The Lymphotoxin Pathway Regulates Aire-IndependentExpression of Ectopic Genes and Chemokines in ThymicStromal Cells1

Natalie Seach,2* Tomoo Ueno,2* Anne L. Fletcher,* Tamara Lowen,* Monika Mattesich,3†

Christian R. Engwerda,§ Hamish S. Scott,4‡ Carl F. Ware,¶ Ann P. Chidgey,*Daniel H. D. Gray,5� and Richard L. Boyd5,6*

Medullary thymic epithelial cells (mTEC) play an important and unique role in central tolerance, expressing tissue-restricted Ags(TRA) which delete thymocytes autoreactive to peripheral organs. Since deficiencies in this cell type or activity can lead todevastating autoimmune diseases, it is important to understand the factors which regulate mTEC differentiation and function.Lymphotoxin (LT) ligands and the LT�R have been recently shown to be important regulators of mTEC biology; however, theprecise role of this pathway in the thymus is not clear. In this study, we have investigated the impact of this signaling pathway ingreater detail, focusing not only on mTEC but also on other thymic stromal cell subsets. LT�R expression was found in all TECsubsets, but the highest levels were detected in MTS-15� thymic fibroblasts. Rather than directing the expression of the autoim-mune regulator Aire in mTEC, we found LT�R signals were important for TRA expression in a distinct population of mTECcharacterized by low levels of MHC class II (mTEClow), as well as maintenance of MTS-15� fibroblasts. In addition, thymicstromal cell subsets from LT-deficient mice exhibit defects in chemokine production similar to that found in peripheral lymphoidorgans of Lta�/� and Ltbr�/� mice. Thus, we propose a broader role for LT�1�2-LT�R signaling in the maintenance of the thymicmicroenvironments, specifically by regulating TRA and chemokine expression in mTEClow for efficient induction of centraltolerance. The Journal of Immunology, 2008, 180: 5384–5392.

T hymic stromal cells (TSC)7 provide chemokines, cyto-kines, and cell surface molecules essential for the differ-entiation of thymocytes. The stroma is composed of thy-

mic epithelial cells (TEC), dendritic cells (DC), fibroblasts,macrophages, and endothelial cells that provide distinct signalsgoverning thymopoiesis (1). Medullary TEC play a unique role incentral tolerance, ectopically expressing a vast range of tissue-

restricted Ag (TRA) that mediate deletion of thymocytes whichpose a danger to peripheral organs and tissues (2). About one-thirdof TRA expression by mTEC is controlled by the transcriptionalregulator Aire and it has been proposed that other “Aire-like” fac-tors exist which promote expression of Aire-independent TRA (3,4). The importance of TRA expression to T cell central toleranceis exemplified by the disease autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). This multiorgan au-toimmune disease is caused by deficiency of the transcriptionalregulator AIRE in humans and Aire in mouse models of the dis-ease (5). Importantly, loss of a single TRA gene, even in the pres-ence of functional Aire, is sufficient to break central tolerance andcause targeted autoimmunity (6).

TRA expression and Ag presentation are regulated duringmTEC differentiation. These functions are reduced in mTEC ex-pressing low levels of CD80 and MHC class II (MHCII) molecules(mTEClow) compared with the more mature, Aire-expressingCD80highMHCIIhighmTEC subset (mTEChigh) (4, 7, 8). Given theessential role of mTEC in central tolerance, it is important to un-derstand factors that govern their differentiation.

The TNF-related cytokines, lymphotoxin (LT) � and LT�, andthe LT�R have been recently shown to influence mTEC differen-tiation (9, 10). LT� can form a soluble homotrimer, LT�3, whichbinds to TNFR1 and TNFR2 as well as the herpesvirus entry me-diator. However, it is the membrane-bound heterotrimer LT�1�2

*Monash Immunology and Stem Cell Laboratories, Monash University, Clayton,Australia; †Bernard O’Brien Institute of Microsurgery, Fitzroy; ‡Division of Molec-ular Medicine, Walter and Eliza Hall Institute of Medical Research, Parkville, Vic-toria, Australia; §Queensland Institute of Medical Research, Herston, Queensland,Australia; ¶Division of Molecular Immunology, La Jolla Institute for Allergy andImmunology, San Diego, CA 92037; and �Joslin Diabetes Center, Boston, MA 02215

