Accepted Manuscript

Aquaporin-4 as a molecular partner of cystic fibrosis transmembrane conduc-tance regulator in rat Sertoli cells

Tito T. Jesus, Raquel L. Bernardino, Ana D. Martins, Rosália Sá, Mário Sousa,Marco G. Alves, Pedro F. Oliveira

PII: S0006-291X(14)00488-4DOI: http://dx.doi.org/10.1016/j.bbrc.2014.03.046Reference: YBBRC 31815

To appear in: Biochemical and Biophysical Research Communi-cations

Received Date: 7 March 2014

Please cite this article as: T.T. Jesus, R.L. Bernardino, A.D. Martins, R. Sá, M. Sousa, M.G. Alves, P.F. Oliveira,Aquaporin-4 as a molecular partner of cystic fibrosis transmembrane conductance regulator in rat Sertoli cells,Biochemical and Biophysical Research Communications (2014), doi: http://dx.doi.org/10.1016/j.bbrc.2014.03.046

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customerswe are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, andreview of the resulting proof before it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1

Title: Aquaporin-4 as a molecular partner of cystic fibrosis 1

transmembrane conductance regulator in rat Sertoli cells 2

3

Tito T. Jesus1, Raquel L. Bernardino1, Ana D. Martins1, Rosália Sá2, Mário 4

Sousa2,3, Marco G. Alves1, Pedro F. Oliveira1� 5

6

1 CICS – UBI – Health Sciences Research Centre, University of Beira Interior, 7

Covilhã, Portugal; 8

2 Department of Microscopy, Laboratory of Cell Biology & Multidisciplinary Unit 9

for Biomedical Research, UMIB-FCT, Institute of Biomedical Sciences Abel 10

Salazar (ICBAS), University of Porto, Portugal; 11

3 Centre for Reproductive Genetics Alberto Barros, Porto, Portugal 12

13

14

� Corresponding author: 15

Pedro Fontes Oliveira 16

Health Sciences Research Centre 17

University of Beira Interior 18

Av. Infante D. Henrique 19

6201-506 Covilhã, Portugal 20

Email: pfobox@gmail.com 21

Tel: +351 275 329077 22

Fax: +351 275 329099 23

2

Abstract 24

Sertoli cells (SCs) form the blood-testis barrier (BTB) that controls the 25

microenvironment where the germ cells develop. The cystic fibrosis 26

transmembrane conductance regulator (CFTR) plays an essential role to male 27

fertility and it was recently suggested that it may promote water transport. 28

Interestingly, Aquaporin-4 (AQP4) is widely expressed in blood barriers, but 29

was never identified in SCs. Herein we hypothesized that SCs express CFTR 30

and AQP4 and that they can physically interact. 31

Primary SCs cultures from 20-day-old rats were maintained and CFTR and 32

AQP4 mRNA and protein expression was assessed by RT-PCR and western 33

blot, respectively. The possible physical interaction between CFTR and AQP4 34

was studied by co-immunoprecipitation. 35

We were able to confirm the presence of CFTR at mRNA and protein level in 36

cultured rat SCs. AQP4 mRNA analysis showed that cultured rat SCs express 37

the transcript variant c of AQP4, which was followed by immunodetection of 38

the correspondent protein. The co-immunoprecipitation experiments showed a 39

direct interaction between AQP4 and CFTR in cultured rat SCs. 40

Our results suggest that CFTR physically interacts with AQP4 in rat SCs 41

evidencing a possible mechanism by which CFTR can control water transport 42

through BTB. The full enlightenment of this particular relation between CFTR 43

and AQP4 may point towards possible therapeutic targets to counteract male 44

subfertility/infertility in men with Cystic Fibrosis and mutations in CFTR gene, 45

which are known to impair spermatogenesis due to defective water transport. 46

47

Keywords: CFTR, Aquaporin-4, Sertoli cells, water transport 48

3

1. Introduction 49

Spermatogenesis takes place within the seminiferous tubules, where Sertoli 50

cells (SCs) directly interact with the developing germ cells [1]. Adjacent SCs 51

connect through specialized junctions, establishing the Sertoli/blood-testis 52

barrier (BTB) and controlling the passage of substances [1,2]. Hence, SCs 53

control the seminiferous tubular fluid (STF) composition and the 54

physiochemical milieu where spermatogenesis occurs [1,3]. The STF 55

composition is dependent of ions and water movements [4]. Thus, distinct 56

types of ion and water transport proteins have been identified in the plasmatic 57

membrane of these cells (for review [3]). Nevertheless, their involvement on 58

STF establishment remains unknown. 59

The cystic fibrosis transmembrane conductance regulator (CFTR) is a cAMP-60

regulated membrane transporter of the ATP-binding cassette superfamily [5], 61

widely expressed in cells of the reproductive tract [6]. Noteworthy, mutations 62

