View
214
Download
1
Category
Preview:
Citation preview
Accepted Manuscript
Aquaporin-4 as a molecular partner of cystic fibrosis transmembrane conduc-tance regulator in rat Sertoli cells
Tito T. Jesus, Raquel L. Bernardino, Ana D. Martins, Rosália Sá, Mário Sousa,Marco G. Alves, Pedro F. Oliveira
PII: S0006-291X(14)00488-4DOI: http://dx.doi.org/10.1016/j.bbrc.2014.03.046Reference: YBBRC 31815
To appear in: Biochemical and Biophysical Research Communi-cations
Received Date: 7 March 2014
Please cite this article as: T.T. Jesus, R.L. Bernardino, A.D. Martins, R. Sá, M. Sousa, M.G. Alves, P.F. Oliveira,Aquaporin-4 as a molecular partner of cystic fibrosis transmembrane conductance regulator in rat Sertoli cells,Biochemical and Biophysical Research Communications (2014), doi: http://dx.doi.org/10.1016/j.bbrc.2014.03.046
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customerswe are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, andreview of the resulting proof before it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Title: Aquaporin-4 as a molecular partner of cystic fibrosis 1
transmembrane conductance regulator in rat Sertoli cells 2
3
Tito T. Jesus1, Raquel L. Bernardino1, Ana D. Martins1, Rosália Sá2, Mário 4
Sousa2,3, Marco G. Alves1, Pedro F. Oliveira1� 5
6
1 CICS – UBI – Health Sciences Research Centre, University of Beira Interior, 7
Covilhã, Portugal; 8
2 Department of Microscopy, Laboratory of Cell Biology & Multidisciplinary Unit 9
for Biomedical Research, UMIB-FCT, Institute of Biomedical Sciences Abel 10
Salazar (ICBAS), University of Porto, Portugal; 11
3 Centre for Reproductive Genetics Alberto Barros, Porto, Portugal 12
13
14
� Corresponding author: 15
Pedro Fontes Oliveira 16
Health Sciences Research Centre 17
University of Beira Interior 18
Av. Infante D. Henrique 19
6201-506 Covilhã, Portugal 20
Email: pfobox@gmail.com 21
Tel: +351 275 329077 22
Fax: +351 275 329099 23
2
Abstract 24
Sertoli cells (SCs) form the blood-testis barrier (BTB) that controls the 25
microenvironment where the germ cells develop. The cystic fibrosis 26
transmembrane conductance regulator (CFTR) plays an essential role to male 27
fertility and it was recently suggested that it may promote water transport. 28
Interestingly, Aquaporin-4 (AQP4) is widely expressed in blood barriers, but 29
was never identified in SCs. Herein we hypothesized that SCs express CFTR 30
and AQP4 and that they can physically interact. 31
Primary SCs cultures from 20-day-old rats were maintained and CFTR and 32
AQP4 mRNA and protein expression was assessed by RT-PCR and western 33
blot, respectively. The possible physical interaction between CFTR and AQP4 34
was studied by co-immunoprecipitation. 35
We were able to confirm the presence of CFTR at mRNA and protein level in 36
cultured rat SCs. AQP4 mRNA analysis showed that cultured rat SCs express 37
the transcript variant c of AQP4, which was followed by immunodetection of 38
the correspondent protein. The co-immunoprecipitation experiments showed a 39
direct interaction between AQP4 and CFTR in cultured rat SCs. 40
Our results suggest that CFTR physically interacts with AQP4 in rat SCs 41
evidencing a possible mechanism by which CFTR can control water transport 42
through BTB. The full enlightenment of this particular relation between CFTR 43
and AQP4 may point towards possible therapeutic targets to counteract male 44
subfertility/infertility in men with Cystic Fibrosis and mutations in CFTR gene, 45
which are known to impair spermatogenesis due to defective water transport. 46
47
Keywords: CFTR, Aquaporin-4, Sertoli cells, water transport 48
3
1. Introduction 49
Spermatogenesis takes place within the seminiferous tubules, where Sertoli 50
cells (SCs) directly interact with the developing germ cells [1]. Adjacent SCs 51
connect through specialized junctions, establishing the Sertoli/blood-testis 52
barrier (BTB) and controlling the passage of substances [1,2]. Hence, SCs 53
control the seminiferous tubular fluid (STF) composition and the 54
physiochemical milieu where spermatogenesis occurs [1,3]. The STF 55
composition is dependent of ions and water movements [4]. Thus, distinct 56
