos têm mostrado que a clorexidina, o fluoreto estanhoso e o triclosan podem
tanto inibir o desenvolvimento e maturação do biofilme como afetar o metabolismo
bacteriano (PRATTEN; BARNETT; WILSON, 1998; SHAPIRO; GIERTSEN;
GUGGENHEIM, 2002; BAEHNI; TAKEUCHI, 2003; AUSCHILL et al., 2005). A
clorexidina é um agente frequentemente utilizado podendo ser usada para limpeza
cavitária antes da restauração ou na forma de verniz para pacientes de alto risco à
cárie ( JONES, 1997; SPLIETH et al., 2000).
Micro-organismos organizados em biofilmes, contudo, apresentam reduzida
susceptibilidade aos agentes antimicrobianos quando comparado às culturas
planctônicas (SOCRANSKY; HAFFAJEE, 2002). Esta característica parece estar
relacionada à combinação de alguns fatores, tais como: menor capacidade de
penetração do agente antimicrobiano; ativação das respostas adaptativas ao estresse;
presença de uma população fisiologicamente heterogênea; presença de variantes
fenotípicas ou persistentes; crescimento lento ou existência da fase estacionária
(STEWART; COSTERTON, 2001; CHAMBLESS; HUNT; STEWART, 2006). O
uso frequente desses agentes no tratamento de doenças crônicas pode resultar na
seleção de espécies resistentes (WILSON; BURNS; PRATTEN, 1996).
Desta forma, é importante desenvolver alternativas contra o biofilme dental
que resultem em pouco ou nenhum efeito colateral. Nesse sentido, a terapia
fotodinâmica antimicrobiana (TFA) surge como um tratamento alternativo ao uso de
agentes antimicrobianos tradicionais (WILSON et al., 1995). O confinamento do
efeito ao local da lesão pela aplicação tópica de um fotossensibilizador e a irradiação
restrita à área de interesse, oferecendo baixo risco a outras células do hospedeiro
(HAMBLIN; HASAN, 2004; ZANIN et al., 2005) e o dano ou morte bacteriana
obtido em curto período de tempo, reduzindo a possibilidade de surgimento de
17
resistência microbiana (WAINWRIGHT, 2004; BACKHAUS et al., 2007; LUAN et
al., 2009) fazem da terapia fotodinâmica uma vantajosa modalidade de tratamento. O uso da TFA para inativação de micro-organismos foi primeiro demonstrado,
há mais de cem anos, por Oscar Raab que reportou o efeito letal do hidrocloreto de
acridina e luz visível contra Paramecia caudatum (RAAB, 1900 in SOUKOS;
GOODSON, 2011). A TFA é baseada no conceito de que um agente fotossensível
pode ser preferencialmente absorvido por bactérias e subsequentemente ativado por
uma luz de comprimento de onda complementar na presença de oxigênio para gerar
radicais livres e oxigênio singlete, os quais são citotóxicos para os micro-organismos
(MALIK; HANANIA; NITZAN, 1990; FINK-PUCHES et al., 1997). Nesse processo,
após a absorção de um fóton de luz, a molécula do fotossensibilizador no estado
singlete em repouso passa para o estado excitado. O tempo de vida da molécula no
estado singlete é bastante limitado, em intervalo de nanossegundos, o que é
demasiado curto para permitir interação significativa com as moléculas vizinhas,
passando, então, para um estado triplete, que apesar de ter baixa energia, tem tempo
de vida relativamente longo (10-9 segundos) (RYTER; TYRRELL, 1998). Nesse
período, aumenta a probabilidade do fotossensibilizador transferir energia para outras
moléculas e seguir um dos dois caminhos denominados como fotoprocesso do tipo I e
tipo II (FUCHS; THIELE, 1998; YAVARI, 2006)
A reação tipo I envolve transferência de elétrons do fotossensibilizador no
estado triplete para moléculas vizinhas ou átomos de hidrogênio produzindo radicais
que podem reagir com o oxigênio para produzir espécies citotóxicas, tais como
superperóxido, radicais hidroxila e radicais livres (ATHAR et al., 1988). O segundo
processo envolve transferência de energia do fotossensibilizador no estado triplete ao
oxigênio molecular no estado fundamental para produzir oxigênio singlete (1O2),
Juntos, todos estes produtos oxidam diversas moléculas biológicas como proteínas e
lipídios da membrana e a estrutura do DNA celular (MACROBERT; BOWN;
PHILLIPS, 1989; MALIK; HANANIA; NITZAN, 1990; BHATTI et al., 1997;
MITRA, 2004).
O oxigênio em seu estado singlete excitado (1O2) é relatado ser provavelmente
o mais importante intermediário nestas reações (CADET et al., 2006; SCHMIDT,
2006). É uma das várias espécies reativas de oxigênio (ERO) que pode induzir
processos antioxidantes e deteriorar tecidos biológicos, danificar essenciais
18
componentes celulares, tais como membrana citoplasmática, ou alterar
irreversivelmente as atividades metabólicas, resultando na morte celular (HAMBLIN;
HASAN, 2004). Apesar de o oxigênio singlete ser considerado o mais importante
dentre as EROs, Rolim et al., (2012) mostraram que a eficácia fotodestrutiva de um
fotossensibilizador pode variar, mesmo se houver níveis semelhantes de produção de 1O2 in vitro, concluindo que a produção de 1O2 não é o parâmetro mais relevante a se
considerar quando se avalia a atividade antimicrobiana do TFA contra S. mutans. Há
vários fatores que influenciam o fotodano, incluindo o tipo, a dose, o tempo de
incubação e localização do fotossensibilizador, a disponibilidade de oxigênio, o
comprimento de onda da luz (nm), a densidade de potência de luz (mW/cm2) e a
densidade de energia da luz (J/cm2) (SOUKOS, GOODSON, 2011; ROLIM et al.,
2012). O oxigênio singlete ainda pode ter efeito direto nas moléculas extracelulares
devido a sua alta reatividade química, de modo que polissacarídeos presentes na
matriz extracelular de biofilmes orais também sejam susceptíveis ao fotodano
(KONOPKA; GOLINSKI, 2007). Nos últimos anos um largo número de drogas fotossensibilizantes tem sido
testado contra micro-organismos orais (WILSON; YIANNI, 1995; WILSON, 2004;
PRATTES et al., 2006, PAULINO et al., 2005; LIMA et al., 2009). O azul de orto
toluidina e o azul de metileno são os mais comumente usados para terapia
fotodinâmica antimicrobiana oral, tendo o azul de orto toluidina apresentado melhores
resultados antimicrobianos (PELOI et al., 2008; MELO et al., 2010, ROLIM et al.,
2012).
A literatura também apresenta três principais tipos de fontes luminosas para a
realização da terapia fotodinâmica antimicrobiana: os lasers, os diodos emissores de
luz (LEDs) e as lâmpadas de luz halógena. As luzes do tipo laser apresentam
vantagens como monocromaticidade e alta eficiência (> 90%), no entanto, tem um
custo elevado. Além disso, em geral apresentam um único comprimento de onda e
requerem uma unidade separada para cada fotossensibilizador, devido aos
comprimentos de onda de absorção diferentes. Os LEDs passaram a ser empregados
na TFA nos últimos anos (ZANIN et al., 2006; LIMA et al., 2009; MELO et al.,
2010). Entre as principais vantagens da utilização da luz LED em relação às fontes
laser estão seu baixo custo, pequeno porte e facilidade de configuração para
irradiações diferentes (NAGATA et al., 2012). Além disso, por não apresentarem boa
19
colimação e coerência, resultam em bandas de emissão de luz mais largas,
favorecendo, assim, a complementaridade com o fotossensibilizador utilizado
(ZANIN et al., 2006; GIUSTI et al., 2008). As lâmpadas halógenas têm a vantagem
de poderem ser espectralmente filtradas para corresponder a qualquer
fotossensibilizador, no entanto, elas não podem ser eficientemente acoplados em
feixes de fibras ópticas e também causam aquecimento na área irradiada. Ainda, como
são fontes de luz de banda larga, a sua potência de saída efetiva é menor (WILSON;
PATTERSON, 2008).
A TFA pode ser utilizada na prevenção da cárie dental por danificar micro-
organismos do biofilme oral e como uma técnica minimamente invasiva para eliminar
bactérias em lesões de cárie dentária. Estudos recentes demonstraram que a
combinação de azul de orto toluidina e fonte de luz LED vermelha nas densidades de
energia de 47 e 94 J/cm2 resultou em significante redução de espécies cariogênicas
presentes em dentina cariada produzidas in vitro e in situ (LIMA et al., 2009; MELO
et al., 2010). Guglielmi e colaboradores (2011) também observaram eficácia da TFA
utilizando o laser de baixa potência InGaAIP (Fosfato Indio-Gálio-Alumínio) (320
J/cm2) associado ao fotossensibilizador azul de metileno em um estudo clínico.
Nesse sentido, a evolução dos estudos com terapia fotodinâmica
antimicrobiana tem mostrado que este processo pode ser utilizada de forma
complementar ao tratamento de lesões de cárie dentinária, inativando as bactérias
cariogênicas e preservando a dentina afetada (KIDD; RICKETTS; BEIGHTON,
1996), contudo ainda não está claro qual a habilidade do fotossensibilizador em
penetrar nos túbulos dentinários e a dificuldade de propagação da luz no tecido.
Em adição, como já exposto, a TFA tem a capacidade de alterar o
metabolismo celular bacteriano, interferindo, desta forma, nos sistemas de transporte
e na ativação de enzimas. Consequentemente a capacidade acidogênica dos S. mutans,
intimamente relacionada com o metabolismo celular, torna-se reduzida (THEDEI et
al., 2008; BOLEAN et al., 2010) conjeturando assim que outras funções deste micro-
organismo também sejam alteradas após terapia fotodinâmica. Desta forma, torna-se
importante e interessante avaliar como a TFA afeta a expressão de importantes genes
de virulência de S. mutans.
20
2. PROPOSIÇÃO
Essa tese de doutorado será apresentada em capítulos, tendo como objetivos:
CAPÍTULO 1: Avaliar a atividade antimicrobiana de fontes de luz azul e
vermelha associadas com diferentes fotossensibilizadores em suspensões
planctônicas de S. mutans e determinar a capacidade de produção de oxigênio
singlete para cada um deles;
CAPÍTULO 2: Quantificar a difusão do fotossensibilizador azul de orto
touidina em dentina desmineralizada produzida através de modelos de lesão de
cárie in vitro e in situ;
CAPÍTULO 3: Avaliar, in vitro, o potencial antimicrobiano da terapia
fotodinâmica utilizando a associação do azul de orto toluidina e luz LED
(638.8 nm) sobre biofilmes de Streptococcus mutans e analisar o padrão de
expressão dos genes gtfB, gtfC, gbpB e luxS por S. mutans presentes em
biofilmes de mono-espécies submetidos a terapia fotodinâmica
antimicrobiana;
CAPÍTULO 4: Avaliar o efeito antimicrobiano da terapia fotodinâmica em
lesões de cárie dentinária através de um estudo clínico randomizado
controlado.
21
3 CAPÍTULOS
Essa tese está baseada no Artigo 46 do Regimento Interno do Programa de
Pós- Graduação em Odontologia da Universidade Federal do Ceará, que regulamenta
o formato alternativo para dissertações de Mestrado e teses de Doutorado e permite a
inserção de artigos científicos de autoria e co-autoria do candidato (Anexo A). Por se
tratarem de pesquisas envolvendo seres humanos, ou parte deles, o projeto de
pesquisa dos trabalhos referentes aos capítulos 2 e 4 foram submetidos à apreciação
do Comitê de Ética em Pesquisa da Universidade Federal do Ceará e Comitê de Ética
em Pesquisa da Faculdade Estadual Vale do Acaraú, tendo sido aprovados (ANEXOS
B e C). Assim sendo, esta tese de doutorado é composta de quatro capítulos a serem
submetidos para publicação em revistas científicas, conforme descrito abaixo:
CAPÍTULO 1 “The antimicrobial activity of photodynamic therapy against Streptococcus mutans
using different photosensitizers” Juliana P.M.L. Rolim, Mary A.S. de-Melo, Sarah F.
Guedes, Fernando B. Albuquerque-Filho, Jackson R. de Souza, Nádia A.P. Nogueira,
Iriana C.J. Zanin, Lidiany K.A. Rodrigues.
CAPÍTULO 2
“Confocal Raman study of photosensitizer penetration in artificially dentin caries
lesions” Juliana P.M.L.Rolim, Mary A.S.De-Melo, Iriana C.J. Zanin, José J.A. Da-
Silva, Alexandre R.Paschoal, Alejandro P.Ayala, Nádia A.P. Nogueira, Lidiany K.A.
Rodrigues.
CAPÍTULO 3
“Gene Expression of S. mutans Biofilms Submitted to Photodynamic Therapy”
Juliana P.M.L. Rolim, Rafael N Stipp, Renata O Mattos-Granner, Jaime A Cury,
Simone Duarte, Deepak Saxena, Smruti Pushalkar, Iriana C.J. Zanin.
22
CAPÍTULO 4
“Antimicrobial effect of Photodynamic therapy in treatment of deep caries lesions in
adults: randomized clinical trial” Juliana P.M.L. Rolim, Mary A.S. De-Melo, Vanara
F. Passos, Ramille A. Lima, Suellen S. Rocha, Iriana C. J. Zanin, Lidiany K.A.
Rodrigues, Nádia A. P. Nogueira
23
3.1. CAPÍTULO 1
The antimicrobial activity of photodynamic therapy against Streptococcus
mutans using different photosensitizers
Juliana P.M.L. Rolima, Mary A.S. de-Meloa, Sarah F.F. Guedesa, Fernando B.
Albuquerque-Filhob; Jackson R. de Souzab, Nádia A.P. Nogueirac, Iriana C.J. Zanina;
Lidiany K.A. Rodriguesa*.
aFaculty of Pharmacy, Dentistry and Nursing, Federal University of Ceará,
Department of Operative Dentistry
Cap. Francisco Pedro street s/n - Rodolfo Teófilo – Zip Code: 60430-170
Fortaleza-CE Brazil Phone/Fax- #558533668232
bDepartment of Organic and Inorganic Chemistry of Federal University of Ceará
Campus do Pici - Bloco 940– Zip Code: 60455-760- Fortaleza - CE Brazil Phone:
#853366 9977
cFaculty of Pharmacy, Dentistry and Nursing, Federal University of Ceará
Department of Clinical and toxicological analyzes
Cap. Francisco Pedro street, 1210 - Rodolfo Teófilo – Zip Code: 60430-170 -
Fortaleza – CE Brazil Phone: #55853366 8262
24
ABSTRACT
Several photosensitizers have been used against oral bacteria without standardization.
Singlet oxygen (1O2) is an aggressive chemical species that can kill cells through
apoptosis or necrosis. Objective: to compare the antimicrobial activity of
photodynamic therapy (PDT) with different photosensitizers at the same
concentration against Streptococcus mutans. In addition, the 1O2 production of each
photosensitizer was determined. The photosensitizers (163.5 µM) methylene blue
(MB), toluidine blue ortho (TBO) and malachite green (MG) were activated with a
light-emitting diode (LED; λ=636 nm), while eosin (EOS), erythrosine (ERI) and rose
bengal (RB) were irradiated with a curing light (λ=570 nm). Light sources were
operated at 24 Jcm-2. For each photosensitizer, 40 randomized assays (n=10 per
condition) were performed under one of the following experimental conditions: no
light irradiation or photosensitizer, irradiation only, photosensitizer only or irradiation
in the presence of a photosensitizer. After treatment, serial dilutions of S. mutans were
seeded onto brain-heart infusion agar to determine viability in colony-forming units
per milliliter (CFUmL-1). Generation of 1O2 was analyzed by tryptophan
photooxidation, and the decay constant was estimated. Results were analyzed by one-
way ANOVA and the Tukey-Kramer test (p<0.05). PDT with irradiation in the
presence of the photosensitizers TBO and MG was effective in reducing S. mutans
counts by 3 and 1.4 log, respectively (p<0.01), compared to their respective untreated
controls. MB generated 1.3 times more 1O2 than TBO, and both produced significantly
higher concentrations of singlet oxygen than the other photosensitizers. Since in vitro
bulk 1O2 production does not indicate that 1O2 was generated in the bacterial activity
site, the bactericidal action against S. mutans cannot be related to in vitro singlet O2
generation rate. In vitro S. mutans-experiments demonstrated TBO as the only
photosensitizer that effectively reduced 3-log of these microorganisms.
Keywords: Photodynamic therapy, singlet oxygen, light-emitting diode,
Streptococcus mutans
25
1. INTRODUCTION
Photodynamic therapy (PDT) is a treatment modality for several diseases,
most notably cancer. PDT involves three separate components: a photosensitizer (PS),
light activation and molecular oxygen [1]. The combination of these components
produces reactive oxygen species (ROS) and leads to the destruction of target cells.
There are two classes of ROS, one created through electron transfer (type I reaction)
and the other by energy transfer (type II reaction). Electron transfer to O2 can produce
superoxide, hydrogen peroxide and hydroxyl radicals. In a type II reaction, energy
transfer to O2 results in the formation of singlet oxygen (1O2) [1,2]. Both type I and
type II photochemical reactions depend on several parameters, most importantly, the
photosensitizer used and the concentration of oxygen [3].
Oxygen in its excited singlet state (1O2) is likely the most important
intermediate in these reactions [4,5]. It is one of several ROS that can induce
antioxidative processes and deteriorate biological tissues, damage essential cell
components, such as the cytoplasmic membrane, or irreversibly alter metabolic
activities, resulting in cell death [6,7,8].
The formed ROS react with different components of the cell. Singlet oxygen,
for example, selectively degrades tryptophan in a fast reaction. This amino acid can
be decayed by other ROS, but it is particularly sensitive to 1O2, which makes it
possible to quantify the amount of singlet oxygen produced by a photosensitizer using
a colorimetric assay to detect tryptophan degradation [9].
Recent reports [10,11,12] have shown that PDT is capable of sensitizing
bacterial cells, thus demonstrating successful antimicrobial activity. The
photodynamic inactivation of bacteria is based on the premise that a photosensitizer
can accumulate in or pass through of over the cytoplasmic membrane to a significant
extent, which is the critical target for inducing irreversible damage to bacteria after
irradiation [13]. However, the efficacy of PDT is dependent upon several factors, such
as the wavelength and its interaction with the photosensitizer, the output power, the
length of irradiation time, the beam diameter, the operation mode of the light source
(continuous or pulsed) and the convergence of the beam (focused or unfocused)
[14,15].
Red light sources (630 – 700 nm) have been used extensively in PDT due to
their relatively long wavelengths, which can effectively penetrate biological tissues
26
[16]. The scientific literature reports that the interaction between these light sources
and the photosensitizers that absorb at this wavelength, such as methylene blue (MB),
toluidine blue ortho (TBO) and malachite green (MG), can result in significant
microbial killing [17,18,19,20]. Additionally, research has also shown that blue light
(380 – 520 nm) is an attractive option for PDT, because blue light sources can be used
in combination with other photosensitizers, such as rose bengal (RB), eosin (EOS)
and erythrosine (ERI), to photoinactivate oral microorganisms [21,22]. However, no
other study has evaluated all these photosensitizers in standardized experimental
conditions, by using the same molar concentration and inoculum of S. mutans.
The production of ROS is a molecular reaction dependent on the concentration
of the photosentitizer. Thus, the current study used red and blue light sources to
activate various photosensitizers with the same molar concentration and analyzed
their antimicrobial activities on planktonic suspensions of S. mutans. Furthermore, the
singlet oxygen generated by each photosensitizer upon irradiation was quantified
using a tryptophan degradation assay.
2. MATERIALS AND METHODS
2.1 Streptococcus mutans
A standard suspension of S. mutans (strain UA159) containing 1 – 2 x 108
viable cells ml-1 was prepared as follows. First, brain heart infusion broth (BHI, Difco,
Kansas City, MO, USA) was inoculated with S. mutans and was incubated for 18 h at
37°C in an atmosphere of 10% CO2 (Thermo Fisher Scientific Inc., Waltham, MA,
USA). The bacterial culture was then centrifuged at 4,000 g for 5 min (5415R,
Eppendorf, São Paulo, SP, Brazil), and the supernatant was discarded. The cell pellet
was resuspended in 5 ml of a sterile solution of 0.9% sodium chloride (NaCl).
The number of viable cells in each suspension was determined with a
spectrophotometer (Amersham Biosciences Ultrospec 1100 pro, GE Healthcare do
Brasil Ltda, São Paulo, SP, Brazil), using a wavelength of 600 nm and an optical
density of 0.3120.
2.2 Experimental Design
27
Using the standard S. mutans suspension, 150 assays were performed. The
photosensitizers methylene blue (MB), toluidine blue ortho (TBO) and malachite
green (MG) were tested alone or in combination with irradiation with a red light-
emitting diode (LED). Rose bengal (RB), erythrosine (ERI) and eosin (EOS) were
tested alone or in combination with irradiation from a blue light source. Ten assays
for each of the following conditions were performed: in the absence of both light and
photosensitizer; with photosensitizer alone; with light irradiation alone; or in the
presence of each photosensitizer and its respective light source.