in the gene that encodes the CFTR protein have been associated with several 63

abnormalities on the male reproductive system and with abnormal production, 64

quality and number of sperm cells [7,8]. CFTR presence was reported in the 65

cytoplasm and plasma membrane of SCs [9], where it plays a role in HCO3- 66

transport [10]. Moreover, CFTR plays an important role in epithelial cells fluid 67

volume regulation [5], enhancing osmotic water permeability via direct 68

molecular interactions with water channels (Aquaporins). This additional role 69

of CFTR in controlling water permeability may have an impact on the 70

development of the Cystic Fibrosis (CF). 71

Aquaporins (AQPs) are essential for water homeostasis regulation and for 72

providing a continuous and rapid water movement across epithelia [11,12,13]. 73

4

During spermatogenesis, there is a striking reduction of germ cells volume, 74

largely due to the osmotically driven fluid efflux [14], being expectable that 75

AQPs are key players in this process. Aquaporin-4 (AQP4) has been briefly 76

identified by immunocytochemistry in the seminiferous tubules [15]. 77

Interestingly, AQP4 is densely expressed in the blood-brain barrier (BBB) [16], 78

which exhibits remarkable similarities with BTB [17]. Several cellular functions 79

have been attributed to AQP4, such as regulation of extracellular space 80

volume, potassium buffering, fluid circulation and resorption, waste clearance, 81

neuroinflammation, osmosensation, cell migration, and Ca2+ signaling (for 82

review see [16]). 83

Since AQP4 mediates water flux through BBB, we aimed to full disclose its 84

expression in isolated SCs. Moreover, CFTR has been reported to interact 85

with AQPs to regulate osmotic water permeability, thus, we hypothesized that 86

CFTR can interact with AQP4 providing new insight on how CFTR can 87

regulate water membrane movements. 88

89

2. Material and Methods 90

2.1. Chemicals 91

NZY M-MuLV Reverse Transcriptase (M-MLV RT), random hexamer primers, 92

dNTPs and NZTaq 2x Green Master Mix, agarose and DNA ladder were 93

obtained from NZYTech (Lisboa, Portugal). Primers were obtained from 94

STABVIDA (Oeiras, Portugal). All other chemicals were purchased from 95

Sigma-Aldrich (St. Louis, USA), unless stated otherwise. 96

97

2.2. Animals 98

5

Male Wistar rats (Rattus norvegicus) were housed under a 12h light–12h 99

darkness cycle and constant room temperature (20±2°C) in our accredited 100

animal facilities, with food and water ad libitum. Accommodation, maintenance 101

and animal handling were performed in accordance with national and 102

international guidelines, particularly with the ‘Guide for the Care and Use of 103

Laboratory Animals’, available in the US National Institutes of Health (NIH 104

Publication no. 85-23, revised 1996), and the EU rules for the care and 105

handling of laboratory animals (Directive 2010/63/EU). 106

107

2.3. Primary Cultures of Rat Sertoli Cells 108

Male Wistar rats (20-day-old) were sacrificed by cervical dislocation. The 109

testes were excised and washed. SCs were isolated as reported by Oliveira 110

and collaborators [18]. Specific protein markers, anti-mullerian hormone 111

(AMH) and vimentin, were used to assess cultures purity [19]. After 96h, 112

cultures were examined by phase contrast microscopy and only the cultures 113

with cell contaminants below 5% were used. 114

115

2.4. RT-PCR 116

The extraction of total RNA (RNAt) from brain, lung and SCs was performed 117

using the E.Z.N.A. Total RNA Kit (Omega Bio-Tek, Norcross, USA) as 118

indicated by the manufacturer. RNA concentration and absorbance ratios 119

(A260/A280) were determined by spectrophotometry (NanophotometerTM, 120

Implen, Germany). The RNAt was reversely transcribed as reported by Alves 121

and collaborators [20]. The resulting complementary deoxyribonucleic acid 122

(cDNA) was used with exon-exon spanning primer sets designed to amplify 123

6

CFTR and AQP4 cDNA fragments (Table 1). Polymerase chain reactions 124

(PCR) were carried out as described by Alves and collaborators [20]. Primers’ 125

sequences, optimal annealing temperature, number of cycles required for 126

exponential amplification phase of fragments, fragments size and positive 127

control are indicated (Table 1). cDNA-free sample was used as negative 128

control. Samples were run in 1% agarose gel electrophoresis and visualized 129

using software Molecular Imager FX Pro Plus MultiImager (Biorad, Hercules, 130

USA) coupled to an image acquisition system (Vilber Lourmat, Marne-la-131

Vallée, France). The size of the expected products was compared to a DNA 132

ladder. 133

134

2.5. Western blot 135

Western Blot was performed as previously described by Alves and 136

collaborators [21]. In brief, proteins samples (50 µg) were fractionated on a 137

