Pten Deletion in Adult Neural Stem/Progenitor Cells Enhances Constitutive Neurogenesis

Development/Plasticity/Repair

Pten Deletion in Adult Neural Stem/Progenitor CellsEnhances Constitutive Neurogenesis

Caroline Gregorian,1 Jonathan Nakashima,1 Janel Le Belle,1 John Ohab,2 Rachel Kim,1 Annie Liu,1 Kate Barzan Smith,1

Matthias Groszer,1,3 A. Denise Garcia,4 Michael V. Sofroniew,4 S. Thomas Carmichael,2 Harley I. Kornblum,1,5 Xin Liu,1,3

and Hong Wu1

Departments of 1Molecular and Medical Pharmacology, 2Neurology, 3Pathology and Laboratory Medicine, and 4Neurobiology, 5The Semel Institute, DavidGeffen School of Medicine, University of California, Los Angeles, Los Angeles, California 90095

Here we show that conditional deletion of Pten in a subpopulation of adult neural stem cells in the subependymal zone (SEZ) leads topersistently enhanced neural stem cell self-renewal without sign of exhaustion. These Pten null SEZ-born neural stem cells and progeniescan follow the endogenous migration, differentiation, and integration pathways and contribute to constitutive neurogenesis in theolfactory bulb. As a result, Pten deleted animals have increased olfactory bulb mass and enhanced olfactory function. Pten null cells in theolfactory bulb can establish normal connections with peripheral olfactory epithelium and help olfactory bulb recovery from acutedamage. Following a focal stroke, Pten null progenitors give rise to greater numbers of neuroblasts that migrate to peri-infarct cortex.However, in contrast to the olfactory bulb, no significant long-term survival and integration can be observed, indicating that additionalfactors are necessary for long-term survival of newly born neurons after stroke. These data suggest that manipulating PTEN-controlledsignaling pathways may be a useful step in facilitating endogenous neural stem/progenitor expansion for the treatment of disorders orlesions in regions associated with constitutive neurogenesis.

Key words: SEZ; PTEN; neurogenesis; olfactory; neural repair; poststroke

IntroductionThe adult CNS contains self-renewing stem cells capable of gen-erating new neurons, astrocytes, and oligodendrocytes, a processevolutionarily conserved in birds, rodents, primates, and humans(Doetsch, 2003). The subependymal zone (SEZ) is one of at leasttwo areas of adult neurogenesis where glial fibrillary acidic pro-tein (GFAP) expressing cells act as slow-dividing neural stem cells(NSCs) capable of generating neuroblast precursors (Doetsch,2003; Garcia et al., 2004; Lledo et al., 2006). The neuroblastsmigrate into the rostral migratory stream (RMS) and then intothe olfactory bulb (OB) where they differentiate into granule andperiglomerular neurons (Luskin, 1993; Lois et al., 1996; Petreanuand Alvarez-Buylla, 2002; Hack et al., 2005; Curtis et al., 2007).Since the majority of granule neurons in the OB are generatedpostnatally (Petreanu and Alvarez-Buylla, 2002), it is believed

that continued neoneurogenesis from the SEZ is critical formaintaining the homeostasis of the OB and therefore the olfac-tory functions (Goldman, 1998).

NSC-mediated neoneurogenesis is also believed to participatein the process of neural repair. Recent findings suggest endog-enously generated new neurons participate in the formation ofcircuitry and at least some functional recovery following neuro-logical damage such as stroke (Yamashita et al., 2006). Therefore,understanding the molecular mechanisms and pathways capableof activating and expanding neural stem/precursor cell (NS/PC)populations, stimulating their migration toward damaged or dis-eased areas, enhancing their survival, and promoting their mat-uration and integration into the existing neural circuitries mayultimately lead to repair and improve damaged neuronal func-tions (Peterson, 2002; Emsley et al., 2005).

Phosphatase and tensin homolog deleted on chromosome 10(PTEN) encodes a phosphatase and is a potent antagonist ofphosphatidylinositol-3-kinase (PI3K) (Liaw et al., 1997; Nelen etal., 1997; Li et al., 1998) and its regulated pathways (Lee et al.,1999; Maehama et al., 2001; Vivanco and Sawyers, 2002). Utiliz-ing Cre-Lox technology, our group as well as others have gener-ated mouse models with conditional deletion of the murine ho-molog of the PTEN gene (Pten) in the brain at differentdevelopmental stages (Backman et al., 2001; Groszer et al., 2001;Kwon et al., 2001; Marino et al., 2002; Fraser et al., 2004; Stiles etal., 2004; Yue et al., 2005). By deleting Pten in the embryonicNSCs, we showed PTEN negatively regulates NSC proliferation,survival, and self-renewal, both in vivo and in vitro (Groszer et al.,

Received July 3, 2008; revised Nov. 8, 2008; accepted Dec. 17, 2008.This work was supported by Miriam and Sheldon Adelson Program in Neural Repair and Rehabilitation (to H.W.,

S.T.C., M.V.S., H.I.K.), National Institutes of Health Grants NS047386 (to M.V.S.) and MH65756 (to H.I.K., H.W.), BrainTumor Society (to X.L., H.W.), and Henry Singleton Brain Cancer Research Program and James S. McDonnell Foun-dation Award (to H.W.). C.G. and K.B.S. are predoctoral trainees supported by United States Department of Healthand Human Services Ruth L. Kirschstein Institutional National Research Service Award T32 CA09056. We thank Dr.Guoping Fan and members of our laboratories for helpful comments on this manuscript.

The authors declare no competing financial interests.Correspondence should be addressed to Dr. Hong Wu, Department of Molecular and Medical Pharmacology, CHS

23-214, University of California, Los Angeles School of Medicine, 650 CE Young Drive South, Los Angeles, CA 90095-1735. E-mail: [email protected].

M. Groszer’s present address: Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive,Oxford OX3 7BN, UK.

DOI:10.1523/JNEUROSCI.3095-08.2009Copyright © 2009 Society for Neuroscience 0270-6474/09/291874-13$15.00/0

1874 • The Journal of Neuroscience, February 11, 2009 • 29(6):1874 –1886

2001, 2006). Our recent results demonstrate that Pten null NS/PCs have enhanced self-renewal capacity, accelerated G0-G1 cellcycle entry, shortened cell cycle, and decreased growth factordependency (Groszer et al., 2006). Therefore, loss of PTEN issufficient to increase the pool of self-renewing NSCs and pro-mote their escape from the homeostatic mechanisms of prolifer-ation control while cell fate commitments of the Pten null NS/PCs are largely undisturbed (Groszer et al., 2001, 2006).

Because PTEN loss can lead to enhanced embryonic NSC self-renewal, proliferation, and survival, its transient inactivationmay be a promising approach for “boosting” the limited adultNSC population, a critical step toward treating certain neurode-generative diseases. However, such an approach would have to bevigorously tested in vivo to ensure that (1) the PTEN-PI3K path-way plays a similar role in adult NSCs, and (2) perturbation ofPTEN-PI3K pathway alone in NSCs is not tumorigenic. To ad-dress these issues and further explore the role of PTEN in regu-lating adult neurogenesis and repair in vivo, we deleted Pten in asubpopulation of adult NS/PCs in the SEZ by crossing Pten con-ditional knock-out mice (Ptenloxp/loxp) (Lesche et al., 2002) with amurine GFAP-Cre� (mGFAP-Cre�) transgenic line.

Materials and MethodsAnimals. mGFAP-Cre� transgenic mice line 77.6 were generated using a15 kb promoter cassette containing the full-length sequence of the mu-rine GFAP gene as described previously for line 73.12 (Garcia et al., 2004)and crossed to Ptenloxp/loxp mice (Lesche et al., 2002) on a 129/BALB/cbackground. F1 generation compound heterozygous animals were back-crossed with Ptenloxp/loxp mice to produce F2 generation experimentalanimals. Animals were genotyped by standard genomic PCR techniques(Lesche et al., 2002). Ptenloxp/loxp;mGFAP-Cre� mice were crossed to RO-SA26 mice (Soriano, 1999) for reporter analysis. In addition to the SEZ,77.6 mice exhibited only a scattered mosaic pattern of Cre/�-gal expres-sion in subpopulations of GFAP � astrocytes in the adult brain. Animalswere housed in a temperature-, humidity-, and light-controlled room(12 h light/dark cycle), and allowed ad libitum access to food and water.All experiments were conducted according to the research guidelines ofthe University of California at Los Angeles Chancellor’s Animal ResearchCommittee. Ptenloxp/loxp and Ptenloxp/loxp;mGFAP-Cre� animals areherein to referred to as control and mutant, respectively.