2.3 Photosensitizer and light
Since PDT is a two-step process in which neither the light source nor the
photosensitizer express antimicrobial effect when used alone, we determined in a
preliminary study the Minimum Inhibitory Concentration (MIC) for the
photosensitizers in order to prevent cytotoxicity of photosensitizers in the absence of
light. Difficulty in achieving an agreement among the MIC’s for all studied
photosensitizers, led to the establishment of the concentration of 163.5 µM for use in
the in vitro S. mutans-experiments. This concentration was coincident with the MICs
of TBO and MB. Each photosensitizer solution was prepared in concentrations of 327
µM by dissolving the dye in physiological phosphate-buffered saline (PBS), pH 7.2
with 5% dimethylformamide (DMF) and filtering through a sterile 0.22 μm
membrane (MilliporeTM, São Paulo, SP, Brazil). After filtration, solutions were stored
in the dark.
One red LED (80 mW) (MMOptics, São Carlos, SP, Brazil) with a
predominant wavelength of 636 nm was used for the photosensitizers MB, TBO and
MG, which absorb light of 660, 640 and 675 nm wavelengths, respectively. A blue
handheld photopolymerizer (800 mW) (CL-K50, Kondortech São Carlos, SP, Brazil)
with a wavelength of 570 nm was used for EOS, ERI and RB, with absorption
maxima at 520, 580 and 550 nm, respectively. All devices were set to reach the value
of 24 J cm -2 (energy density) according to the following equations:
Fluency = power density × time.
Where, power density (PD) is:
PD= P (mW)
A (cm2)
28
Where, P is the output power of the light source and A is the irradiated area.
Since the non-collimate lights may spread as it propagates, the area (A)
considered in the present calculation related to the hemisphere area (2 πr2 – in which r
is the distance from the end of the light tip to the suspension into the well) (Figure 1).
In order to decrease the discrepancy between the applied irradiation times, a 7 mm r
distance was chosen for the blue light source, and for the other source, this r distance
was set at 3 mm consequently, the applied PDs were respectively 259.9 and 141.5
mW cm-2.
FIGURE 1. Schematic design of emitting light delivery
Emission spectra of light sources were measured and compared with the
absorption spectrum of the respective photosensitizers using a HP 8453 system
spectrophotometer (Hewlett- Packard, Palo Alto, CA, USA) (Figures 2A and 2B).
Room temperature was maintained at 25oC, and 0.01% solutions (w/v) were diluted
with deionized water (pH 7.2) into a quartz cell with 1 mm light path. The spectral
overlap of the respective light emission spectra and the absorption spectra of
photosensitizers were obtained with Origin Lab 8.0 software (Origin Lab Corporation,
Northampton, MA, USA).
29
FIGURE 2A. Spectrum of the blue light source system and the absorbance spectra of
the EOS, ERI and RB in water solution.
30
FIGURE 2B. Spectrum of the red LED light source system and the absorbance
spectra of the TBO, MB and MG in water solution.
2.4 In vitro photosensitization
For each photosensitizer, 0.1 mL of the S. mutans standard suspension was
added to each well of sterile, 96-well flat-bottom microtiter plates with lids (TPP,
Trasadingen, Switzerland). Next, 0.1 mL of the photosensitizer solution was added to
wells in which photosensitizer was tested alone or in combination with light. Control
wells received 0.1 mL of 0.9% NaCl solution. Plates were incubated for 5 min on an
orbital shaker (TE-145, TECNAL, Piracicaba, SP, Brazil). Wells that were exposed to
light, with or without photosensitizer, were irradiated under aseptic conditions in a
laminar flow hood in the dark. To prevent light scattering into neighboring wells,
plates were covered with a black glass plate with openings corresponding to the
diameter of the well [23].
After treatment, suspensions were serially diluted in 0.9% NaCl solution. In
order to assess bacterial viability, 0.1 mL aliquots of each dilution were plated in
triplicate on BHI agar and incubated for 48 h at 37°C in a partial atmosphere of 10%
CO2. After incubation, the number of colony forming units per milliliter (CFUmL-1)
31
was determined. The results were log-transformed and analyzed by analysis of
variance (ANOVA) and the Tukey test. Statistical significance was defined as p ≤
0.05.
2.5 Degradation of Tryptophan by Singlet Oxygen
The same solution of each photosensitizer that was used for experiments was
analyzed for photogeneration of singlet oxygen by assessing the reaction of the
photosensitizer with tryptophan. One hundred microliters of each photosensitizer was
added to 2.5 mL of a 150 µM solution of tryptophan in PBS, pH 7.2, 5% DMF
saturated with O2 in a quartz cuvette. Emission by tryptophan at 355 nm after
excitation at 280 nm was measured with a fluorescence spectrophotometer
(HitachiF4500, Tokyo, Japan), before and during irradiation. The two evaluated light
sources expressed different kinetics of tryptophan degradation. Hence, the red light
source presented a higher speed of degradation than the blue one. The analysis
intervals were 10 sec for the red source and 120 sec for the blue source. Data was
collected for up to 2240 sec. The information obtained included the reaction rate
between tryptophan and singlet oxygen, assuming first-order kinetics (y = ax + b),
and the percent consumption of tryptophan, given the same irradiation potency for
each photosensitizer. The observed reaction occurs in two phases, the first one is a
photochemical step, which results in the production of singlet oxygen, followed by
the reaction of 1O2 with tryptophan. Thus, the global reaction may be described as
follows: Ln[A] – Ln[A]o = -kt, where [A] is the concentration of 3PS in the instant t,
[A]o is the concentration of 1PS at the beginning of the reaction, and k is the
calculated speed constant and t is the time. Consequently, as k expresses the speed of
tryptophan degradation it can be assumed that is similar to 1O2 production.
3. RESULTS
Photodynamic therapy with TBO and MG promoted a significant reduction in
the number of CFUmL-1 of S. mutans, as shown in figures 3 and 4, respectively. The
highest reduction of microorganisms was achieved with PDT using TBO,
approximately 3 log10. The photosensitizers EOS and MB showed no statistical
difference between PDT and control groups with p-values of 0.621 and 0.396,
32
respectively, as shown in figures 5 and 6. PDT performed with ERI had a significant
effect on the viability of S. mutans, when compared to control groups, where neither
light nor photosensitizer, or light alone was applied. However, when the
photosensitizer was utilized alone, a significant reduction in microbial viability was
observed, compared to the other control groups (Figure 7). No growth of S. mutans
was observed among the groups exposed to RB (Figure 8). These results demonstrate
that light sources alone operating with an energy density of 24 J cm-2 have no
antimicrobial effect on S. mutans.
FIGURE 3. Effect of toluidine blue ortho (TBO) treatment on the viability of S.
mutans. Data (CFU ml-1) are log-transformed and error bars indicate standard
deviation.
FIGURE 4. Effect of malachite green (MG) treatment on the viability of S. mutans.
Data (CFU ml-1) are log-transformed and error bars indicate standard deviation.
1
10
Control LED TBO PDT
Log UFC mL -‐1
Groups
Toluidine blue a a a
b
1
10
Control LED MG PDT
Log UFC mL -‐1
Groups
Malachite Green a a a b
33
FIGURE 5. Effect of eosin (EOS) treatment on the viability of S. mutans. Data (CFU
ml-1) are log-transformed and error bars indicate standard deviation.
FIGURE 6. Effect of methylene blue (MB) treatment on the viability of S. mutans.
Data (CFU ml-1) are log-transformed and error bars indicate standard deviation.
1
10
Control Light EOS PDT
Log UFC/m
L
Groups
Eosin aaaa
1
10
Control LED MB PDT
Log UFC mL -‐1
Groups
Methylene Blue a a a
a
1
10
Control Light ERI PDT
Log UFC mL -‐1
Groups
Erythrosin a
a cb
34
FIGURE 7. Effect of erythrosin (ERI) treatment on the viability of S. mutans. Data
(CFU ml-1) are log-transformed and error bars indicate standard deviation.
FIGURE 8. Effect of rose bengal (RB) treatment on the viability of S. mutans. Data
(CFU ml-1) are log-transformed and error bars indicate standard deviation.
All photosensitizers reduced tryptophan luminescence when irradiated with
the convenient wavelength, except for MG. First-order kinetics best describe the
reactions, as the relationship between the inverse natural log of Ln[A]vs. irradiation
time is linear in periods equal or inferior to 60 sec for red light source, and for blue
source in periods equal or inferior to 2000 sec (Figures 9 and 10). The data obtained
indicated by the greater reduction in tryptophan concentration by the former.
1
10
Control Light RB PDT
Log UFC mL -‐1
Groups
Rose Bengal aa
b b
20 40 60-‐0.8
-‐0.6
-‐0.4
-‐0.2
0.0
-‐ Ln A
time, s ec ond
MB O (-‐1 ,40x10 -‐2) T B O (-‐1 ,10x10 -‐2)
35
FIGURE 9. Reduction in tryptophan luminescence when irradiated with a red light
source at a convenient wavelength and speed of tryptophan degradation.
0 200 400 600 800 1000 1200 1400 1600 1800 2000
-‐0.4
-‐0.3
-‐0.2
-‐0.1
0.0
-‐Ln A
time, s ec ond
E O S (-‐4 .92x10 -‐4) E R I (-‐1 .20x10 -‐4) B R (-‐1 .17x10 -‐4)
FIGURE 10. Reduction in tryptophan luminescence when irradiated with a blue light
source at a convenient wavelength and speed of tryptophan degradation.
5. DISCUSSION
Management of dental caries involves prescribing therapeutic regimens to
individuals according to their risk levels and optimal conservative treatment decisions
[24]. Based on this premise, different approaches to control cariogenic biofilms,
including the use of antimicrobial agents, have been employed for dental disinfection
[25]. The current study focuses on the use of PDT performed with different
photosensitizers, since a better understanding of S. mutans photoinactivation is an
important issue in Dentistry. In addition, the resulting production of reactive oxygen
species (ROS) was evaluated, particularly 1O2, because many of the bacteria that
cause oral infections do not express proteins that neutralize ROS, such as catalase and
superoxide dismutase [26].
Our results demonstrate that for MB, TBO, EOS and MG, neither the
photosensitizer alone, nor irradiation in the absence of a photosensitizer, had a
significant effect on the viability of S. mutans. Thus, our results confirm those of
previous studies on oral microorganisms [12,27,28] that conclude that there is no dark
toxicity from either component when used separately. However, for RB and ERI,
36
complete bacterial killing and a decrease in cell viability, respectively, were observed
in those groups where the photosensitizer alone was present. One possible explanation
for this is that the concentration used (163.5 µM) is high for these photosensitizers,
resulting in bacterial toxicity. According to Goulart et al. [29], RB becomes toxic for
A. actinomycetemcomitans at concentrations above 0.1 µM and is dose-dependent up
to 50 µM, when cell death is nearly 100%. A recent study demonstrated that PDT
performed using ERI was able to obtain a reduction of 5.16, while RB had a reduction
of 6.86 log10 CFU/mL on planktonic cultures of S. mutans when compared to the
control group. These photosensitizers did not present cytotoxicity in the absence of
light [30]. A concentration as low as 2 μM for both photosensitizers and fluence of 92
J cm-2 (4-fold higher than our) were used, explaining the different results obtained in
our study. With regard to S. mutans susceptibility to RB, another study demonstrated
that the dye shows toxicity in the dark per se in concentrations above 2.5 μM, which
is in agreement with our results [31]. Moreover, the latter study found that in these
concentrations RB also presented toxicity to fibroblasts, causing damage to human
cells [31].
It is possible to estimate the spectral overlap between emission and absorption
spectra by multiplying each wavelength of emission spectra and corresponding
absorption spectra. For blue light source, can be seen that the three absorption spectra
are superimposed on the spectrum of excitation (Figures 2A). Moreover, the fact that
the RB spectrum has its maximum absorption coinciding with the peak of excitement
is partly balanced by the fact that its maximum absorbance is about two times lower
than that of other photosentitizers. Thus, for the treatment with blue light, since, the
total energy absorbed by the three compounds is almost the same, and an accurate
calculation of the total energy value is unnecessary and misleading, since
experimental errors normally expected in this kind of experiment are much larger than
the difference between the estimated values. Furthermore, a detailed calculation of the
total absorbed energy would be extremely important if the photosensitizers spectra
were not so much overlapped in the emission spectrum region, or the RB absorption
peak was equal to the others, which would cause a much larger amount of light
absorption by this dye. However, the dark toxicity generated by RB and ERI did not
permit any reliable comparison between the different photosensitizers. Our findings
demonstrate that the greater antimicrobial efficacy observed with illuminated RB
37
against S. mutans can be attributed exclusively to the PS action. This phenomenon
could be observed by the outstanding antimicrobial action expressed in the presence
of RB, in spite of the absence of the light source. We recognize that if proper MICs
for different PSs had been used, the antimicrobial activity of each PS might have
shown different effects, thus, studies must be performed using lower concentrations of
RB and ERI to validate their use in PDT against S. mutans. However, it is essential
that the photosensitizer is not harmful to the cells alone, because in many cases it will
be present in healthy as well as targeted cells. To ensure this, the dark toxicity of the
photosensitizer must be very low, assuring the most destructive ability of the drug
comes from the production ROS by irradiation. Consequently, to test PSs in the same
molar concentration is important to determine the drug, which is capable of ensuring
that healthy cells will be not or minimally affected.
No microbial reduction was demonstrated with EOS. To the best of our
knowledge, no other study was performed using EOS in PDT against S. mutans.
According to our spectral analysis and to the literature, the peak of light absorption
for EOS and ERI are at 520 and 580, respectively, and the light source used in the
present study emits light predominantly in 570 nm. So, without considering the
overlapping area, these data could explain the slightly better results obtained for ERI
than for EOS since ERI-mediated PDT statistically reduced S. mutans when compared
to its respective control groups.
Despite the fact that MB and TBO are phenothiazine derivatives and have
similar chemical structures with physical and chemical properties and hydrophilic
features that allow their free passage across the bacterial membrane [32], the results
differed greatly between these two photosensitizers in the present study. Blue
methylene (MB) and toluidine blue orto (TBO) present a very similar spectrum
absorption in the region of the visible red light (≅ λ = 660 nm and 630 nm
respectively), similar tricycles chemical structure size and form what make them ideal
for intercalation with acids nucleic. Nevertheless, the predominant wavelength of the
red light source used in the current study was 636 nm, and the peak of maximum
absorption for MB, TBO and MG are 660, 640, 674 nm, respectively. Therefore, it
seems that the red light source used is capable of causing a more efficient absorption
by TBO, and this may partially explain the better results found with this
photosensitizer when compared to the others. Analyses of figure 2B shows that the
38
overlapping spectral for MG is approximately 2-fold higher than the that found for
MB, while the energy absorbed by TBO is about 3.5-fold greater than that absorbed
by MB. Therefore, the overlapping spectral of red light emission with TBO
absorption was important for obtaining phototoxic effects in vitro against S. mutans.
Thus, one can speculate that since this overlap was the highest one for this light
source, the other photosensitizers themselves absorbed less photons, and therefore
lesser amounts of reactive oxygen species were produced. Nevertheless, this
hypothesis seems unlikely, since MB was the photosensitizer that produced the
highest amount of 1O2, which indicates that the observed antimicrobial inefficacy did
not result from the total energy absorbed.
A distinguishing characteristic between these dyes is the partition coefficient
(P), which is almost 3-fold higher for TBO than for MB [33], indicating the higher
ability of TBO molecules to permeate and accumulate in the hydrophobic region of
the cellular membrane and therefore present better photobactericidal activities. In
addition, TBO is a more effective photobactericide and has a greater ability to
dimerize than MB. This pattern was consistently observed in both Gram-positive and
Gram-negative bacteria [34].
It is relevant to remember that the photodynamic efficacy of each
photosensitizer varies according to the target microorganisms. Thus, S.
mutans photoinactivation is reported to be caused mainly by membrane damage due
to lipid peroxidation [35], which is the probable action mechanism of TBO-mediated
PDT. Consequently, it can be hypothesized that MB did not provide efficient
antimicrobial effect due to its site of antibacterial action. TBO is known to be
membrane active causing an increase in permeability, whereas MB intercalates with
bacterial DNA, generating strand breaks in the organism’s nucleic acid, with resultant
genetic mutation and photodamage. MB-mediated antibacterial PDT has been
demonstrated to damage the outer cell membrane to a lesser extent than its ability to
cause bacterial cell DNA injury. Besides, the lack of antimicrobial effect of MB may
be due to the photosensitizer pre-illumination time. Photosensitizers that acts in the
nucleic acid will be apparent on longer incubation times [36], thus the 5-min pre-
irradiation time used in this study may not have been long enough for MB to reach its
specific target.
39
The penetration of photosensitizers into the cell is not a passive process. Since
the cell membrane acts as a selective barrier to free diffusion, penetration of
photosensitizer molecules depends on their size, charge and solubility, and they may
accumulate at particular subcellular locations or be associated with the more
hydrophobic regions of membranous organelles [37]. Differences in intracellular
concentration or localization between the photosensitizers may be responsible for the
variability in efficacy we observed in this study. The fact that both TBO and MB
produced higher levels of singlet oxygen after irradiation, while only TBO
demonstrated potent antimicrobial activity, may be due to different interactions with
the bacterial cell resulting from slight structural variations between the two
photosensitizers. It is important to remember that TBO interacts more easily with the
bacterial membrane than does MB, owing to its greater solubility in the hydrophobic
region of the membrane and the fact that it has the lowest molecular weight of all of
the photosensitizers studied here (305.83 g mol-1), allowing it to diffuse more easily.
Thus, it is not without reason that TBO is one of the most widely used
photosensitizers in PDT research [23,33]. It should be emphasized that only TBO and
MG caused bacterial reduction compared to their respective control groups. However,
MG was not able to show a biologically significant reduction, since it only presented
a 1.4 log reduction in S. mutans.
Nymam and Hynninen [38] have emphasized that special attention should be
paid to the singlet oxygen yield (UD) of each photosensitizer because the type II
photochemical reaction, which generates singlet molecular oxygen, represents the
dominant process for most of the photosensitizers employed in PDT [39]. The
correlation between singlet oxygen production and the efficacy of a treatment regimen
could be one important issue to be incorporated into guidelines for PDT use [40].
Consequently, the relative production of singlet oxygen during irradiation with red
and blue light sources was determined in the present study. Among all the
photosensitizers tested, MB and TBO were most effective in reducing the
luminescence of tryptophan when irradiated with red light. The rates of tryptophan
decay indicate that MB degrades tryptophan 27% faster than does TBO. However, the
most potent bactericidal activity was achieved with TBO and MG, which did not
present the highest in vitro singlet oxygen production rate. One possible explanation
for this phenomenon is that TBO and MB have different interaction mechanisms with
40
bacteria, as has been previously described. Thus, the bulk in vitro -1O2 production may
not be related to the ability of the photosensitizer to get into or closer to the bacterial
activity site. Even though singlet O2 production was high for MB samples, if this ERO
is not in close contact with bacterial cell DNA it will not have any effect on killing S.
mutans.
Although without biological significance, MG was another photosensitizer
irradiated with a red light source, which delivered promising results against S. mutans.
However, MG did not produce singlet oxygen, indicating that the antimicrobial
activity of PDT may also be promoted by other ROS. Indeed, a previous study has
demonstrated that MG-induced photodamage occurs via the classical type I
photosensitization mechanism, with very little contribution from type II reactions
[41].
The photosensitizers irradiated by a blue light source produced a lower
amount of singlet oxygen than the other photosensitizers irradiated by red light
source. ERI exhibited some toxicity to the bacteria, even without irradiation.
However, irradiation increased the antimicrobial activity of ERI, suggesting that the
ROS formed after irradiation are responsible for this increase. The fact that all of the
red compounds produced singlet oxygen, but only ERI exhibited an antimicrobial
effect, emphasizes that other factors influence the effectiveness of PDT. These factors
may include the pharmacodynamic properties of the photosensitizer, such as cellular
penetration, localization and influx and efflux parameters; the intracellular stability
and activity of the photosensitizer; and sufficient targeting of the photosensitizer
toward the pathogen [37]. Another consideration is that the blue light used was not
derived from an LED, and the lack of collimation and coherence may decrease the
efficacy of PDT. It can be speculated that a reduction on the quantity of blue light
delivered or absorbed by the photosensitizers occurred due to a higher dissipation of
energy, despite the focusing light tip in this light source [42]. Some of the limitations
considered in this study include energy density calculation for lights with filter tip
performed similarly to that used for calculation in LED sources, and the lack of a
suitable method for calculating dissipated energy.
In conclusion, the efficacy of a given photosensitizer for photodestruction can
vary, even if there are similar levels of in vitro singlet oxygen production. Therefore,
singlet oxygen production is not the most relevant parameter to consider when
41
evaluating the antimicrobial activity of PDT against S. mutans. Due to the parameters
chosen to perform the present study such as molar concentration, light source
characteristics and pre-irradiation time, RB and ERI exhibited cytotoxicity at
concentrations as low as 163.5 µM, while TBO and MG were effective in decreasing
S. mutans counts after PDT, although only TBO was effective in reducing 3-log of
these microorganisms.
ACKNOWLEDGEMENTS
The authors thank Bruna Melo de Codes for her help during experimental procedures.
REFERENCES
[1]. B.C. WILSON, S.M. PATTERSON, The physics, biophysics and technology of
photodynamic therapy, Phy. Med. Biol 53 (2008) 61-109.
[2]. A.C KÜBLER, Photodynamic therapy, Med Laser Appl 20 (2005) 37-45.