types of ion and water transport proteins have been identified in the plasmatic 57
membrane of these cells (for review [3]). Nevertheless, their involvement on 58
STF establishment remains unknown. 59
The cystic fibrosis transmembrane conductance regulator (CFTR) is a cAMP-60
regulated membrane transporter of the ATP-binding cassette superfamily [5], 61
widely expressed in cells of the reproductive tract [6]. Noteworthy, mutations 62
in the gene that encodes the CFTR protein have been associated with several 63
abnormalities on the male reproductive system and with abnormal production, 64
quality and number of sperm cells [7,8]. CFTR presence was reported in the 65
cytoplasm and plasma membrane of SCs [9], where it plays a role in HCO3- 66
transport [10]. Moreover, CFTR plays an important role in epithelial cells fluid 67
volume regulation [5], enhancing osmotic water permeability via direct 68
molecular interactions with water channels (Aquaporins). This additional role 69
of CFTR in controlling water permeability may have an impact on the 70
development of the Cystic Fibrosis (CF). 71
Aquaporins (AQPs) are essential for water homeostasis regulation and for 72
providing a continuous and rapid water movement across epithelia [11,12,13]. 73
4
During spermatogenesis, there is a striking reduction of germ cells volume, 74
largely due to the osmotically driven fluid efflux [14], being expectable that 75
AQPs are key players in this process. Aquaporin-4 (AQP4) has been briefly 76
identified by immunocytochemistry in the seminiferous tubules [15]. 77
Interestingly, AQP4 is densely expressed in the blood-brain barrier (BBB) [16], 78
which exhibits remarkable similarities with BTB [17]. Several cellular functions 79
have been attributed to AQP4, such as regulation of extracellular space 80
volume, potassium buffering, fluid circulation and resorption, waste clearance, 81
neuroinflammation, osmosensation, cell migration, and Ca2+ signaling (for 82
review see [16]). 83
Since AQP4 mediates water flux through BBB, we aimed to full disclose its 84
expression in isolated SCs. Moreover, CFTR has been reported to interact 85
with AQPs to regulate osmotic water permeability, thus, we hypothesized that 86
CFTR can interact with AQP4 providing new insight on how CFTR can 87
regulate water membrane movements. 88
89
2. Material and Methods 90
2.1. Chemicals 91
NZY M-MuLV Reverse Transcriptase (M-MLV RT), random hexamer primers, 92
dNTPs and NZTaq 2x Green Master Mix, agarose and DNA ladder were 93
obtained from NZYTech (Lisboa, Portugal). Primers were obtained from 94
STABVIDA (Oeiras, Portugal). All other chemicals were purchased from 95
Sigma-Aldrich (St. Louis, USA), unless stated otherwise. 96
97
2.2. Animals 98
5
Male Wistar rats (Rattus norvegicus) were housed under a 12h light–12h 99
darkness cycle and constant room temperature (20±2°C) in our accredited 100
animal facilities, with food and water ad libitum. Accommodation, maintenance 101
and animal handling were performed in accordance with national and 102
international guidelines, particularly with the ‘Guide for the Care and Use of 103
Laboratory Animals’, available in the US National Institutes of Health (NIH 104
Publication no. 85-23, revised 1996), and the EU rules for the care and 105
handling of laboratory animals (Directive 2010/63/EU). 106
107
2.3. Primary Cultures of Rat Sertoli Cells 108
Male Wistar rats (20-day-old) were sacrificed by cervical dislocation. The 109
testes were excised and washed. SCs were isolated as reported by Oliveira 110
and collaborators [18]. Specific protein markers, anti-mullerian hormone 111
(AMH) and vimentin, were used to assess cultures purity [19]. After 96h, 112
cultures were examined by phase contrast microscopy and only the cultures 113
with cell contaminants below 5% were used. 114
115
2.4. RT-PCR 116
The extraction of total RNA (RNAt) from brain, lung and SCs was performed 117
using the E.Z.N.A. Total RNA Kit (Omega Bio-Tek, Norcross, USA) as 118
indicated by the manufacturer. RNA concentration and absorbance ratios 119
(A260/A280) were determined by spectrophotometry (NanophotometerTM, 120