Received for publication November 6, 2007. Accepted for publication February12, 2008.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by grants from the Australian National Health and MedicalResearch Council and funding from Norwood Immunology Ltd. and the AustralianStem Cell Centre (to R.L.B.). D.H.D.G. was supported by a National Health andMedical Research Council C. J. Martin Overseas Training Fellowship. H.S.S. wassupported by National Health and Medical Research Council Fellowships 171601 and461204, National Health and Medical Research Council Program Grants 257501 and264573, and Eurothymaide, 6th Framework Programme of the European Union.2 N.S. and T.U. contributed equally to this work.3 Current address: Department of Plastic and Reconstructive Surgery, Innsbruck Med-ical University Anichstrasse, 35 A- 6020 Innsbruck, Austria.4 Current address: Division of Molecular Pathology, Institute of Medical and Veter-inary Science and anson Institute, Box 14 Rundle Mall Post Office, Adelaide, SouthAustralia 5000, Australia.5 D.H.D.G. and R.L.B. share senior authorship.6 Address correspondence and reprint requests to Dr. Richard Boyd, Monash Immu-nology and Stem Cell Centre, Monash University, Wellington Road, Clayton, Vic-toria, Australia 3800. E-mail address: richard.boyd@med.monash.edu.au

7 Abbreviations used in this paper: TSC, thymic stromal cell; Aire, autoimmune reg-ulator; DC, dendritic cell; TRA, tissue-restricted Ag; LT, lymphotoxin; TEC, thymicepithelial cell; cTEC, cortical TEC; mTEC, medullary TEC; MHCII, MHC class II;wt, wild type; UEA-1, Ulex europeaus agglutinin 1; EpCAM, epithelial cell adhesionmolecule; PDGFR�, platelet-derived growth factor receptor �; FGF, fibroblastgrowth factor; LTBR-ag, LTBR agonist.

Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00

The Journal of Immunology

www.jimmunol.org

and LT-related inducible ligand that competes for glycoprotein Dbinding to herpesvirus entry mediator on T cells (LIGHT), whichsignal exclusively through the LT�R (11). LT�R signals activateNF-�B-dependent production of chemokines and cytokines criti-cally involved in the organogenesis and development of peripherallymphoid organs (12). In lymph nodes and Peyer’s patches, theLT�1�2-LT�R axis regulates cross-talk between the hemopoieticand stromal compartment that is necessary for their developmentand maintenance of proper architecture (13).

Both Lta�/� and Ltbr�/� mice exhibit autoimmunity character-ized by lymphocytic infiltration of organs and production of au-toantibodies to several tissues (9, 10). Importantly, autoimmunity(albeit mild) was transferred upon engraftment of Ltbr�/� thymicstroma into thymectomized recipients, indicating a level of stro-mal-dependent defect in central tolerance (14). The precise role ofLT�R signaling in the thymus, however, remains unclear.

Early studies using Lta�/� and Ltbr�/� mice indicated signalingthrough LT�R directly regulated Aire expression and Aire-depen-dent TRA transcription in mTEC (10). In contrast, a similar studyof Ltbr�/� mice indicated no change in mTEC-dependent Aire orTRA transcription on a per cell basis, but perturbed mTEC orga-nization and differentiation (9). In support of this finding, morerecent reports demonstrated that the expression and function ofAire in mTEC was unaffected in the absence of LT�R signaling(15, 16). Thus, the emerging consensus is that LT�R signaling isrequired for proper organization and differentiation of mTEC;however, the mechanism by which LT�R regulates these effectsremains undefined.