[3]. M. OCHSNER, Photophysical and photobiological processes in the
photodynamic therapy of tumors, J Photochem Photobiol B: Biol 39(1997) 1–18.
[4]. J.J.L. CADET, G.R.RAVANAT, M.H. MARTINEZ, P. MEDEIROS, DI
MASCIO, Singlet oxygen oxidation of isolated and cellular DNA: Product formation
and mechanistic insights, Photochem. Photobiol 82 (2006) 1219–1225.
[5]. R. SCHMIDT, Photosensitized generation of singlet oxygen, Photochem.
Photobiol 82 (2006) 1161–1177.
[6]. Z. MALIK, J. HANANIA, Y. NITZAN, Bactericidal effects of photoactivated
porphyrins--an alternative approach to antimicrobial drugs, J. Photochem. Photobiol.
B5 (1990) 281-293.
[7]. M. BHATTI, A. MACROBERT, S. MEGHJI, B. HENDERSON, M. WILSON,
Effect of dosimetric and physiological factors on the lethal photosensitization of
Porphyromonasgingivalis in vitro, Photochem. Photobiol 65 (1997) 1026-31.
[8]. M.R. HAMBLIN, T. HASAN, Photodynamic therapy: a new anti-microbial
approach to infectious disease?, Photochem Photobial Sci 3 (2004) 436–450.
[9]. S. CRIADO, S. G. BERTOLOTTI, N.A. GARCÍA, Kinetics aspects of the rose
Bengal-sensitized photo-oxygenation of tryptophan alkyl esters. Ground state and
photopromoted dye-(tryptophan derivative interactions, J. Photochem. Photobiol. B
(1996) 3479-86.
42
[10]. J.S.M. GIUSTI, L. SANTOS-PINTO, A.C PIZZOLITO, K. HELMERSON, E.
CARVALHO-FILHO, C. KURACHI, V.S. BAGNATO, Antimicrobial photodynamic
action on dentin using a light-emitting diode light source, Photomed. Laser. Surg 26
(2008) 279-285.
[11]. I.C.J. ZANIN, R.B. GONCALVES, A. BRUGNERA-JR, C.K. HOPE, J.
PRATTEN, Susceptibility of Streptococcus mutans biofilms to photodynamic
therapy: an in vitro study, J. Antimicrob. Chemother 56 (2005) 324-330.
[12]. I.C. ZANIN, M.M. LOBO, L.K. RODRIGUES, L.A. PIMENTA, J.F.
HOFLING, R.B. GONCALVES, Photosensitization of in vitro biofilms by toluidine
blue O combined with a light-emitting diode, Eur. J. Oral. Sci 114 (2006) 64-69.
[13]. M. MERCHAT, G. BERTOLINI, P. GIACOMINI, A. VILLA NUEVA, G.
JORI, Meso-substituted cationic porphyrins as efficient photosensitizers of Gram-
positive and Gram-negative bacteria, J. Photochem. Photobiol: B 32 (1996) 153–157.
[14]. M. WILSON, Photolysis of oral bacteria and its potential use in the treatment of
caries and periodontal disease, J. Appl. Bacteriol 75 (1993) 299-306.
[15]. K. PLAETZER, T. KIESSLICH, T. VERWANGER, B. KRAMMER, The
modes of cell death induced by PDT: An Overview, Med. Laser. Appl 18 (2003) 7-
19.
[16]. B.C. WILSON, The physics of photodynamic therapy, Phys. Med. Biol 31
(1986) 327-360.
[17]. J.P.M. LIMA, M.A. SAMPAIO DE MELO, F.M.BORGES, A.H. TEIXEIRA,
C. STEINER-OLIVEIRA, M. NOBRE DOS SANTOS, L.K. RODRIGUES, I.C.
ZANIN, Evaluation of the antimicrobial effect of photodynamic antimicrobial therapy
in an in situ model of dentine caries, Eur. J. Oral. Sci. 117 (2009) 568-74.
[18]. M.A.S. MELO, D.M. DE-PAULA, J.P.M. LIMA, F.M.C. BORGES, C.
STEINER-OLIVEIRA, M. NOBRE-DOS-SANTOS, I.C.J. ZANIN, E.B. BARROS,
L. K.A. RODRIGUES, In Vitro Photodynamic Antimicrobial Chemotherapy in
Dentine Contaminated by Cariogenic Bacteria, Laser Physics 20 (2010) 1–10.
[19]. L.S. PELOI, R.S.S. SOARES, C.E.G. BIONDO, V.R. SOUZA, N. HIOKA, E.
KIMURA, Photodynamic effect of light-emitting diode light on cell growth inhibition
induced by methylene blue, J. Biosci. 33 (2008) 231–237
[20]. R.A. PRATES, A.M. YAMADA JR, L.C. SUZUKI, M.C. EIKO
HASHIMOTO, S. CAI, S. GOUW-SOARES, L. GOMES, M.S RIBEIRO,
43
Bactericidal effect of malachite green and red laser on Actinobacillus
actinomycetemcomitans, J. Photochem. Photobiol B 86 (2007) 70-6.
[21]. D. METCALF, C. ROBINSON, D. DEVINE, S. WOOD, Enhancement of
erythrosine-mediated photodynamic therapy of Streptococcus mutans biofilms by
light fractionation, J. Antimicrobial. Chemotherapy 58 (2006) 190–192.
[22]. M. NISNEVITCH, F. NAKONECHNY, Y. NITZAN, K. BIOORG,
Photodynamic antimicrobial chemotherapy by liposome-encapsulated water-soluble
photosensitizers, Bioorg. Khim 6 (2010) 396-402.
[23]. R.C. SOUZA, J.C. JUNQUEIRA, R.D. ROSSONI, C.A. PEREIRA, E. MUNIN,
A.O. JORGE, Comparison of the photodynamic fungicidal efficacy of methylene
blue, toluidine blue, malachite green and low-power laser irradiation alone against
Candida albicans, Lasers. Med. Sci 25 (2010) 385-9.
[24]. K. ANUSAVICE, Clinical decision-making for coronal caries management in
the permanent dentition, J. Dent. Educ 65 (2001) 1143-1146.
[25]. M.S. WOLFF, C. LARSON, The cariogenic dental biofilm: good, bad or just
something to control?, Braz. Oral. Res. 23 (2009) 31-38 .
[26]. K.L. RUOFF, Miscellaneous catalase-negative, gram-positive cocci: Emerging
opportunists, J. Clin. Microbiol 40 (2002) 1129-1133.
[27]. J.A. WILLIAMS, G.J. PEARSON, M.J. COLLES, M. WILSON, The effect of
variable energy input from a novel light source on the photoactivated bactericidal
action of toluidine blue O on Streptococcus Mutans, Caries Res. 37 (2003) 190-193.
[28]. N.S. SOUKOS, S.S. SOCRANSKY, S.E. MULHOLLAND, S. LEE, A.G.
DOUKAS, Photomechanical drug delivery into bacterial biofilms, Pharmaceutical.
Res 17 (2003) 405-409.
[29]. R.C. GOULART, M. BOLEAN, T.P. PAULINO, G. THEDEI, S.L.S. SOUZA,
A.C. TEDESCO, P.CIANCAGLINI, Photodynamic therapy in Planktonic and biofilm
cultures of Aggregatibacter actinomycetemcomitans, Photomed. Laser. Surg 28
(2010) 53-60.
[30].A. C. COSTA, J. CHIBEBE JUNIOR, C. A. PEREIRA, A.K. MACHADO, M.
BELTRANEJUNIOR,J.C.JUNQUEIRA,A.O.JORGE,Susceptibility of planktonic
cultures of Streptococcus mutans to photodynamic therapy with a light-emitting
diode, Braz. Oral. Res 24 (2010) 413-418.
44
[31]. T. P. PAULINO, K. F. RIBEIRO, G. THEDEI JR., A. C. TEDESCO, P.
CIANCAGLINIA, Use of hand held photopolymerizer to photoinactivate
Streptococcus mutans, Arch. Oral. Biol 50 (2005) 353 -359.
[32] G. JORI, C. FABRIS, M. SONCIN, S. FERRO, O. COPPELLOTTI, D. DEI, L.
FANTETTI, G. CHITI, G. RONCUCCI, Photodynamic Therapy in the Treatment of
Microbial Infections: Basic Principles and Perspective Applications, Lasers. Surg.
Med 38 (2006) 468–481.
[33]. M.N. USACHEVA, M.C. TEICHERT, M.A. BIEL, Comparison of the
methylene blue and toluidine blue photobactericidal efficacy against Gram-positive
and Gram-negative microorganisms, Lasers Surg Med29 (2001) 165–173.
[34]. M. N. USACHEVA, M. C. TEICHERT, M.A. BIEL, The role of the methylene
blue and toluidine blue monomers and dimers in the photoinactivation of bacteria, J
Photochem and Photobiol B: Biol 71 (2003) 87–98.
[35]. S. WOOD, D. METCALF, D. DEVINE, C. ROBINSON, Erythrosine is a
potential photosensitizer for the photodynamic therapy of oral plaque biofilms, J
Antimicrob Chemother 57 (2006) 680-4.
[36]. M. WAINWRIGHT, Methylene blue derivatives-suitable photoantimicrobials
for blood product disinfection?, Int J Antimicrob Agents 16 (2000) 381-94.
[37]. O.E. AKILOV, K. O’RIORDAN, S. KOSAKA, T. HASAN, Photodynamic
therapy against intracellular pathogens: Problems and potentials, Med. Laser. Appl 21
(2006) 251-260.
[38]. E.S. NYMAN, P.H. HYNNINEN, Research advances in the use of tetrapyrrolic
photosensitizers for photodynamic therapy, J. Photochem. Photobiol. B: 73 (2004) 1–
28.
[39]. D.P. VALENZENO, Photomodification of biological membranes with emphasis
on singlet oxygen mechanisms, Photochem. Photobiol 46 (1987) 147–160.
[40]. T. MAISCH, Anti-microbial photodynamic therapy: useful in the future?, Lasers
Med Sci 22 (2007) 83–91.
[41]. J.A. BARTLETT, G.L. INDIG, Spectroscopic and photochemical properties of
malachite green non covalent bound to bovine serum albumin, Dyes. Pigments (1999)
43 219-226.
[42]. T S. MANG, Lasers and light sources for PDT: past, present and future,
Photodiagnosis Photodyn Ther 1 (2004) 43-48.
45
3.2. CAPÍTULO 2
Confocal Raman study of photosensitizer penetration in artificially dentin
caries lesions
Juliana Paiva Marques Lima ROLIM1; Mary Anne Sampaio DE-MELO1; Iriana Carla
Junqueira ZANIN1; José Júnior Alves DA-SILVA2; Alexandre Rocha PASCHOAL2;
Alejandro Pedro AYALA2; Nádia Accioly Pinto NOGUEIRA1, Lidiany Karla
Azevedo RODRIGUES1 1 Post-graduation Program, Faculty of Pharmacy, Dentistry and Nursing, Federal University of Ceará, Brazil, 944 Cap. Francisco Pedro Street - Rodolfo Teófilo, Zip Code: 60430-170 2 Physics Department, Federal University of Ceara, Fortaleza, Ceará, Brazil, Pici
Campus – Build # 922 – Fortaleza, Ceara, Brazil Zip code: 60455-760
Address all correspondence to:
Prof. Lidiany Karla Azevedo Rodrigues, DDS, MSc, PhD, Associate Professor Department of Dentistry, Faculty of Pharmacy, Dentistry and Nursing, Federal University of Ceara, Fortaleza, Ceara, Brazil Cap. Francisco Pedro Street - Rodolfo Teófilo – Zip Code: 60430-170 Phone- #558533668410, Fax- #558533668232 Email: lidianykarla@yahoo.com
Keywords: Photodynamic therapy; Dentin; Dental caries; dye penetration
46
ABSTRACT
The antimicrobial effect of photodynamic antimicrobial therapy (PACT) on
microorganisms located in carious dentin is dependent on the photosensitizer (PS)
penetration inside the tissue. Thus, understanding the penetration of PSs at the
molecular level is an important issue. This study determined the degree of toluidine
blue ortho (TBO) penetration in demineralised dentin using confocal Raman
microspectroscopy (CRM). Dentin specimens (n=10) were submitted to in vitro or in
situ microbial models of dentin caries induction and treated with TBO for 5 min. The
lesion depth and demineralisation level were accessed by cross-sectional
microhardness (MH). The samples were analysed with CRM mapping across the
dentin surface. Raman spectra were collected from non-caries dentin specimens
treated with TBO, and the ratios of the relative intensities of the Raman bands
corresponding to the TBO and collagen were used as references. By the Raman band
intensity of TBO, the presence of TBO as a function of spatial position across the area
was determined. The MH and CRM data were analysed by t-test and one-way
ANOVA, respectively (p<0.05). The lesion depth and mineral loss values were higher
for in situ specimens compared with in vitro samples (p < 0.05). The mean (SD)
penetration values (µm) for the control, in vitro and in situ data were 44.8 (5.6), 46.1
(4.5) and 51.2 (8.5), respectively. There were no statistically significant differences
among the groups (p=0.097). This investigation confirmed the diffusion of TBO into
sound or demineralised dentin, but dentin demineralisation degree did not increase the
level of TBO penetration.
47
INTRODUCTION
Photodynamic antimicrobial therapy (PACT) is a treatment modality for tissue
infection that involves delivering harmless visible light of an appropriate wavelength
to promote molecules from non-toxic dyes or photosensitizer (PS) into the excited
state. This excited PS then transfers energy to ground-state molecular oxygen to
produce excited-state singlet oxygen and free radicals that can oxidise many
organisms, such as bacteria, fungi and yeast, and lead to the injury and death of
microorganisms (1,2). Thus, PACT has been associated with minimal intervention
dentistry as a potential alternative to oral bacteria inactivation in the remaining
demineralized dentine tissue, contributing to a minimal removal of carious tissues and
a more conservative approach for dealing with deep caries lesions (3). Several studies
have suggested PACT is an effective approach to eradicate cariogenic bacteria that
infect the tooth tissue (4-7).
Considering the anatomical features of dentin, which is a porous, hard,
mineralised connective tissue composed primarily of tubular hydroxyapatite-coated
collagen type I fibrils with changes in the relative proportions of dentinal tubules
within different areas of the dentin (8), bacteria from carious lesions and their
bacterial products can penetrate and diffuse profoundly through the dentinal tubule
toward the pulp and promote inflammatory changes in the pulp-dentin complex (9).
Thus, a key factor for clinical success is that the photosensitizer should be able to
achieve and interact with the target bacteria inside the tissues.
Currently, the effectiveness of PACT on oral microorganisms in caries dentin
tissue has been facing limitations. First, the elimination of bacteria located in
demineralised dentin can be reduced, possibly due to lower penetration of
photosensitizer to reach and then bind to the bacteria cells inside the dentinal tubules
(10). Second, the bacteria may be located below the range of effective light
penetration, and the clinical PACT performance will be necessarily limited to those
areas where the light can be delivered relatively easily to photoactivate the
photosensitizer attached to the bacteria. Additionally, the lack of accurate dosimetry
and undefined treatment parameters has diminished the success of PACT (11). For
PACT to be of use clinically, effective delivery methods for both the light and PS to
the site of action are necessary.
48
The analysis of topically applied dyes into the dentin tissue is important for
understanding and defining the mechanisms by which the development of optimized
and effective bacterial killing methods can be achieved. Likewise, the method of
penetration analysis by histological sectioning using the classic management by visual
dye penetration analysis may present less acuracy. In addition, care must be taken
with dyes that could act as redox indicators and be colourless within certain pH
ranges (12).
Confocal Raman microspectroscopy is becoming an invaluable technique for
the quantitative determination of the molecular chemistry of microscopic samples
directly in situ, and it has been applied to biological sciences (13,14). Raman
scattering has been shown to be a prominent non-invasive optical spectroscopic tool
for penetration studies by providing quantitative biochemical information about tissue
composition (15).
The present study aimed to clarify the impact of the dye penetration on PACT
approach in carious tissue and quantify the diffusion of a widely used photosensitizer
toluidine blue ortho (TBO) into the demineralized dentin produced by an in vitro and
in situ producing by caries-like-lesions microbial model.
MATERIALS AND METHODS
First, coronal dentin slabs (5 x 5 x 2 mm2) were obtained using a water-cooled
diamond saw and a cutting machine (Isomet ™ Low Speed Saw, Buehler, Lake Bluff,
IL, USA). The slabs were subsequently flattened with water-cooled abrasive discs in
series (320, 600, and 1200 grit Al2O3 papers; Buehler, Lake Bluff, IL, USA) and
polished with felt paper and diamond spray (1 µm; Buehler, Lake Bluff, IL, USA).
The slabs were immersed in distilled water and then sterilised by autoclaving at
121°C for 15 minutes (16). The specimens were stored in humidity throughout the
study period to avoid dryness of the dentin surface.
For selection and randomised distribution purposes, the surface microhardness
was determined for each sample by performing five indentations (Knoop diamond, 25
g, 5 sec) (FM 100, Future Tech, Tokyo, Japan) in the centre of the dentin surface. The
dentin slabs presenting microhardness mean values around 53.15 ± 5.31 Knoop
hardness number (KHN) were selected.
49
After that, samples were randomly allocated in three groups, with ten
experimental units per group, according to a computer-generated randomisation list:
(G1) sound (control), (G2) caries-like lesion artificially developed by an in vitro
model and (G3) caries-like lesion artificially developed by an in situ model.
In situ demineralization model
The in situ and in vitro models of the present study was approved by the
Research and Ethics Committee (Protocol # 143/2006) and conformed to the
Resolution # 196/96 of the National Health Council concerning the Human Research
Code of Ethics and The Code of Ethics of the World Medical Association
(Declaration of Helsinki) for experiments involving humans. This in situ model was
similar to those reported in previous studies where 10 volunteers wore an acrylic
palatal device containing human dentin slab for 14-days period in which the
cariogenic challenge was provided by dripping a 40% sucrose solution onto all dentin
slabs 10x/day according the methodology described by Lima et al. (6).
In vitro demineralization model
The slabs selected for this group were fixed in the lids of glass container
vessels with plastic rods and submitted to a demineralization model according to
Melo et al.(17). The dentin slabs were immersed in sterile BHI containing 5% sucrose
(w/v). All BHI-containing recipients, except the not-inoculated group (untreated),
were inoculated with S. mutans CTT 3440. The dentin specimens were transferred to
fresh medium every day for 5 days. In addition, each BHI-containing recipient was
streaked onto a new fresh BHI agar media plated and incubated at 37°C in an
atmosphere of 10% CO2 for 24 h to check absence of contamination.
Confocal Raman microspectroscopy
At the end of the model periods, the 5th day in vitro and 14th day in situ, all the
slabs were randomly investigated by confocal Raman spectroscopic analysis. The
images were performed using an alpha300S confocal Raman microscope (WITec,
Ulm, Germany) with a piezo scan stage (100 x 100 x 20 μm). The system was
equipped with a 20x microscope objective for measuring in air with a working
distance of 0.26 mm and a numerical aperture of 0.90 (Nikon, Düsseldorf, Germany)
50
focused into a multi-mode fibre (50 µm) that acts as a pinhole for the confocal
microscope. The microscope objective was used to focus the excitation beam of a
2mW-Nd:YAG laser (532 nm emission) onto the surface and to collect the scattered
light. The output power was limited to 100 mW so that the surface would not be
burned. The zero-th order light was blocked by a long-pass edge filter for 532 nm.
Initially, the Raman spectra of dentin slabs and photosensitizer were recorded
singly to find a Raman signal from the dye, which must be distinguishable from other
dental tissue components. In the following, 5 µl of photosensitizer (TBO, 100 µg ml-1)
dissolved in distilled water was applied in the superficies of the slabs for 5 minutes
(pre-irradiation time) without light exposure. The Raman spectra of the sample were
measured at different depths by moving the focal plane in the axial direction. Thus,
the Raman spectra were successively recorded along line scans perpendicular to the
interface. The laser beam was focused onto the sample surface with a 20x lens. The
dentin slab was placed on a computer-controlled table, and the sample was moved
relative to the laser spot position by a 3-axis stage.
The surface area to be scanned was carefully selected in the centre of the slab,
and the line scan began at 100 µm from this area. Considering the confocal setup,
collecting information from the sample surface was possible, but looking deep inside
the samples and obtaining 3D information were also possible. During the Raman
imaging, a spectrum (∼1000 cm−1 width) of each position of the laser beam inside the
sample was recorded. The Raman spectra of each line scan were post-conditioned by
software (WITec Project version 1.88, WITec, GmbH, Germany), and the full width
at half-maximum (FWHM) of the intensity profile was used as a criterion for the axial
measurements. The characteristics of the dye spectra collected, such as the integrated
intensity of a particular spectral band, can also be examined. The spectra were Raman
shift frequency-calibrated using known lines of silicon.
Cross-Section Microhardness Testing (CSMH)
In parallel to the above analysis, the longitudinal hardness of the slabs subject
to in vitro and in situ artificial caries formation was obtained for determining the
depth of carious lesions and level of demineralisation in both situations.
The dentin slabs were longitudinally sectioned at the center. The segments
were embedded in acrylic resin and serially polished. The cross-sectional
51
microhardness measurements were made with a microhardness tester (Future Tech
FM-ARS, Tokyo, Japan) with a Knoop diamond under a 25 g load for 5 s. A lane of
thirteen indentations was made. The indentations were made at the following depths:
10, 20, 30, 40, 50, 60, 80, 100, 120, 140, 160, 180 and 200 μm.