PCR. The specificity of Pten excision was evaluated by PCR using DNAfrom tail clip biopsy. For Pten PCR, the loxp (650 bp), wild-type (500 bp),and exon 5 (300 bp) fragments are amplified simultaneously by usingthree primers TCCCAGAGTTCATACCAGGA (Pten6637-F),GCAATGGCCAGTACTAGTGA-AC (Pten6925-R), and AATCTGTG-CATGAAGGGAAC (Pten7319-R). PCR was performed in 20 �l reac-tions using standard procedures for forty cycles; each cycle consisted ofdenaturing at 94°C for 45 s, annealing at 60°C for 30 s, and extension at72°C for 1 min, followed by a single 5 min extension at 72°C. The PCRproducts were analyzed on 2% agarose gels.

5-Bromo-2�-deoxyuridine labeling. 5-Bromo-2�-deoxyuridine (BrdU;Sigma, B5002) was given as either a single intraperitoneal injection of 200mg/kg followed by perfusion with 4% paraformaldehyde after 2 h, or asfour intraperitoneal injections of 200 mg/kg every 12 h followed by per-fusion after 14 d. Staining with anti-BrdU antibody (1:1000 BD Bio-sciences, 51–75512) was performed according to manufacturer’ssuggestions.

Neurosphere cultures. Neurosphere cultures were prepared as de-scribed previously (Groszer et al., 2006). Briefly, 8-week-old SEZs weredissected, minced with a razor blade, dissociated by enzymatic digestionwith Accumax followed by light trituration with a fire-polished glasspipette, and passed through a 70 �M nylon mesh. For moderate densitycultures, cells were resuspended at 10,000 cells/ml (10K) in Neurobasalmedium (Invitrogen), supplemented with B-27 ( Invitrogen), Heparin(Sigma), 20 ng/ml basic fibroblast growth factor (bFGF, Peprotech), and20 ng/ml epidermal growth factor (EGF, Invitrogen). For clonal/lowdensity cultures, tertiary neurospheres were dissociated into a single cell

suspension as described above and the cells were plated at 1000 cells/ml(1K) in T25 tissue culture flasks. Clonal cultures were passaged every 2weeks. At passage 1, 4, 8, 16, and 24, cells were also plated into 96 wellplates at clonal density and after 10 d clonal neurospheres were countedand differentiated. All neurospheres in the 96-well clonal plates whichmeasured �40 �M in diameter were counted using the MicrocomputerImaging Device Program (MCID).

Immunocytochemistry of neurospheres. Immunocytochemistry of neu-rosphere cultures was performed as described previously (Groszer et al.,2001). Briefly, following neurosphere counting, at least 20 randomlychosen clonal neurospheres were transferred from the 96-well platesonto poly-L-lysine (BD Biosciences) and laminin-coated glass coverslips(one sphere per coverslip) for differentiation in Neurobasal medium inthe absence of growth factors. After five days, the differentiated neuro-spheres were fixed in 4% paraformaldehyde and immunostained withrabbit anti-TUJ1 (1: 1000; Covance, MMS-435P) for neurons.

Image analysis and quantification. BrdU-immunostained (BrdU �)nuclei were visualized with a Leica light microscope (40� objective)equipped with a charge-coupled device digital camera. For 14 d postin-jection, comparable sections of immunostained profiles contained in theGCL and RMS were counted in 5 �m thick serial sections at 100 �mintervals. For the 2 h postinjection period, the numbers of BrdU � nucleiwere counted in coronal sections of SEZ and OB. The respective areas ofthese layers/regions were determined with nuclei were visualized withAriol SL-50 scanner and analysis system (Applied Imaging/Genetix) soft-ware and the quantified values were converted to densities (number ofBrdU � profiles per mm 3); n � 6. The structure volumes and RMS weremeasured as described previously (Petreanu and Alvarez-Buylla, 2002;Tsai et al., 2006).

Histology and immunohistochemistry of tissue section. All IHC stainingwas performed on 5 �m sections that were prepared from paraffin-embedded blocks and placed on charged glass slides. The slides weredeparaffinized with xylene and rehydrated in descending grades (100%–70%) of ethanol. The endogenous peroxidase activity was inactivated in3% hydrogen peroxide (H2O2). After washing in deionized water, anti-gen retrieval was performed by incubating the slides in 0.01 M citric acidbuffer, pH 6.0, at 95°C for 13.5 min. Slides were then allowed to cool for30 min in citric acid buffer. After washing in deionized water, the slideswere transferred to either PBS, pH 7.4, or TBST for 5 min. For DABstaining, slides were first blocked with 5% normal goat serum then incu-bated with primary antibody overnight at 4°C. Following three 5 minwashes in either PBS or TBST, slides were incubated with biotinylatedsecondary antibody (1:200, Biogenex) for 30 min at room temperature.Amplification was performed with a horseradish peroxidase system(Vectastain ABC kit, Vector, PK-6100) using a liquid DAB peroxidasesubstrate (Biogenex, HK130 –5K). Slides were counterstained in Gill’shematoxylin, dehydrated, cleared, and coverslipped. Negative controlslides were run without primary antibody. For fluorescence double stain-ing, the section was treated as above and first stained with the first anti-body followed by signal amplification with TSA Plus Fluorescence Sys-tems (PerkinElmer, NEL-7448). After biotin blocking, the section wasstained with the second antibody and signal was amplified with TSAsystem with different fluorescence. Primary antibodies used were rabbitanti-PTEN (1:100; Cell Signaling, 9552); rabbit anti-pS6 (1:100; Cell Sig-naling 2155); rabbit anti-pAKT (1:100; Cell Signaling, 9172); rat anti-GFAP (1:1000; ZYMED Laboratories, 18 – 0063); goat anti-Nestin (1:50;R&D Systems, AF2736); rabbit anti-Cre (1:3000; Covance PRB-106C);goat anti-doublecortin (1:500; Santa Cruz, sc8066); mouse anti-NeuN(1:1000; Chemicon, MAB377); rabbit anti-�-galactosidase (1:1000; MPBiochemicals, 55976); rabbit anti-ki-67 (1:100; Vector, VP-RM04). 4�,6-diamidino-2-phenylindole (DAPI; Invitrogen, D-1306) used as a fluo-rescent counterstain.

Olfactory habituation test. This task measures the ability of mice todetect a novel odorant and to habituate responding to that odorant overrepeated presentations. Previous studies (Trinh and Storm, 2004) dem-onstrated that a high number of sniffs upon initial exposure of an odor-ant indicated that the animal detected a novel odorant. Each mouse washoused individually and handled daily for five days before the beginningof any behavioral manipulation. Individual mice were then exposed to an

Gregorian et al. • Pten Deletion in Adult Neural Stem Cells J. Neurosci., February 11, 2009 • 29(6):1874 –1886 • 1875

odorant for three successive 2 min trials separated by 1 min intervals. Thefirst odorant was always sterile water to habituate the animal to theintroduction of a novel object (cotton swab) in the home cage. Followingthis pre-exposure phase, a cotton swab saturated with an odorant wasintroduced into the home cage for another three successive 2-min trialseparated by 1 min intervals. The total number of contacts that the mousemade with the cotton swab for each of three 2 min exposures as well as thetotal amount of time spent in contact with the cotton swab was recorded.The odorants used were isoamyl acetate, isomenthone, hexyl alcohol,limonene, and anisole (Sigma). For data collection and analysis, all ex-periments were recorded using a camcorder. The number of sniffs andthe duration of each sniff were analyzed in a blind setting by viewingrecordings in real time. To be consistent and unbiased in analysis, a fullsheet of plain paper with a 1 in 2 box was cut out and placed onto thescreen with the cotton swab directly in the middle of the box, thus block-ing the rest of the screen. Every time the nose of the mouse entered thebox, it was scored as a sniff; the duration of each sniff was recorded as theamount of time the nose of the mouse remained in the box. Time inter-vals were divided into five categories of time as follows: less then 1, 2–5,6 –9, 10 –12, and �12 s. A total of 14 control and 12 mutant sexually naivemale mice at 10 –12 months of age were used in behavior experiments.

Chemical ablation of olfactory epithelium. Control and mutant sexuallynaive 14- to 16-week-old male mice (n � 8) were housed individuallyand given intraperitoneal injections of dichlobenil (2.6-dichlo-benzonitrile, Sigma, 25 �g/g body weight) in DMSO (dimethyl sulfoxide,2 �l/g body weight) for 7 d (Yoon et al., 2005). An additional cohort ofcontrol and mutant mice (n � 5) were given DMSO (vehicle, 2 �l/g bodyweight) and evaluated for ability to detect novel odors using the odoranthabituation test at 2, 3, and 4 weeks after the last injection.