Previous studies predominantly focused on the influence of LTsignals on the mTEChighAire� subset of TSC. Given the impor-tance of interplay among thymic cell types for negative selection,we sought to clarify and extend these data, analyzing the influenceof the LT pathway on this and other TSC subsets. We find thatalthough LT�R signaling was not required for differentiation ofAire-expressing mTEChigh, it was important for expression ofAire-independent TRA and Ulex europeaus agglutinin 1 (UEA-1)binding in mTEClow, as well as the maintenance of normal num-bers of MTS-15� fibroblasts. Importantly, TSC populations ofLta�/� and Ltb�/� mice exhibit a previously unreported defi-ciency in chemokine production, which was restored upon treat-ment with LT�R agonist Abs. These data refine and extend the roleof the LT�R pathway in the thymus to the maintenance of certainTSC subsets and regulation of key molecules involved in TSCorganization and function.

Materials and MethodsMice

Lta�/� and Ltb�/� mice were generated and maintained on a C57BL/6background as previously described (17, 18). Mice were housed at theDepartment of Biochemistry Animal Facility (Monash University, Clayton,Victoria, Australia) according to institutional guidelines. All mice used inthis study were between 4 and 6 mo of age, unless otherwise stated.

Animal treatments

Mice were injected i.p. with 100 �g of LT�R-agonist Ab (4H8) or anisotype control in sterile PBS. Mice were either injected once or daily for3 consecutive days. Thymus and spleen were harvested 8 h or 3 daysfollowing the first injection.

Abs and immunoconjugates

The following Abs used in this study were purchased from BD Pharmin-gen, unless otherwise stated: MTS-10 (19) and MTS-15 (20) were grownin our laboratory, anti-epithelial cell adhesion molecule (EpCAM, cloneG8.8a; a gift from Dr. A. Farr, Department of Biological Structure, Uni-versity of Washington, Seattle, WA), anti-Aire (clone 5H12-2), anti-LT�R (clone 4H8), IgG2a isotype control (clone RTK2758; BioLegend),

pan-cytokeratin (DakoCytomation), anti-Ly51 (clone 6C3), anti-I-A/I-E(clone M5/114.15.2), anti-CD80 (clone 16-10A1), anti-CD86 (clone GL1),anti-CD40 (clone 3/23), anti-H2-Db (clone KH95), anti-CD45 (clone 30-F11), anti-CD31 (clone MEC13.3), anti-CD8� (clone 53-6.7), anti-CD4(clone GK1.5), anti-TCR� (clone H57-597), and anti-Ki67 (clone B56).The lectin Ulex europaeus agglutinin 1 (UEA-1) was purchased from Vec-tor Laboratories. Secondary reagents were streptavidin-allophycocyanin(BD Pharmingen), streptavidin-Alexa Fluor 488, anti-rat Ig Alexa Fluor488, anti-rat Ig Alexa Fluor 568, anti-rabbit Ig Alexa Fluor 647 (all fromMolecular Probes), and anti-rat IgG2cFITC (Southern BiotechnologyAssociates).

Immunohistology

Thymic tissue was dissected and cleaned to remove excess fat and con-nective tissue. Thymic lobes were suspended in Tissue-Tek OCT com-pound (Sakura Finetek) and snap frozen in a liquid nitrogen and isopentaneslurry. Sections of 8–10 �m were cut on a Leica CM1850 cryostat and leftto air dry at 4°C for 30 min. Primary Abs were added to sections and slideswere incubated at room temperature for 15 min, then washed in PBS for 5min. Secondary Abs were then applied to slides, which were incubated for15 min, washed, and then mounted with a coverslip using fluorescentmounting medium (DakoCytomation). Images were acquired on a Bio-RadMRC 1024 confocal microscope and analyzed using LaserSharp2000 soft-ware (Bio-Rad).

TSC isolation by enzymatic digestion

Individual thymic digestion. Digestion of individual thymi was per-formed as previously described in the study of Gray et al. (21). Briefly,thymi were digested in collagenase/DNase, then collagenase/Dispase/DNase (Roche) and resulting suspensions were passed through 100-�mmesh to remove debris. Excluding the first thymocyte wash, all fractionsfrom each thymus were pooled and counted using a Z2 Coulter Counter(Beckman Coulter). For flow cytometric analysis, 5 � 106 cells from eachindividual thymus were stained with appropriate Abs.Pooled thymic digestion. Enzymatic digestion was performed as previ-ously described (21) on pools of 6–10 thymi per group. Final digestionswere incubated with anti-CD45 microbeads (Miltenyi Biotec) according tothe manufacturer’s protocols. This suspension was run on an AutoMACS(Miltenyi Biotec) to deplete CD45� cells. CD45� cells were rerun usingthe same program to recover any remaining unlabeled cells. Depleted cells(CD45�) were pooled and recovered by centrifugation.

