Integrated DNA Technologies

Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA

Adam Clore, PhD

gBlocks® Gene Fragments Product Information

Double-stranded, linear, synthetic DNA fragments

200 ng DNA provided, dry Typically shipped within 2–4 business days Affordable for basic research needs

Designed and tested with the Gibson Assembly® method

Suitable for all purposes that require dsDNA

Gene Assembly

• Leverages IDT proprietary Ultramer® synthesis technology

Assembly Selection

• Process removes gene assemblies with deletions and/or substitutions

Sequence Confirmation

• Each gBlocks fragment is confirmed by three independent methods

Ship Preparation

• gBlocks fragements are amplified, normalized, packaged, and shipped

Making gBlocks® Gene Fragments

Assembled using IDT Ultramer® Oligonucleotides Correctly assembled sequences are enriched using a proprietary,

cloning-independent method Each gBlocks Gene Fragment is verified The result is high-fidelity, double-stranded DNA that is routinely

cloned to yield >80% correct colonies

3 Ways We Make Sure Your gBlocks are Correct

Capillary Electrophoresis

Mass Spectrometry

Sanger Sequencing

Cloning of gBlocks® Gene Fragments

0%

20%

40%

60%

80%

100%

120%% WT/Full Coverage

125bp 300bp 500bp 750bp Length of gBlocks Fragment

The Evolution of gBlocks® Gene Fragments — Cheaper, Faster, Better

Jan 2012 •500 bp •4–7 day TAT•$99

Oct 2013•750 bp for $149•3–4 day TAT

Nov 2013• Mass Spec QC added

•2–4 day TAT•$89/$129

Dec 2013 •gBlocks Libraries

Feb 2014 •1 kb gBlocks fragments

gBlocks® Gene Fragments Libraries

Pools of gBlocks Gene Fragments with 1–18 N or K mixed bases Mixed bases need to be consecutive Mixed bases need to be 125 bp from either end Length of gBlocks libraries is between 251 and 500 bp

Top 4 Questions:- Can you make more complex libraries?

Other mixed bases than N or K Multiple variable regions Variable regions within the first and last

125 bp of the gBlocks Specific codon substitutions (AlaΔSer)

………- Why only 18 Ns?- Are your libraries biased?- Can I get a discount?

Libraries @idtdna.com

At least 125 bp At least 125 bp1–18 bases

NNNNN….NNNNNOr

NNKNN….NKNNK

How are gBlocks® Libraries Made and QCed?

How are they made? This is proprietary, but the process is based on our capability for making very

high quality oligos and gBlocks Gene Fragments.

How are they QCed? The constant regions are gBlocks Gene Fragments and are QCed by size

verification, capillary electrophoresis, and mass spec for sequence verification.

We rely on a validated process (by NGS) to ensure that >80% of DNA species are present in the final 200 ng of material shipped.

Sequence Fidelity in the Constant Regions

6 NNK

Looking for the error rates at each position in the constant region of the gene fragments

5 NNK

Base Distribution in Variable Region

1 NNK

2 NNK

3 NNK

4 NNK

5 NNK

6 NNK

115 bp 115 bp• Built 6 gene fragments

with 1–6 NNK codons• Sequence-verified each

by NGS: MySeq®, 250 bp reads, forward and reversePosition 1 2 3

Base mix N N KA 2502744 2400917 2286C 2183361 2088264 3160G 2124224 2315143 4180965T 2761775 2767780 5385693

Count of reads by position

Position 1 2 3Base mix N N K

A 26% 25% 0.02%C 23% 22% 0.03%G 22% 24% 44%T 29% 29% 56%

Percentage of each base by position

Base Distribution in Variable Region

6 NNK

Examples of Orders/Applications

• Binding site engineering• Catalytic site analysis• Antibody engineering• Vaccine development• DNA binding analysis• Promoter optimization

• Systematic codon replacement

• Introducing multiple variable regions

NNK(1-18)

NNM(1-18)

NNK

NNK(1-9)

NNM(1-9)

NNK(1-9)

NNM(1-9)