Implen, Germany). The RNAt was reversely transcribed as reported by Alves 121
and collaborators [20]. The resulting complementary deoxyribonucleic acid 122
(cDNA) was used with exon-exon spanning primer sets designed to amplify 123
6
CFTR and AQP4 cDNA fragments (Table 1). Polymerase chain reactions 124
(PCR) were carried out as described by Alves and collaborators [20]. Primers’ 125
sequences, optimal annealing temperature, number of cycles required for 126
exponential amplification phase of fragments, fragments size and positive 127
control are indicated (Table 1). cDNA-free sample was used as negative 128
control. Samples were run in 1% agarose gel electrophoresis and visualized 129
using software Molecular Imager FX Pro Plus MultiImager (Biorad, Hercules, 130
USA) coupled to an image acquisition system (Vilber Lourmat, Marne-la-131
Vallée, France). The size of the expected products was compared to a DNA 132
ladder. 133
134
2.5. Western blot 135
Western Blot was performed as previously described by Alves and 136
collaborators [21]. In brief, proteins samples (50 µg) were fractionated on a 137
12% SDS-PAGE and transferred to polyvinylidene difluoride membranes. The 138
membranes were blocked and incubated overnight at 4ºC with rabbit anti-139
AQP4 (1:500, AQP41-A, Gentaur, Gdansk, Poland) or goat anti-CFTR (1:500; 140
SC-8909, Santa Cruz Biotechnology, Heidelberg, Germany). The immune-141
reactive proteins were detected separately with goat anti-rabbit IgG-AP 142
(1:5000, Sc 2007, Santa Cruz Biotechnology, Heidelberg, Germany) or 143
donkey anti-goat IgG-AP (1:5000, Sc 2020, Santa Cruz Biotechnology, 144
Heidelberg, Germany). Membranes were reacted with ECF detection system 145
(GE, Healthcare, Weßling, Germany) and read with the BioRad FX-Pro-plus 146
(Bio-Rad, Hemel Hempstead, UK). The densities from each band were 147
obtained using the Quantity One Software (Bio-Rad, Hemel Hempstead, UK). 148
7
149
2.6. Co-Immunoprecipitation 150
Immunoprecipitation of CFTR was performed using the Dynabeads® Co-151
Immunoprecipitation Kit (Life Technologies, Calsbad, USA). Anti-CFTR goat 152
antibody was conjugated to magnetic beads according to the manufacturer’s 153
protocol. In brief, harvested SCs (50 mg) were lysed in extraction buffer (1x IP 154
Buffer, NaCl 100 mM, Protease Inhibitors 1:400) and centrifuged (2600.g for 5 155
minutes). The final supernatant contained the cell lysate ready to be used 156
immediately for co-immunoprecipitation. For co-immunoprecipitation, CFTR 157
antibody-coupled beads were washed in extraction buffer. The supernatant 158
was discarded and the pelleted beads were resuspended in the cell lysate. 159
This suspension was incubated at 4ºC for 30 minutes. The supernatant was 160
then removed and the beads washed three times in the extraction buffer. The 161
beads were then washed in the Last Wash Buffer (LWB) (1x LWB, Tween 20 162
0,02%). Finally, the beads were resuspended in the Elution Buffer and gently 163
mixed. Protein expression was evaluated by slot blot after confirmation of 164
antibodies specificity by western blot. 165
166
2.7. Slot-Blot 167
Protein samples (5 µg) derived from co-immunoprecipitation were diluted in 168
phosphate buffer saline (PBS) and transferred to activated 169
polyvinylidenedifluoride membranes using a Hybri-slot manifold system 170
(Biometra, Göttingen, Germany). The membranes were then blocked and 171
incubated overnight at 4ºC with rabbit anti-AQP4 antibody (1:500) or goat anti-172
CFTR antibody (1:500). The immune-reactive proteins were detected 173
8
separately with goat anti-rabbit IgG-AP (1:5000) or donkey anti-goat IgG-AP 174
(1:5000). Membranes were then reacted with ECF and read using a BioRad 175
FX-Pro-plus. 176
177
3. Results 178
179
3.1. Aquaporin-4 is expressed in rat Sertoli cells 180
Several types of AQPs have been identified throughout the male reproductive 181
tract. However, the expression of AQP4, which is known to play a crucial role 182
in water membrane transport through blood barriers, remained to be 183
elucidated in SCs. Thus, we evaluated the expression of AQP4 isoforms in 184
cultured rat SCs. It has been described that AQP4 exists in several isoforms. 185