Flow cytometry

Immunofluorescent staining was performed as previously reported (20).Sample data from 1 � 104 CD45� cells were acquired on a FACSCalibur(BD Biosciences) using up to four fluorescent channels and analyzed usingCellQuest software (BD Biosciences). Statistical analysis was performedwith SPSS version 15.0 software using the Mann-Whitney U test.

FACS

TSC depleted of CD45� cells were stained with appropriate immunoflu-orescent markers in FACS/EDTA (5 mM EDTA in PBS with 2% FCS and0.02% NaN3) and sorted on a FACSVantage cell sorter (BD Biosciences)at no more than 3 � 103 cells per second. Samples were collected in 30%(v/v) FCS in RPMI 1640, recovered by centrifugation, counted, and ana-lyzed for purity. Populations were sorted to �95% purity.

RNA preparation and cDNA synthesis

Total RNA was isolated from sorted TSC or whole tissues using TRI re-agent (Molecular Research Center) and 1-bromo-3-chloropropane phaseseparation reagent (Molecular Research Center) according to the manufac-turer’s instructions. RNA was reverse transcribed using Superscript III (In-vitrogen Life Technologies) and oligo(dT) oligonucleotides (InvitrogenLife Technologies) according to the manufacturer’s protocol.

Real-time PCR

Quantitative PCR was performed on a Corbett Rotor-Gene 3000 (CorbettResearch) in 10-�l reactions using SYBR Green Supermix (Invitrogen LifeTechnologies) with appropriate primers (200 nM). After initial holds for 2min at 50°C, then 10 min at 95°C, PCR was performed with 40 cycles of95°C for 15 s and 60°C for 60 s. Target transcript levels relative to thoseof GAPDH were determined using the 2��Ct method. Analysis of relativegene expression was performed using real-time quantitative PCR and the2��Ct method (22). Refer to Table I for primer sequences used.

5385The Journal of Immunology

ResultsBroad expression of LT�R on TSC subsets

In peripheral lymphoid organs, LT�R is expressed exclusively bystromal cells and transduces signals from both LT�1�2 andLIGHT produced by hemopoietic cells (23). Although a previousstudy showed thymic expression of LT�R by in situ hybridization,the stromal defects reported in LT-deficient mice prompted moreprecise analysis (24). Analysis of thymic sections stained with Absto LT�R revealed low level expression by reticular stromal cellsthroughout the thymus (Fig. 1A). Flow cytometric analysis re-vealed LT�R expression on CD45�MHCII� TEC and higher lev-els on CD45�MHCII� nonepithelial cells (non-TEC), as indicatedby the increased ratio of LT�R to isotype median expression levels(Fig. 1B).

To more precisely analyze the distribution of LT signaling com-ponents, thymic stromal and thymocyte subsets were FACS puri-fied using defined markers (see Table II) and transcription ofLT�R, LT�, LT�, and LIGHT was assessed by real-time PCR. Fig.1C illustrates that significant levels of LT�R transcription werefound in all TEC subsets, with slightly higher levels in corticalTEC (cTEC) and mTEClow. The high levels of LT�R transcriptionby CD45�MHCII� non-TEC, which has been shown to consistpredominantly of fibroblasts and endothelium (20), supported theflow cytometry data and were predominantly derived from MTS-15� fibroblasts. LT�R transcription was low in DC and undetect-able in thymocytes. Consistent with a previous study (9), LTtranscripts were found predominantly on CD4� and CD8� single-positive (SP) thymocytes. In addition, we found high expressionlevels of LT� and the majority of transcript for LIGHT in stromalsubsets, suggesting that LT�R ligands are also derived from TSCsubsets, not just mature thymocytes. Together, these data extendthe expression profile of LT�R to all major TEC subsets and fi-

broblasts and reveal distinct thymocyte and stromal-derivedligands.