Stroke model. Stroke was produced in 2- to 5-month-old control andmutant animals. Briefly, stroke was produced using a distal, branch ar-tery occlusion of the middle cerebral artery (Ohab et al., 2006; Tsai et al.,2006). The middle cerebral artery was exposed over the surface of thefrontoparietal cortex through a small craniotomy, and a parietal branchcoagulated and transected. Both jugular veins in the neck were occludedfor 15 min and then released. This produces a small stroke in he vibrissal(barrel) somatosensory field of the cortex.

Stereology. Stereological quantification was performed using serial sec-tions through the anterior SEZ, OB, and peri-infarct cortex using unbi-ased counting with the optical fractionator as described previously (Tsaiet al., 2006).

Statistical analysis. Unless otherwise noted, all data were subjected tostatistical analysis by using two-sample t testing assuming unequal vari-ances (Excel Data Analysis Tool Pak, Microsoft) to determine the differ-ences between the control and mutant groups. A p value of 0.05 or lesswas considered significant.

ResultsGeneration of mGFAP-Cre� line for conditionally targetingadult neural stem/progenitor cellsPrevious studies have made a compelling case that the majority ofmultipotent NSCs responsible for neoneurogenesis in the adultmouse brain express GFAP (Doetsch et al., 1999; Groszer et al.,2001; Imura et al., 2003; Garcia et al., 2004). To further explorethe role of PTEN in regulating adult neurogenesis and repair invivo, we generated a new mGFAP-Cre� transgenic line 77.6 usingthe mGFAP gene cassette (Garcia et al., 2004) (for details, pleasesee Materials and Methods). Immunohistochemistry (IHC) of77.6 mice crossed to Rosa26-LacZ reporter mice (Soriano, 1999)showed Cre expression in a small subpopulation of SEZ cell inadult brain (Fig. 1a,b) and �-Gal expression in many more cellscorresponding to Cre� cells and their progenies (Fig. 1e). TheseCre�/�-Gal� cells represent adult NSCs since their progeniescan migrate and differentiate along the RMS (Fig. 1f) and reachthe granule cell layer (GCL) in the OB (Fig. 1h). In addition, weused double-labeling immunohistochemistry to compare expres-sion of Cre with GFAP and Nestin, intermediate filaments whose

dynamic regulation by neural progenitors and astrocytes at dif-ferent stages of development has been well documented (Garciaet al., 2004; Lagace et al. 2007). Three dimensional analysis of SEZcells using scanning confocal laser microscopy showed that Cre�

cells in the SEZ express GFAP (Fig. 1c) and Nestin (Fig. 1d). Cellsthat were Cre positive/GFAP negative or Cre positive/Nestin neg-ative were not found (data not shown). Furthermore, neither Crenor LacZ reporter expression could be detected in embryonicbrains (data not shown), suggesting Cre is not expressed duringembryonic development, and only postnatally in progenitor cells.In contrast to the previously reported mGFAP lines 7.1 (Bush etal., 1998; Imura et al., 2003) and 73.12 (Garcia et al., 2004),mGFAP-Cre� line 77.6-mediated reporter expression in progen-itor cells was limited to the SEZ region and no Cre or LacZ re-porter expression could be detected in GFAP� NSC populationsin the hippocampus. Therefore, mGFAP-Cre� line 77.6 was cho-sen for this study because we hypothesized that the limited Cretransgene expression in NSCs of line 77.6 would circumvent in-creased brain size, altered brain histoarchitecture and prematurelethality caused by global Pten deletion from NSCs in previousconditional knock-out models (Groszer et al., 2001; Yue et al.,2005).

Pten deletion in the adult NSC leads to increased self-renewalwithout tumorigenesis or premature senescenceTo explore PTEN�s role in regulating adult NSCs, Ptenloxp/loxp

(Lesche et al., 2002) mice were crossed with mGFAP-Cre� line77.6 mice. Ptenloxp/loxp;mGFAP-Cre� mutants are viable and fer-tile, yielding Mendelian offspring distributions (data not shown).Importantly, no tumors or aberrant neurological phenotypeswere detected in mutant animals up to two years of age.

Previously, we found that deletion of Pten in embryonic NSCresulted in an enhanced ability to self-renew in vitro comparedwith control spheres (Groszer et al., 2006). To assess the functionof PTEN in controlling adult NSC self-renewal and proliferation,we compared neurosphere forming activity of Pten deleted brain(Mutant) with that of their wild-type littermates (Control) in aserial clonal passaging experiment. Similar to Pten deletion in theembryonic neural stem cells, spheres formed from Pten deletedadult brain were generally bigger (supplemental Fig. 1a, availableat www.jneurosci.org as supplemental material). Importantly, bypassage 4 �90% of spheres isolated from the mutant culturescarried Pten bi-allele deletion and were positive for the Cre trans-gene (supplemental Fig. 1b, available at www.jneurosci.org as supplemental material). At each passage, mGFAP-Cre-mediated Pten deletion in adult NSCs resulted in increased clonalneurosphere number, a measurement of neural stem cell self-renewal capacity (Fig. 2a). Serial clonal passaging of cells over 48weeks (24 passages), at a density at which nearly all spheres arederived from a single cell, resulted in the eventual senescence ofwild-type cultures while the mutant cells maintained high rates ofself-renewal. This enhanced neurosphere formation was also re-flected in the total cell numbers attained at each passage (Fig. 2b).Previous study has suggested that progenitors tend to lose theirneurogenic potential and become more glial-restricted over time(Seaberg et al., 2005). Following in vitro differentiation, the clonalneurospheres from mutant mice maintained a significantly en-hanced neurogenesis even at late passages, whereas the wild-typecultures produced fewer neurons than their mutant counterpartat every passage and their ability to generate neurons declinedsubstantially with time in culture (Fig. 2c), similar to our previousstudies on Pten deleted embryonic NSCs (Groszer et al., 2001).Together, these data indicate that Pten deletion persistently en-

1876 • J. Neurosci., February 11, 2009 • 29(6):1874 –1886 Gregorian et al. • Pten Deletion in Adult Neural Stem Cells

Figure 1. mGFAP-Cre line for conditionally targeting adult neural stem/progenitor cells. a, b, e, f, h, Survey images of coronal sections of the SEZ (a, b, e), RMS (f ), and OB (h) stained bybright-field immunohistochemistry. A small number of cells in the SEZ express Cre (a, low mag; b, high mag). Scale bars, 80 �m. c, d, Confocal micrographs of single optical slices through cells inthe SEZ that are double stained by immunofluorescence for Cre and GFAP (c) or Cre and Nestin (d). Individual channels and orthogonal analysis show that all Cre-expressing (Figure legend continues.)


hances self-renewal of adult NSC, whilemaintaining their capacity to produceneurons, without any evidence of stem cellexhaustion.

Pten deletion leads to expansion ofneural stem and progenitor cells in theSEZ regionAt the tissue level, Pten deletion led to arobust increase in GFAP� cells (Fig. 3a,second right) in the SEZ. Cells with hyper-phosphorylation of S6 (P-S6) (Fig. 3a,third right) and AKT (P-AKT; supplemen-tal Fig. 2a, available at www.jneurosci.orgas supplemental material), surrogatemarkers for PTEN loss and PI3K activa-tion that have been implicated in neuronsurvival and cell cycle control (Datta et al.,1999), could be easily visualized in thesame region. GFAP expression and num-bers of GFAP� cells did not appear differ-ent from controls in neighboring struc-tures and other parts of forebrain exceptthe SEZ region (data not shown), furthersupporting SEZ-specific Pten deletion.Importantly, these P-S6� cells also expressGFAP (Fig. 3a) and/or Doublecortin(DCX), a marker for immature and mi-grating neuroblast progenitors (supple-mental Fig. 2b, available at www.jneurosci.org as supplemental material),suggesting that PTEN loss or PI3K-AKTactivation leads to the expansion of adultNSC and progenitors in SEZ region.

Consistent with NSC expansion, thevolume of the mutant SEZ is significantlyincreased when compared with controls(Fig. 3b) (0.021 � 0.0011 vs 0.032 � 0.008mm 3 � SEM; p � 0.01), which was accompanied by a greaternumber of Ki-67� (Fig. 3c) (6832.12 � 231.8 vs 8376.98 � 122.8cells � SEM; p � 0.01) and DCX� neuroblasts (Feng and Walsh,2001). Figure 3d shows a statistically significant increase in DCXvolume in Ptenloxp/loxp;mGFAP-Cre� SEZ (Fig. 3d) (0.019 �0.0012 vs 0.062 � 0.0064 mm 3 � SEM; p � 0.01). These resultsindicated that Pten null NSCs can readily proliferate and differ-entiate into DCX� neuroblasts, the precursors for adultneurogenesis.