Besides the first two classical AQP4 isoforms described rat brain, M1 (or 186
AQP4a) and M23 (or AQP4c) [22], other new AQP4 isoforms were recently 187
identified by screening the cDNA rat brain library [23]. They were named 188
AQP4b, AQP4d, AQP4e (or Mz) and AQP4f but their role and tissue 189
localization remains to be unraveled, being that each isoform corresponds to 190
an alternative transcript variant (variants a to f, respectively) [24]. Therefore, 191
we investigated the presence of the two classical and functional isoforms in 192
isolated SCs. When we analyzed the expression of the mRNA transcript 193
variant a of AQP4 in rat SCs, we were unable to detect any expression of this 194
variant, as the 198 bp product was only detected in the positive control 195
(Figure 1, Panel A). However, we were able to detect a 234 bp product 196
corresponding to the mRNA expression of the AQP4 transcript variant c 197
(Figure 1, Panel B). Furthermore, using a specific AQP4 antibody we were 198
9
able to further confirm the protein expression of this AQP in SCs by detecting 199
a single band with an apparent molecular weight of approximately 32 kDa in 200
the immunoblot analysis. (Figure 1, Panel C-D). 201
202
3.2. Rat SCs express CFTR mRNA and protein 203
Boockfort and collaborators [7] have previously reported the CFTR presence 204
in cultured SCs from Sprague-Dawley rats and it has been proposed that 205
CFTR plays a crucial role in seminiferous fluid secretion and ionic composition 206
[10,25]. As could be expected, we were also able to detect the presence of 207
the 156 bp product of CFTR mRNA in cultured rat SCs (Figure 2, Panel A). 208
Moreover, we used a specific anti-CFTR antibody and we were able to detect 209
a single specific staining of approximately 165 kDa by western blot analysis, 210
which corresponds to the intact CFTR protein (Figure 2, Panel B-C). 211
212
3.3. CFTR interacts with Aquaporin 4 in rat Sertoli cells 213
CFTR expression has been reported in germ cells of various developmental 214
stages evidencing its role during spermatogenesis [26,27,28]. In that process, 215
CFTR has been suggested to be involved in water fluxes regulation [26]. 216
Since adjacent SCs form the BTB and are responsible for the establishment 217
of the intratubular fluid microenvironment, being known to highly express 218
CFTR, we hypothesized that this HCO3- transporter may modulate water 219
fluxes in SCs by molecular interactions with AQPs. Since it has been reported 220
that AQP4 plays a key role in water transport through BBB, we hypothesized 221
that it could be present not only in SCs (which form the BTB), but also interact 222
with CFTR in these cells. To test our hypotheses, we used a co-223
10
immunoprecipitation protocol and were able to efficiently conjugate the anti-224
CFTR antibody to magnetic beads and to precipitate the CFTR protein from 225
cultured rat SCs (Figure 3, Panel A) by the specific staining detected using 226
the same anti-CFTR antibody and the Slot-blot technique (Figure 3, Panel B). 227
Interestingly, using the same sample (obtained after conjugating the anti-228
CFTR goat antibody to magnetic beads and after the co-immunoprecipitation 229
protocol) we were also able to detect the presence of a specific staining 230
correspondent to the AQP4 (Figure 3, Panel C). These results obtained using 231
a specific anti-AQP4 antibody, clearly indicate that AQP4 derived from 232
cultured rat SCs co-immunoprecipitated with CFTR. 233
234
4. Discussion 235
The SCs are epithelial somatic cells that transport electrolytes and water to 236
create a proper intraluminal environment for the occurrence of 237
spermatogenesis. This process is highly regulated and depends of several 238
membrane transporters [3]. Among those, the expression of functional CFTR 239
has been described in SCs [7]. In several conditions associated with CFTR 240
mutation, an abnormal germ cell development has been reported [9], 241
suggesting that normal CFTR expression is required for a successful 242
spermatogenesis. Noteworthy, nearly 20% of men with infertility due to sperm 243