12% SDS-PAGE and transferred to polyvinylidene difluoride membranes. The 138

membranes were blocked and incubated overnight at 4ºC with rabbit anti-139

AQP4 (1:500, AQP41-A, Gentaur, Gdansk, Poland) or goat anti-CFTR (1:500; 140

SC-8909, Santa Cruz Biotechnology, Heidelberg, Germany). The immune-141

reactive proteins were detected separately with goat anti-rabbit IgG-AP 142

(1:5000, Sc 2007, Santa Cruz Biotechnology, Heidelberg, Germany) or 143

donkey anti-goat IgG-AP (1:5000, Sc 2020, Santa Cruz Biotechnology, 144

Heidelberg, Germany). Membranes were reacted with ECF detection system 145

(GE, Healthcare, Weßling, Germany) and read with the BioRad FX-Pro-plus 146

(Bio-Rad, Hemel Hempstead, UK). The densities from each band were 147

obtained using the Quantity One Software (Bio-Rad, Hemel Hempstead, UK). 148

7

149

2.6. Co-Immunoprecipitation 150

Immunoprecipitation of CFTR was performed using the Dynabeads® Co-151

Immunoprecipitation Kit (Life Technologies, Calsbad, USA). Anti-CFTR goat 152

antibody was conjugated to magnetic beads according to the manufacturer’s 153

protocol. In brief, harvested SCs (50 mg) were lysed in extraction buffer (1x IP 154

Buffer, NaCl 100 mM, Protease Inhibitors 1:400) and centrifuged (2600.g for 5 155

minutes). The final supernatant contained the cell lysate ready to be used 156

immediately for co-immunoprecipitation. For co-immunoprecipitation, CFTR 157

antibody-coupled beads were washed in extraction buffer. The supernatant 158

was discarded and the pelleted beads were resuspended in the cell lysate. 159

This suspension was incubated at 4ºC for 30 minutes. The supernatant was 160

then removed and the beads washed three times in the extraction buffer. The 161

beads were then washed in the Last Wash Buffer (LWB) (1x LWB, Tween 20 162

0,02%). Finally, the beads were resuspended in the Elution Buffer and gently 163

mixed. Protein expression was evaluated by slot blot after confirmation of 164

antibodies specificity by western blot. 165

166

2.7. Slot-Blot 167

Protein samples (5 µg) derived from co-immunoprecipitation were diluted in 168

phosphate buffer saline (PBS) and transferred to activated 169

polyvinylidenedifluoride membranes using a Hybri-slot manifold system 170

(Biometra, Göttingen, Germany). The membranes were then blocked and 171

incubated overnight at 4ºC with rabbit anti-AQP4 antibody (1:500) or goat anti-172

CFTR antibody (1:500). The immune-reactive proteins were detected 173

8

separately with goat anti-rabbit IgG-AP (1:5000) or donkey anti-goat IgG-AP 174

(1:5000). Membranes were then reacted with ECF and read using a BioRad 175

FX-Pro-plus. 176

177

3. Results 178

179

3.1. Aquaporin-4 is expressed in rat Sertoli cells 180

Several types of AQPs have been identified throughout the male reproductive 181

tract. However, the expression of AQP4, which is known to play a crucial role 182

in water membrane transport through blood barriers, remained to be 183

elucidated in SCs. Thus, we evaluated the expression of AQP4 isoforms in 184

cultured rat SCs. It has been described that AQP4 exists in several isoforms. 185

Besides the first two classical AQP4 isoforms described rat brain, M1 (or 186

AQP4a) and M23 (or AQP4c) [22], other new AQP4 isoforms were recently 187

identified by screening the cDNA rat brain library [23]. They were named 188

AQP4b, AQP4d, AQP4e (or Mz) and AQP4f but their role and tissue 189

localization remains to be unraveled, being that each isoform corresponds to 190

an alternative transcript variant (variants a to f, respectively) [24]. Therefore, 191

we investigated the presence of the two classical and functional isoforms in 192

isolated SCs. When we analyzed the expression of the mRNA transcript 193

variant a of AQP4 in rat SCs, we were unable to detect any expression of this 194

variant, as the 198 bp product was only detected in the positive control 195

(Figure 1, Panel A). However, we were able to detect a 234 bp product 196

corresponding to the mRNA expression of the AQP4 transcript variant c 197

(Figure 1, Panel B). Furthermore, using a specific AQP4 antibody we were 198

9

able to further confirm the protein expression of this AQP in SCs by detecting 199

a single band with an apparent molecular weight of approximately 32 kDa in 200

the immunoblot analysis. (Figure 1, Panel C-D). 201

202

3.2. Rat SCs express CFTR mRNA and protein 203

Boockfort and collaborators [7] have previously reported the CFTR presence 204

in cultured SCs from Sprague-Dawley rats and it has been proposed that 205

CFTR plays a crucial role in seminiferous fluid secretion and ionic composition 206