Libraries@idtdna.com

Pricing and Delivery Time

# of Ns Diversity NNKs Diversity Price USD0 1 0 1 89.00$ 1 4 4 239.00$ 2 16 16 239.00$ 3 64 1 32 314.00$ 4 256 128 389.00$ 5 1,024 512 464.00$ 6 4,096 2 1,024 539.00$ 7 16,384 4,096 614.00$ 8 65,536 16,384 689.00$ 9 262,144 3 32,768 764.00$

10 1,048,576 131,072 839.00$ 11 4,194,304 524,288 914.00$ 12 16,777,216 4 1,048,576 989.00$ 13 67,108,864 4,194,304 1,064.00$ 14 268,435,456 16,777,216 1,139.00$ 15 1,073,741,824 5 33,554,432 1,214.00$ 16 4,294,967,296 134,217,728 1,289.00$ 17 17,179,869,184 536,870,912 1,364.00$ 18 68,719,476,736 6 1,073,741,824 1,439.00$

TAT: 10–15 Business Days

>1 billion sequence variants for = $1,439

Mixed Base

Remember the Carlson Curve?

Compares the cost of reading DNA to the cost of writing DNA

1.0E-09 IDT

• You get up to 418 combinations in a tube = about 68 billion gene fragments

• For $1,439• That is $0.000 000 021 per gene

fragment • Or 0.000 000 0042 ¢/base (for a

500 bp library)

Biosecurity

IDT is one of the five founding members of the International Gene Synthesis Consortium (IGSC)

Screens the sequence of every gene/gBlocks Gene Fragment order

To ensure safety and regulatory conformance

IDT reserves the right to refuse any order that does not pass this analysis

For more information about the IGSC and the Harmonized Screening Protocol, please visit the website at http://www.genesynthesisconsortium.org/Home.html.

In October of 2010, the United States government issued final Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA, describing how commercial providers of synthetic genes should perform gene sequence and customer screening. IDT and the other IGSC member companies supported the adoption of the Screening Framework Guidance, and IDT follows that Guidance in its application of the Harmonized Screening Protocol. For more information, please see 75 FR 62820 (Oct. 13, 2010), or http://federalregister.gov/a/2010-25728.

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP Detection Controls

New Technologies

Gene Construction and Modification

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP detection controls

New Technologies

Gene Construction and Modification

3 Ways to Assemble GenesUltramer® Oligos gBlocks® Gene Fragments Custom Gene Synthesis

Product Description Single-stranded custom oligo

Double-stranded linear fragment

Double-stranded product delivered in a vector/BAC

Delivery Amount 200 pmol 200 ng >4μg

Length 45–120 bases 125–750 bp 25 – 2M bp

Turnaround Time 2–3 business days 2–4 business days Variable

Quality Control Mass Spec Sanger Sequencing Sanger Sequencing (or NGS for long constructs)

Estimated Purity 50–80% 85–90% 100%

Minimum Order Size 288 oligos 1 fragment 1 gene

Sequence Fidelity

Cost

Delivery time

$ $$$

Gene Construction Case Study #1:An alternative to site-directed mutagenesis

gBlocks® Gene Fragments

Direct cloning & mutagenesis

gBlocks® Gene Fragments used as an alternative to site-directed mutagenesis to introduce 18 mutations spread over the 1039 nt exon 7 of the gene JARID2 in order to verify that C-rich consensus sites with a central invariant CA dinucleotide are important for the in splicing of large exons >1000 nt.

Gene Construction Case Study #2: Immune Response After Flu Vaccination

DECODED 2.4 (October 2012):Using gBlocks® Gene Fragments to Generate Antibody Variable RegionsFrancois Vigneault, PhDChurch Lab at Harvard University now Abvitro, Inc

Each domain (VL, VH, CL, CH) is≈ 100 aa or ≈ 400 nt

So each domain = 1 gBlocks fragment

Identifying Rare Antibodies

1. Patient vaccination2. Identification and quantification of all

mRNAs by NGS (multiple data points)— thousands of antibody sequences

3. Select the very few VL and VH domains that are highly expressed

4. Build the potentially best antibodies by combining a small selection of VL

domains and gBlocks Gene Fragments coding for the VH domains

5. Selection of the strongest binding antibodies by phage display and surface plasmon resonance (Georgiou lab at University of Texas, Austin)