abnormalities have a mutation in the CFTR gene [29]. Thus, we tested if 244
CFTR was expressed in cultured rat SCs. We identified a RT-PCR product of 245
predicted size consistent with the CFTR sequence, when RNA from cultured 246
rat SCs was used as a template. These results show that cultured rat SCs 247
express CFTR mRNA. To determine whether CFTR messenger RNA was 248
11
translated into a functional protein, we used an immunoblot analysis. With this 249
approach, we were able to detect immunoreactive bands in rat SCs samples 250
using a specific antibody against CFTR. These immunoblot studies were 251
conclusive and confirm the presence of CFTR protein in cultured rat SCs. 252
CFTR enhances osmotic water permeability in various cells or tissues 253
[30,31,32] and it interacts with AQPs in rat epididymis, establishing a 254
synergistic interaction [33]. Water movements are essential for the luminal 255
fluid environment [34] however the presence of specific water transporters 256
(AQPs) in SCs has been discussed. Some AQP isoforms have been 257
consistently described in SCs [35,36,37]. Those isoforms are expected to be 258
involved in STF secretion [3,34]. Herein we chose to investigate AQP4 259
expression in cultured SCs since: (1) the presence of AQP4 was only reported 260
in SCs using immunohistochemical analysis of testicular tissue sections [15] 261
and thus lacked confirmation; (2) AQP4 is the predominant water channel in 262
mammalian brain and is abundantly expressed in astrocytes that support BBB 263
[38], a structure similar to the BTB. AQP4 may be transcribed as six distinct 264
mRNAs (transcript variants a to f) [38], where AQP4a (also M1), AQP4c (also 265
M23) are the classical and functional water transport channels, with brain 266
expressing both isoforms and tissues outside of the central nervous system 267
expressing predominantly AQP4 M23 [39]. These two AQP4 isoforms differ in 268
their sizes and water transport rates (when expressed in epithelial cells), 269
being that AQPc results in a shorter variant with increased single-channel 270
osmotic water permeability [39,40]. Hence, we evaluated the presence of 271
transcripts a and c in cultured rat SCs and we only detected mRNA transcript 272
variant c (AQP M23). The presence of AQP4 protein was also confirmed by 273
12
immunoblot. To the best of our knowledge, our results are the first to 274
unequivocally demonstrate the presence of this aquaporin isoform in rat SCs. 275
CFTR, besides functioning as an ion channel, also acts as a regulator of 276
several other membrane transport proteins, among which are epithelial Na+ 277
channels [41] and outwardly rectifying Cl- channels [42]. Besides, AQPs are 278
also essential in the establishment of intratubular fluid composition. Recent 279
data showed that CFTR interacts with several AQPs in various cellular 280
systems [30,31], including in the epididymis [33]. It has been suggested that 281
these interactions may be of clinical outcome to CF, in which mutation of the 282
CFTR gene leads to fluid accumulation [43,44]. Thus, since it has been 283
suggested that CFTR can interact with AQPs, we further investigated the 284
possibility of a physical interaction between CFTR and AQP4 in cultured rat 285
SCs. The direct interaction between AQP4 and CFTR observed in the present 286
study, using the co-immunoprecipitation technique, strongly suggests that 287
CFTR might serve as a regulator of AQPs and water homeodynamics in SCs, 288
as it was previously shown to occur in other cells of the male reproductive 289
tract [32,33]. To the best of our knowledge, our results are the first to 290
unequivocally demonstrate a molecular interaction between CFTR and AQP4 291
in cultured rat SCs. 292
In conclusion, our results show that CFTR and AQP4 are expressed in rat 293
SCs. Although we did not perform functional studies regarding the role of 294
AQP4 in these cells, their role in water balance and ion homeostasis in the 295
several tissues where they are expressed is well known. We were able to 296
demonstrate that CFTR and AQP4 physically interact in cultured rat SCs. This 297
interaction most likely occurs in in vivo conditions when a fully intact BTB is 298