[10,25]. As could be expected, we were also able to detect the presence of 207

the 156 bp product of CFTR mRNA in cultured rat SCs (Figure 2, Panel A). 208

Moreover, we used a specific anti-CFTR antibody and we were able to detect 209

a single specific staining of approximately 165 kDa by western blot analysis, 210

which corresponds to the intact CFTR protein (Figure 2, Panel B-C). 211

212

3.3. CFTR interacts with Aquaporin 4 in rat Sertoli cells 213

CFTR expression has been reported in germ cells of various developmental 214

stages evidencing its role during spermatogenesis [26,27,28]. In that process, 215

CFTR has been suggested to be involved in water fluxes regulation [26]. 216

Since adjacent SCs form the BTB and are responsible for the establishment 217

of the intratubular fluid microenvironment, being known to highly express 218

CFTR, we hypothesized that this HCO3- transporter may modulate water 219

fluxes in SCs by molecular interactions with AQPs. Since it has been reported 220

that AQP4 plays a key role in water transport through BBB, we hypothesized 221

that it could be present not only in SCs (which form the BTB), but also interact 222

with CFTR in these cells. To test our hypotheses, we used a co-223

10

immunoprecipitation protocol and were able to efficiently conjugate the anti-224

CFTR antibody to magnetic beads and to precipitate the CFTR protein from 225

cultured rat SCs (Figure 3, Panel A) by the specific staining detected using 226

the same anti-CFTR antibody and the Slot-blot technique (Figure 3, Panel B). 227

Interestingly, using the same sample (obtained after conjugating the anti-228

CFTR goat antibody to magnetic beads and after the co-immunoprecipitation 229

protocol) we were also able to detect the presence of a specific staining 230

correspondent to the AQP4 (Figure 3, Panel C). These results obtained using 231

a specific anti-AQP4 antibody, clearly indicate that AQP4 derived from 232

cultured rat SCs co-immunoprecipitated with CFTR. 233

234

4. Discussion 235

The SCs are epithelial somatic cells that transport electrolytes and water to 236

create a proper intraluminal environment for the occurrence of 237

spermatogenesis. This process is highly regulated and depends of several 238

membrane transporters [3]. Among those, the expression of functional CFTR 239

has been described in SCs [7]. In several conditions associated with CFTR 240

mutation, an abnormal germ cell development has been reported [9], 241

suggesting that normal CFTR expression is required for a successful 242

spermatogenesis. Noteworthy, nearly 20% of men with infertility due to sperm 243

abnormalities have a mutation in the CFTR gene [29]. Thus, we tested if 244

CFTR was expressed in cultured rat SCs. We identified a RT-PCR product of 245

predicted size consistent with the CFTR sequence, when RNA from cultured 246

rat SCs was used as a template. These results show that cultured rat SCs 247

express CFTR mRNA. To determine whether CFTR messenger RNA was 248

11

translated into a functional protein, we used an immunoblot analysis. With this 249

approach, we were able to detect immunoreactive bands in rat SCs samples 250

using a specific antibody against CFTR. These immunoblot studies were 251

conclusive and confirm the presence of CFTR protein in cultured rat SCs. 252

CFTR enhances osmotic water permeability in various cells or tissues 253

[30,31,32] and it interacts with AQPs in rat epididymis, establishing a 254

synergistic interaction [33]. Water movements are essential for the luminal 255

fluid environment [34] however the presence of specific water transporters 256

(AQPs) in SCs has been discussed. Some AQP isoforms have been 257

consistently described in SCs [35,36,37]. Those isoforms are expected to be 258

involved in STF secretion [3,34]. Herein we chose to investigate AQP4 259

expression in cultured SCs since: (1) the presence of AQP4 was only reported 260

in SCs using immunohistochemical analysis of testicular tissue sections [15] 261

and thus lacked confirmation; (2) AQP4 is the predominant water channel in 262

mammalian brain and is abundantly expressed in astrocytes that support BBB 263

[38], a structure similar to the BTB. AQP4 may be transcribed as six distinct 264