SEZ-born Pten null progenitors and their progenies followthe endogenous migration pathwaySEZ-born progenitors are known to migrate to the OB via thewell-defined RMS. Because PTEN has been implicated in con-trolling cell chemotaxis (Funamoto et al., 2002; Iijima and Dev-

reotes, 2002) as well as migration (Tamura et al., 1998; Liliental etal., 2000; Raftopoulou et al., 2004; Yue et al., 2005), we deter-mined whether the progenies of SEZ-born Pten null progenitorscould respond to normal environmental cues and migrate intoand along the RMS. To mark the SEZ-born progenitors andtheir differentiated progenies, we pulse labeled control andmutant mice with BrdU and quantified the number of BrdU �

cells in the RMS after 5 d of chase. As shown in Figure 4a, asignificant increase in the number of BrdU � cells was found inthe mutant RMS (Fig. 4a) (22998 � 968 vs 33386 � 786 cellsper mm 3 � SEM; p � 0.05). Furthermore, the BrdU � cellswere also positive for P-S6 staining (Fig. 4a), indicating thatSEZ-born Pten null progenitors exhibited enhanced cell pro-liferation but could follow the endogenous migration pathwayinto the RMS.

We then tested whether the migrating Pten null progenitorswithin the RMS express similar markers as controls. Neuroblastsin mutant RMS are Pten� (supplemental Fig. 3, available at www.jneurosci.org as supplemental material) and DCX� (Fig. 4b) withmany more DCX� neuroblasts in the RMS of Ptenloxp/loxp;mGFAP-Cre� mice (Fig. 4b) (2642 � 126 vs 3894 � 60 cells permm 2 � SEM; p � 0.05).

During migration, neuroblasts are restricted to the RMSwith few cells diverging from the path (Doetsch and Alvarez-Buylla, 1996). Although it seemed that a greater number of

4

(Figure legend continued.) cells in the SEZ also express GFAP (c) and Nestin (d). Orthogonalimages (ortho) show three-dimensional analysis of individual cells at specific sites marked byintersecting x, y, and z axes. Scale bars, 20 �m. Many cells express the reporter protein �-gal (e)in the neurogenic proliferative regions of the SEZ. Migrating neuroblasts in the RMS (f ) andgranule neurons in the OB (h) also express �-gal. Box in g indicates the region shown in h.Arrows in a, b, and e indicate representative Cre or �-gal-positive cells in SEZ. SEZ, Subepend-myal zone; LV, left ventricle; STR, striatum; RMS, rostral migratory stream; OB, olfactory bulb;GCL, granule cell layer; Gl, glomeruli.

Figure 2. Pten deletion in clonal neurosphere cultures enhances stem cell self-renewal and neurogenesis over long-term serialclonal passages compared with the gradual senescence and decreased neurogenesis in wild-type cultures. a, Neurosphere cul-tures generated from the adult SVZ of Pten knock-out (Mutant) and wild-type (Control) mice were cultured at clonal density (1000cells/ml), passaged, and reseeded at clonal density every 2 weeks. Clonal neurosphere numbers, representative of the number ofstem cells present in the culture, were significantly higher in mutant cultures at all passages ( p � 0.001). b, The clonal neuro-spheres were then dissociated and the total cell number was counted at each passage followed by reculturing at clonal density.After the first passage, mutant cultures consistently produced higher total cell numbers even after long-term serial clonal pas-saging while control cultures produced decreased cell numbers with time, eventually senescing by passage 24. Data are means �SEM; n � 4. c, Immunocytochemistry for TUJ1 � cells (green) and the counterstain Hoescht (blue) are shown at passage 4 and 16indicating the clonal neurospheres from mutant mice maintained their robust neurogenesis even at late clonal passages while theability to generate neurons was dramatically attenuated in control cultures over time. Scale bar, 60 �m. n � 4.


cells diverged from the RMS in the Ptenloxp/loxp;mGFAP-Cre�

mice, the ratio of diverging DCX � cells to the total number ofcells in the mutant RMS was not significantly different fromthat of controls (1.28 � 0.004 vs 1.36 � 0.009% of total �SEM; p � 0.05). These results suggest that Pten null SEZ-bornneuroblasts are able to recognize environmental cues and mi-grate along the endogenous pathway.

Deletion of Pten in adult SEZ leads to increased OB massAlthough OB granule cell neurons (GC) are continuously gener-ated throughout adulthood, OB volume remains constant duringadulthood (Pomeroy et al., 1990). This homeostatic stage isachieved largely via a balance between SEZ neoneurogenesis andcell death in the GCL of OB (Najbauer and Leon, 1995; Fiske andBrunjes, 2001; Petreanu and Alvarez-Buylla, 2002). Measure-

Figure 3. mGFAP-Cre-mediated Pten deletion leads to expansion of adult neural stem cells and their progenies in vivo. Survey images of coronal sections of control and mutant SEZ. a, Comparedwith littermate controls, mutant mice showed increased GFAP and P-S6-positive (labeled cells which co-localized in the SEZ. DAPI counter stain is used to visualize nuclei. Scale bars: top, 150 �m;bottom, 25 �m. b– d, Images of H&E (b), Ki-67 (c), and DCX (d) expression demonstrate increased proliferation in mutant SEZ compared with control regions. Scale bar, 60 �m. n � 5. SEZ,Subependymal zone; LV, lateral ventricle; CC, corpus callosum; STR, striatum; H&E, hematoxylin and eosin; DCX, doublecortin.


ments taken from mutants and their litter-mate controls demonstrated continuousincreases in size (Fig. 5a, upper panel) andweight of mutant OB, starting at 2.5months of age (Fig. 5a, lower panel). Thisincreased size and mass of mutant OB isconsistent with previous reports that thereis a surge of progenitors migrating to theOB at 3– 4 months of age (Petreanu andAlvarez-Buylla, 2002). Histological analy-sis of mutant OB (Fig. 5b) and other brainregions (supplemental Fig. 4, available atwww.jneurosci.org as supplemental mate-rial) revealed normal histoarchitecture.

Because SEZ-born progenitors migrateand integrate into the GCL of the OB, wehypothesized that an increase in GCL vol-ume may contribute to the increased OBmass. Compared with control, Ptenloxp/loxp;mGFAP-Cre� GCL volume increased two-fold at 3.5 months (Fig. 5c, columns on theleft) (2.92 � 0.071 vs 5.60 � 0.25 mm 3 �SEM; p � 0.05) while no statistically sig-nificant differences were observed in theexternal plexiform layer (EPL) (Fig. 5c,columns on the right) (1.19 � 0.054 vs1.10 � 0.043 mm 3 � SEM; p � 0.05), aregion not influenced by SEZ-mediatedneurogenesis. To further test whether in-creased GCL volume is due to SEZ-borngranule cells incorporated into the OB,mice were injected with BrdU and killed at2 h or 14 d after the last injection. Thesetime points were chosen to ensure thatthere were no ectopic proliferating cells inthe mutant OB (2 h chase) and to allowsufficient time for BrdU-labeled neuro-blasts to migrate, differentiate, and incor-porate into the outer layers of the OB (14 dchase). BrdU� cells could not be detectedin either control or mutant OB after 2 h ofchase (supplemental Fig. 5, available atwww.jneurosci.org as supplemental mate-rial). However, after 14 d chase there wasan approximate twofold increase in thenumber of BrdU� cells in the GCL of 3.5-month-old Ptenloxp/loxp;mGFAP-Cre�

mice when compared with wild-type con-trols (Fig. 5d) (2.92 � 0.07 vs 5.60 � 0.25cells � SEM; p � 0.001). These results in-dicate that the increase in GCL volume wasnot due to ectopic cell proliferation withinthe OB but from an increase in the numberof cells that migrated from the SEZ to theGCL via the RMS. We also observed a sig-

Figure 4. Pten deletion leads to enhanced migration of SEZ-born progenitors in RMS. a, Representative images of RMS stainedfor BrdU, P-S6, and their colocalization revealed an increase in Pten null SEZ-born progenitors migrating in RMS when comparedwith control and shows the BrdU � population in mutant RMS is Pten null. Scale bar, 100 �m. b, Survey images of sagittal

4

sections of control and mutant RMS stained with DCXdemonstrate an increase in the number of migrating neu-roblasts in mutant RMS compared with control. DAPIcounter stain is used to visualize nuclei. Scale bar, 400�m. n � 6. DCX, Doublecortin; RMS, rostral migratorystream; OB, olfactory bulb.


nificant decrease in the number of TUNEL� cells in the mutantGCL 2.51 � 0.22 (control) vs 1.83 � 0.16 (mutant) cells � SEM;p � 0.05), indicating that OB enlargement in the mutant mice isa net result of increased cell proliferation and decreased celldeath. Furthermore, Pten null NSC-derived granule neurons inthe GCL were positive for both P-S6 and NeuN, a neuron-specificmarker (Fig. 5e). Together, these results indicate that Pten deletedNSCs and their progenies can follow endogenous cues along thenormal RMS and reach the OB. Within the OB, they can differ-entiate and integrate into the GCL.