The mean Knoop hardness number (KHN) values were obtained. Thus, KHN
was plotted against depth for each specimen, and the integrated hardness profile of the
demineralisation was calculated relative to the underlying sound dentin. The mean
sound dentin values of KHN for the computation of integrated demineralisation were
obtained from inner sound dentin under the lesion in the same tooth.
For the calculation of the depth of the caries lesion, the hardness values of
dentin of 60 or less were considered. The calculations were made according to the
study of Sousa et al.(18).
Statistical Analysis
Descriptive statistics (mean and standard deviation) of the measurements of
dye penetration in µm were recorded for each sample. The data were analysed
statistically by a one-way ANOVA. The lesion depth and demineralisation level were
analysed by t-test. The significance level was set at 5%. The software BioStat 2007
Professional (AnalystSoft Robust Business Solutions Company, Vancouver, British
Columbia, Canada) was used.
RESULTS
All spectra were recorded in the region of 877–1785 cm-1, which covers the
fingerprint region associated with dentin mineral, collagen and dye. The spectra were
taken as a direct indication of the chemical composition of dentin tissue. The most
intense peak at 961 cm-1 (v1 symmetric stretch, PO43-) is assigned to the dentin mineral
phosphate. The peak at 1070 cm-1 [n1 symmetric stretch, CO32-) is assigned to the
mineral carbonate. The dentin collagen matrix features are present at 1667 (backbone
amide I), 1452 (CH2), 1273 (amide III) and 1242 cm-1 (amide III).
Medicinally useful photosensitizes are usually aromatic molecules that are
efficient in the formation of long-lived triplet excited states. Referring to toluidine
blue orto, its chemical formula is described as CH3C6H4NH2 with a molecular weight
52
of 107.16 g/mol. In an aqueous solution, the toluidine blue-orto behaves as a cationic
dye that has an area with a variable range.
The Raman spectrum of the TBO sample shows stretching vibrations of C=C,
C=N and S-C bonds at 1759, 1639 and 1167 cm−1, respectively. A strong peak at 1618
cm−1 and a weak peak at 1452 cm−1 are attributed to the vibration of the aromatic
rings. This characteristic peak of the TBO structure at 1618 cm−1 was observed and
selected to be the reference. Variations in the absolute peak position by up to 5 cm-1
are considered within the accuracy of the experimental set-up.
Representative mapping spectra across the in vitro and in situ dentin slab are
shown in Figs. 1 and 2, respectively. Yellow represents high intensity, and dark
brown represents low intensity. The plot is oriented in Z-axis and the photosensitizer
is represented by in higher intensity of the image (Fig. 3 and 4).
The decreased intensity of the Raman peaks attributed to the photosensitizer
(1618 cm-1) across the sample indicates the gradual decline of TBO infiltration into
the dentin. The average penetration of the dye in each group was described in Tab. 1.
Most of the intensity assigned to the TBO remains approximately 46 μm, showing
largely similar penetration among the groups. The data from the deep penetration
from the in situ artificial caries-like lesion was higher than the other groups, although
a statistically significant difference was not found. Only traces of the PS can be
observed below 50 μm, and nothing can be detected in the deeper zone (>70 µm),
suggesting that the photosensitizer does not infiltrate to the depth of the dentin
demineralisation beyond this point. The intensity assigned to the dental compound is
still detectable, indicating that only the photosensitizer was totally absent from this
region.
When the demineralisation parameter was compared between the in vitro and
in situ studies, the values were significantly lower for the in vitro challenge (p<0.05).
A similar result was found for the lesion depth analysis, statistical difference between
the in vitro and in situ cariogenic challenges was approximately 100 and 170 µm,
respectively (p< 0.0001).
53
FIGURE 1. Raman spectra recorded from the photosensitizer-TBO; in vitro caries-
affected dentin and dentin sensitized by TBO. Rescaled and offset for clarity.
FIGURE 2. Raman spectra recorded from the photosensitizer-TBO; in vitro caries-
affected dentin and dentin sensitized by TBO. Rescaled and offset for clarity.
54
FIGURE 3. Micro-Raman mapping spectra acquired at 1-mm intervals across the in
vitro caries dentin slab (left); a spatial range of 10 µm x 200 µm across the sample
and a single spectrum of higher intensity area (right).
55
FIGURE 4. Micro-Raman mapping spectra acquired at 1-mm intervals across the in
situ caries dentin slab (left); a spatial range of 10 µm x 200 µm across the sample and
a single spectrum of higher intensity area (right).
Table1. Data of integrated demineralization(ΔS), lesion depth and photosensitizer’s
penetration in lesions produced by different artificial caries development models and
r2 and p values obtained by liner regression.
Microbial caries-inducing
models
Demineralization (ΔS) r2 p
Dentin lesion depth (µm)
r2 p Photosensitizer’
s penetration (µm)
Control ( no demineralization) - - - - - -
44.1±5.7a
In vitro model 3309.4±384.7 A
0.12 0.31 109.1±
26.1 A
0.09 0.38 45.3±5.2
a
In situ model 5271.9±1317.0 B
0.04 0.49 177.3±
19.8 B
0.26 0.071 52.6±9.6
a
Different letters represent statistically significant differences of means (p <0.05)
DISCUSSION
To carry out PACT effectively in vivo, the most important factor is to govern
the outcome of PACT ensuring that both principal components, the light and PS,
sufficiently reach all the target bacteria. This factor involves light delivery and the
relative effects of the absorption and scattering of light related to the loss of the
fluence rate (19). In addition, considering the most PS chemical compounds, the first
crucial step is to get the drug in the target location, specifically, here leads the dye
reach bacteria inside a complex configuration of intertubular and tubular dentin
(48.000 dentinal tubules/ mm3)(20). Bacteria and their products can diffuse through
the dentinal tubule toward reach deep areas (493 to 525 µm) (20) reflecting a critical
factor for the clinical success of photodynamic therapy.
This in vitro study has shown that TBO, well-known photosensitizer against S.
mutans (21), readily penetrated into the dentin through dentinal tubules. The
fluorescent dye molecules are taken up from the interprismatic spaces into the
56
dentinal tubules, which seem to act as channels to lead the dye molecules into the
pulp cavity. This confirms that the dentin significantly permeable to photosensitizers.
The result of the TBO evaluation across the entire length of coronal
demineralized dentin shows a lower level of penetration, approximately 46 µm.
Considering these dye penetration stages in demineralized dentin, this fact may give
us a preliminary quantitative understanding of the differences that are observed in the
in PACT studies in carious dentin as possible explanation (4,7,17).
Although it has been shown higher values in the in situ experiment compared
with the in vitro assay, the demineralisation degree and depth of the lesion caries did
not provide a greater degree of dye penetration. This observation explains the
difference in the results of photodynamic therapy studies involving planktonic and
biofilm cultures to the detriment of studies that examined the antimicrobial
effectiveness of PACT in dentin. Burns et al. (22) showed that the S. mutans death
after PACT was lower when a demineralized dentin slice was present compared with
the absence of these slices. Other study arranged by Williams et al. (23) showed log
reduction of 8-10 cfu/ml when S. mutans planktonic suspensions was exposed to TBO
and laser light system. However, research in vitro and in situ that analysed the
effectiveness of PACT in S. mutans located in carious lesions showed microbial
reductions of 2.5 and 3 logs, respectively, in an initial microbial population of 5 logs
(6,17). Carious lesions formed by in vitro and in situ models are characterised by
being less demineralised and disorganised compared with caries lesions in vivo, but a
PACT clinical study still showed a slight reduction in the microbial population (24).
In case of photosensitizer penetration, besides the particularities of dentin
tissue, many factors can interfere in this process. It is dependent on solubility,
concentration and particle size of used photosensitizer. Other factors are capillary
forces, osmotic gradients and concentration gradients (25). George and Kishen. (26)
showed, by a visual examination of the cross section of specimens that the extension
of methylene blue penetration, dissolved in water, into dentinal tubules was of
approximately 15% of extension, the least penetration in relation to different
formulations tested. The same authors had suggested a multicomponent formulation
with mixture of glycerol:ethanol:water (30:20:50) to facilitate the photosensitizer
diffusion into dentinal tubules based on glycerol and ethanol, which are widely used
vehicles for various commercial products.
57
Recently, the use of polymer-based nanoparticles for photosensitizer delivery
and release systems has been suggested (27,28). Pagonis et al. (29) evaluated the in
vitro effects of nanoparticles loaded with the photosensitizer methylene blue in
antimicrobial photo-disinfection of the infected radicular human dentin and suggested
that the synergism of light and photosensitizer-loaded nanoparticles offered a novel
design for a nanoplatform for enhanced drug delivery in the root canal system and the
photo-destruction of root canal biofilms. Gold nanoparticles still are able to enhance
the ability of the PS to kill bacteria, ensuring an improvement in antimicrobial
Photodynamic therapy activity (30-32). TBO-loaded gold nanoparticles will be able to
increase the bacterial reduction to greater values as suggested by Naik et al. (33).
Therefore, the application of Raman spectroscopy as a depth profiling method
expressed here has been demonstrated to be able to monitor topically applied
substances in dentin. This is consistent with previous reports with respect to the
dental adhesive systems yield (13-15), which showed that the molecular selectivity of
the method provides the means to separate the Raman signal of the substance from the
dental signal. This advantage is great when the substance applied is to be studied
without interference from the substance itself.
In conclusion, this investigation confirmed the diffusion of TBO and also
showed that similar penetration patterns of photosensitizer were reached in different
demineralized dentin substrates. The lower photosensitizer penetration results showed
the relevance of the influence of the dye profiles in the development of a dosimetry
procedure approach to formulation design and the subsequent success in clinical trials
of PACT in the dental caries field.
The author(s) declare no potential conflicts of interest with respect to the authorship
and/or publication of this article. This research received no specific grant from any
funding agency in the public, commercial or not-for-profit sectors.
58
REFERENCES
1. Dai T, Huang YY, Hamblin MR. 2009. Photodynamic therapy for localized
infections--state of the art. Photodiagnosis Photodyn Ther 6:170-88.
2. Huang L, Dai T, Hamblin MR.2010. Antimicrobial photodynamic inactivation
and photodynamic therapy for infections. Methods Mol Biol 635:155-73.
3. Wilson M. 2004. Lethal photosensitisation of oral bacteria and its potential
application in the photodynamic therapy of oral infections. Photochem
Photobiol Sci 3:412–418.
4. Giusti JS, Santos-Pinto L, Pizzolito AC, Helmerson K, Carvalho-Filho E,
Kurachi C, Bagnato VS. 2008. Antimicrobial photodynamic action on dentin
using a light-emitting diode light source. Photomed Laser Surg 26:281-7.
5. Costa AC, Chibebe Junior J, Pereira CA, Machado AK, Beltrame Junior M,
Junqueira JC, Jorge AO. 2010. Susceptibility of planktonic cultures of
Streptococcus mutans to photodynamic therapy with a light-emitting diode.
Braz Oral Res 24:413-8
6. Lima JPM, Sampaio de Melo MA, Borges FMC, Teixeira AH, Steiner-
Oliveira C, Nobre dos Santos M, Rodrigues LKA, Zanin ICJ. 2009.
Evaluation of the antimicrobial effect of photodynamic antimicrobial therapy
in an in situ model of dentine caries. Eur J Oral Sci 117: 568–574.
7. Monteiro-Oliveira MP, Rodrigues LKA, De Melo MAS, Nobre-dos-Santos M. 2010. Photodynamic Therapy Effect in Carious Bovine Dentin - An In Vitro
Study. J Oral Laser Applications 10: 29-36.
8. Schilke R, Lisson JA, Bauss O, Geurtsen W. 2000. Comparison of the number
and diameter of dentinal tubules in human and bovine dentine by scanning
electron microscopic investigation. Arch Oral Biol 45:355-61.
9. Love RM, Jenkinson HF. 2002. Invasion of dentinal tubules by oral bacteria.
Crit Rev Oral Biol Med 13:171-83.
10. Konopka K, Goslinski T. 2007. Photodynamic Therapy in Dentistry. J Dent
Res 86:694-707.
11. Dai T, Huang YY, Hamblin MR. 2009. Photodynamictherapy for
localizedinfections--stateofthe art.Photodiagnosis Photodyn Ther 6:170-88.
59
12. Mjör IA. 2009. Dentin Permeability: The Basis for Understanding Pulp
Reactions and Adhesive Technology. Braz Dent J 20: 3-16.
13. Wang Y, Spencer P. 2002. Quantifying adhesive penetration in
adhesive/dentin interface using confocal Raman microspectroscopy. J Biomed
Mater 59:46-55.
14. Wang Y, Spencer P, Walker MP. 2007. Chemical profile of adhesive/caries-
affected dentin interfaces using Raman microspectroscopy. J Biomed Mater
Res 81:279-86.
15. Van Meerbeek B, Mohrbacher H, Celis JP, Roos JR, Braem M, Lambrechts P,
Vanherle G. 1993. Chemical Characterization of the Resin-Dentin Interface by
Micro-Raman Spectroscopy. J Dent Res 72:1423-1428.
16. Pantera EA, Schuster GS. 1990. Sterilization of extracted human teeth. J Dent
Educ 54:283-5.
17. Melo MAS, De-Paul DM, Lima JPM, Borges FMC, Steiner-Oliveira C,
Nobre-dos-Santos, Zanin ICJ, Barros EB, Rodrigues LKA. 2010. In vitro
photodynamic antimicrobial chemotherapy in dentine contaminated by
cariogenic bacteria. Laser Physics 20:1504-1513.
18. Sousa RP, Zanin IC, Lima JP, Melo MA, Beltrão HC, Rodrigues LK. 2009. In
situ effects of restorative materials on dental biofilm and enamel
demineralisation. Caries Res 37: 44–51
19. Dourda AO, Moule AJ, Young WG. 1994. A morphometric analysis of the
cross-sectional area of dentine occupied by dentinal tubules in human third
molar teeth. Int Endod J 27:184-9.
20. Kouchi Y, Ninomiya J, Yasuda H, Fukui K, Moriyama T, Okamoto H. 1980.
Location of Streptococcus mutans in the dentinal tubules of open infected root
canals. J Dent Res 59:2038-46.
21. Rolim JPML, Melo MAS, Guedes SF, Albuquerque-Filho FB, Souza JR,
Nogueira NAP, Zanin ICJ, Rodrigues LKA. 2012. The antimicrobial activity
of photodynamic therapy against Streptococcus mutans using different
photosensitizers. J Photochem Photobiol B 106: 40-46.
22. Burns T, Wilson M, Pearson GJ. 1995. Effect of dentine and collagen on the
lethal photosensitization of Streptococcus mutans. Caries Res 29:192-197.
60
23. Williams JA, Pearson JG, Colles MJ, Wilson M. 2003. The effect of variable
energy input from a novel light source on the photoactivated bactericidal
action of toluidine blue O on Streptococcus Mutans. Caries Res 37:190-193.
24. Guglielmi CAB, Simionato MRL, Ramalho KM, Imparato JCP, Pinheiro SL,
Luz MAAC. 2011. Clinical use of photodynamic antimicrobial chemotherapy
for the treatment of deep carious lesions. J Biomed Opt 16:1-7.
25. Kwon SR, Wertz PW, Li Y, Chan DC. 2012.Penetration pattern of rhodamine
dyes into enamel and dentin: confocal laser microscopy observation. Int J
Cosmet Sci. Feb; 34(1):97-101.
26. George S, Kishen A. 2007. Photophysical, photochemical, and photobiological
characterization of methylene blue formulations for light-activated root canal
disinfection. J Biomed Opt 12: 034029.
27. He X, Wu X, Wang K, Shi B, Hai L. 2009. Methylene blue-encapsulated
phosphonate-terminated silica nanoparticles for simultaneous in vivo imaging
and photodynamic therapy. Biomaterials 30:5601-9.
28. Allison RR, Mota HC, Bagnato VS, Sibata CH. 2008. Bio-nanotechnology
and photodynamic therapy--state of the art review. Photodiagnosis Photodyn
Ther 5:19-28.
29. Pagonis TC, Chen J, Fontana CR, Devalapally H, Ruggiero K, Song X, Foschi
F, Dunham J, Skobe Z, Yamazaki H, Kent R, Tanner ACR, Amiji MM,
Soukos NS. 2010. Nanoparticle-based endodontic antimicrobial photodynamic
therapy. J Endod 36:322-8.
30. Nolwazi NA, Kaminee MB, Edith AA, Aletta KB, Tebello N. 2012. Synthesis
of phthalocyanine conjugates with gold nanoparticles and liposomes for
photodynamic therapy. J Photochem Photobiol B 107:35-44.
31. Perni S, Piccirillo C, Pratten J, Prokopovich P, Chrzanowski W, Parkin IP,
Wilson M. 2009. The antimicrobial properties of light-activated polymers
containing methylene blue and gold nanoparticles. Biomaterials 30:89-93
32. Pissuwan D, Valenzuela SM, Cortie MB. 2006. Therapeutic possibilities of
plasmonically heated gold nanoparticles, Trends Biotechnol 24:62–67
33. Naik A, Ismail S, Kayb C, Wilson M, Parkin IP. 2011. Antimicrobial activity
of polyurethane embedded with methylene blue, toluidine blue and gold
61
nanoparticles against Staphylococcus aureus; illuminated with white light.
Mater Chem Phys 129: 446-45.
62
3.3. CAPÍTULO 3
Gene Expression of S. mutans Biofilms Submitted to Photodynamic Therapy Juliana P.M.L. Rolim1, Rafael N Stipp2, Renata O Mattos-Granner2, Jaime A Cury2,
Simone Duarte4, Deepak Saxena4, Smruti Pushalkar4, Iriana C.J. Zanin1.
1 Post-graduation Program, Faculty of Pharmacy, Dentistry and Nursing, Federal University of Ceará, Brazil 2 Post-graduation Program, Faculty of Dentistry, State University of Campinas
3 Basic Sciences and Craniofacial Biology, New York University College of Dentistry
Address all correspondence to:
Prof. Iriana Carla Junqueira Zanin dos Santos, DDS, MSc, PhD, Associate Professor Department of Dentistry, Faculty of Pharmacy, Dentistry and Nursing, Federal University of Ceara, Fortaleza, Ceara, Brazil Cap. Francisco Pedro Street - Rodolfo Teófilo – Zip Code: 60430-170 Phone- #558533668410, Fax- #558533668232 Email: irianaz@yahoo.com.br
Keywords: Photodynamic therapy; Dental caries; Clinical trial
63
ABSTRACT
Background: Some factors influencing colonization and accumulation of S. mutans
in biofilm formation. GtfB, GtfC, GtfD, GbpB and LuxS enzymes have these
responsibilities. LuxS-mediated signaling has an important role in the development
and spatial organization of oral biofilms, and so can impact the pathogenic potential
of dental plaque. Objectives: This study evaluated the antimicrobial potential and the
pattern change of gene expression by photodynamic antimicrobial therapy (PACT) on
Streptococcus mutans biofilms formed in vitro. Methods: PACT was performed
using the association of TBO (Toluidine Blue ortho) and a LED (energy density of 55
J cm-2; 620-660 nm). S. mutans UA159 biofilms were formed on 96 standard
hydroxyapatite discs using the bath culture method with tryptone-yeast extract broth
containing 1% of sucrose and incubation at 37°C at 5% CO2. After 5 days, the
biofilms were treated in quadruplicates: neither with sensitizer nor light (S-L-); with
sensitizer and without light (S+L-); without sensitizer and with light (S-L+) and with
sensitizer and light (S+L+). Biofilms samples were collected, diluted and plated for
counting of S. mutans. Remaining biofilms had the total RNA extracted and purified;
cDNA synthesized and the qPCR reaction performed for gtfB, gtfC gbpB and LuxS
genes. The microbiological data were evaluated by ANOVA and Tukey test and
qPCR data were analyzed using REST 2009 program (α=5%). Results: A reduction
of 5 log on viable counts was found in S+L+ group compared with S-L-. The
quantitative analyses revealed that PACT was unable to significantly alter the
expression of gtfB, gtfC and gbpB genes (p>0.05). Results differ regarding luxS gene.
The qPCR showed up-regulation in S+L+ in relation to S-L- (a 4.5 fold-change)
(p<0.001). In S+L- no change (p=0.100) was found, even in S-L+ (p=0.053).
Conclusion: Under tested conditions PACT was effective in killing S. mutans,
however altering in virulence gene expression was only observed to LuxS, an
oxidative stress related gene.