mRNAs (transcript variants a to f) [38], where AQP4a (also M1), AQP4c (also 265

M23) are the classical and functional water transport channels, with brain 266

expressing both isoforms and tissues outside of the central nervous system 267

expressing predominantly AQP4 M23 [39]. These two AQP4 isoforms differ in 268

their sizes and water transport rates (when expressed in epithelial cells), 269

being that AQPc results in a shorter variant with increased single-channel 270

osmotic water permeability [39,40]. Hence, we evaluated the presence of 271

transcripts a and c in cultured rat SCs and we only detected mRNA transcript 272

variant c (AQP M23). The presence of AQP4 protein was also confirmed by 273

12

immunoblot. To the best of our knowledge, our results are the first to 274

unequivocally demonstrate the presence of this aquaporin isoform in rat SCs. 275

CFTR, besides functioning as an ion channel, also acts as a regulator of 276

several other membrane transport proteins, among which are epithelial Na+ 277

channels [41] and outwardly rectifying Cl- channels [42]. Besides, AQPs are 278

also essential in the establishment of intratubular fluid composition. Recent 279

data showed that CFTR interacts with several AQPs in various cellular 280

systems [30,31], including in the epididymis [33]. It has been suggested that 281

these interactions may be of clinical outcome to CF, in which mutation of the 282

CFTR gene leads to fluid accumulation [43,44]. Thus, since it has been 283

suggested that CFTR can interact with AQPs, we further investigated the 284

possibility of a physical interaction between CFTR and AQP4 in cultured rat 285

SCs. The direct interaction between AQP4 and CFTR observed in the present 286

study, using the co-immunoprecipitation technique, strongly suggests that 287

CFTR might serve as a regulator of AQPs and water homeodynamics in SCs, 288

as it was previously shown to occur in other cells of the male reproductive 289

tract [32,33]. To the best of our knowledge, our results are the first to 290

unequivocally demonstrate a molecular interaction between CFTR and AQP4 291

in cultured rat SCs. 292

In conclusion, our results show that CFTR and AQP4 are expressed in rat 293

SCs. Although we did not perform functional studies regarding the role of 294

AQP4 in these cells, their role in water balance and ion homeostasis in the 295

several tissues where they are expressed is well known. We were able to 296

demonstrate that CFTR and AQP4 physically interact in cultured rat SCs. This 297

interaction most likely occurs in in vivo conditions when a fully intact BTB is 298

13

established. However, this needs further investigation beyond this short 299

report. The finding that CFTR regulates water permeability in various tissues, 300

in addition to its role as an ionic channel, raises the possibility that abnormal 301

SCs functioning in men with CF may involve altered water transport, plus to 302

defective HCO3- transport, resulting in severe alterations in the intratubular 303

fluid composition and impairment of spermatogenesis. The results presented 304

here raise new questions and point new directions towards the understanding 305

of male subfertility/infertility in men with mutations in CFTR gene. In vivo 306

experiments are the next step to clarify the clinical significance of this 307

interaction in SCs and in a full functional BTB. The full enlightenment of these 308

molecular interactions and mechanisms may point towards possible 309

therapeutic targets to counteract male subfertility/infertility in men with CF and 310

mutations in CFTR gene. 311

312

5. Acknowledgments 313

Supported by FCT (PTDC/QUI-BIQ/121446/2010 and PEst-314

C/SAU/UI0709/2011) co-funded by Fundo Europeu de Desenvolvimento 315

Regional - FEDER via Programa Operacional Factores de Competitividade - 316

COMPETE/QREN. M.G. Alves (SFRH/BPD/80451/2011) was funded by FCT. 317

P.F. Oliveira was funded by FCT through FSE and POPH funds (Programa 318

Ciência 2008). T.T. Jesus and R.L. Bernardino were funded by 319

Santander/Totta – UBI protocol. 320

321

6. Declaration of Interests 322

The authors confirm that this article has no conflict of interests. 323

14

7. References 324

[1] D.D. Mruk, C.Y. Cheng, Sertoli-Sertoli and Sertoli-germ cell interactions 325

and their significance in germ cell movement in the seminiferous 326

epithelium during spermatogenesis, Endocr. Rev. 25 (2004) 747-806. 327

[2] M.G. Alves, L. Rato, R.A. Carvalho, P.I. Moreira, S. Socorro, P.F. Oliveira, 328

Hormonal control of Sertoli cell metabolism regulates spermatogenesis, 329

Cell. Mol. Life Sci. 70 (2013) 777-793. 330

[3] L. Rato, S. Socorro, J.E. Cavaco, P.F. Oliveira, Tubular fluid secretion in 331

the seminiferous epithelium: ion transporters and aquaporins in Sertoli 332

cells, J. Membr. Biol. 236 (2010) 215-224. 333

[4] T.T. Turner, Resorption versus secretion in the rat epididymis, J. Reprod. 334