Thymic stromal phenotype in LT-deficient mice

The broad expression of LT�R and its ligands extends on previousstudies and prompted a re-examination of the consequence of LTdeficiency on specific TSC subsets. The architecture and compo-sition of thymi from adult Lta�/� and Ltb�/� mice were comparedwith age-matched controls by immunohistochemistry (Fig. 2). Thelectin UEA-1 recognizes a carbohydrate epitope highly expressedon a subset of mTEC by histology and with which Aire is asso-ciated (25). It should be noted that although histological observa-tions indicated that UEA-1 bound only a minor fraction of mTEC(26), flow cytometric studies reveal that UEA-1 binds to essen-tially all mTEC in normal young mice, perhaps due to the height-ened sensitivity of flow cytometry, epitope masking by histology,or differential surface and intracellular expression (Ref. 20 andpresent study).

By histology, the medullae of Lta�/� and Ltb�/� mice exhibitedsimilar size but had notably reduced UEA-1 staining (Fig. 2A).Previous histological analysis has revealed a loss of Aire expres-sion in thymi from Ltbr�/� and Lta�/� mice, without significantalterations in the differentiation or distribution of UEA-1� med-ullary epithelium (10). In contrast, Boehm et al. (9) demonstratedthat signaling through the LT�R was needed for both optimalnumbers and organization of UEA-1� mTEC, a finding supportedrecently by Venanzi et al. (16). Although the thymic medullarydefects observed in mice deficient for LT� and LT� ligands appearto be generally less severe than in mice deficient for the LT�R (9,16), a loss of homogenous UEA-1 distribution has been observedwithin the medullary regions of Ltb�/� mice (9). In line with re-cent reports (15, 16), we found that Aire protein expression was

Table I. Primer sequences

Gene Forward (5�–3�) Reverse (5�–3�)

Lta GCTTGGCACCCCTCCTGTC GATGCCATGGGTCAAGTGCTLtb CCAGCTGCGGATTCTACACCA AGCCCTTGCCCACTCATCCLtbr CCAGATGTGAGATCCAGGGC GACCAGCGACAGCAGGATGTnfsf14 (LIGHT) CAGGCCCCTACAGACAACAC ACTCGTCTCCCACAAGGAACTAire GGTTCTGTTGGACTCTGCCCTG TGTGCCACGACGGAGGTGAGCsna TTTGCTATGCCCAGACTTCA TTTCCTCACTGCTGCTATGCCsng TCTGGCAAAGCACGAAATAAAGG AGTTGTTTGGAAGAACACGCTAIns2 GACCCACAAGTGGCACAA ATCTACAATGCCACGCTTCTGSpt1 GTGTTGCTTGGTGTTTCCAC GCAGAATCAGCAGTTCCAGACsnb GGCACAGGTTGTTCAGGCTT AAGGAAGGGTGCTACTTGCTGCsnk ATTCTGGCATTAACTCTGCCC AAAGATGGCCTGTAGTGGTAGTAGad1 QIAGEN validated primers for quantitative RT-PCR (Cat.No. QT00163527)Fabp9 QIAGEN validated primers for quantitative RT-PCR (Cat.No. QT00115913)Col2 AGAACAGCATCGCCTACCTG CTTGCCCCACTTACCAGTGTCrp QIAGEN validated primers for quantitative RT-PCR (Cat.No. QT00255444)Tgn QIAGEN validated primers for quantitative RT-PCR (Cat.No. QT00116592)K14 QIAGEN validated primers for quantitative RT-PCR (Cat.No. QT00114422)Ccl19 GCTAATGATGCGGAAGACTG ACTCACATCGACTCTCTAGGCcl21 GCAGTGATGGAGGGGGTCAG CGGGGTGAGAACAGGATTGCCcl17 CTGCTCGTTCTGGGGAC TGTTTGTCTTTGGGGTCTGCCcl22 GGTCCCTATGGTGCCAATG TTATCAAAACAACGCCAGGCCcl25 TGAAACTGTGGCTTTTTGCC GTCAAGATTCTCATCGCCCTCCxcl12 GCTCTGCATCAGTGACGGTA TGTCTGTTGTTGTTCTTCAGCCxcl13 GCACAGCAACGCTGCTTCT TCTTTGAACCATTTGGCAGCIl6 TGTATGAACAACGATGATGCACTT ACTCTGGCTTTGTCTTTCTTGTTATCTnfa CATCTTCTCAAAATTCGAGTGACAAGCC TGGGAGTAGACAAGGTACAACCCATCRelb QIAGEN validated primers for quantitative RT-PCR (Cat.No. QT00172578)Fgf7 GCGCAAATGGATACTGACACG GGGCTGGAACAGTTCACACTFgf10 GACCAAGAATGAAGACTGTCCG TACAGTCTTCAGTGAGGATACCGapdh ACCATGTAGTTGAGGTCAATGAAGG GGTGAAGGTCGGTGTGAACG