Pten loxp/loxp;mGFAP-Cre � mice exhibitenhanced habituation to novel odorsThe life-long neurogenesis along SEZ-RMS-OB suggests that adult-born neu-rons play critical roles in olfactory func-tions (Petreanu and Alvarez-Buylla, 2002;Winner et al., 2002): adult-born neuronsextend new processes and form new syn-apses with each other or with existing GC(Cecchi et al., 2001; Petreanu and Alvarez-Buylla, 2002), and the rates of neurogen-esis are known to be positively correlatedwith performance on memory (Nilsson etal., 1999; Shors et al., 2001; Rochefort et al.,2002) and olfactory discrimination tasks(Gheusi et al., 2000; Enwere et al., 2004).To test whether SEZ-derived Pten null GCsare functional, we performed an olfactorybehavioral test. This Odorant HabituationTask behavioral assay measures the abilityof mice to detect a novel odorant and tohabituate in responding to that odorantover repeated presentations (Trinh andStorm, 2004). We found that olfactory dis-crimination was intact in Ptenloxp/loxp;mGFAP-Cre� mice since the first exposureto an odorant resulted in an increase in thenumber of sniffs from the previous trial,proving that the mice were able to detect anovel odor (Fig. 6a). Furthermore, mutantmice habituate faster to a novel odorantwhen compared with controls, as demon-strated by a decrease in the number ofsniffs during the second and third expo-sures of both isoamyl acetate and isomen-thone (Fig. 6a, right panels). A similar pat-tern was observed with two additionalodorants regardless of order of presenta-tion (data not shown). In addition, whenthe duration of the sniffs was measured,Ptenloxp/loxp;mGFAP-Cre� mice exhibited adecrease in the time spent within eachodorant group compared with controls(supplemental Fig. 6, available at www.jneurosci.org as supplemental material). Adecrease in the time spent investigating anodorant after repeating exposure furtherimplies that Ptenloxp/loxp;mGFAP-Cre�

mice have an increased ability to recall,recognize, or habituate to the odorantwhen compared with control.

This enhanced odorant habituationsuggests that 1) Pten deletion in adult NSC

causes enhanced proliferation and self-renewal without interfer-ing with the normal properties and destiny of their differentiatedprogenies, and 2) Pten null granule neurons are able to integrateinto the olfactory circuitry and contribute to odor discrimina-tion. We therefore hypothesized that perturbation of endogenousPTEN function may be beneficial for neuronal repair and postin-jury recovery. To test this hypothesis, mice were treated withdichlobenil, a chemical shown to selectively destroy the olfactorysensory epithelium (Mombaerts et al., 1996; Yoon et al., 2005) inadult mice. In agreement with published reports, we observed a

Figure 5. Increased OB mass and enhanced proliferation and migration of SEZ-born progenitors to the GCL of OB in mutantmice. a, Enlarged OB of mutant mice. Photo shows a brain hemisphere from age-matched control and mutant mice. Scale bar, 1mm. Panel below depicts the progressive increase in the ratio of mutant/control OB weight. n � 40. b, Histological analysis of OBsection from control and mutant mice reveals normal histoarchitecture. Scale bar, 500 �m. c, GCL volume is significantly increasedin mutant mice (*p � 0.05) whereas no significant change is observed in EPL ( p � 0.05). Data are means � SEM; n � 10. d,SEZ-born neuroblast migration was analyzed by BrdU pulse-labeling. Mice were injected with 200 mg/kg BrdU peritoneally, anddistribution of BrdU-labeled cells was determined 2 weeks after injection. An increased number of BrdU-labeled cells withinmutant GCL indicated Pten mutant mice had a significant increase in cell number at 2 weeks post injection. Scale bar, 100 �m. n�5. e, Representative GCL images show enhanced immunoreactivity for NeuN and increased NeuN/P-S6 double positive cells inmutant when compared with a matched control region. DAPI is used as counterstain to visualize nuclei. Scale bar, 10 �m. OB,Olfactory bulb; GCL, granule cell layer; EPL, external plexiform layer.


severe destruction of the main olfactory epithelium (MOE) neu-ronal layer in animals treated with dichlobenil when comparedwith controls (supplemental Fig. 7, available at www.jneurosci.org as supplemental material). Post dichlobenil treatment, allmice were evaluated weekly for their ability to detect novel odors(Odorant Habituation Test as described above). Consistent withprevious report (Yoon et al., 2005), all drug treated mice, regard-less of genotype, lost their ability to detect odorants 2 weeks aftertreatment (Fig. 6b, top panel). However, Ptenloxp/loxp;mGFAP-Cre� mice showed an improvement in odorant detection 4 weekspost treatment (Fig. 6b, middle panel). MOE examination after 4weeks of dichlobenil treatment showed comparable regenerationof the epithelial layer in both control and mutant mice with nosignificant difference in Pten (supplemental Fig. 8b, available atwww.jneurosci.org as supplemental material) or P-S6 (supple-mental Fig. 8c, available at www.jneurosci.org as supplementalmaterial) staining, indicating improved behavioral test perfor-mance in the mutant animals is not due to enhanced regenerationor Pten deletion in mutant MOE. By 6 weeks post treatment, thePtenloxp/loxp;mGFAP-Cre� mice had almost recovered to pre-treatment stage (Fig. 6b, bottom panel). These results suggestPten null cells in the OB can establish normal connections withperipheral olfactory epithelium and enhanced NSC self-renewaland proliferation in Pten deleted SEZ may help OB recovery fromacute damage.

Pten deletion enhances poststroke neuroblast migrationStroke is a common cause of neuronal damage. Seven to ten daysafter the initial insult, SEZ-born neuroblasts proliferate and mi-grate to the site of injury, contributing to poststroke neurogenesisand recovery (Arvidsson et al., 2002; Parent, 2002; Jin et al., 2003;Tsai et al., 2006). We tested whether Pten deletion in SEZ NSCscould enhance neuroblast proliferation and migration after isch-emic injury. For this, we introduced a limited stroke in the sen-sorimotor cortex of the brain, which closely mimics the humancondition and quantified the location and number of immatureneurons with the protein marker doublecortin (DCX) (Car-michael, 2005; Ohab et al., 2006). As reported in normal adultmice (Ohab et al., 2006; Tsai et al., 2006), there were no DCX�

cells in the cortex of either control or Ptenloxp/loxp;mGFAP-Cre�

mice before stroke (data not shown), suggesting that Pten nullNSCs in the SEZ do not migrate to the cortex without additionalstimulation (supplemental Fig. 9, available at www.jneurosci.orgas supplemental material). Conditional Pten deletion also had noeffect on infarct size (1.57 � 0.38 vs 1.48 � 0.34 mm 3 � SEM; p �0.05).

One week after stroke, DCX� cells were found in subcorticalwhite matter and peri-infarct cortex of both groups (Fig. 7a, leftpanels). However, Ptenloxp/loxp;mGFAP-Cre� mice showed a largeand statistically significant increase of DCX� neuroblasts in theperi-infarct cortex at day 7 when compared with controls (Fig. 7a,right panels) (�4500 more immature neurons per animal in mu-tant vs control; p � 0.001), suggesting that Pten null NSCs andtheir progenies can readily respond to ischemic injury and mi-grate to the damaged site. Staining of P-S6 marker further sup-ports the idea that it is Pten null neuroblasts which contribute tothe increased DCX� population in the peri-infarct site (Fig. 7b).These results indicate that PTEN is a potent negative regulator ofNSC/progenitor proliferation and neurogenesis in response toinjury.

Previous studies have shown that despite the migration oflarge numbers of newly born immature neurons to peri-infarctcortex in the first week after stroke, only a small percentage sur-

vive long term (Arvidsson et al., 2002; Ohab et al., 2006). Todetermine if PTEN plays a role in the long-term survival anddifferentiation of immature neurons in regions of damage afterstroke, we labeled newly born cells in the first week after strokewith BrdU, and co-labeled these cells 90 d later with double stain-ing for the mature neuronal marker NeuN. There was no differ-ence in stereological counts of BrdU/NeuN cells betweenPtenloxp/loxp;mGFAP-Cre� mice and littermate controls 90 d after

Figure 6. Enhanced olfactory habituation and recovery after epithelium injury inPtenloxp/loxp;mGFAP-Cre� mice. a, b, Control and mutant mice were subjected to the olfactoryhabituation test. Pretraining of wild-type control mice to a cotton swab soaked in water habit-uated mice to the presence of the swab in their cage. This was manifested as a decline in thenumber of sniffs with subsequent exposures to the swab. During odorant testing, the cottonswab was laced with 50 �M isoamyl acetate or 50 �M hexyl alcohol and introduced on threesuccessive trials. The fact that the control mice sniffed the isoamyl acetate- and hexyl alcohol-laced cotton swabs more times than during the third exposure to the water swab indicated thatthe animal was able to smell these odorants. a, Compared with control, mutant mice sniffed theswabs less frequently in the second and third exposures (all three conditions) signifying theyhabituated to the novel odorant faster than the control. n � 14 (control) and 12 (mutant).b, Both control and mutant mice lost their ability to detect odorants at 2 weeks posttreatment, whereas the ability of mutant mice to detect odorants began recovering at 4weeks post treatment, and their ability to detect odorants was restored to pre-treatmentlevels by week 6. Data are means � SEM; n � 8.


stroke (315 � 123 vs 303 � 199 cells per animal in mutant andcontrol � SEM, respectively; p � 0.05). This data indicate thatalthough PTEN plays a prominent role in the control the initialproliferation and migration of immature neurons in poststrokeneurogenesis, it does not play an autonomous role in the survivalof these cells in the long term.