6. Verify when the best antibodies are produced using NGS data

Making Gene Synthesis More AffordableAssume 1200 bp gene; what is the price differential for 8 genes with one variable region? Assume $0.35/bp

3’ 1 5’

3’ 2 5’

3’ 3 5’

3’ 4 5’

3’ 5 5’

3’ 6 5’

3’ 7 5’

3’ 8 5’

gBlocks® Gene Fragments

10 gBlocks fragments = ~$890

1

2

3

4

5

6

7

8

Genes

8 Genes = $3,360

Assembling Multiple gBlocks® With the Gibson Assembly® Method

Gibson Assembly™ Master Mix

• gBlocks Gene Fragments with 20–30 bp overlaps designed by the researcher or by specialists at IDT

• gBlocks Gene Fragments and

vector are assembled using the Gibson Assembly® Method

• Construct is transformed and screened for the correct sequence

Gibson Assembly® MethodHow Isothermal Assembly of gBlocks® Gene Fragments WorksStep 1: gBlocks Gene Fragments are designed with 30 bp overlaps on the 3’ strand for use in the reaction with the following steps.

Step 2: A mesophilic exonuclease briefly cleaves bases from the 5’ end of the double-stranded DNA fragments, before being inactivated by the 50°C reaction temperature.

Step 3: The newly generated, complementary, single-stranded 3’ ends anneal.

Step 4: A high fidelity DNA polymerase fills in any single-stranded gaps.

Step 5: Finally, a thermophilic DNA ligase covalently joins DNA segments.

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP Detection Controls

New Technologies

Gene Construction and Modification

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP Detection Controls

New Technologies

Gene Construction and Modification

CRISPR — Easy Genome Modification

Clustered Regularly Interspaced Short Palindromic Repeat A prokaryotic defense mechanism that screens for and cleaves specific DNA

sequences Can be used to create targeted changes to the genomes of bacteria, archaea,

and eukaryotes

The 3 Stages of CRISPR Resistance

● Stage 1: CRISPR Adaptation– Foreign DNA is incorporated in the CRISPR

array.

● Stage 2: CRISPR Expression– CRISPR RNAs (crRNAs) are transcribed from

CRISPR locus.

● Stage 3: CRISPR Interference– Foreign nucleic acid complementary to the

crRNA is neutralized.

Utilizing CRISPR for Genome Modification

We need 3 components: 1. CRISPR Associated Gene 9 (CAS9) 2. RNA with CRISPR repeats (crRNA)3. Trans-acting RNA (tracrRNA)

* 2 and 3 can be combined into a single sequence called a single guide RNA (sgRNA)

Zhang lab: http://www.genome-engineering.org

CRISPR-Cas9 System in Mammals

gBlocks® Gene Fragments for CRISPR

gBlocks® Gene Fragments for CRISPR

Genome Editing Case Study #1:CRISPR Mediated Deletions

Non Homologus End Joining (NHEJ)Error prone

Leads to indels and rearrangements

Gene Fragments Used in CRISPR Research

4 gBlocks for Cas9 codon optimization

• gBlocks U6-gRNA• gBlocks T7-gRNA for IVT

Genome Engineering Case Study #2:CAS9 as a Homing device

Multiple, tuned, gene activation with nuclease-dead CAS9/gene promoter fusion proteins

Promoter gene and sgRNA were gBlocks fragments

2013 Citations of CRISPR/Cas Genome Editing with gBlocks®

First author Affiliation JournalChen UCSF CellMalina McGill Genes Dev.Mali Harvard Med School (Church lab) ScienceMali Harvard Med School (Church lab) Nature BiotechFriedland Harvard Med School (Church lab) Nature MethodsPerez-Pinera Duke Nature MethodsDickinson Univ. North Carolina Nature MethodsGilbert UCSF CellCheng Whitehead/MIT Cell ResearchWaaijers Univ. Utrecht GeneticsGratz Univ. Wisconsin GeneticsBassett Oxford Biology Open

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP Detection Controls

New Technologies

Gene Construction and Modification

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP Detection ControlsNew Technologies