Keywords: S. mutans, photodynamic therapy, gene expression
64
INTRODUCTION
S. mutans is considered one of the main microorganisms related to the
pathogenesis of dental caries, by having some virulence factors, such as the ability to
produce acids and survivability and maintenance metabolism in acid environments (1)
Baehni and Takeuchi (2003) (2) reported that these bacteria are capable of
maintaining the acid production from the glycolysis in environments with a pH lower
than 5.0. Moreover, other mechanisms for adaptation to stress acid have been
identified in S. mutans, such as induction of stress proteins (3,4) and change the
composition of the cell membrane (5,6). Such resistance mechanisms make these
bacteria more competitive compared to other microorganisms biofilm during periods
of acidification of the medium (7). Due to this participation of S. mutans in the
etiology of dental caries, great importance has been given to the study of this
microorganism (8). Another factor that influences colonization and accumulation of S. mutans in
biofilm and forming caries lesion is its ability to produce glucosyltransferases (Gtfs)
and synthesize water-insoluble glucans from sucrose, which allows bacteria to adhere
firmly to the tooth surface and contribute to the formation of dental biofilm (9). Three
glucosyltransferases enzymes (GtfB, GtfC and GtfD) are responsible for the synthesis
of water-soluble and water-insoluble glucans and are encoded respectively by genes
gtfB, gtfC and gtfD. GtfB catalyzes the synthesis of rich glucosidic glucans linkages
of the type-α 1-3, resulting in water-insoluble polymers (10). GtfD catalyzes the
formation of rich α-glucosidic glucan links 1-6, which result in water-soluble
molecules, while GtfC is involved in the synthesis of water-soluble and water-
insoluble glucans (10). Futhermore, the glucan-binding proteins (GbpB) are a group
of proteins that demonstrate in vitro binding affinity to glycans (9). S. mutans is
characterized by producing four Gbps (A / B / C / D), all important to the biofilm
formation. Among S. mutans Gbps identified so far, the GbpB has particularities that
make it interesting once there is a positive relationship between the GbpB amount and
in vitro biofilm formation (11). In addition there is evidence that S. mutans has a
signaling pathway mediated by LuxS that affects biofilm formation (12).
65
In this context, a meaningful strategy for prevention and treatment of dental
caries would be the control of both growth and virulence factors of S. mutans. The
photodynamic antimicrobial therapy (PACT) may emerge as a suitable treatment
because of its ability to kill oral bacteria. Several studies have shown that PACT is
able to inactivate S. mutans in planktonic culture (13-15), organized as biofilms (16-
18) and also inserted in dental caries lesions (19-21). In this process a photoactive
dye, called as photosensitizer, is taken up into cells and is irradiated with light of an
appropriate wavelength resulting in cell death through the production of reactive
oxygen species (ROS) (22).
Isolation and characterization of genes involved in S. mutans virulence may
contribute to understanding of how S. mutans responds to different changes in the oral
cavity and to different treatments. The purpose of this study was to evaluate the
antimicrobial effect of photodynamic therapy and its ability to alter the pattern of
gene expression of Streptococcus mutans present in oral biofilms formed in vitro.
Furthermore, there is currently no scientific evidence in the literature about how the
ortho toluidine blue and the LED light irradiation can affect gene expression by S.
mutans in biofilms.
MATERIALS AND METHODS Experimental Design For this in vitro experiment, 96 hydroxyapatite (HA) sterile discs (0.74 cm2)
were randomly allocated to four groups, with 24 experimental units per set of group.
Biofilms of S. mutans UA159 were grown on HA discs immersed in bath culture and
the mature biofilm was submitted to PACT after 5 days. To minimize the inherent
bias, related to microbiological procedures, four independent experiments were
performed at different time points. The treatment conditions in which biofilms were
exposed are as follows: biofilms were exposed to both TBO and light (S + L +),
biofilms were not exposed to sensitizer or light (S – L –), biofilms were exposed only
to sensitizer (S + L –) or biofilms were exposed only to light (S – L +).
66
Photosensitizer and light source The photosensitizer was toluidine blue ortho (TBO, Sigma-Aldrich Chemicals,
Poole, UK), dissolved in deionized water (100 μg ml–1) and stored at room
temperature in the dark. A red light emitting diode (LED; Laserbeam, Rio de Janeiro,
RJ, Brazil) with a spectrum of emission ranging from 620 to 660 nm and predominant
wavelength of 638.8 nm was used as a light source. Irradiation was performed in a
noncontact mode with a focused beam at 2.0 mm of working distance. A power meter
Lasermate (Coherent Inc., Santa Clara, CA, USA) was used to measure the peak
power, and a maximum output power of 40 mW was determined. Since noncollimated
light may spread as it propagates, the area considered in the present calculation of
power density of light was related to the hemisphere area (15) and was 31.8 mW cm-2.
Consequently, biofilms were exposed to a 55 J cm–2 energy density after 15 min of
irradiation.
Specimens Preparation
Disks of hydroxyapatite were used in this study. Device metal wire of stainless
steel wire was developed in order to support the disk vertically HA simulating the
forces of gravity found in biofilms in the mouth. HA discs were subjected to an
ultrasonic bath for 10 minutes to remove the hydroxyapatite powder and subsequently
were autoclaved at 121°C for 15 minutes and placed in metal devices (23).
In vitro Biofilm Formation Saliva-coated HA discs incubated with tryptic soy broth and yeast extract
media with 1% of sucrose inoculated with S. mutans in 24-well polystyrene plates.
The biofilms were then formed in the HA discs for 120 h with the culture medium
being replaced every 24 h (23). At the end of the experimental period, the mature
biofilms were washed in NaCl 0.89% solution, and then submitted to treatments.
PACT of in vitro Biofilms After 5 days of biofilm formation, HA discs containing the biofilms were
transferred to other 24-well polystyrene plates containing TBO (groups S + L + and S
+ L –) or sterile Milli-Q water (groups S – L – and S – L +) during the preirradiation
67
time of 5 min in the dark. Following this time, the biofilms were exposed for 15 min
to LED irradiation (groups S + L + and S – L +) or maintained at room temperature
during the same period (groups S + L – and S – L –). Only one disc hydroxyapatite of
each experimental group was used for microbiological analyzes and three discs were
targeted for analysis of RNA extraction.
The biofilms were then scraped with a sterile spatula and transferred to a pre
weighed microtube containing 1 ml of NaCl 0.89% solution. To disperse the biofilm,
2 pulses of 10 s with a 1 min interval at an output of 7 W were performed (Branson
Sonifier 150; Branson Ultrasonics, Danbury, Conn, USA). Ten-fold serial dilutions
were carried out and aliquots of pure and diluted samples were plated onto blood agar
and were then incubated at 37 ° C, 5% CO2 for 48 h before enumerating the viable
microorganisms. The results were expressed as colony-forming units (CFU) per
milligram of biofilm. Additionally, the remaining biofilm was collected and stored in
an RNA stabilizer (RNAlaterTM Ambion Inc., Austin, TX, USA) for subsequent RNA
extraction and gene expression of S. mutans biofilms submitted to PACT.
RNA extraction
Total RNA present in all samples was extracted by the method described by
Stipp et al. (2008) (24) with some modifications. Initially, RNA solution was removed
by centrifugation at 11.000 g, 4°C for 1 minute. Then samples were placed in
cryogenic tubes containing small zirconia threaded beads. The tubes were placed into
Bead-Beater during 60 seconds at maximum power (Mini bead beater-16 - Biospec
Products, Bartlesville, OK, USA) in order to promote mechanical disruption of cells.
850μl of solution of beta-mercapto with RLT (the proportion of 10 μL of beta
mercapto to 1 mL of RLT) was added to the sample, mixed for 30 seconds and
centrifuged for 2 minutes, 11.000 g at 4°C. Subsequently 400 μL of the resulting
supernatant was transferred to an eppendorf tube containing 285.7 μL of absolute
ethanol.
The continuity of the total extraction occurred with the transfer of the solution
containing the sample with absolute ethanol to the column purification kit RneasyTM
Mini (Qiagen, DUS, Bundesland, Germany) and following the manufacturer's
68
recommendations The samples were treated with DNase I (Qiagen, DUS, Bundesland,
Germany) for removal of contaminant genomic DNA.
The concentration and purity of the RNA integrity was verified by analyzing
the absorbance A260/A280 ratio followed by in 2% agarose gels (0.15 μg ethidium
bromide per ml). Digital images were captured under ultraviolet light with the Gel
logic 200 Imaging System (Eastman Kodak Co, Rochester, NY, USA).
To minimize contamination by genomic DNA, TurboTM enzyme DNase
(Applied Biosystems, Ambion, Austin, TX, USA) was used. The solution stood for 30
min at 37°C in a Thermal cycle (Digital, dry block, Labnet, Austin, TX, USA). Then,
the entire sample was added to an eppendorfTM tube containing 350 μl of RLTTM and
250 μL of absolute ethanol. The solution was mixed and transferred to purification
columns Rneasy kitTM MinEluteTM Cleanup kit (Qiagen) and following the
manufacturer's recommendations.
Samples were taken immediately to -80°C freezer and concentration, purity
and integrity of the RNA after Turbo DNAse treatment was obtained as described
before.
cDNA synthesis and Real-time Polymerase Chain Reaction (q-PCR)
The cDNAs were synthesized from the purified RNA using iScriptTM cDNA
Synthesis kit (Bio-Rad, Hercules, CA, USA). Reverse transcriptase reactions were
prepared from a mixture containing 4 μl of IScript, l μL IScript RT, 0.5 μg of purified
sample RNA and water-free DNase and RNase in an amount sufficient for a final
solution of 20 μL. The resulting solution was mixed for 5 s and incubated at 25°C for
5 minutes and 42°C for 30 minutes. The reaction was completed by heating the
mixture at 85°C for 5 minutes. After the process, 30 μl of water-free DNase and
RNase was added to the solution cDNA to make it in a final concentration of 10 ng
μL-1. Soon after the cDNA samples were stored at -20°C.
From the obtained cDNA, q-PCR reactions were performed to evaluate the
expression of genes gtfB, gtfC, gbpB and luxS. The pairs of specific primers to each
gene were used to generate product of sizes between 90 and 200 pb (Table 1).
The quantitative PCR reactions were performed on a cycling machine (MJ
MiniOpticonTM, Bio-Rad, Hercules, CA, USA). Solutions with 12.5 µL of SYBR
Green master mix (SYBR GreenTM Supermix iQTM, Bio-Rad, Hercules, CA, USA), 3
69
mL of cDNA sample, 1.5 µL of each primer F/R and 6.5 µL of water were prepared
for each sample. Standard curves were performed for each primer. Experiments were
performed in duplicate and S. mutans genes gyrA/F1 and gyrA/R1 were used as a
reference gene (25). The contamination by genomic DNA was determined by
performing control reactions cDNA without the addition of reverse transcriptase.
Table 1. Primers used in the Real-Time Polymerase Chain Reaction
Gene Gene ID1 Orientation Primer sequence (5’→3’) Product size (pb)
gyrA2 1028427 Forward
Reverse
5'- ATTGTTGCTCGGGCTCTTCCAG -3'
5'- ATGCGGCTTGTCAGGAGTAACC -3'
105
gtfB3 1028336 Forward
Reverse
5'-CGAAATCCCAAATTTCTAATGA-3'
5'-TGTTTCCCCAACAGTATAAGGA-3'
197
gtfC3 1028343 Forward
Reverse
5'-ACCAACCGCCACTGTTACT-3'
5'-AACGGTTTACCGCTTTTGAT-3'
161
gbpB3 1029610 Forward
Reverse
5'-CAACAGAAGCACAACCATCA-3'
5'-TGTCCACCATTACCCCAGT-3'
151
luxS4 1027971 Forward
Reverse
5'- ACTGTTCCCCTTTTGGCTGTC-3'
5'- AACTTGCTTTGATGACTGTGGC -3'
93
1 GenBank: http:// www.ncbi.nlm.gov/entrez/query.fcgi?db=gene 2Primer sequence from (25) 3Primer sequence from (24) 4Primer sequence from (26)
Statistical Analysis
To establish the difference between the experimental groups in
microbiological analysis, an analysis of variance (one-way ANOVA) followed by
Tukey-Kramer were applied. The software BioStat 2007 professional (AnalysSoft
Robust solutions Business company, Vancouver, Canada) was used. The Real-Time
PCR data were analyzed using REST 2009 (27). The significance level was set at 5%
for both analyses.
RESULTS Microbial analysis Microbiological data were measured by calculating the logarithm reduction
among S-L-, S+L-, S-L+ and S+L+ values. The microbiological variation profile of S.
70
mutans biofilm with or without PACT treatment is shown in Figure 1. Results show
that after PACT significant reduction of 5 logs was observed (p= 0.01). Neither
incubation with TBO alone (S+L-) nor irradiation of the biofilms in the absence of
TBO (S-L+) had a significant effect on the viability of S. mutans biofilms (p= 0.94,
p=0.60, respectively).
FIGURE 1: Effect of treatments on the viability of S. mutans present in biofilms
formed in vitro. Data represent mean values (four independent experiments). Error
bars represent SD and data followed by different letters differ statistically (p <0.05).
gtfB, gtfC, gbpB and luxS expression analysis
The iQTM SYBR® Supermix was used to quantify the effect of PACT
on gtfB, gtfC, gbpB and luxS gene expression (Figure 2). The quantitative analyses
revealed that PACT, under the conditions of this study, was unable to significantly
alter the expression of gtfB, gtfC and gbpB genes. Statistically significant differences
among the groups are described in Table 2. However, results differ regarding luxS
gene. The qPCR revealed that S. mutans showed a 4.5 fold-change up-regulation of
this gene in PACT group in relation to the control group (p<0.01) (Fig. 2). In the
absence of irradiation or photosensitizer no change in the gene expression was
observed.
0.00E+00
2.00E+00
4.00E+00
6.00E+00
8.00E+00
1.00E+01
1.20E+01
S+L+ S-‐L-‐ S+L-‐ S-‐L+
Log 10 CFU.mg -‐
1
Treatments
PACT S.mutans UA 159 -‐ in vitro model
a
b b b
71
Table 2: P values achieved by each treatment compared with the control group
gene S+L+ S+L- S-L+ gtfB 0.341 0.527 0.345 gtfC 0.881 0.298 0.056 gbpB 0.123 0.393 0.300 luxS <0.010* 0.100 0.053
Note: p value followed by an asterisk (*) indicates statistically significant difference
Figure 2: Effect of treatments on the expression of gtfB, gtfC, gbpB and luxS genes.
Columns indicate means and error bars represent standard deviations. *, P < 0.05
(REST 2009).
DISCUSSION
Bacterial biofilms are formed when unicellular organisms come together to
form a community that is attached to a solid surface and encased in an
exopolysaccharide matrix, which environmental influences are vastly reduced (28)
Bacteria growing within biofilms often exhibit differing phenotypes compared with
planktonically grown counterparts. One of the most clinically important phenotypes is
increased resistance to antimicrobial compounds (29). The control of dental caries
requires the reestablishment of commensal microbiota equilibrium and the
suppression of both the growth and virulence factors of pathogenic bacteria. To
address this, we developed a single-species biofilm of oral streptococci in vitro and
1 1.5 2
2.5 3
3.5 4
4.5 5
5.5 6
S-‐L-‐ S+L-‐ S-‐L+ S+L+
S-‐L-‐ S+L-‐ S-‐L+ S+L+
S-‐L-‐ S+L-‐ S-‐L+ S+L+
S-‐L-‐ S+L-‐ S-‐L+ S+L+
gtfB gtfC gbpB luxS
fold difference normalized
expression
*
72
analyzed the antimicrobial effect of TBO associated with a red LED on the viability
and expression of important virulence genes of S. mutans.
The results of this study show that photodynamic therapy using the association
of a LED light and the TBO is effective even in the complex and protective structure
of a biofilm, with a significant 5-log reduction in microorganisms. Recent studies
analyzing PACT reinforces its activity against bacterial cells arranged in biofilms.
Significant log reductions (1–3 log) in the viability of these microorganisms using the
same photosensitizer and light source were also observed before (17,18). On S.
mutans monospecies biofilm, log10 reductions of up to 5.48 were observed when S–
L– and S+L+ groups were compared. (30)
The mechanism of action of PACT in microorganisms is well established. The
photosensitizer activated by light in the presence of oxygen produces reactive oxygen
species (ROS). There are two classes of ROS, one created through electron transfer
(type I reaction) that can produce superoxide, hydrogen peroxide and hydroxyl
radicals; and another created by energy transfer (type II reaction). In a type II
reaction, energy transfer to O2 results in the formation of singlet oxygen (1O2) (31).
These products are capable of damaging essential components of the cells, like
citoplasmatic membrane or DNA, or by modifying metabolic activities in an
irreversible way (22). This oxidative stress likely will result in destruction of target
cells. Although the sites of photosensitizer action depend on classes of
photosensitizer, TBO is known to be membrane active, since it is able to accumulate
and diffuse through the hydrophobic region of the cellular membrane, causing death
(32,33).
One of the most important virulence factors of S. mutans is its ability to
produce glucosyltransferases (Gtfs) and synthesize water-insoluble glucans from
sucrose (34) and its cooperative action with the enzyme GbpB. The genes expression
that encoding these enzymes on S. mutans is critical for maintaining the 3-
dimensional structure of microcolonies over time and are directly associated with the
amount of biofilm (35). However the data of our study show that the cytotoxicity
caused by ROS, utilizing TBO did not modulat the expression of these genes.
Moreover, one possible response to oxidative stress among bacteria is the
LuxS regulated stress response pathway (36). The LuxS enzyme is responsible for the
synthesis of autoinducer 2 (AI-2), the most broadly distributed interspecies signaling
molecule known in bacteria (37) and it is present in S. mutans biofilm formation.
73
(38,39) Also, the luxS plays critical roles in modulating other virulence factors of S.
mutans, such as acid stress tolerance and bacteriocin production (38-40). On these
considerations, the oxidation generated by PACT on S.mutans biofilms may leads to
an increase in the luxS expression as a compensatory effect to control the oxidative
stress suffered by the cell. In our study, we found up-regulation of 4-fold more for
PACT group in relation control group. This luxS expression induction evidence that
PACT may compromises cell integrity.
It is proved that the expression of 30% of all genes of S. mutans is affected by
the luxS mutation. Genes involved in biofilm formation, acid tolerance, bacteriocin
synthesis, and oxidative stress tolerance were among them (41). Of the genes affected
by LuxS, several of them have been shown to play a major role in acid tolerance, low
pH and hydrogen peroxide, including brpA, ciaH (42,43), dnaK and groEL (37).
Futhermore, many stresses encountered by oral bacteria, can induce DNA damage
(44). The ability of S. mutans to survive challenges imposed by acid and oxidative
stress depends on several enzymes of DNA repair systems, including recombination
protein RecA, AP endonuclease Smx and UV repair excinuclease UvrA that are
altered by the gene luxS (45, 46, 47).
In the literature, there is only one study examinating the gene expression of S.
mutans submitted to PACT. Bolean et al., (2010) (4) evaluated the effect of PACT on
groEL gene expression, a stress-specific protein. Although working with diferent
sensitizer and light source, the authors found that PACT induces groEL gene
expression in equivalent amounts as those found to H2O2. Their results showed that
PACT induced an increase in the expression of genes related with oxidative stress,
corroborating our results.
In conclusion, under tested conditions, PACT was highly effective in killing S.
mutans present in biofilms formed in vitro. However ROS are not capable of altering
the expression of important virulence genes once expression of gtfB, gtfC and gbpB
were not affected by PACT. This is especially important when considering that PACT
does not eliminate all microorganisms present in the biofilm and that the presence of
residual bacteria in biofilms irradiated with higher expression of these genes could
result in the induction of greater virulence. Finally, the induction of genes expression
related to oxidative stress such as luxS, although expected by the production of ROS,
should be further investigated in order to clarify the influence of PACT in the biofilm
74
organization and virulence after treatment. Furthermore, future studies should be
conducted to examine the role of other genes that regulate oxidative and acid stress in
photodynamic antimicrobial therapy
REFERENCES
1. Lemos JA, Abranches J, Burne RA. 2005. Responses of cariogenic
streptococci to environmental stresses. Curr Issues Mol Biol 7: 95–107.
2. Baehni PC, TakeuchI Y. 2003. Anti-plaque agents in the prevention of
biofilm-associated oral diseases. Oral Dis 9: 23–9.
3. Lemos JA, Chen YY, Burne RA. 2001. Genetic and physiologic analysis of
the groE operon and the role of HcrA repressor in stress gene regulation and
acid tolerance in Streptococcus mutans. J Bacteriol 183: 6074-84.
4. Bolean M, Paulino TP, Thedei JR G, Ciancaglini P. 2010. Photodynamic
Therapy with Rose Bengal Induces GroEL Expression in Streptococcus
mutans. Photomed Laser Surg 28: 79-84.
5. Quivey RG, Faustoferri R, Monahan K, Marquis R. 2000. Shifts in membrane
fatty acid profiles associated with acid adaptation of Streptococcus mutans.
FEMS Microbiol Lett 189: 89-92.
6. Fozo EM, Quivey RG. 2004. Shifts in the membrane fatty acid profile of
Streptococcus mutans enhance survival in acidic environments. Appl Environ
Microbiol 70(2): 929-36.
7. Marsh PD. 2003. Are dental diseases examples of ecological catastrophes?
Microbiology 149: 279-294,.
8. Arthur RA, Tabchoury CPM, Matos-Graner RO, Cury AADB, Leme AFP,
Vale GC, Cury JA. 2007. Genotypic Diversity of S. mutans in Dental Biofilm
Formed In Situ under Sugar Stress Exposure. Braz. Dent. J 18: 185-191.
9. Banas, J. A; Vickerman, M. M. 2003. Glucan-binding proteins of the oral
streptococci. Crit Rev Oral Biol Med14:89-99.
10. Fujiwara T, Hoshino T, Ooshima Y, Hamada S. 2002. Differential and
quantitative analyses of mRNA expression of glucosyltransferases from
Streptococcus mutans MT8148. J Dent Res 81:109-113.