DiscussionNeurological disorders are the leading source of disability. Cur-rently there are no treatments that promote repair and recoveryin the brain from any major neurological disorder, includingstroke, degenerative disease, and trauma. NSCs are cells that cangive rise to the major components of the brain and spinal cord,thus attractive resources for repairing neurological disorders(Lindvall and Kokaia, 2006). The major challenges of NSC-mediated neuronal repair are 1) to understand the key pathwaysinvolved in controlling NSC self-renewal, proliferation, survival

and differentiation, 2) to develop method-ologies for manipulating these pathwaystoward therapeutic use, and 3) to test thepotential benefit of NSCs and their proge-nies in human disease-relevant model sys-tems before being used on humanpatients.

In this study we demonstrated that de-letion of Pten in adult NSCs is not tumor-igenic but promotes NSC expansion.Progeny from Pten null NSCs follow theendogenous migratory cues, differentiate,and integrate into the existing circuitry.Under conditions of acute damage, such asolfactory epithelium ablation, animalswith Pten NSC deletion exhibited faster re-covery. These data suggest that condi-tional manipulation of the PTEN/PI3Kpathway in NSCs may be beneficial forNSC expansion, proliferation, and sur-vival, in turn, promoting recovery and theintegration of newly born neurons to ex-isting or damaged neuronal networks as-sociated with constitutive neurogenesis.

Stem cell self-renewal is known to beregulated by different signaling pathways,but the effect of a specific pathway maydepend on the developmental stage or lin-eage of a stem cell population. For exam-ple, deletion of p21 in adult neural stemcells results in a transient increase in neu-rospheres formation with a subsequentdecline in stem cell numbers; a phenome-non known as stem cell “exhaustion”(Kippin et al., 2005). Although, in a similarmanner, PTEN loss leads to the “exhaus-tion” of adult hematopoietic stem cells(Yilmaz et al., 2006; Zhang et al., 2006; andour unpublished observation), condi-tional deletion of Pten in both embryonicand adult NSC promotes a sustained self-renewal and stem/progenitor expansion(Groszer et al., 2006; Groszer et al., 2001;and this study). Significantly, we observedthat the mutant cultures maintain an en-hanced self-renewal, proliferation/sur-vival rate, over extremely long-term ex-

pansion times under clonal conditions, suggesting that the role ofPTEN in regulating stem cell activity may be modulated by fac-tors specific to the neural stem cell lineage. Therefore, furtherstudy of these lineage- or developmental stage-specific mediatorsof self-renewal pathways will be increasingly critical for our un-derstanding of the underlying mechanisms of stem cell self-renewal and therapeutic manipulations.

In the current study, we demonstrated enhanced and pro-longed neurogenic capacity in clonal cultures of Pten-deletedneural stem/progenitor cells compared with wild-type controls.In our first report of Pten mutant embryonic progenitors, we didnot expand cultures for prolonged periods of time, and thereforedid not observe this phenomenon. However, more recently, in anexperiment using serial passaging of embryonic progenitors, wealso observed similar results to those reported here. AlthoughPten deletion promotes neuronal survival, we do not think that

Figure 7. Pten deletion enhances post-stroke neuroblast migration. a, DCX labeling in peri-infarct cortex and SEZ. DCX � cellsin control and mutant 7 d after stroke. Right panel shows stereological quantification of DCX � cells in peri-infarct cortex. Scalebars: top, 100 �m; bottom, 25 �m. n � 6. b, Representative images of P-S6 staining from both hemispheres of mutant mouse.Left panel shows hemisphere containing peri-infarct cortex which has increased staining for p-S6 in peri-infarct cortex whencompared with uninjured cortex in the same animal (right panel). DAPI is used as counterstain to visualize nuclei. Scale bar, 50�m. CTX, Cortex; CC, corpus callosum.


this effect, in and of itself, accounts for the observed enhance-ment in neurogenesis, as the observed enhancement in neuronalproduction appears similar between Pten deleted and wild-typeneurospheres at early passages as well. It is possible that Ptendeletion in some way promotes a neuronal cell fate to some extentbut this is not necessarily at the expense of glial differentiation.Instead, we view the enhanced maintenance of neurogenesis asbeing largely due to the fact that Pten deletion is allowing for themaintenance of a multipotent stem cell-like pool that retainsneuronal competence, whereas multiply passaged wild-type cul-tures do not maintain stem cells production, and become en-riched for glial restricted precursors (Bhattacharyya and Svend-sen, 2003; Jain et al., 2003; Seaberg et al., 2005).

Our previous studies and those by others demonstrated thatPten deletion in the embryonic brain leads to abnormal histoar-chitecture with severe layering defects (Backman et al., 2001;Groszer et al., 2001; Marino et al., 2002; Yue et al., 2005). How-ever, as Pten deletion happens in nearly 100% of the neural stem/progenitor cells, it is unclear whether the abnormal phenotypesobserved are caused by intrinsic migratory defects of Pten-nullneurons, extrinsic microenvironmental cues provided by Ptennull radial glia, or perhaps both (Groszer et al., 2001). In thisstudy, we demonstrated that in the presence of wild-type envi-ronmental cues, Pten null adult NSCs and their progenies canfollow the endogenous migration pathway, undergo differentia-tion, and reach their normal target. This result is consistent witha previous study on Pten heterozygous mice showing thatPten�/� cells migrated to the outer layers of the OB more rapidlyand incorporated at the same sites as Pten�/� cells (Li et al.,2002). Therefore, the extrinsic microenvironment cues plays amore predominant role in controlling the migratory behavior ofSEZ-derived Pten null NSCs and their progenies.

Nearly 90% of the GCs in the OB are SEZ-derived and incor-porated postnatally, and their survival depends on incoming ac-tivities (Rosselli-Austin and Williams, 1990; Brunjes, 1994). GCsare also known to extensively shape mitral cell response to odors(Yokoi et al., 1995), and there is evidence that the OB circuitrymaximizes differences in odor representations (Friedrich andLaurent, 2001; Dulac, 2005). Animals carrying a mutation in thecyclic nucleotide gated channel are not able to transduce the sig-nal from the olfactory receptors in the olfactory neurons (Bakeret al., 1999) and have smaller GCL volume and OB mass (Pe-treanu and Alvarez-Buylla, 2002). The lack of electrical activity inthe OB of these mice dramatically reduced the survival of newlygenerated neurons of the GCL, suggesting that peripheral olfac-tory epithelium plays a critical role in the survival of GCL neu-rons in the OB (Petreanu and Alvarez-Buylla, 2002). Our resultsshowed that PTEN loss in SEZ NSCs leads to an increase in GCLvolume and OB size as well as an improvement in olfactory func-tion, suggesting that the Pten null SEZ-derived GCL neurons areable to integrate into the existing circuitry, receive electrical inputfrom olfactory epithelium and are thus functional. Because olfac-tory ablation/repair is a multifactor-dependent process, we can-not rule out that mechanisms other than Pten null granular cellsin the OB also contribute to the faster recovery observed in ourstudy. Since Pten conditional deletion in adult NSCs also en-hances the recovery of olfactory function after ablation of olfac-tory epithelium, our data suggest an important role for SEZ-derived neurons in reestablishment of the connection betweenOB and olfactory epithelium during acute damage via a currentlyunknown mechanism.