Fertil. 72 (1984) 509-514. 335

[5] Y. Liu, D.K. Wang, L.M. Chen, The physiology of bicarbonate transporters 336

in mammalian reproduction, Biol. Reprod. 86 (2012) 99. 337

[6] P.M. Quinton, Too much salt, too little soda: cystic fibrosis, Sheng Li Xue 338

Bao 59 (2007) 397-415. 339

[7] F.R. Boockfor, R.A. Morris, D.C. DeSimone, D.M. Hunt, K.B. Walsh, Sertoli 340

cell expression of the cystic fibrosis transmembrane conductance 341

regulator, Am. J. Physiol. 274 (1998) C922-930. 342

[8] P.Y. Wong, CFTR gene and male fertility, Mol. Hum. Reprod. 4 (1998) 343

107-110. 344

[9] S. Teixeira, R. Sá, A. Grangeia, J. Silva, C. Oliveira, L. Ferráz, A. Alves, S. 345

Paiva, A. Barros, M. Sousa, Immunohystochemical analysis of CFTR in 346

normal and disrupted spermatogenesis, Syst. Biol. Reprod. Med. 59 347

(2012) 53-59. 348

15

[10] W.M. Xu, J. Chen, H. Chen, R.Y. Diao, K.L. Fok, J.D. Dong, T.T. Sun, 349

W.Y. Chen, M.K. Yu, X.H. Zhang, L.L. Tsang, A. Lau, Q.X. Shi, Q.H. 350

Shi, P.B. Huang, H.C. Chan, Defective CFTR-dependent CREB 351

activation results in impaired spermatogenesis and azoospermia, PLoS 352

ONE 6 (2011) e19120. 353

[11] P. Agre, L.S. King, M. Yasui, W.B. Guggino, O.P. Ottersen, Y. Fujiyoshi, 354

A. Engel, S. Nielsen, Aquaporin water channels--from atomic structure 355

to clinical medicine, J. Physiol. 542 (2002) 3-16. 356

[12] D. Brown, J.M. Verbavatz, G. Valenti, B. Lui, I. Sabolic, Localization of 357

the CHIP28 water channel in reabsorptive segments of the rat male 358

reproductive tract, Eur. J. Cell Biol. 61 (1993) 264-273. 359

[13] E.M. Wintour, Water channels and urea transporters, Clin. Exp. 360

Pharmacol. Physiol. 24 (1997) 1-9. 361

[14] H.F. Huang, R.H. He, C.C. Sun, Y. Zhang, Q.X. Meng, Y.Y. Ma, Function 362

of aquaporins in female and male reproductive systems, Hum. Reprod. 363

Update 12 (2006) 785-795. 364

[15] F. Zhuo, S.-Q. Sun, Expression of Aquaporin-4 in Testis and Epididymis 365

of Rat, Sichuan J. Anat. 4 (2007) 28-29. 366

[16] E.A. Nagelhus, O.P. Ottersen, Physiological Roles of Aquaporin-4 in 367

Brain, Physiol. Rev. 93 (2013) 1543-1562. 368

[17] M.G. Alves, P.F. Oliveira, S. Socorro, P.I. Moreira, Impact of diabetes in 369

blood-testis and blood-brain barriers: resemblances and differences, 370

Curr. Diab. Rev. 8 (2012) 401-412. 371

[18] P.F. Oliveira, M.G. Alves, L. Rato, S. Laurentino, J. Silva, R. Sa, A. 372

Barros, M. Sousa, R.A. Carvalho, J.E. Cavaco, S. Socorro, Effect of 373

16

insulin deprivation on metabolism and metabolism-associated gene 374

transcript levels of in vitro cultured human Sertoli cells, Biochim. 375

Biophys. Acta 1820 (2012) 84-89. 376

[19] K. Steger, R. Rey, S. Kliesch, F. Louis, G. Schleicher, M. Bergmann, 377

Immunohistochemical detection of immature Sertoli cell markers in 378

testicular tissue of infertile adult men: a preliminary study, Int. J. Androl. 379

19 (1996) 122-128. 380

[20] M.G. Alves, A. Neuhaus-Oliveira, P.I. Moreira, S. Socorro, P.F. Oliveira, 381

Exposure to 2,4-dichlorophenoxyacetic acid alters glucose metabolism 382

in immature rat Sertoli cells, Reprod. Toxicol. 38 (2013) 81-88. 383

[21] M.G. Alves, S. Socorro, J. Silva, A. Barros, M. Sousa, J.E. Cavaco, P.F. 384