13
established. However, this needs further investigation beyond this short 299
report. The finding that CFTR regulates water permeability in various tissues, 300
in addition to its role as an ionic channel, raises the possibility that abnormal 301
SCs functioning in men with CF may involve altered water transport, plus to 302
defective HCO3- transport, resulting in severe alterations in the intratubular 303
fluid composition and impairment of spermatogenesis. The results presented 304
here raise new questions and point new directions towards the understanding 305
of male subfertility/infertility in men with mutations in CFTR gene. In vivo 306
experiments are the next step to clarify the clinical significance of this 307
interaction in SCs and in a full functional BTB. The full enlightenment of these 308
molecular interactions and mechanisms may point towards possible 309
therapeutic targets to counteract male subfertility/infertility in men with CF and 310
mutations in CFTR gene. 311
312
5. Acknowledgments 313
Supported by FCT (PTDC/QUI-BIQ/121446/2010 and PEst-314
C/SAU/UI0709/2011) co-funded by Fundo Europeu de Desenvolvimento 315
Regional - FEDER via Programa Operacional Factores de Competitividade - 316
COMPETE/QREN. M.G. Alves (SFRH/BPD/80451/2011) was funded by FCT. 317
P.F. Oliveira was funded by FCT through FSE and POPH funds (Programa 318
Ciência 2008). T.T. Jesus and R.L. Bernardino were funded by 319
Santander/Totta – UBI protocol. 320
321
6. Declaration of Interests 322
The authors confirm that this article has no conflict of interests. 323
14
7. References 324
[1] D.D. Mruk, C.Y. Cheng, Sertoli-Sertoli and Sertoli-germ cell interactions 325
and their significance in germ cell movement in the seminiferous 326
epithelium during spermatogenesis, Endocr. Rev. 25 (2004) 747-806. 327
[2] M.G. Alves, L. Rato, R.A. Carvalho, P.I. Moreira, S. Socorro, P.F. Oliveira, 328
Hormonal control of Sertoli cell metabolism regulates spermatogenesis, 329
Cell. Mol. Life Sci. 70 (2013) 777-793. 330
[3] L. Rato, S. Socorro, J.E. Cavaco, P.F. Oliveira, Tubular fluid secretion in 331
the seminiferous epithelium: ion transporters and aquaporins in Sertoli 332
cells, J. Membr. Biol. 236 (2010) 215-224. 333
[4] T.T. Turner, Resorption versus secretion in the rat epididymis, J. Reprod. 334
Fertil. 72 (1984) 509-514. 335
[5] Y. Liu, D.K. Wang, L.M. Chen, The physiology of bicarbonate transporters 336
in mammalian reproduction, Biol. Reprod. 86 (2012) 99. 337
[6] P.M. Quinton, Too much salt, too little soda: cystic fibrosis, Sheng Li Xue 338
Bao 59 (2007) 397-415. 339
[7] F.R. Boockfor, R.A. Morris, D.C. DeSimone, D.M. Hunt, K.B. Walsh, Sertoli 340
cell expression of the cystic fibrosis transmembrane conductance 341
regulator, Am. J. Physiol. 274 (1998) C922-930. 342
[8] P.Y. Wong, CFTR gene and male fertility, Mol. Hum. Reprod. 4 (1998) 343
107-110. 344
[9] S. Teixeira, R. Sá, A. Grangeia, J. Silva, C. Oliveira, L. Ferráz, A. Alves, S. 345
Paiva, A. Barros, M. Sousa, Immunohystochemical analysis of CFTR in 346
normal and disrupted spermatogenesis, Syst. Biol. Reprod. Med. 59 347
(2012) 53-59. 348
15
[10] W.M. Xu, J. Chen, H. Chen, R.Y. Diao, K.L. Fok, J.D. Dong, T.T. Sun, 349
W.Y. Chen, M.K. Yu, X.H. Zhang, L.L. Tsang, A. Lau, Q.X. Shi, Q.H. 350
Shi, P.B. Huang, H.C. Chan, Defective CFTR-dependent CREB 351
activation results in impaired spermatogenesis and azoospermia, PLoS 352
ONE 6 (2011) e19120. 353
[11] P. Agre, L.S. King, M. Yasui, W.B. Guggino, O.P. Ottersen, Y. Fujiyoshi, 354
A. Engel, S. Nielsen, Aquaporin water channels--from atomic structure 355
to clinical medicine, J. Physiol. 542 (2002) 3-16. 356
[12] D. Brown, J.M. Verbavatz, G. Valenti, B. Lui, I. Sabolic, Localization of 357
the CHIP28 water channel in reabsorptive segments of the rat male 358
reproductive tract, Eur. J. Cell Biol. 61 (1993) 264-273. 359
[13] E.M. Wintour, Water channels and urea transporters, Clin. Exp. 360
Pharmacol. Physiol. 24 (1997) 1-9. 361
[14] H.F. Huang, R.H. He, C.C. Sun, Y. Zhang, Q.X. Meng, Y.Y. Ma, Function 362
of aquaporins in female and male reproductive systems, Hum. Reprod. 363