SEZ-born progenitors are known to play a role in postisch-emic injury recovery (Ohab et al., 2006). In a stroke-injury

model, Pten conditional knock-out animals showed a robust in-crease in cell proliferation and DCX� neuroblast migration fromthe SEZ over long distances to the peri-infarct cortex, suggestingPten null neuroblasts are responsive to chemotactic stimulationand can migrate to the injury site. Although the SEZ DCX volumedid not increase in Pten conditional knock-out mice poststrokewhen compared with non-stroke animals (supplemental Fig. 10,available at www.jneurosci.org as supplemental material), thesignificantly enhanced proliferation and migration of Pten nullneuroblasts to the peri-infarct cortex suggested that Pten nullneuroblasts are primed for the signals that induce poststroke neu-rogenesis. Pten deletion might have been expected to promoteneuroblast survival as it potentiates the action of the PI3K/Aktpathway, a common downstream signaling pathway for many ofthe neural stem cell survival and differentiation growth factors(Greenberg and Jin, 2006). Interestingly, Pten conditional dele-tion in these neuroblasts is not sufficient to promote their long-term differentiation/survival and functional integration oncethey have migrated into peri-infarct cortex. Thus, in addition tosoluble growth factor signaling, the cellular environment of theperi-infarct cortex may exert an important degree of control overcell survival in newly born neurons after stroke.

Stem cell-based therapies, including the promotion of endog-enous neurogenesis or transplantation of stem/progenitor cells,are limited in large part by the death of the progenitor pool(Goldman, 2005). In poststroke neurogenesis, despite a robustgeneration of newly born neurons, ninety percent of them even-tually die (Ohab et al., 2006). After stem/progenitor transplanta-tion, a similar result is seen in which most transplanted cells die orfail to differentiate. The differential roles of PTEN defined in thepresent study highlight the key differences between constitutive/normal and injury-induced neurogenesis. PTEN inactivationalone is sufficient to promote a significant increase in neurogen-esis, neuronal survival and improved function in the olfactorybulb but insufficient to promote long-term survival after stroke.Although both poststroke and normal neurogenesis involvegrowth factor signaling within glial and vascular niches (Nilssonet al., 1999; Teramoto et al., 2003; Ohab et al., 2006; Hagg, 2007;Puche and Baker, 2007) poststroke neurogenesis requires addi-tional, likely, cellular signals that are independent of the commonPI3K-AKT-mediated growth factor signaling pathway. In design-ing successful stem cell based therapies it will be important todetermine both the molecular and cellular constituents that sup-port survival and differentiation of stem cell progenies.

ReferencesArvidsson A, Collin T, Kirik D, Kokaia Z, Lindvall O (2002) Neuronal re-

placement from endogenous precursors in the adult brain after stroke.Nat Med 8:963–970.

Backman SA, Stambolic V, Suzuki A, Haight J, Elia A, Pretorius J, Tsao MS,Shannon P, Bolon B, Ivy GO, Mak TW (2001) Deletion of Pten in mousebrain causes seizures, ataxia and defects in soma size resemblingLhermitte-Duclos disease. Nat Genet 29:396 – 403.

Baker H, Cummings DM, Munger SD, Margolis JW, Franzen L, Reed RR,Margolis FL (1999) Targeted deletion of a cyclic nucleotide-gated chan-nel subunit (OCNC1): biochemical and morphological consequences inadult mice. J Neurosci 19:9313–9321.

Bhattacharyya A, Svendsen CN (2003) Human neural stem cells: a new toolfor studying cortical development in Down’s syndrome. Genes Brain Be-hav 2:179 –186.

Brunjes PC (1994) Unilateral naris closure and olfactory system develop-ment. Brain Res Brain Res Rev 19:146 –160.

Bush TG, Savidge TC, Freeman TC, Cox HJ, Campbell EA, Mucke L, JohnsonMH, Sofroniew MV (1998) Fulminant jejuno-ileitis following ablationof enteric glia in adult transgenic mice. Cell 93:189 –201.


Carmichael ST (2005) Rodent models of focal stroke: size, mechanism, andpurpose. NeuroRx 2:396 – 409.

Cecchi GA, Petreanu LT, Alvarez-Buylla A, Magnasco MO (2001) Unsuper-vised learning and adaptation in a model of adult neurogenesis. J ComputNeurosci 11:175–182.

Curtis MA, Kam M, Nannmark U, Anderson MF, Axell MZ, Wikkelso C,Holtås S, van Roon-Mom WM, Bjork-Eriksson T, Nordborg C, Frisen J,Dragunow M, Faull RL, Eriksson PS (2007) Human neuroblasts migrateto the olfactory bulb via a lateral ventricular extension. Science315:1243–1249.

Datta SR, Brunet A, Greenberg ME (1999) Cellular survival: a play in threeAkts. Genes Dev 13:2905–2927.

Doetsch F (2003) The glial identity of neural stem cells. Nat Neurosci6:1127–1134.

Doetsch F, Alvarez-Buylla A (1996) Network of tangential pathways forneuronal migration in adult mammalian brain. Proc Natl Acad Sci U S A93:14895–14900.

Doetsch F, Caille I, Lim DA, García-Verdugo JM, Alvarez-Buylla A (1999)Subventricular zone astrocytes are neural stem cells in the adult mamma-lian brain. Cell 97:703–716.

Dulac C (2005) Molecular architecture of pheromone sensing in mammals.Novartis Found Symp 268:100 –107; discussion 107- 110:167–170.

Emsley JG, Mitchell BD, Kempermann G, Macklis JD (2005) Adult neuro-genesis and repair of the adult CNS with neural progenitors, precursors,and stem cells. Prog Neurobiol 75:321–341.

Enwere E, Shingo T, Gregg C, Fujikawa H, Ohta S, Weiss S (2004) Agingresults in reduced epidermal growth factor receptor signaling, diminishedolfactory neurogenesis, and deficits in fine olfactory discrimination.J Neurosci 24:8354 – 8365.

Feng Y, Walsh CA (2001) Protein-protein interactions, cytoskeletal regula-tion and neuronal migration. Nat Rev Neurosci 2:408 – 416.

Fiske BK, Brunjes PC (2001) Cell death in the developing and sensory-deprived rat olfactory bulb. J Comp Neurol 431:311–319.

Fraser MM, Zhu X, Kwon CH, Uhlmann EJ, Gutmann DH, Baker SJ (2004)Pten loss causes hypertrophy and increased proliferation of astrocytes invivo. Cancer Res 64:7773–7779.

Friedrich RW, Laurent G (2001) Dynamic optimization of odor representa-tions by slow temporal patterning of mitral cell activity. Science291:889 – 894.

Funamoto S, Meili R, Lee S, Parry L, Firtel RA (2002) Spatial and temporalregulation of 3-phosphoinositides by PI 3-kinase and PTEN mediateschemotaxis. Cell 109:611– 623.

Garcia AD, Doan NB, Imura T, Bush TG, Sofroniew MV (2004) GFAP-expressing progenitors are the principal source of constitutive neurogen-esis in adult mouse forebrain. Nat Neurosci 7:1233–1241.

Gheusi G, Cremer H, McLean H, Chazal G, Vincent JD, Lledo PM (2000)Importance of newly generated neurons in the adult olfactory bulb forodor discrimination. Proc Natl Acad Sci U S A 97:1823–1828.

Goldman S (2005) Stem and progenitor cell-based therapy of the humancentral nervous system. Nat Biotechnol 23:862– 871.

Goldman SA (1998) Adult neurogenesis: from canaries to the clinic. J Neu-robiol 36:267–286.

Greenberg DA, Jin K (2006) Growth factors and stroke. NeuroRx3:458 – 465.

Groszer M, Erickson R, Scripture-Adams DD, Lesche R, Trumpp A, Zack JA,Kornblum HI, Liu X, Wu H (2001) Negative regulation of neural stem/progenitor cell proliferation by the Pten tumor suppressor gene in vivo.Science 294:2186 –2189.

Groszer M, Erickson R, Scripture-Adams DD, Dougherty JD, Le Belle J, ZackJA, Geschwind DH, Liu X, Kornblum HI, Wu H (2006) PTEN nega-tively regulates neural stem cell self-renewal by modulating G0 –G1 cellcycle entry. Proc Natl Acad Sci U S A 103:111–116.

Hack MA, Saghatelyan A, de Chevigny A, Pfeifer A, Ashery-Padan R, LledoPM, Gotz M (2005) Neuronal fate determinants of adult olfactory bulbneurogenesis. Nat Neurosci 8:865– 872.

Hagg T (2007) Endogenous regulators of adult CNS neurogenesis. CurrPharm Des 13:1829 –1840.

Iijima M, Devreotes P (2002) Tumor suppressor PTEN mediates sensing ofchemoattractant gradients. Cell 109:599 – 610.

Imura T, Kornblum HI, Sofroniew MV (2003) The predominant neuralstem cell isolated from postnatal and adult forebrain but not early embry-onic forebrain expresses GFAP. J Neurosci 23:2824 –2832.

Jain M, Armstrong RJ, Elneil S, Rosser AE, Barker RA (2003) Migration anddifferentiation of transplanted human neural precursor cells. Neurore-port 14:1257–1262.