75
11. Mattos-Graner RO, Jin S, King WF, Chent, Smith DJ, Duncan MJ. 2001.
Cloning of the Streptococcus mutans gene encoding Glucan binding protein B
and analysis of genetic diversity and protein production in clinical isolates.
Infect Immun. 69(11): 6931-41.
12. Wen, ZT, Suntharaligham P, Cvitkovitch DG, Burne RA. 2005. Trigger factor
in Streptococcus mutans is involved in stress tolerance, competence
development, and biofilm formation. Infect. Immun 73: 219– 225.
13. Williams JA, Pearson GJ, Colles MJ, Wilson M. 2003. The effect of variable
energy input from a novel light source on the photoactivated bactericidal
action of toluidine blue O on Streptococcus mutans. Caries Res 37: 190-3.
14. Paulino TP, Ribeiro KF, Thedei G Jr, Tedesco AC, CIancaglini P. 2005. Use
of hand held photopolymerizer to photoinactivate Streptococcus mutans. Arch
Oral Biol 50: 353–359.
15. Rolim JPML, Melo MAS, Guedes SF, Albuquerque-Filho FB, Souza JR,
Nogueira NAP, Zanin ICJ, Rodrigues LKA. 2012. The antimicrobial activity
of photodynamic therapy against Streptococcus mutans using different
photosensitizers. J Photochem Photobiol B 106: 40-46.
16. Wood S, Metcalf D, Devine D, Robinson C. 2006. Enhancement of
erythrosine-mediated photodynamic therapy of Streptococcus mutans biofilms
by light fractionation. J Antimicrol Chemother 58: 190–192.
17. Zanin IC, Gonçalves RB, Junior AB, Hope CK, Pratten J. 2005. Susceptibility
of Streptococcus mutans biofilms to photodynamic therapy: an in vitro study.
J Antimicrob Chemother 56 (2): 324-30.
18. Zanin IC, Lobo MM, Rodrigues LK, Pimenta LA, Hofling JF, Gonçalves RB.
2006. Photosensitization of in vitro biofilms by toluidine blue O combined
with a light-emitting diode. Eur J Oral Sci 114 (1): 64-9.
19. Lima JPM, Sampaio De Melo MA, Borges FM, Teixeira AH, Steiner-Oliveira
C, Nobre DOS Santos M, Rodrigues LK, Zanin IC. 2009. Evaluation of the
antimicrobial effect of photodynamic antimicrobial therapy in an in situ model
of dentine caries, Eur J Oral Sci 117: 568–574.
20. Melo MAS, De-Paula DM, Lima JPM, Borges FMC, Steiner-Oliveira C,
Nobre-Dos-Santos M, Zanin ICJ, Barros EB, Rodrigues LKA. 2010. In vitro
photodynamic antimicrobial chemotherapy in dentine contaminated by
cariogenic bacteria, Laser Phys; 20: 1–10.
76
21. Guglielmi CAB, Simionato MRL, Ramalho KM, Imparato JCP, Pinheiro SL, Luz
MAAC. 2011. Clinical use of photodynamic antimicrobial chemotherapy for the
treatment of deep carious lesions. Journal of Biomedical Optics 16(8): 088003, 1-7.
22. Malik Z, Hanania J, Nitzan Y. 1990. Bactericidal effects of photoactivated
porphyrins - an alternative approach to antimicrobial drugs. J Photochem
Photobiol B 5: 281-293.
23. Duarte S, Klein MI, Aires CP, Cury JA, Bowen WH, Koo H. 2008. Influences
of starch and sucrose oh Streptococcus mutans biofilms. Oral microbial
Immunol 23: 206-212.
24. Stipp RN, Gonçalves RB, Hofling JF, Smith DJ, Mattos-Graner RO. 2008.
Transcriptional analysis of gtfb, gtfC and gbpB and their putative response
regulators in several isolates os Streptococcus mutans. Oral Microbiology
Immunology 23: 466-473.
25. Levesque CM, Voronejskaia E, Huang YC, Mair RW, Ellen RP, Cvitkovitch
DG. 2005. Involvement of sortase anchoring of cell wall proteins in biofilm
formation by Streptococcus mutans. Infect Immun 73: 3773–3777.
26. Zezhang T Wen, David Yates, Sang-Joon Ahn and Robert A Burne. 2010.
Biofilm formation and virulence expression by Streptococcus mutans are
altered when grown in dual-species model. BMC Microbiology, 10:111
27. Pfaffl MW, Horgan GW, Dempfle. 2002. Relative expression software tool
(Rest@) for group-wise comparison and statistical analysis of relative
expression results in real-time PCR. Nucleic Acids Research 30(9): 1-10
28. Mah TC, O’Toole GA. 2001. Mechanisms of biofilm resistance to
antimicrobial agents. TRENDS in Microbiology 9:34-39.
29. Mullany P, Roberts AP. 2010. Oral biofilms: a reservoir of transferable,
bacterial, antimicrobial resistance. Expert Review of anti-infective therapy 8:
1441-50
30. Teixeira AH, Pereira ES, Rodrigues LKA, Saxena D, Duarte S, Zanin ICJ.
2012. Effect of Photodynamic Antimicrobial Chemotherapy on in vitro and in
situ Biofilms. Caries Res 46: 549–554.
31. Wilson BM, Patterson SM. 2008. The physics, biophysics and technology of
photodynamic therapy. Phy Med Biol 53: 61–109.
77
32. Usacheva MC, Teichert MA, Biel. 2003. The role of the methylene blue and
toluidine blue monomers and dimers in the photoinactivation of bacteria, J.
Photochem Photobiol B Biol 71:87–98.
33. Bevilacqua IM, Nicolau RA, Khouri S, et al. (2007). The impact of
photodynamic therapy on the viability of Streptococcus mutans in a planktonic
culture. Photomed Laser Surg 25: 513–518.
34. Cury JA, Rebelo MA, Del Bel Cury AA, Derbyshire MT, Tabchoury CP.
2000. Biochemical composition and cariogenicity of dental plaque formed in
the presence of sucrose or glucose and fructose. Caries Res 34 (6): 491-497.
35. Koo H, Xiao J, Klein MI, Jeon JG 2010 b. Exopolysaccharides produced by
Streptococcus mutans glucosyltransferases modulate the establishment of
microcolonies within multispecies biofilms. J Bacteriol 192: 3024–3032.
36. Wen ZT, Nguyen AH, Bitoun JP, Abranches J, Baker HV, Burne RA. 2011.
Transcriptome analysis of LuxS-deficient Streptococcus mutans grown in
biofilms. Mol Microbiol 26: 2-18
37. Vendeville A, Winzer K, Heurlier K, Tang CM, Hardie KR. 2005. Making
‘sense’ of metabolism: autoinducer-2, LuxS and pathogenic bacteria. Nat Rev
Microbiol 3:383–396.
38. Wen ZT, Burne RA. 2004. LuxS-mediated signaling in Streptococcus mutans
is involved in regulation of acid and oxidative stress tolerance and biofilm
formation. J. Bacteriol 186: 2682-2691
39. Yoshida A, Ansai T, Takehara T, Kuramitsu HK. 2005. LuxS-based signaling
affects Streptococcus mutans biofilm formation. Appl. Environ. Microbiol 71:
2372-2380
40. Merritt J, QI F, Goodman SD, Anderson MH, Shi W. 2003. Mutation of luxS
Affects Biofilm Formation in Streptococcus mutans. Infect Immun 7: 1972-
1979.
41. Sztajer H, Lemme A, Vilchez R, Schulz S, Geffers R, Yip CYY, Levesque
CM, Cvitkovitch DG, Wagner-Dobler. 2008. Autoinducer-2-Regulated Genes
in Streptococcus mutans UA159 and Global Metabolic Effect of the luxS
Mutation. J Bacteriol 190: 401–415.
42. Ahn SJ, Wen ZT, Burne RA. 2006. Multilevel control of competence
development and stress toler- ance in Streptococcus mutans UA159. Infect
Immun 74: 1631–1642.
78
43. Wen ZT, Baker HV, Burne RA. 2006. Influence of BrpA on critical virulence
attributes of Streptococcus mutans. J Bacteriol 188: 2983–2992.
44. Lemos JA, Burne RA. 2008. A model of efficiency: stress tolerance by
Streptococcus mutans. Microbiology 154: 3247–3255.
45. Quivey RG, Faustoferri RC, Clancy KA, Marquis RE. 1995. Acid adaptation
in Streptococcus mutans UA159 alleviates sensitization to environmental
stress due to RecA deficiency. FEMS Microbiol Lett 126: 257–261
46. Hanna MN, Ferguson RJ, Li YH, Cvitkovitch DG. 2001. uvrA is an acid-
inducible gene involved in the adaptive response to low pH in Streptococcus
mutans. J Bacteriol 183: 5964–5973.
47. Faustoferri RC, Hahn K, Weiss K, Quivey RG Jr. 2005. Smx nuclease is the
major, low-pH-inducible apurinic/apyrimidinic endonuclease in Streptococcus
mutans. J Bacteriol 187: 2705–2714.
79
3.4. CAPÍTULO 4
Antimicrobial effect of Photodynamic therapy in treatment of deep caries lesions
in adults: randomized clinical trial Juliana P.M.Lima Rolim1;Mary A.S. de-Melo1; Vanara F. Passos1; Ramille A. Lima1;
Iriana C. J. Zanin1; Suellen S. Rocha1; Lidiany K.A. Rodrigues1, Nádia A. P.
Nogueira1 .
1Faculty of Pharmacy, Dentistry and Nursing, Federal University of Ceará Cap. Francisco Pedro S/N - Rodolfo Teófilo – Zip Code: 60430-170 Phone- #558533668410 Fax- #558533668232 Fortaleza-CE-Brazil
Address all correspondence to: Nádia Accioly Pinto Nogueira Department of Clinical and toxicological analyzes, Faculty of Pharmacy, Dentistry and Nursing, Federal University of Ceara, Fortaleza, Ceara, Brazil Cap. Francisco Pedro Street - Rodolfo Teófilo – Zip Code: 60430-170 Phone- #558533668262 Fax- #558533668232 Fortaleza- nadia@ufc.br
80
ABSTRACT
Previous in vitro and in situ studies have demonstrated that photodynamic
antimicrobial chemotherapy (PACT) is effective in reducing cariogenic bacteria in
demineralized dentine and it has been suggested as complementary treatment to deep
caries removal. The purpose of this study was to investigate the performance of the
PACT using a light emitting diode (LED) associated with a photosensitization dye. In
a randomized, controlled, split-mouth, clinical trial, 45 patients with at least two deep
carious lesions on permanent pre-molars and molars were enrolled. Remaining
dentinal samples of each deep carious lesion were treated either with non-PACT-
control (application of sterile 0.89% NaCl solution) or PACT. The PACT procedure
was characterized by 100 µg ml-1 toluidine blue ortho followed by irradiation with an
LED (λ= 630 nm; 94 J cm-2). Standardized samples of dentin from the pulpal wall
region were collected using a curette before and immediately after treatments and
kept in a transport medium for microbiological analysis. Samples were cultured in
blood agar, Mitis Salivarius Bacitracin agar and Rogosa agar to determine the total
viable bacteria, mutans streptococci and Lactobacillus spp. counts, respectively. After
incubation, colonies were counted and microbial reduction was calculated for
different bacteria in each group. The data were transformed into logarithms and
statistical analysis was performed using un-paired t test (α = 5%). PACT led to
statistically significant reductions in mutans streptococci (1.08 ± 1.20 log),
Lactobacillus spp. (1.70 ± 1.75 log), and total viable bacteria (1.07 ± 1.01 log)
compared to the control, which showed log reductions respectively of 0.05 ± 1.02,
0.52 ± 1.75 and 0.47 ± 0.99 for the same microorganisms. Dentin from deep carious
lesions treated with PACT showed a decrease in cariogenic microbial.
Keywords: Dental caries, LED, photodynamic antimicrobial therapy
81
INTRODUCTION
Dental caries results from an ecological imbalance in the physiological
equilibrium between tooth minerals and products from oral microbial biofilms, mainly
supragingival plaque (1). Biofilm bacteria, such as mutans streptococci and
Lactobacillus species, secrete organic acids as a by-product of fermentable
carbohydrates metabolism. This process leads to the demineralization of tooth hard-
tissue and the cavitation in its advanced stages (2). Dentin caries are characterized by
the presence of two distinct layers. The outer layer is highly infected with bacteria
that dissolve the mineralized tissue of dentine while the inner layer tends to be
contaminated with fewer bacteria and is usually susceptible to remineralization (3). It
is clear for conservative treatment that the removal of all infected dentin from lesions
in direction to pulp is not required for caries management (4). The possibility of kill
bacteria present in the dentin tubules in the remaining demineralized tissue, may
contribute to a more conservative approach in deep caries lesions treatment.
Consequently, it would be interesting the use of new therapies that kill bacteria in vivo
and decrease the amount of tooth tissue to be removed during cavity preparation (5).
Previous studies have shown that PACT is able to reduce oral bacteria in
planktonic culture (6-9), biofilm (10,11) and dentin substrate (12-14). This technique
is based on generation of cytotoxic oxygen species by the excitation of a
photosensitizing agent with a light in a complementary wavelength. Among the
technique benefits follows the in vivo rapid noninvasive topical application of the
drug in the carious lesion; the bacterial killing after a short exposure to light; the un-
likely resistance development of considering the widespread generic toxicity of
reactive oxygen species; and the possibility of restrict the antimicrobial effect by
restricting the field of irradiation (15).
Despite the numerous benefits of photodynamic therapy, there are no
randomized controlled trials to justify the clinical indication for this therapy. Clinical
trials are needed to analyze this approach as an effective complementary method for
the control and treatment of caries. Therefore, the aim of this study was to investigate
the performance of PACT using a light emitting diode (LED) associated with a
toluidine blue ortho (TBO) photosensitization dye, as an alternative to kill
microorganisms in deep dentin caries lesions.
82
MATERIALS AND METHODS Experimental design
A randomized split-mouth clinical trial was conducted in order to evaluate the
antimicrobial effect of PACT in vivo. This randomized controlled trial followed a set
of recommendations reported by the CONSORT 2010 Statement. Calculation of
statistical significance was performed using the unpaired t-test for the unpaired
samples (Biostat 5.0, α = 5% power test at 0.85), and the minimum sample size was
estimated 35 patients.
Volunteers’ selection
Accordingly, a sample of 58 subjects was recruited to compensate possible
dropout during the experimental period. The protocol study was approved by Local
Research and Ethics Committee, (protocol # 173/2010). Healthy patients of both
genders were selected from Operative Dentistry Clinic of the Federal University of
Ceará, Brazil, with ages ranging from 18 to 35 years. The study was performed from
July 2010 to July 2011. The patients were only included in this study after that written
informed consent was obtained from each one.
The inclusion criteria of the patients involved the association of: 1. patients
that present at least two permanent molar or pre-molar with active deep carious
lesions without pulp involvement; and 2. the presence of a well-defined radiolucent
zone between the caries lesion and the pulp identified by interproximal radiographs
(Fig. 1). The exclusion criteria of patients were: 1. history of allergic disease, 2. use of
mouthwash 3. use of antibiotics 3 months before or during the study, 4. patients that
refused to sign the informed consent. Teeth were excluded if present at least one of
the following signs: periapical radiograph showing pulp involvement, apical
radiolucency, abscess or fistula associated, spontaneous pain, no response to cold pulp
test; swelling in periodontal tissues, and abnormal tooth mobility. After applying the
inclusion and exclusion criteria, 50 patients (100 teeth) were selected, however 45
volunteers completed the study because five patients had pain or dropped out
Four dentists were trained and calibrated in identifying eligible caries lesions
using anamnese history, clinical examination and interproximal radiographs.
However, only a professional has been appointed to carry out all processes of
83
excavation and treatment. The allocation sequences of treatments were achieved
through excel list. Two teeth were treated in each randomized patient.
FIGURE 1: Radiograph showing the distance between caries lesion and pulp in the
selected teeth, an example of the size of caries lesions included in study.
CLINICAL PROCEDURES Initially, teeth were anaesthetized using Novocol 100 (SSwhite, Rio de
Janeiro, RJ, Brazil) and isolated with a rubber dam (Maidetex, São José dos Campos-
SP, Brazil). The next clinical step in all teeth comprised the opening of the cavity and
the removal of undermined enamel using high-speed equipment with copious
air/water spray and diamond burs (KG Sorensen, Zenith Dental ApS, Agerskov,
Denmark). Caries at the lateral walls of the cavity and at the enamel–dentin junction
was completely removed with excavators and/or round tungsten carbide burs (Komet
Germany No.1.204.018) at low speed. Subsequently, the half bulk of carious lesions
(the first sample of carious dentin for a baseline analysis) were collected by hand
excavation instruments.
Following, each tooth of the patient was subjected to one of two treatments:
PACT (experimental group) or 0,89% NaCl solution (control group) in a split-mouth
design. PACT tooth was sensitized with 10 µL of 100 µg/ml toluidine blue ortho
during a pre-irradiation of 5 min in the dark followed by LED irradiation during 5
min. Control tooth received an equal volume of sterile 0,89% NaCl solution and were
submitted to a 10 min waiting period in order to simulate the pre-irradiation plus
84
irradiation conditions. After treatments the second collects of dentinal caries was
conducted.
A calcium hydroxide base material (Dycal; DeTrey Dentsply, Skarpnäck,
Sweden) was applied over the remaining carious dentin and the cavity was
temporarily sealed with glass- ionomer (Fuji II ® - ionomer cement encapsulated
resin modified - GC America Inc. Alsip, IL, USA) following the manufacturer's
recommendations. After 8 to 12 weeks, new clinical and radiographic examination
was performed to diagnose health pulp, following part of the glass-ionomer was
removed and the cavity was finally restorated using resin Filtek Z350 (3M ESPE, ST
Paul, USA). A schematic representation of clinical and laboratorial procedures is
represented in Fig. 2.
FIGURE 2: Schematic diagram illustrating clinical and laboratorial procedures. A—
Caries lesion. B - Removal of the baseline sample . C—Application of 0.89% NaCl or
100μg ml-1 TBO. D- LED irradiation or waiting time. E— collection of post treatment
sample. F— Restoration of the tooth. G— microbiological analysis.
PHOTOSENSITIZER AND LIGHT SOURCES
Toluidine blue Ortho (TBO) was obtained from Sigma Chemicals (Poole,
UK), dissolved in deionized water (100 μg ml-1), and stored in the dark. The light
85
source used was a red light-emitting diode (LED; MMoptics, São Carlos,SP, Brazil),
with a predominant wavelength of 630 nm. A fibre optic cable with a 6 mm spot
distributed the light. Irradiation was performed with a focused beam maintained at a
distance of 2.0 mm from the cavity floor. A power meter Lasermate (Coherent, Santa
Clara, CA, USA) was used to measure the power of the LED device; an output of 150
mW was used and energy density of the 94 J cm-2.
MICROBIOLOGICAL PROCEDURES
Samples collected prior and after treatments were weighted using pre-weighed
microcentrifuge tubes. Thus, 0.89% NaCl solution (1 ml mg-1) and three sterile glass
beads (0.1 mm in diameter) were added to tubes following agitation for 1 min in a cell
disruptor (Disrupter Genie, Precision Solutions, Rice Lake, WI, USA) in order to
detach the bacterial cells. Afterwards, the suspension was serially diluted (1:10,1:100,
1:1,000, 1:10,000, 1:100,000, and 1:1,000,000) in 0.89% NaCl solution. Thus,
samples were plated in triplicate to assess microorganism viability, on the following
culture media: Blood Agar to total microorganisms, Mitis Salivarius Agar containing
bacitracin and sucrose for mutans streptococci (16) and Rogosa Agar for lactobacilli
counts (17). Agar plates were then incubated at 37°C, 5% CO2 for 48 h before
enumerating the viable microorganisms. The results were performed by a blinded
examiner and expressed as colony-forming units (CFU) per milligram of biofilm.
STATISTICAL ANALYSIS
The microbiological data were transformed into log10. The subtraction of the
initial count values from the final values of carious dentin resulted in the data of log
reduction. The normality distribution of the data and equality of variances were
checked using the Kolmogorov–Smirnov and Levene tests, respectively. These data
were analyzed using an unpaired t- test. The significance level was set at 5%. The
software SPSS (Statistical Package for the Social Sciences) was used.
RESULTS
Initially 58 patients were recruited for the study. However two patients were
using antibiotics, three patients showed periapical changes in radiographic
examination, one had fistula associated with tooth and two patients responded
86
negatively for thermal pulp test. Thus 50 patients started the study, however 2 patients
reported spontaneous pain in teeth treated and three dropped out. So 45 volunteers
completed the entire study until the final restoration of the tooth.
The results showed that PACT reduces significantly viable counts of all tested
microorganisms (Table 1). The PACT promoted a log reduction of 1.08 for mutans
streptococci comparing with 0.50 in the respective group control (p < 0.0001), log
reduction of 1.69 for Lactobacillus spp comparing with 0.52 in control group (p =
0.003), and 1.07 for total viable bacteria comparing with 0.47 for control group (p =
0.008).