Update 12 (2006) 785-795. 364
[15] F. Zhuo, S.-Q. Sun, Expression of Aquaporin-4 in Testis and Epididymis 365
of Rat, Sichuan J. Anat. 4 (2007) 28-29. 366
[16] E.A. Nagelhus, O.P. Ottersen, Physiological Roles of Aquaporin-4 in 367
Brain, Physiol. Rev. 93 (2013) 1543-1562. 368
[17] M.G. Alves, P.F. Oliveira, S. Socorro, P.I. Moreira, Impact of diabetes in 369
blood-testis and blood-brain barriers: resemblances and differences, 370
Curr. Diab. Rev. 8 (2012) 401-412. 371
[18] P.F. Oliveira, M.G. Alves, L. Rato, S. Laurentino, J. Silva, R. Sa, A. 372
Barros, M. Sousa, R.A. Carvalho, J.E. Cavaco, S. Socorro, Effect of 373
16
insulin deprivation on metabolism and metabolism-associated gene 374
transcript levels of in vitro cultured human Sertoli cells, Biochim. 375
Biophys. Acta 1820 (2012) 84-89. 376
[19] K. Steger, R. Rey, S. Kliesch, F. Louis, G. Schleicher, M. Bergmann, 377
Immunohistochemical detection of immature Sertoli cell markers in 378
testicular tissue of infertile adult men: a preliminary study, Int. J. Androl. 379
19 (1996) 122-128. 380
[20] M.G. Alves, A. Neuhaus-Oliveira, P.I. Moreira, S. Socorro, P.F. Oliveira, 381
Exposure to 2,4-dichlorophenoxyacetic acid alters glucose metabolism 382
in immature rat Sertoli cells, Reprod. Toxicol. 38 (2013) 81-88. 383
[21] M.G. Alves, S. Socorro, J. Silva, A. Barros, M. Sousa, J.E. Cavaco, P.F. 384
Oliveira, In vitro cultured human Sertoli cells secrete high amounts of 385
acetate that is stimulated by 17beta-estradiol and suppressed by 386
insulin deprivation, Biochim. Biophys. Acta 1823 (2012) 1389-1394. 387
[22] J.S. Jung, R.V. Bhat, G.M. Preston, W.B. Guggino, J.M. Baraban, P. 388
Agre, Molecular characterization of an aquaporin cDNA from brain: 389
candidate osmoreceptor and regulator of water balance, Proc. Natl. 390
Acad. Sci. U. S. A. 91 (1994) 13052-13056. 391
[23] S.E. Moe, J.G. Sorbo, R. Sogaard, T. Zeuthen, O. Petter Ottersen, T. 392
Holen, New isoforms of rat Aquaporin-4, Genomics 91 (2008) 367-377. 393
[24] S.E. Moe, J.G. Sorbo, R. Sogaard, T. Zeuthen, O. Petter Ottersen, T. 394
Holen, New isoforms of rat Aquaporin-4, Genomics 91 (2008) 367-377. 395
[25] W.H. Ko, H.C. Chan, S.B. Chew, P.Y. Wong, Regulated anion secretion 396
in cultured epithelia from Sertoli cells of immature rats, J. Physiol. 512 ( 397
Pt 2) (1998) 471-480. 398
17
[26] X. Gong, J. Li, K. Cheung, G. Leung, S.B.C. Chew, P. Wong, Expression 399
of the cystic fibrosis transmembrane conductance regulator in rat 400
spermatids: implication for the site of action of antispermatogenic 401
agents, Mol. Hum. Reprod. 7 (2001) 705-713. 402
[27] S. Hihnala, M. Kujala, J. Toppari, J. Kere, C. Holmberg, P. Höglund, 403
Expression of SLC26A3, CFTR and NHE3 in the human male 404
reproductive tract: role in male subfertility caused by congenital 405
chloride diarrhoea, Mol. Hum. Reprod. 12 (2006) 107-111. 406
[28] S. Teixeira, R. Sá, A. Grangeia, J. Silva, C. Oliveira, L. Ferráz, Â. Alves, 407
S. Paiva, A. Barros, M. Sousa, Immunohystochemical analysis of 408
CFTR in normal and disrupted spermatogenesis, Systems Biology in 409
Reproductive Medicine (2012) 1-7. 410
[29] K. van der Ven, L. Messer, H. van der Ven, R.S. Jeyendran, C. Ober, 411
Cystic fibrosis mutation screening in healthy men with reduced sperm 412
quality, Hum. Reprod. 11 (1996) 513-517. 413
[30] R. Schreiber, R. Nitschke, R. Greger, K. Kunzelmann, The cystic fibrosis 414
transmembrane conductance regulator activates aquaporin 3 in airway 415
epithelial cells, J. Biol. Chem. 274 (1999) 11811-11816. 416
[31] R. Schreiber, H. Pavenstadt, R. Greger, K. Kunzelmann, Aquaporin 3 417
cloned from Xenopus laevis is regulated by the cystic fibrosis 418
transmembrane conductance regulator, FEBS Lett. 475 (2000) 291-419
295. 420
[32] C. Pietrement, N. Da Silva, C. Silberstein, M. James, M. Marsolais, A. 421
Van Hoek, D. Brown, N. Pastor-Soler, N. Ameen, R. Laprade, V. 422
Ramesh, S. Breton, Role of NHERF1, cystic fibrosis transmembrane 423
18
conductance regulator, and cAMP in the regulation of aquaporin 9, J. 424
Biol. Chem. 283 (2008) 2986-2996. 425
[33] K.H. Cheung, C.T. Leung, G.P. Leung, P.Y. Wong, Synergistic effects of 426