Oliveira, In vitro cultured human Sertoli cells secrete high amounts of 385

acetate that is stimulated by 17beta-estradiol and suppressed by 386

insulin deprivation, Biochim. Biophys. Acta 1823 (2012) 1389-1394. 387

[22] J.S. Jung, R.V. Bhat, G.M. Preston, W.B. Guggino, J.M. Baraban, P. 388

Agre, Molecular characterization of an aquaporin cDNA from brain: 389

candidate osmoreceptor and regulator of water balance, Proc. Natl. 390

Acad. Sci. U. S. A. 91 (1994) 13052-13056. 391

[23] S.E. Moe, J.G. Sorbo, R. Sogaard, T. Zeuthen, O. Petter Ottersen, T. 392

Holen, New isoforms of rat Aquaporin-4, Genomics 91 (2008) 367-377. 393

[24] S.E. Moe, J.G. Sorbo, R. Sogaard, T. Zeuthen, O. Petter Ottersen, T. 394

Holen, New isoforms of rat Aquaporin-4, Genomics 91 (2008) 367-377. 395

[25] W.H. Ko, H.C. Chan, S.B. Chew, P.Y. Wong, Regulated anion secretion 396

in cultured epithelia from Sertoli cells of immature rats, J. Physiol. 512 ( 397

Pt 2) (1998) 471-480. 398

17

[26] X. Gong, J. Li, K. Cheung, G. Leung, S.B.C. Chew, P. Wong, Expression 399

of the cystic fibrosis transmembrane conductance regulator in rat 400

spermatids: implication for the site of action of antispermatogenic 401

agents, Mol. Hum. Reprod. 7 (2001) 705-713. 402

[27] S. Hihnala, M. Kujala, J. Toppari, J. Kere, C. Holmberg, P. Höglund, 403

Expression of SLC26A3, CFTR and NHE3 in the human male 404

reproductive tract: role in male subfertility caused by congenital 405

chloride diarrhoea, Mol. Hum. Reprod. 12 (2006) 107-111. 406

[28] S. Teixeira, R. Sá, A. Grangeia, J. Silva, C. Oliveira, L. Ferráz, Â. Alves, 407

S. Paiva, A. Barros, M. Sousa, Immunohystochemical analysis of 408

CFTR in normal and disrupted spermatogenesis, Systems Biology in 409

Reproductive Medicine (2012) 1-7. 410

[29] K. van der Ven, L. Messer, H. van der Ven, R.S. Jeyendran, C. Ober, 411

Cystic fibrosis mutation screening in healthy men with reduced sperm 412

quality, Hum. Reprod. 11 (1996) 513-517. 413

[30] R. Schreiber, R. Nitschke, R. Greger, K. Kunzelmann, The cystic fibrosis 414

transmembrane conductance regulator activates aquaporin 3 in airway 415

epithelial cells, J. Biol. Chem. 274 (1999) 11811-11816. 416

[31] R. Schreiber, H. Pavenstadt, R. Greger, K. Kunzelmann, Aquaporin 3 417

cloned from Xenopus laevis is regulated by the cystic fibrosis 418

transmembrane conductance regulator, FEBS Lett. 475 (2000) 291-419

295. 420

[32] C. Pietrement, N. Da Silva, C. Silberstein, M. James, M. Marsolais, A. 421

Van Hoek, D. Brown, N. Pastor-Soler, N. Ameen, R. Laprade, V. 422

Ramesh, S. Breton, Role of NHERF1, cystic fibrosis transmembrane 423

18

conductance regulator, and cAMP in the regulation of aquaporin 9, J. 424

Biol. Chem. 283 (2008) 2986-2996. 425

[33] K.H. Cheung, C.T. Leung, G.P. Leung, P.Y. Wong, Synergistic effects of 426

cystic fibrosis transmembrane conductance regulator and aquaporin-9 427

in the rat epididymis, Biol. Reprod. 68 (2003) 1505-1510. 428

[34] Y.S. Cho, M. Svelto, G. Calamita, Possible functional implications of 429

aquaporin water channels in reproductive physiology and medically 430

assisted procreation, Cell. Mol. Biol. 49 (2003) 515-519. 431

[35] H.H. Badran, L.S. Hermo, Expression and regulation of aquaporins 1, 8, 432

and 9 in the testis, efferent ducts, and epididymis of adult rats and 433

during postnatal development, J. Androl. 23 (2002) 358-373. 434

[36] L. Hermo, D. Krzeczunowicz, R. Ruz, Cell specificity of aquaporins 0, 3, 435

and 10 expressed in the testis, efferent ducts, and epididymis of adult 436

rats, J. Androl. 25 (2004) 494-505. 437

[37] T. Tani, Y. Koyama, K. Nihei, S. Hatakeyama, K. Ohshiro, Y. Yoshida, E. 438

Yaoita, Y. Sakai, K. Hatakeyama, T. Yamamoto, Immunolocalization of 439

aquaporin-8 in rat digestive organs and testis, Arch. Histol. Cytol. 64 440

(2001) 159-168. 441

[38] C. Iacovetta, E. Rudloff, R. Kirby, The role of aquaporin 4 in the brain, 442