TABLE 1: Log reduction (mean and standard) achieved by each treatment
Microorganisms Groups Log reduction
Total microorganisms Control 0.47 ± 0.99 PACT 1.07 ± 1.01 *
Lactobacillus ssp
Control 0.52 ± 1.75 PACT 1.69 ± 1.74 *
Mutans streptococci
Control 0.05 ± 1.02 PACT 1.07 ± 1.21 *
Note: data followed by asterisk (*) differ statistically (p ≤ 0.05)
DISCUSSION The aim of this randomized, controlled clinical trial was to investigate the
microbiological effects of PACT treatment in deep dentin lesion of adult patients
considering that there is a lack of substantial evidence to support the use of
antimicrobial photodynamic therapy process in caries management. As a result of
increasing advances in the understanding of pathogenesis, photosensitizers and cell
target interaction and parameters used, it is increasingly likely that clinical studies of
PACT will be more narrowly defined to focus the real effect of this treatment.
The choice of an LED, instead of a laser device, was determined by its
physical characteristics that associated with its low cost and portability, made it more
desirable to be used in PACT. In addition, the lack of collimation and coherence of
LEDs, which results in wider bands of emission (620–660 nm), can provide light
emission throughout the entire absorption spectrum of the sensitizer (11), which may
87
promote optimization of photodynamic processes. Furthermore, Zanin et al. 2005 (10)
demonstrated that the use of a HeNe laser or an LED in association with TBO had the
same antimicrobial effect on S. mutans biofilm viability. TBO was chosen as a
photosensitizer due to its characteristics of an optimal photosensitizer including
photophysical, chemical and biological characteristics such as the possibility of local
delivery into the infected area, selectivity for microorganisms in low concentrations,
avoiding damage to host tissue, and diffusion capacity (18). Besides, a recent study
demonstrated that TBO, associated with an LED, was the only photosensitizer among
those tested at the same molar concentration and irradiation conditions, effective
against planktonic cultures of S. mutans (9).
In the present study, significant log10 reductions of microorganisms analyzed
were achieved with values ranging from 1.07 to 1.69. This corresponds to Gugliemi et
al. 2011 (19) that reported log reduction from 0.91 to 1.38 using methylene blue dye
(100 mg L-1) and a low power laser (100 mW; 320 J cm−2, time exposure of 90 s) on
similar oral target-microbiota, however parameters comparisons can not be made
since this study was not conducted control group. There is a statistically significant
difference between PACT and control group, however this difference is not biological
relevant. According to FDA (Food and Drug Administration) TFM (Tentative Final
Monograph) and the European EN 1500 report, a minimum of 3log10 steps must be
achieved to state a pertinent antimicrobial efficacy (99.9% efficacy).
However, the no expressive microbial reduction results from clinical trials
compared to those reported in in vitro and in situ studies pinpoint the problematic
transfer of laboratorial and preclinical results into clinical reality (13,14). Innumerous
investigations have shown great reduction or even the fully elimination with PACT
treatment of S. mutans when suspended in planktonic cultures (8,9,20), in vitro, in situ
biofilms (10,11, 21) and dental caries (13,14,19). Pereira et al., 2011 (22) analyzed
PACT in mono species biofilms of C. albicans, S. aureus and S. mutans and multi-
species of the association of these microorganisms. Biofilms formed by only one type
of species were more sensitive to PACT compared to multi-species. These results
demonstrate that the interaction between various organisms producing different
polysaccharide matrix, form a biofilm of complex composition which makes it less
susceptible to antimicrobial photodynamic treatment.
88
Partial removal of caries from deep lesions usually involves complete removal
of carious tissue from cavity walls but limited removal from the pulpal floor. This
caries-affected dentin area is target point to PACT in caries management aiming to
eliminate residual bacteria. In 2004, Williams et al (23) reported for the first time the
PACT effectiveness against S. mutans in matrix of collagen substrate and carious
dentin showing maximum mean log reduction of 1.4. Since then, successive literature
reports an effective microbial reduction of S. mutans in dentinal caries lesions
produced in vitro and in situ models (13,14). The evolution of antimicrobial
photodynamic therapy studies have shown that this treatment can be an alternative
mainly in dentin caries lesions, inactivating cariogenic bacteria and preserving
affected dentin.
In this approach, dentin substrate plays an important role in PACT
effectiveness against dental caries. Dentin is porous, hard, mineralized tissue
composed primarily of hydroxyapatite and collagen type I fibrils (24). The matrix
dentin is formed by pulp odontoblast cells and the odontoblast processes are present
in dentinal tubules besides nerve fibers and unmineralized collagen fibrils. In caries
affected dentin, strains of S. mutans are able to bind to demineralized type I collagen,
facilitating adherence to dentin (25). This structure and composition of dentin may
influence in the process of bacterial penetration and invasion of dentinal tubules. All
this feature of the dentin tissue which protects bacterial cells is the key to the
difficulty of penetration and the reach of photosensitizer and the irradiation in targets
microorganisms.
This difficulty can be overcome by changing parameters such as time and
concentration of photosensitizer, pre-irradiation time and type, out-put power and
energy density of light sources. According Konopka and Goslinski (2007) (26)
successful PACT is limited by problems in dosimetry and sub-optimal
photosensitizer. Similar parameters were considerated in preview reports from our
research group against S. mutans presents in dentin caries lesions produced in vitro
and in situ (13,14). The LED device with an energy density of 94 J cm-2 associated
with 100 μg ml-1 TBO as photosensitizer were able to promote significant bacterial
reduction (3log10) in dentin caries produced in situ (14). 3.5 log10 and 4.5 log10 in
relation Lactobaccilis and total microorganisms respectively. In vitro PACT study,
approximately 2.5 log10 S. mutans reduction was observed (13,14). The differences in
89
results of this study and previous multi-species models used before under the same
parameters suggests that the ability of the photosensitizer to penetrate dentinal
tubules, the difficulty of light propagation in dentin tissue and also the complexicity
of dental caries enviromental are considerable obstacles to the clinical use of PACT in
caries lesions.
Considering that future clinical trials should be performed using other
parameters, as adding other components to facilitate their action photosensitizer as
described by George and Kishen (2007) (27) in which they used glycerol: ethanol:
water (30:20:50) may facilitate the photosensitizer diffusion into dentinal tubules.
With respect to irradiation, increased power output of the light source and also of the
irradiation time will outweigh the effects of absorption and scattering of light that
may be lost through the dentinal structure.
In conclusion, dentin from deep carious lesions treated with PACT showed a
decrease in cariogenic microbial albeit not clinically relevant. This grades that the
concept of PACT is plausible and could foster new adjunctive therapeutic concepts in
the caries management. The evidence supported by studies available so far justifies
the research efforts to improve this therapy.
90
REFERENCES
1. Selwitz RH, Ismail AI, Pitts NB. 2007. Dental caries. Lancet 369: 51–59.
2. Featherstone JDB. 2004. The continuum of dental caries – evidence for a
dynamic disease process. J Dent Res 83C: C39–C42.
3. Zaygorodniy AV, Rohanizadeh R, Swain MV. 2008. Ultrastructure of the
dentine carious lesions. Arch Oral Biol 53: 124–132.
4. Thompson V, Craig RG, Curro WS, Ship JA. 2008. Treatment of deep carious
lesions by complete excavation or partial removal: a critical review. J Am
Dent Assoc 139: 705–712
5. Burns T, Wilson M, Pearson GJ. 1994. Killing of cariogenic bacteria by light
from a gallium aluminium arsenide diode laser. J Den Res 22: 273–278.
6. Matevki D, Weersink R, Tenenbaum HC, Wilson B, Ellen RP, Lepine G.
2003. Lethal photosensitization of periodontal pathogens by a red-filtered
xenon lamp in vitro. J Periodont Res 38: 428–435.
7. Williams JA, Pearson GJ, Colles MJ, Wilson M. 2003. The effect of variable
energy input from a novel light source on the photoactivated bactericidal
action of toluidine blue o on streptococcus mutans. Caries Res 37: 190–193.
8. Williams JA, Pearson GJ, Colles MJ. 2006. Antibacterial action of
photoactivated didinfection {pad} used on endodontic bacteria in planktonic
suspension and in artificial and human root canals. J Dent Res 34: 363–371.
9. Rolim JPML, Melo MAS, Guedes SF, Albuquerque-Filho FB, Souza JR,
Nogueira NAP, Zanin ICJ, Rodrigues LKA. 2012. The antimicrobial activity
of photodynamic therapy against Streptococcus mutans using different
photosensitizers. J Photochem Photobiol B 106: 40-46.
10. Zanin ICJ, Goncalves RB, Brugnera A Jr, Hope CK, Pratten J. 2005.
Susceptibility of Streptococcus mutans biofilms to photodynamic therapy: an
in vitro study. J Antimicrob Chemother 56: 324–330.
11. Zanin IC, Lobo MM, Rodrigues LK, Pimenta LA, Hofling JF, Goncalves RB.
2006. Photosensitization of in vitro biofilms by toluidine blue O combined
with a light-emitting diode. Eur J Oral Sci 114: 64–69
12. Giusti JSM, Santos-Pinto L, Pizzolito AC, Helmerson K, Carvalho-Filho E,
Kurachi C, Bagnato VS. 2008. Antimicrobial photodynamic action on dentin
using a light-emitting diode light source. Photomed Laser Surg 26: 279–285.
91
13. Melo MAS, De-Paula DM, Lima JPM, Borges FMC, Steiner- Oliveira C,
Nobre-Dos-Santos M, Zanin ICJ, Barros EB, Rodrigues LKA. 2010. In Vitro
Photodynamic Antimicrobial Chemotherapy in Dentine Contaminated by
Cariogenic Bacteria. Laser Physics 20: 1–10.
14. Lima JPM, Sampaio De Melo MA, Borges FM, Teixeira AH, Steiner-Oliveira
C, Nobre Dos Santos M, Rodrigues LK, Zanin IC. 2009. Evaluation of the
antimicrobial effect of photodynamic antimicrobial therapy in an in situ model
of dentine caries, Eur J Oral Sci 117: 568-74.
15. Soukos NS, Goodson JM. 2011. Photodynamic therapy in the control of oral
biofilms. Periodontol 2000 55: 143–166.
16. Gold OG, Jordan HV, Van Houte J. 1973. A selective medium for
Streptococcus mutans. Arch Oral Biol18: 1357–1364.
17. Rogosa M, Mitchell JA, Wiseman RF. 1951. A selective medium for the
isolation and enumeration of oral lactobacilli. J Dent Res 30: 682–689.
18. O’Neill JF, Hope C, Wilson M. 2002. Oral bacteria in multi-species biofilms
can be killed by red light in the presence of toluidine blue. Lasers Surg Med
31: 86-90.
19. Guglielmi CA, Simionato MR, Ramalho KM, Imparato JCP, Pinheiro SL; Luz
MAAC. 2011. Clinical use of photodynamic antimicrobial chemotherapy for
the treatment of deep carious lesions. J Biomed Opt 16: 088003.
20. Paulino TP, Ribeiro KF, Thedei JR G, Tedesco AC, Ciancaglini P. 2005. Use of
hand held photopolymerizer to photoinactivate Streptococcus mutans. Arch
Oral Biol 50: 353-359.
21. Teixeira AH, Pereira ES, Rodrigues LKA, Saxena D, Duarte S, Zanin ICJ.
2012. Effect of Photodynamic Antimicrobial Chemotherapy on in vitro and in
situ Biofilms. Caries Res 46: 549–554.
22. Pereira CA, Romeiro RL, Costa ACBP, Machado AKS, Junqueira JC, AOC.
2011. Susceptibility of Candida albicans, Staphylococcus aureus, and
Streptococcus mutans biofilms to photodynamic inactivation: an in vitro
study. Lasers Med Sci 26:341–348.
23. Williams JA, Pearson GJ, Colles MJ, Wilson M. 2004. The photo-activated
antibacterial action of toluidina blue O in a collagen matrix and carious
dentine. Caries Res 38: 530-536.
92
24. Love RM, Jenkinson HF. 2002. Invasion of dentinal tubules by oral bacteria.
Crit Rev Oral Biol Med 13:171-83.
25. Switalski LM, Butcher WG, Caufield PC, Lantz MS. 1993. Collagen mediates
adhesion of Streptococcus mutans to human dentin. Infect Immun 61:4119-
4125.
26. Konopka K, Goslinski T. 2007. Photodynamic Therapy in Dentistry. J Dent
Res 86:694-70
27. George S, Kishen A. 2007. Photophysical, photochemical, and photobiological
characterization of methylene blue formulations for light-activated root canal
disinfection. J Biomed Opt 12: 034029.
93
4. CONCLUSÃO GERAL:
Com base nos resultados desta tese, conclui-se que:
1. O fotossensibilizador azul de orto toluidina é eficaz na redução de S. mutans.
Contudo, a produção de oxigênio singlete não é o parâmetro mais relevante a
considerar ao avaliar a atividade antimicrobiana da terapia fotodinâmica contra S.
mutans.
2. Há similar difusão do azul de orto toluidina em diferentes níveis de
desmineralização da dentina. Assim, há importância da influência do perfil de
penetração do fotossensibilizador e subsequente sucesso em ensaios clínicos da
terapia fotodinâmica no campo da cárie dental.
3. A terapia antimicrobiana fotodinâmica foi altamente eficaz em matar S. mutans
presentes em biofilmes formados in vitro. No entanto, não foi capaz de alterar a
expressão de genes de virulência gtfB, gtfC e gbpB. Isto é especialmente importante
quando se considera que a terapia não elimina todos os microorganismos presentes no
biofilme e que a presença de bactérias residuais em biofilmes irradiados com maior
expressão destes genes pode resultar na indução de uma maior virulência. Finalmente,
a indução da expressão de genes relacionados com o stress oxidativo, tais como luxS,
devem ser investigados de modo a esclarecer a influência da terapia fotodinâmica
antimicrobiana na organização do biofilme e virulência após o tratamento.
4. Houve diminuição significativa da microbiota cariogênica em dentina de lesões de
cárie após terapia antimicrobiana fotodinâmica, evidenciando que a proposta da
terapia fotodinâmica é plausível e poderá promover novos conceitos terapêuticas no
tratamento da cárie. Desta forma, os estudos disponíveis justificam os esforços na
investigação para melhorar esta terapia.
94
REFERÊNCIAS
AOKI, H; SHIROZA, T; HAYAKAWA, M; SATO, S; KURAMITSU, H. K. Cloning
of a Streptococcus mutans glucosyltransferase gene coding for insoluble glucan
synthesis. Infect. Immun., v. 53, n. 3, p. 587–94, 1986.
ATHAR, M; MUKHTAR, H; ELMETS, C. A; ZAIM, M. T; LLOYD, J. R;
BICKERS, D. R. In situ evidence for the involvement of superoxide anions in
cutaneous porphyrin photosensitization. Biochem. Biophys. Res. Commun., v. 151,
n. 3, p. 1054–1059, 1988.
AUSCHILL, T. M; HEIN, N; HELLWIG, E; FOLLO, M; SCULEAN, A;
ARWEILER, N. B. Effect of two antimicrobial agents on early in situ biofilm
formation. J. Clin. Periodontol., v. 32, n. 2 , p. 147–152, 2005.
BACKHAUS, R; TRASSIEIRA, M; VILLA, M; VERA DONOSCO, C. D; CRUZ, J.
F. Terapia fotodinámica El cáncer de próstata localizado. Actas. Urol. Esp., v. 31, n.
6, p. 633-641, jun. 2007,
BADET, C; THEBAUD, N. B. Ecology of Lactobacilli in the Oral Cavity: A Review
of Literature. Open. Microbiol. J., v. 2, p. 38-48, 2008.
BAEHNI, P. C; TAKEUCHI, Y. Anti-plaque agents in the prevention of biofilm-
associated oral diseases. Oral. Dis., v. 9, suppl. 1, p. 23–9, 2003.
BANAS, J. A; VICKERMAN, M. M. Glucan-binding proteins of the oral
streptococci. Crit Rev Oral Biol Med., v. 14, n. 2, p. 89-99, Mar. 2003.
BHATTI, M; MACROBERT, A; MEGHJI, S; HENDERSON, B; WILSON, M.
Effect of dosimetric and physiological factors on the lethal photosensitization of
95
Porphyromonas gingivalis in vitro. Photochem. Photobiol., v. 65, n. 6, p. 1026-1031,
Jun. 1997.
BOLEAN, M; PAULINO, T. P; THEDEI JR, G; CIANCAGLINI, P. Photodynamic
Therapy with Rose Bengal Induces GroEL Expression in Streptococcus mutans
Photomed. Laser. Surg., v. 28, Suppl. 1, p. S79–S84, 2010.
BOWDEN, G; EDWARDSSON, S. Ecologia Oral E Cárie Dentária. In:
THYLSTRUP, A; FEJERSKOV, O. Cariologia clínica. São Paulo: Santos; p.45-9,
1995.
BURNE, R. A. Oral streptococci.products of their environment. J. Dent. Res., v. 77,
n. 3, p. 445-452, 1998.
CAMILLI, A; BASSLER, B. L. Bacterial small-molecule signaling pathways.
Science., v. 311, n. 5764, p. 1113–1116, 2006. Feb
CADET, J. J. L; RAVANAT, G. R; MARTINEZ M. H; MEDEIROS, P; DI
MASCIO. Singlet oxygen oxidation of isolated and cellular DNA: product formation
and mechanistic insights, Photochem. Photobiol., v. 82, n. 5, p. 1219–1225, Set.
2006.
CHAMBLESS, J. D; HUNT, S. M; STEWART, P. S. A three-dimensional computer
model of four hypothetical mechanisms protecting biofilms from antimicrobials.
Appl. Environ. Microbiol., v. 72, n. 3, p. 2005–13, 2006.
COSTERTON, J. W; GEESEY, G. G; CHENG, K-J. How bacteria stick. Sci. Am., v.
238, n. 1, p. 86-95, 1978.
COSTERTON, J. W; LEWANDOWSKI, Z. D. E; CALDWELL, D. R; KORBER H.
M; LAPPIN-SCOTT. Microbial biofilms. Annu. Rev. Microbiol., v. 49, n.1, p. 711-
745, 1995.
96
COSTERTON, J. W; STEWART, P. S; GREENBERG, E. P. Bacterial biofilms: a
common cause of persistent infections. Science., v. 284, n. 5443, p.1318-1322, 1999.
CURY, J. A; REBELO, M. A; DEL BEL CURY, A. A; DERBYSHIRE, M. T;
TABCHOURY, C. P. Biochemical composition and cariogenicity of dental plaque
formed in the presence of sucrose or glucose and fructose. Caries. Res., v. 34, n. 6 ,
p.491-497, Dez. 2000.
CVITKOVITCH, D. G; LI, Y. H; ELLEN, R. P. Quorum sensing and biofilm
formation in Streptococcal infections. J. Clin. Invest., v. 112, n.11, 1626-1632, Dez.
2003.
DIAZ, P. I; CHALMERS, N. I; RICKARD, A. H; KONG, C; CRAIG L. MILBURN,
C. L; ROBERT J. PALMER, R. J; KOLENBRANDER, E. P. Molecular
Characterization of Subject-Specific Oral Microflora during Initial Colonization of
Enamel. Appl. Environ. Microbiol., v. 72, n. 4, p. 2837-2848, 2005
DUQUE, C; STIPP, R. N; WANG, B; SMITH, D. J; HOFLING, J. F; HOWARD, K;
KURAMITSU, H. K; DUNCAN, M. J; MATTOS-GRANER R. O. Downregulation
of GbpB, a Component of the VicRK Regulon, Affects Biofilm Formation and Cell
Surface Characteristics of Streptococcus mutans. Infect.Immun., v. 79, n. 2, p. 786–
796, 2011.
FINK-PUCHES, R; HOFER, A; SMOLLE, J; KERL, H; WOLF, clinical response
and log-term follow-up of solar keratoses treated with topically applied 5-
aminolevulinic acid and irradiation by different wave bands of light. J. Photochem.
Photobiol. B., v. 41, n. 2 , p. 145–151, 1997.
FUCHS, J; THIELE, J. The role of oxygen in cutaneous photodynamic therapy. Free
Radic. Biol. Med., v. 24, n. 5, p. 835-847, Mar. 1998.
FUJIWARA, T; TAMESADA, M; BIAN, Z; KAWABATA, S; KIMURA, S;
HAMADA S. Deletion and reintroduction of glucosyltransferase genes of
97
Streptococcus mutans and role of their gene products in sucrose dependent cellular
adherence. Microb. Pathog., v. 20, n.4, p. 225– 233, 1996.
FUJIWARA, T; HOSHINO, T; OOSHIMA, T; HAMADA, S. Differential and
quantitative analyses of mRNA expression of glucosyltransferases from
Streptococcus mutans MT8148. J. Dent. Res., v. 81; n.2, p.109-113, 2002.
GIUSTI, J. S. M; SANTOS-PINTO, L; PIZZOLITO, A. C; HELMERSON K;
CARVALHO-FILHO, E; KURACHI, C; BAGNATO, V. S. Antimicrobial
photodynamic action on dentin using a light-emitting diode light source. Photomed.
Laser. Surg., v. 26, n. 4, p.279-285, Aug. 2008
GOODMAN, S. D; GAO, Q. Characterization of the gtfB and gtfC promoters from
Streptococcus mutans GS-5. Plasmid., v. 43, n.1 , p. 85-98, Ju. 2000.
GUGLIELMI C, A.B; SIMIONATO,M. R; RAMALHO K. M.; IMPARATO, J. C. P;
PINHEIRO, S. L; LUZ, M. A. A. C. Clinical use of photodynamic antimicrobial
chemotherapy for the treatment of deep carious lesions. J. Biomed. Opt., v. 16, n. 8,
p. 088003, Aug. 2011.