Gene Construction and Modification

Synthetic Template Case Study #1:gBlocks® Gene Fragments as DNA Standards

Zymo ResearchDecoded 3.3 (July 2013)

• gBlocks Gene Fragments as truly un-methylated DNA standards

• PrimeTime® qPCR Assays for multiplex analysis

Synthetic Template Case Study #2: gBlocks® Gene Fragment as Synthetic Template in Multiplex PCR

ACVR2B-LIMK1-ACVR1B-CDK7 wtTCATACCTGCATGAGGATGTGCCCTGGTGCCGTGGCGAGGGCCACAAGCCGTCTATTGCCCACAGGGACTTTAAAAGTAAGAATGTATTGCTGAAGAGCGACCTCACAGCCGTGCTGGCTGACTTTGGCTTGGGAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTGGTCCGCGAGAACAAGAATGTGGTGGTGGCTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACTGTATGTGATCAGAAGCTGCGTCCCAACATCCCCAACTGGTGGCAGAGTTATGAGGCACTGCGGGTGATGGGGAAGATGATGCGAGAGTGTTGGTATGGATGTATGGTGTAGGTGTGGACATGTGGGCTGTTGGCTGTATATTAGCAGAGTTACTTCTAAGGGTTCCTTTTTTGCCAGGAGATTCAGACCTTGATCAGCTAACAgcggccgc

• Equimolar ratios of the four samples are always perfect

A single DNA source for 4 different standard curves.

gBlocks® Gene Fragments as Quadruplex Standards

2.00E+06 2.00E+04 2.00E+020.0

5.0

10.0

15.0

20.0

25.0

30.0

35.0

40.0

gBlocks Fragments as Standards

Hs LIMK1

Hs CDK7

Hs ACVR1B

Hs ACVR2B

Copies

Cq

Va

lue

s

Fourplex Reaction Conditions

Reagent Final Conc.10X buffer 1X100 mM dNTPs 800 nM50 mM MgCl2 3 mM25 µM Forward Primer 1 500 nM25 µM Reverse Primer 1 500 nM12.5 µM Probe 250 nM25 µM Forward Primer 2 500 nM25 µM Reverse Primer 2 500 nM12.5 µM Probe 250 nM25 µM Forward Primer 3 500 nM25 µM Reverse Primer 3 500 nM12.5 µM Probe 250 nM25 µM Forward Primer 4 500 nM25 µM Reverse Primer 4 500 nM12.5 µM Probe 250 nMImmolase polymerase 0.8 UH2O ----Template  

Synthetic Template Case Study #3:Using gBlocks® Gene Fragments As Modified Standards

While both template sequences contain the primers and probe binding sites, by altering the length of one, the modified amplicon can be distinguished from the endogenous one.

Hs.PT.51.4056836 LIMK1Hs LIMK1 ForwardGAACATCATCCACCGAGACCHs LIMK1 ReverseAGTCTTCTCGTCCACCATGAHS LIMK1 ProbeCCAGCCCGAAGTCAGCCACC

Hs LIMK1 endogenous amplicon sequenceGAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTGGTCCGCGAGAACAAGAATGTGGTGGTGGCTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACT

Hs LIMK1 –10GAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTAACAAGAATGTGGTGGTGGCTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACT

SYBR® Green Dye Dissociation Curve

By deleting or adding bases, a unique standard can be used that is distinguishable from the endogenous sequence.

If you have trouble with contamination, you will always be able to distinguish the standard from the endogenous amplicon.

gBlocks fragment (–10 bases)

gBlocks fragment (endogenous )

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP Detection Controls

New Technologies

Gene Construction and Modification

How are Researchers Using gBlocks® Gene Fragments?

Genome Modification

qPCR and SNP Detection Controls

New Technologies

Gene Construction and Modification

New Uses for gBlocks® Gene Fragments in 2014

Gene variant libraries Promoter variation Gene insertion without homologous recombination

Synthetic Biology Partners

New England BioLabs Gibson Assembly™ Master Mix

IDT and SGI are working together to develop further enabling tools for the SynBio community.

Gene constructs from 5 kb to 2 Mb

Nicola Brookman-Amissah

Is it possible to get the registered trademark for gBlocks fragments?