cystic fibrosis transmembrane conductance regulator and aquaporin-9 427
in the rat epididymis, Biol. Reprod. 68 (2003) 1505-1510. 428
[34] Y.S. Cho, M. Svelto, G. Calamita, Possible functional implications of 429
aquaporin water channels in reproductive physiology and medically 430
assisted procreation, Cell. Mol. Biol. 49 (2003) 515-519. 431
[35] H.H. Badran, L.S. Hermo, Expression and regulation of aquaporins 1, 8, 432
and 9 in the testis, efferent ducts, and epididymis of adult rats and 433
during postnatal development, J. Androl. 23 (2002) 358-373. 434
[36] L. Hermo, D. Krzeczunowicz, R. Ruz, Cell specificity of aquaporins 0, 3, 435
and 10 expressed in the testis, efferent ducts, and epididymis of adult 436
rats, J. Androl. 25 (2004) 494-505. 437
[37] T. Tani, Y. Koyama, K. Nihei, S. Hatakeyama, K. Ohshiro, Y. Yoshida, E. 438
Yaoita, Y. Sakai, K. Hatakeyama, T. Yamamoto, Immunolocalization of 439
aquaporin-8 in rat digestive organs and testis, Arch. Histol. Cytol. 64 440
(2001) 159-168. 441
[38] C. Iacovetta, E. Rudloff, R. Kirby, The role of aquaporin 4 in the brain, 442
Vet. Clin. Pathol. 41 (2012) 32-44. 443
[39] G.-q. Zheng, Y. Li, Y. Gu, X.-m. Chen, Y. Zhou, S.-z. Zhao, J. Shen, 444
Beyond water channel: Aquaporin-4 in adult neurogenesis, 445
Neurochem. Int. 56 (2010) 651-654. 446
19
[40] L. Strand, S.E. Moe, T.T. Solbu, M. Vaadal, T. Holen, Roles of aquaporin-447
4 isoforms and amino acids in square array assembly, Biochemistry 448
(Mosc.) 48 (2009) 5785-5793. 449
[41] R. Schreiber, A. Hopf, M. Mall, R. Greger, K. Kunzelmann, The first-450
nucleotide binding domain of the cystic-fibrosis transmembrane 451
conductance regulator is important for inhibition of the epithelial Na+ 452
channel, Proc. Natl. Acad. Sci. USA 96 (1999) 5310-5315. 453
[42] E.M. Schwiebert, M.E. Egan, T.-H. Hwang, S.B. Fulmer, S.S. Allen, G.R. 454
Cutting, W.B. Guggino, CFTR regulates outwardly rectifying chloride 455
channels through an autocrine mechanism involving ATP, Cell 81 456
(1995) 1063-1073. 457
[43] M. Levin, A. Verkman, Aquaporins and CFTR in ocular epithelial fluid 458
transport, J. Membr. Biol. 210 (2006) 105-115. 459
[44] J.B. Lyczak, C.L. Cannon, G.B. Pier, Lung infections associated with 460
cystic fibrosis, Clin. Microbiol. Rev. 15 (2002) 194-222. 461
462
463
20
Figure Legends 464
465
Figure 1. Expression of Aquaporin-4 (AQP4) in cultured rat Sertoli cells (SCs) 466
showing representative image of RT-PCR (Panel A and B), Western Blot 467
(Panel C) and slot blot (Panel D). (NtC, no-template control; PtC, brain cDNA) 468
469
Figure 2. Expression of CFTR in cultured rat Sertoli cells (SCs) showing 470
representative image of RT-PCR (Panel A), Western Blot (Panel B) and slot 471
blot (Panel C). (NtC, no-template control; PtC, lung cDNA) 472
473
Figure 3. Molecular interaction of Aquaporin-4 (AQP4) and CFTR in cultured 474
rat Sertoli cells (SCs) as determined by co-immunoprecipitation (Panel A). 475
Immunoprecipitated CFTR protein was detected (Panel B) and co-476
immunoprecipitated AQP4 protein derived from the SCs eluted (Panel C). 477
478
21
479
480
22
481
482
483
23
Tables 484
485
Table 1. Oligonucleotides and Cycling Conditions for PCR Amplification of 486
Cystic fibrosis transmembrane conductance regulator (CFTR), Aquaporin-4 487
transcript variant a (AQP4a or M1) and Aquaporin-4 transcript variant c 488
(AQP4c or M23). 489
490
Gene Sequence (5'- 3') AT (ºC)
Amplificon Size (bp)
C PtC
CFTR AN: NM_031506.1
Forward: GTTGGGAATCAGCGATGGAG
65 156 40c. Lung Reverse:
TGACTGTGTAGGGAAGCACA
AQP4a AN: NM_012825.3
Sense: CAGGGAAGGCATGAGTGACG
56 198 40c. Brain Antisense:
TCTGAGCCACCCCAGTTAAT
AQP4c AN: NM_001142366.1
Sense: GAAGACAGCACCTGTGATAGC
58 234 40c. Brain Antisense:
CACAGGTAGGGGGTTCTCTG
Abbreviations: AN – Genebank Accession Number; AT - annealing temperature; C - Number of 491
cycles during exponential phase of amplification; PtC - Positive Control 492
493
494
495
24
Highlights 496
• Aquaporin-4 is expressed in cultured rat Sertoli cells 497
• Aquaporin-4 co-immunoprecipitates with CFTR in cultured rat Sertoli 498
cells 499
• CFTR may control water transport through Blood-Testis Barrier by 500
AQP4 interaction 501
502
503
Recommended