HAMBLIN, M. R; HASAN, T. Photodynamic therapy: a new antimicrobial approach
to infectious disease? Photochem. Photobial. Sci., v. 3, n. 5, p. 436-450, May. 2004.
HANADA, N; KURAMITSU, H. K. Isolation and characterization of the
Streptococcus mutans gtfD gene, coding for primer- dependent soluble glucan
synthesis. Infect. Immun.; v. 57, n.7, p.2079–85, 1989.
HAYACIBARA, M. F; KOO, H; VACCA-SMITH, A. M; KOPEC, L. K; SCOTT-
ANNE, K; CURY, J. A; BOWEN, W. H. The influence of mutanase and dextranase
on the production and structure of glucans synthesized by streptococcal
glucosyltransferases. Carbohydr. Res., v. 339, n. 12, p. 2127-2137.5, Aug. 2004.
98
JONES, C.G. Chlorhexidine: is it still the gold standard? Periodontol 2000., v. 15, n.
1 , p.55-62, 1997.
KIDD, E. A. M; RICKETTS, D. N. T; BEIGHTON, D. Criteria for caries removal at
the enamel-dentine junction: A clinical and microbiological study. B. Dent J., v. 180,
n. 8, p. 287-291, Apr. 1996.
KOLENBRANDER, P.E; ANDERSEN, R. N; BLEHERT, D. S; EGLAND, P. G;
FOSTER, J. S; PALMER JR, R. J. Communication among oral bacteria. Microbiol. Mol. Biol. Rev., v. 66, n.3, p. 486–505, Sep. 2002.
KONOPKA K; GOSLINSKI T. Photodynamic Therapy in Dentistry. J. Dent. Res., v.
86, n. 8, p. 694-707, 2007.
KOPEC, L. K; VACCA-SMITH, A. M; BOWEN, W. H. Structural aspects of glucans
formed in solution and on the surface of hydroxyapatite. Glycobiology., v.7, n.7,
p.929-934, 1997.
LAWRENCE, J. R; SWERHONE, G. D; LEPPARD, G. G; ARAKI, T; ZHANG. X;
WEST, M. M; HITCHCOCK, A. P. Scanning transmission X-ray, laser scanning, and
transmission electron microscopy mapping of the exopolymeric matrix of microbial
biofilms. Appl. Environ. Microbiol., v. 69, n.9, p. 5543–5554, Sep. 2003.
LEMOS, J. A; ABRANCHES, J; BURNE, R. A. Responses of cariogenic streptococci
to environmental stresses. Curr. Issues. Mol. Biol., v.7, p. 95–107, 2005.
LERICHE, V; SIBILLE, P; CARPENTIER B. Use of an enzyme-linked lectinsorbent
assay to monitor the shift in polysaccharide composition in bacterial biofilms. Appl.
Environ. Microbiol., v. 66, n.5, p. 1851–1856, May. 2000.
LI, Y; BURNE, R. A. Regulation of the gtfBC and ftf genes of Streptococcus mutans
in biofilms in response to pH and carbohydrate. Microbiology., v. 147, n.1, p. 2841–
8, Oct. 2001.
99
LI, Y.H; TANG, N; ASPIRAS, M.B; LAU, P.C; LEE, J.H; ELLEN, R.P;
CVITKOVITCH, D.G. A quorum-sensing signaling system essential for genetic
competence in Streptococcus mutans is involved in biofilm formation, J. Bacteriol., v. 184, n. 10, p. 2699–2708, 2002.
LI; J; HELMERHORST, E. J; LEONE, C. W; TROXLER, R. F; YASKELL, T;
HAFFAJEE, A. D; SOCRANSKY, S. S; OPPENHEIM, F. G. Identification of early
microbial colonizers in human dental biofilm. J. Appl. Microbiol., v. 97, n.6, p.
1311–8, Dec. 2004.
LIMA J. P. M; SAMPAIO DE MELO, M. A; BORGES, F. M; TEIXEIRA, A. H;
STEINER-OLIVEIRA, C; NOBRE DOS SANTOS, M; RODRIGUES, L.K; ZANIN,
I.C. Evaluation of then antimicrobial effect of photodynamic antimicrobial therapy in
an in situ model of dentine caries, Eur. J. Oral. Sci., v. 117, n. 5, p. 568–574, Oct.
2009.
LUAN, X; QIN, Y; BI, L; HU, C; ZHANG, Z; LIN, J et al. Histological evaluation of
the safety of toluidine blue-mediated photosensitization to periodontal tissues in mice.
Lasers. Med. Sci., v. 24, n. 2, p. 162-6, Mar. 2009.
MACROBERT, A. J; BOWN, S.G; PHILLIPS, D. What are the ideal properties of a
photosensitizer? In: Photosensitizing compounds: their chemistry, biology and clinical
use. Chichester: Wiley; p. 4-16, 1989.
MALIK, Z; HANANIA, J; NITZAN, Y. New trends in photobiology bactericidal
effects of photoactivated porphyrins--an alternative approach to antimicrobial drugs.
J. Photochem. Photobiol. B., v. 5, n. 3/4, p. 281-293, May. 1990.
MATTOS-GRANER, R. O., JIN, S; KING, W. F; CHEN, T; SMITH, D. J;
DUNCAN, M. J. Cloning of the Streptococcus mutans gene encoding glucan binding
protein B and analysis of genetic diversity and protein production in clinical isolates.
Infect. Immun., v. 69, n.11, p. 6931–6941, Nov. 2001.
100
MELO, M. A. S; DE-PAULA, D. M; LIMA, J. P. M; BORGES, F. M. C; STEINER-
OLIVEIRA, C; NOBRE-DOS-SANTOS, M; ZANIN, I. C. J; BARROS, E. B;
RODRIGUES, L. K. A. In vitro photodynamic antimicrobial chemotherapy in dentine
contaminated by cariogenic bacteria. Laser. Phys., v. 20, 1, p. 1–10, Jan. 2010.
MERRITT, J; QI, F; GOODMAN, S. D; ANDERSON, M. H; SHI, W. Mutation of
luxS Affects Biofilm Formation in Streptococcus mutans. Infect. Immun., v. 71, n.4,
p. 1972-1979, 2003.
MERRITT, J; KRETH, J; SHI, W; QI, F. LuxS controls bacteriocin production in
Streptococcus mutans through a novel regulatory component. Mol Microbiol., v. 57,
n.4, p. 960–969, 2005
MILLER, M. B; BASSLER, B. L. Quorum sensing in bacteria. Annu. Rev. Microbiol., v. 55, n. 1, p.165-199, 2001.
MITRA, S. Photodynamic therapy: biophysical mechanisms and molecular responses.
2004. PhD Thesis (Doctor of Philosophy) – Department of Biochemistry and
Biophysics, School of Medicine and Dentistry, University of Rochester, Rochester,
NY, 2004. Disponível em:
<http://www.urmc.rochester.edu/smd/Rad/foster/people/Soumya_PhDthesis.pdf>.
Acesso em: 15 Jan. 2009.
NAGATA, J. Y; HIOKAB, N; KIMURAC, E; BATISTELA, V. R; TERADAA, R.
S. S; GRACIANOA, A. X; BAESSOD, M. L; HAYACIBARAA, M. F. Antibacterial
photodynamic therapy for dental caries: Evaluation of the photosensitizers used and
light source properties. Photodiagnosis. Photodyn. Ther., v. 9, n. 2, p. 122-131, Jun.
2012.
NYVAD, B. Microbial colonization of human tooth surfaces. Acta Pathol Microbiol
Immunol Scand Suppl, Copenhagen, v.32, n.1, p.1-45, 1993.
101
PAULINO, T. P; RIBEIRO, K. F; THEDEI JR, G; TEDESCO, A. C;
CIANCAGLINI, P. Use of hand held photopolymerizer to photoinactivate
Streptococcus mutans. Arch. Oral Biol., v. 50, n. 3, p. 353-359, Mar. 2005.
PELOI, L. S; SOARES, R. S. S; BIONDO, C. E. G; SOUZA, V.R; HIOKA, N;
KIMURA, E. Photodynamic effect of light-emitting diode light on cell growth
inhibition induced by methylene blue. J. Biosci., v. 33, n. 2, p. 231–237, Jun. 2008.
PRATES, R. A; YAMADA JR, A. M; SUZUKI, L. C; HASHIMOTO, M. C. E; CAI,
S; GOUW-SOARES, S; GOMES, L; RIBEIRO, M. S. Bactericidal effect of
malachite Green and red laser on actinobacillusactinomycetemcomitans. J.
Photochem. Photobiol. B., v. 86, n. 1, p. 1-7, Jan. 2006.
PRATTEN, J; BARNETT, P; WILSON, M. Composition and susceptibility to
chlorhexidine of multi-species biofilms of oral bacteria. Appl. Environ. Microbiol., v. 64, n.9, p. 3515–3519, 1998.
PUCCI, M. J; JONES, K. R; KURAMITSU, H. K; MACRINA, F. L. Molecular
cloning and characterization of the glucosyltransferase C. gene (gtfC) from
Streptococcus mutans LM7. Infect. Immun; v. 55, n.9, p.2176–82, Sep. 1987.
RAAB O. U¨ ber die Wirkung fluoriziender Stoffe auf Infusorien.Zeit Biol 1900: 39:
524–546 In. SOUKOS N. S; GOODSON J. M. Photodynamic therapy in the control
of oral biofilms. Periodontol 2000., n. 1, v. 55, p. 143–166, 2011.
ROLIM, J. P. M. L; DE-MELO, M. A. S; GUEDES, S. F; ALBUQUERQUE-FILHO,
F. B; SOUZA J. R; NOGUEIRA, N. A. P; ZANIN, I. C. J; LIDIANY K.A.
RODRIGUES. The antimicrobial activity of photodynamic therapy against
Streptococcus mutans using different photosensitizers. Photochem. Photobiol. Biol:
B., v. 106, p. 40–46, Jan. 2012.
102
RYTER, S.T; TYRRELL, M. Singlet molecular oxygen (1O2); A possible effector of
eukaryotic gene expression. Free Radic. Biol. Med., v. 24, n. 9, p. 1520-1534, Jun.
1998
SCHILLING, K. M; BOWEN, W. H. Glucans synthesized in situ in experimental
salivary pellicle function as specific binding sites for Streptococcus mutans. Infect.
Immun ., v. 60, n. 1 , p. 284-295, Jan. 1992.
SCHMIDT, R. Photosensitized generation of singlet oxygen, Photochem. Photobiol., v. 82, n. 5, p. 1161–1177, Set. 2006.
SHAPIRO, S; GIERTSEN, E; GUGGENHEIM, B. An in vitro oral biofilm model
for comparing the efficacy of antimicrobial mouthrinses. Caries. Res., v. 36, n.2, p.
93–100, 2002.
SOCRANSKY, S. S; HAFFAJEE, A. D. Dental biofilms: difficult therapeutic targets.
Periodontol 2000., v. 28, n.1 , p. 12–55, 2002.
SOUKOS N. S; GOODSON J. M. Photodynamic therapy in the control of oral
biofilms. Periodontol 2000., v. 55, n. 1, p. 143–166, 2011.
SPLIETH, C; STEFFEN, H; ROSIN, M; WELK A. caries prevention with
chlorhexidine-tymol varnish in high risk schoolchildren. Community Dent Oral
Epidemiol., v. 28,n. 6, p. 419-23, 2000.
STEWART, P. S; COSTERTON, J. W. Antibiotic resistance of bacteria in biofilms.
Lancet., v. 358, n. 9276, p. 135–8, 2001.
SUTHERLAND, I. W. The biofilm matrix—an immobilized but dynamic microbial
environment. Trends. Microbiol., v. 9, n 5, p.222–227, May. 2001.
103
TAMESADA, M; KAWABATA, S. Synergistic effects of streptococcal
glucosyltransferase on adhesive biofilm formation. J. Dent. Res., v. 83,n. 11, p. 874–
9, Nov. 2004.
TEN CATE, J. M. Biofilms: a new approach to the microbiology of dental plaque.
Odontology., v. 94, n. 1, p. 1-9, Sep. 2006.
THEDEI JR, G; LEITÃO, D.P.S; BOLEAN, M; PAULINO, T. P; SAPADRO, A. C.
C; CIANCAGLINI, P. Toluene permeabilization affects F- and P-type ATPase
activities present in Streptococcus mutans plasma membrane. Braz. J. Med.
Biol.Res., v. 41, n. 12, p. 1047–1053, 2008.
THUMNHEER, T; VAN DER PLOEG, J. R; GIERTSEN, E; GUGGENHEIM, B.
Effects of Streptococcus mutans gtfC deficiency on mixed oral biofilms in vitro.
Caries. Res., v. 40, n. 2, p. 163-71, 2006.
TSUMORI, H; KURAMITSU, H. The role of the Streptococcus mutans
glucosyltransferases in the sucrose-dependent attachment to smooth surfaces:
essential role of the GtfC enzyme. Oral. Microbiol. Immunol., v. 12, n. 5, p. 274–
280, Oct. 1997.
WAINWRIGHT, M. Photoantimicrobials - a PACT against resistance and infection.
Drugs. Fut., v. 29, n. 1, p. 85, 2004
WEN, Z. T; BURNE, R. A. Functional genomics approach to identifying genes
required for biofilm development by Streptococcus mutans. Appl. Environ.
Microbiol., v. 68, p.1196–1203. 2002.
WEN, Z. T; BURNE, R. A. LuxS-mediated signaling in Streptococcus mutans is
involved in regulation of acid and oxidative stress tolerance and biofilm formation. J. Bacteriol., v. 186, n. 9, p.2682-2691, 2004
WEN, Z. T; SUNTHARALIGHAM P; CVITKOVITCH D. G; BURNE R. A.
104
Trigger factor in Streptococcus mutans is involved in stress tolerance, competence
development, and biofilm formation. Infect. Immun., v. 73, p.219– 225. 2005.
WEN Z. T; YATES D; AHN S-J; BURNE R. A. Biofilm formation and virulence
expression by Streptococcus mutans are altered when grown in dual-species model.
BMC. Microbiol., v. 10, p. 1-11, 2010.
WEN, Z. T; NGUYEN, A. H; BITOUN, J. P; ABRANCHES, J; BAKER, H. V;
BURNE, R. A. Transcriptome analysis of LuxS-deficient Streptococcus mutans
grown in biofilms. Mol oral Microbiol..v.26,n. 1, p. 2-18, 2011
WILSON, M; BURNS, T; PRATTEN, J; PEARSON, G. J. Bacteria in supragingival
plaque samples can be killed by low-power laser light in the presence of a
photosensitizer. J. Appl. Bacteriol., v. 78, n. 5; p.569-74, 1995.
WILSON, M; YIANNI, C. Killing of methicillin-resistant Staphylococcus aureus by
low-power laser light. J. Med. Microbiol., v. 42, n.1, p. 62-6, Jan. 1995.
WILSON, M; BURNS, T; PRATTEN, J. Killing of Streptococcus sanguis in
biofilmes using a light-activated antimicrobial agent. J. Antimicrobial. Chemother.,
v. 37, n. 2, p. 377-81, 1996.
WILSON, M. Lethal photosensitization of oral bacteria and its potential application in
the photodynamic therapy of oral infections. Photochem. Photobiol. Sci., v. 3, n. 5,
p. 412-418, May. 2004.
WILSON, B. C; PATTERSON, M. S. The physics, biophysics and technology of
photodynamic therapy. Phys. Med. Biol., v. 53, n.9, p. 61-109, May. 2008.
WUNDER, D; BOWEN, W. H. Action of agents on glucosyltransferases from
Streptococcus mutans in solution and adsorbed to experimental pellicle. Arch. Oral.
Biol., v. 44, n.3, p. 203–14, 1999.
105
YAMASHITA, Y; BOWEN, W. H; BURNE, R. A; KURAMITSU, H. K. Role of the
Streptococcus mutans gtf genes in caries induction in the specific-pathogen-free rat
model. Infect. Immun., v. 61, n.9, p.3811–3817, Sep. 1993.
YAVARI, N. Optical spectroscopy for tissue diagnostics and treatment control. 2006.
(Doctoral Thesis)- Department of Physics and technology, the University of Bergen,
Bergen, 2006.
YOSHIDA, A; ANSAI, T; TAKEHARA, T; KURAMITSU, H. K. LuxS-based
signaling affects Streptococcus mutans biofilm formation. Appl. Environ.
Microbiol., v. 71, n. 5, p. 2372-2380, 2005.
ZANIN, I. C. J; GONCALVES, R. B; BRUGNERA-JR, A; HOPE, C. K; PRATTEN,
J. Susceptibility of Streptococcus mutans biofilms to photodynamic therapy: an in
vitro study. J. Antimicrob. Chemother., v. 56, n. 2, p. 324-330, Aug. 2005.
ZANIN, I. C; LOBO, M. M; RODRIGUES, L.K, PIMENTA, L. A; HOFLING J. F;
GONCALVES, R. B. Photosensitization of in vitro biofilms by toluidine blue O
combined with a light-emitting diode. Eur. J. Oral. Sci., v. 114, n.1, p. 64-69, Feb.
2006.
106
APÊNDICE A
INFORMAÇÕES E CONSENTIMENTO PÓS-INFORMAÇÃO PARA PARTICIPAÇÃO EM PESQUISA – PARA OS VOLUNTÁRIOS QUE
DOARÃO OS DENTES
Nome do Voluntário:________________________________________________ As informações contidas neste prontuário foram fornecidas por Juliana Paiva Marques Lima (aluna de doutorado do curso de Odontologia) e Profa. Dra. Nádia Accioly Pinto Nogueira, onde você autoriza, por escrito, sua doação de dentes terceiros molares, extraídos por necessidades clínicas, após conhecer os procedimentos que serão realizados e tendo liberdade para decidir sem qualquer coação. Título do trabalho: “Confocal Raman study of photosensitizer penetration in artificially dentin caries lesions”. Objetivos: Este estudo vai avaliar o grau de penetraçãoo do fotossensibilizador, azul de orto toluidina e dentina sadia e desmineralizada Justificativa: Os estudos em terapia fotodinâmica estão evoluindo. Já existem alguns estudos nos quais avaliam a efetividade da terapia em cárie dentinária. Desta forma, há a necessidade de investigar o quanto o fotossensibilizador penetra nos túbulos dentinários e seu alcance nos micro-organismos alvos.
Procedimento experimental: Para a realização desse estudo, serão selecionados terceiros molares não erupcionados (“o dente do ciso”) que não contenham fraturas e rachaduras. Os dentes serão cortados em blocos de dentina, medindo 5x5x2 mm com uma cortadeira elétrica, serão lixados e polidos. Após o polimento final, os blocos serão lavados em água corrente e mantidos em ambiente úmido até serem submetidos ao protocolo de desmineralização in vitro e in situ.
Desconforto ou riscos esperados e benefícios vinculados à pesquisa: Os voluntários que doarem os seus dentes extraídos não sofrerão nenhum risco porque os dentes utilizados serão extraídos, segundo razões clínicas e decisão de tratamento do cirurgião dentista do próprio voluntário. Forma de acompanhamento e assistência: A assistência necessária será dada pelo dentista responsável pela extração dos dentes, não estando vinculada aos pesquisadores. Métodos alternativos existentes: Os pesquisadores preferiram, nessa pesquisa, utilizar dentes humanos ao invés de dentes bovinos, para simular uma condição o mais próxima possível daquela existente na cavidade bucal.
107
Garantia de esclarecimento: O voluntário tem garantia de que receberá resposta a qualquer pergunta ou esclarecimento de qualquer dúvida quanto aos procedimentos, riscos, benefícios e outros assuntos relacionados à pesquisa. Além disso, os pesquisadores proporcionarão informação atualizada sobre essa pesquisa. O voluntário tem, também, liberdade para deixar de participar da pesquisa a qualquer momento. Qualquer dúvida, favor comunicar o mais rápido possível. Tel: 3366-82-32 (Pós-graduação odontologia) ou 9925-25-84 (Juliana Paiva) Retirada do Consentimento: O voluntário tem a liberdade de retirar seu consentimento a qualquer momento e deixar de participar do estudo sem prejuízo de ordem pessoal-profissional com os responsáveis pela pesquisa. Garantia de sigilo: Os pesquisadores asseguram a privacidade dos voluntários quanto aos dados confidenciais envolvidos na pesquisa.
Formas de ressarcimento e indenização: Como os pesquisadores não participarão dos procedimentos de decisão e extração dos dentes, não haverá formas de ressarcimento e indenização. ATENÇÂO: A sua participação em qualquer tipo de pesquisa é voluntária. Em caso de dúvida, quanto aos seus direitos, escreva para o Comitê de Ética em pesquisa da UFC. Eu, ______________________________________, certifico que tendo lido as informações acima e suficientemente esclarecido(a) de todos os itens pela aluna Juliana Paiva Marques Lima, estou plenamente de acordo com a realização do experimento. Assim, eu autorizo a utilização dos meus dentes, que foram extraídos por razões alheias à vontade dos pesquisadores na pesquisa acima mencionada.
Fortaleza, ____ de ______________ de 2009. Nome (por extenso):___________________________________________________ Assinatura:__________________________________________________________
108
ANEXO A
109
ANEXO B
110
ANEXO C
Recommended