Jin K, Sun Y, Xie L, Peel A, Mao XO, Batteur S, Greenberg DA (2003) Di-rected migration of neuronal precursors into the ischemic cerebral cortexand striatum. Mol Cell Neurosci 24:171–189.

Kippin TE, Martens DJ, van der Kooy D (2005) p21 loss compromises therelative quiescence of forebrain stem cell proliferation leading to exhaus-tion of their proliferation capacity. Genes Dev 19:756 –767.

Kwon CH, Zhu X, Zhang J, Knoop LL, Tharp R, Smeyne RJ, Eberhart CG,Burger PC, Baker SJ (2001) Pten regulates neuronal soma size: a mousemodel of Lhermitte-Duclos disease. Nat Genet 29:404 – 411.

Lee JO, Yang H, Georgescu MM, Di Cristofano A, Maehama T, Shi Y, DixonJE, Pandolfi P, Pavletich NP (1999) Crystal structure of the PTEN tumorsuppressor: implications for its phosphoinositide phosphatase activityand membrane association. Cell 99:323–334.

Lesche R, Groszer M, Gao J, Wang Y, Messing A, Sun H, Liu X, Wu H (2002)Cre/loxP-mediated inactivation of the murine Pten tumor suppressorgene. Genesis 32:148 –149.

Li J, Simpson L, Takahashi M, Miliaresis C, Myers MP, Tonks N, Parsons R(1998) The PTEN/MMAC1 tumor suppressor induces cell death that isrescued by the AKT/protein kinase B oncogene. Cancer Res58:5667–5672.

Li L, Liu F, Salmonsen RA, Turner TK, Litofsky NS, Di Cristofano A, PandolfiPP, Jones SN, Recht LD, Ross AH (2002) PTEN in neural precursor cells:regulation of migration, apoptosis, and proliferation. Mol Cell Neurosci20:21–29.

Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, TsouHC, Peacocke M, Eng C, Parsons R (1997) Germline mutations of thePTEN gene in Cowden disease, an inherited breast and thyroid cancersyndrome. Nat Genet 16:64 – 67.

Liliental J, Moon SY, Lesche R, Mamillapalli R, Li D, Zheng Y, Sun H, Wu H(2000) Genetic deletion of the Pten tumor suppressor gene promotes cellmotility by activation of Rac1 and Cdc42 GTPases. Curr Biol 10:401– 404.

Lindvall O, Kokaia Z (2006) Stem cells for the treatment of neurologicaldisorders. Nature 441:1094 –1096.

Lledo PM, Alonso M, Grubb MS (2006) Adult neurogenesis and functionalplasticity in neuronal circuits. Nat Rev Neurosci 7:179 –193.

Lois C, García-Verdugo JM, Alvarez-Buylla A (1996) Chain migration ofneuronal precursors. Science 271:978 –981.

Luskin MB (1993) Restricted proliferation and migration of postnatallygenerated neurons derived from the forebrain subventricular zone. Neu-ron 11:173–189.

Maehama T, Taylor GS, Dixon JE (2001) PTEN and myotubularin: novelphosphoinositide phosphatases. Annu Rev Biochem 70:247–279.

Marino S, Krimpenfort P, Leung C, van der Korput HA, Trapman J, Cameni-sch I, Berns A, Brandner S (2002) PTEN is essential for cell migrationbut not for fate determination and tumourigenesis in the cerebellum.Development 129:3513–3522.

Mombaerts P, Wang F, Dulac C, Chao SK, Nemes A, Mendelsohn M, Ed-mondson J, Axel R (1996) Visualizing an olfactory sensory map. Cell87:675– 686.

Najbauer J, Leon M (1995) Olfactory experience modulated apoptosis in thedeveloping olfactory bulb. Brain Res 674:245–251.

Nelen MR, van Staveren WC, Peeters EA, Hassel MB, Gorlin RJ, Hamm H,Lindboe CF, Fryns JP, Sijmons RH, Woods DG, Mariman EC, PadbergGW, Kremer H (1997) Germline mutations in the PTEN/MMAC1 genein patients with Cowden disease. Hum Mol Genet 6:1383–1387.

Nilsson M, Perfilieva E, Johansson U, Orwar O, Eriksson PS (1999) En-riched environment increases neurogenesis in the adult rat dentate gyrusand improves spatial memory. J Neurobiol 39:569 –578.

Ohab JJ, Fleming S, Blesch A, Carmichael ST (2006) A neurovascular nichefor neurogenesis after stroke. J Neurosci 26:13007–13016.

Parent JM (2002) The role of seizure-induced neurogenesis in epileptogen-esis and brain repair. Epilepsy Res 50:179 –189.

Peterson DA (2002) Stem cells in brain plasticity and repair. Curr OpinPharmacol 2:34 – 42.

Petreanu L, Alvarez-Buylla A (2002) Maturation and death of adult-bornolfactory bulb granule neurons: role of olfaction. J Neurosci22:6106 – 6113.

Pomeroy SL, LaMantia AS, Purves D (1990) Postnatal construction of neu-ral circuitry in the mouse olfactory bulb. J Neurosci 10:1952–1966.


Puche AC, Baker H (2007) Olfactory cell derivation and migration. J MolHistol 38:513–515.

Raftopoulou M, Etienne-Manneville S, Self A, Nicholls S, Hall A (2004)Regulation of cell migration by the C2 domain of the tumor suppressorPTEN. Science 303:1179 –1181.

Rochefort C, Gheusi G, Vincent JD, Lledo PM (2002) Enriched odor expo-sure increases the number of newborn neurons in the adult olfactory bulband improves odor memory. J Neurosci 22:2679 –2689.

Rosselli-Austin L, Williams J (1990) Enriched neonatal odor exposure leadsto increased numbers of olfactory bulb mitral and granule cells. Brain ResDev Brain Res 51:135–137.

Seaberg RM, Smukler SR, van der Kooy D (2005) Intrinsic differences dis-tinguish transiently neurogenic progenitors from neural stem cells in theearly postnatal brain. Dev Biol 278:71– 85.

Shors TJ, Miesegaes G, Beylin A, Zhao M, Rydel T, Gould E (2001) Neuro-genesis in the adult is involved in the formation of trace memories. Nature410:372–376.

Soriano P (1999) Generalized lacZ expression with the ROSA26 Cre re-porter strain. Nat Genet 21:70 –71.

Stiles B, Groszer M, Wang S, Jiao J, Wu H (2004) PTENless means more.Dev Biol 273:175–184.

Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM (1998)Inhibition of cell migration, spreading, and focal adhesions by tumorsuppressor PTEN. Science 280:1614 –1617.

Teramoto T, Qiu J, Plumier JC, Moskowitz MA (2003) EGF amplifies the

replacement of parvalbumin-expressing striatal interneurons after isch-emia. J Clin Invest 111:1125–1132.

Trinh K, Storm DR (2004) Detection of odorants through the main olfac-tory epithelium and vomeronasal organ of mice. Nutr Rev 62:S189 –192;discussion S224 –141.

Tsai PT, Ohab JJ, Kertesz N, Groszer M, Matter C, Gao J, Liu X, Wu H,Carmichael ST (2006) A critical role of erythropoietin receptor in neu-rogenesis and post-stroke recovery. J Neurosci 26:1269 –1274.

Vivanco I, Sawyers CL (2002) The phosphatidylinositol 3-Kinase AKTpathway in human cancer. Nat Rev Cancer 2:489 –501.

Winner B, Cooper-Kuhn CM, Aigner R, Winkler J, Kuhn HG (2002) Long-term survival and cell death of newly generated neurons in the adult ratolfactory bulb. Eur J Neurosci 16:1681–1689.

Yamashita T, Ninomiya M, Hernandez Acosta P, García-Verdugo JM, Suna-bori T, Sakaguchi M, Adachi K, Kojima T, Hirota Y, Kawase T, Araki N,Abe K, Okano H, Sawamoto K (2006) Subventricular zone-derived neu-roblasts migrate and differentiate into mature neurons in the post-strokeadult striatum. J Neurosci 26:6627– 6636.

Yokoi M, Mori K, Nakanishi S (1995) Refinement of odor molecule tuningby dendrodendritic synaptic inhibition in the olfactory bulb. Proc NatlAcad Sci U S A 92:3371–3375.

Yoon H, Enquist LW, Dulac C (2005) Olfactory inputs to hypothalamicneurons controlling reproduction and fertility. Cell 123:669 – 682.

Yue Q, Groszer M, Gil JS, Berk AJ, Messing A, Wu H, Liu X (2005) PTENdeletion in Bergmann glia leads to premature differentiation and affectslaminar organization. Development 132:3281–3291.


Health & Medicine

Pten Deletion in Adult Neural Stem/Progenitor Cells Enhances Constitutive Neurogenesis