Vet. Clin. Pathol. 41 (2012) 32-44. 443

[39] G.-q. Zheng, Y. Li, Y. Gu, X.-m. Chen, Y. Zhou, S.-z. Zhao, J. Shen, 444

Beyond water channel: Aquaporin-4 in adult neurogenesis, 445

Neurochem. Int. 56 (2010) 651-654. 446

19

[40] L. Strand, S.E. Moe, T.T. Solbu, M. Vaadal, T. Holen, Roles of aquaporin-447

4 isoforms and amino acids in square array assembly, Biochemistry 448

(Mosc.) 48 (2009) 5785-5793. 449

[41] R. Schreiber, A. Hopf, M. Mall, R. Greger, K. Kunzelmann, The first-450

nucleotide binding domain of the cystic-fibrosis transmembrane 451

conductance regulator is important for inhibition of the epithelial Na+ 452

channel, Proc. Natl. Acad. Sci. USA 96 (1999) 5310-5315. 453

[42] E.M. Schwiebert, M.E. Egan, T.-H. Hwang, S.B. Fulmer, S.S. Allen, G.R. 454

Cutting, W.B. Guggino, CFTR regulates outwardly rectifying chloride 455

channels through an autocrine mechanism involving ATP, Cell 81 456

(1995) 1063-1073. 457

[43] M. Levin, A. Verkman, Aquaporins and CFTR in ocular epithelial fluid 458

transport, J. Membr. Biol. 210 (2006) 105-115. 459

[44] J.B. Lyczak, C.L. Cannon, G.B. Pier, Lung infections associated with 460

cystic fibrosis, Clin. Microbiol. Rev. 15 (2002) 194-222. 461

462

463

20

Figure Legends 464

465

Figure 1. Expression of Aquaporin-4 (AQP4) in cultured rat Sertoli cells (SCs) 466

showing representative image of RT-PCR (Panel A and B), Western Blot 467

(Panel C) and slot blot (Panel D). (NtC, no-template control; PtC, brain cDNA) 468

469

Figure 2. Expression of CFTR in cultured rat Sertoli cells (SCs) showing 470

representative image of RT-PCR (Panel A), Western Blot (Panel B) and slot 471

blot (Panel C). (NtC, no-template control; PtC, lung cDNA) 472

473

Figure 3. Molecular interaction of Aquaporin-4 (AQP4) and CFTR in cultured 474

rat Sertoli cells (SCs) as determined by co-immunoprecipitation (Panel A). 475

Immunoprecipitated CFTR protein was detected (Panel B) and co-476

immunoprecipitated AQP4 protein derived from the SCs eluted (Panel C). 477

478

21

479

480

Figure 2

22

481

482

483

23

Tables 484

485

Table 1. Oligonucleotides and Cycling Conditions for PCR Amplification of 486

Cystic fibrosis transmembrane conductance regulator (CFTR), Aquaporin-4 487

transcript variant a (AQP4a or M1) and Aquaporin-4 transcript variant c 488

(AQP4c or M23). 489

490

Gene Sequence (5'- 3') AT (ºC)

Amplificon Size (bp)

C PtC

CFTR AN: NM_031506.1

Forward: GTTGGGAATCAGCGATGGAG

65 156 40c. Lung Reverse:

TGACTGTGTAGGGAAGCACA

AQP4a AN: NM_012825.3

Sense: CAGGGAAGGCATGAGTGACG

56 198 40c. Brain Antisense:

TCTGAGCCACCCCAGTTAAT

AQP4c AN: NM_001142366.1

Sense: GAAGACAGCACCTGTGATAGC

58 234 40c. Brain Antisense:

CACAGGTAGGGGGTTCTCTG

Abbreviations: AN – Genebank Accession Number; AT - annealing temperature; C - Number of 491

cycles during exponential phase of amplification; PtC - Positive Control 492

493

494

495

24

Highlights 496

• Aquaporin-4 is expressed in cultured rat Sertoli cells 497

• Aquaporin-4 co-immunoprecipitates with CFTR in cultured rat Sertoli 498

cells 499

• CFTR may control water transport through Blood-Testis Barrier by 500

AQP4 interaction 501

502

503