5386 BROAD IMPACT OF LT SIGNALS ON THE THYMIC STROMA

readily detectable on thymic sections of both Lta�/� and Ltb�/�

mice (Fig. 2B) and, upon higher magnification, appeared to be ofsimilar intensity and localization to controls (Fig. 2C, secondpanel). Therefore, the disruption of UEA-1 distribution was notaccompanied by loss of Aire expression.

Flow cytometry was used to determine the precise effects ofLT� or LT� deficiency on mTEC phenotype, TSC numbers, andAire expression. The total thymic cellularity of LT�- and LT�-deficient mice was similar to controls and thymocyte subsets; triplenegative (TN), double positive (DP), and CD4 and CD8 SP (fourSP and eight SP, respectively) were not different (data not shown).

Within the CD45� TSC compartment, surface staining with theepithelial cell adhesion molecule, EpCAM, defines TEC whilebinding of UEA-1 and Ly-51 distinguishes mTEC and cTEC, re-spectively (20). In control mice, approximately two-thirds of Ep-CAM� TEC bound high levels of the lectin UEA-1 (UEA-1high)(Fig. 3A). Analysis of both Lta�/� and Ltb�/� TEC revealed asignificant drop in the proportion of UEA-1high cells comparedwith wild-type (wt) controls (EpCAM�UEA-1high mean � SD; wt64.1% � 7.92, Lta�/� 31.7% � 6.81, Ltb�/� 25.3% � 6.20; p �0.001), with an increased proportion of TEC-expressing low levels

FIGURE 2. Reduced UEA-1 but not Aire expression in the thymic me-dulla of Lta�/� and Ltb�/� mice. Thymic sections from Lta�/�, Ltb�/�,and control mice were stained for medullary epithelial markers UEA-1 (A;green), Aire (B; red), and merge of UEA-1/Aire and pan epithelial markerkeratin (C; blue), including higher magnification (second row). Images arerepresentative of three to four experiments.

FIGURE 1. Expression of LT�R and its ligands on thymic cell popu-lations. A, Thymic sections from C57BL/6 mice stained with anti-LT�R orisotype control Abs (green). B, Flow cytometric analysis of LT�R expres-sion (solid line) compared with isotype (dashed line), on CD45� stromagated on MHCIIhigh (hi), low (lo), or negative (�) cells, as quantified bythe numerical ratio of LT�R to isotype control median expression levelsfor each gated population. C, PCR of LT�, LT�, LIGHT, and LT�R ex-pression in purified thymic cell populations (see Table II), relative to wholeTSC expression, standardized to 1. Mean and SE were determined fromtwo to three experiments for each population.

Table II. Phenotype of thymic and spleen cell populations

Cell Population Phenotype

Whole TSC CD45�

TEC CD45�EpCAM�MHC II�

Non-TEC CD45�MHCII�

cTEC CD45�MHCII�UEA1�

MHCIIhighmTEChigh CD45� MHCIIhi UEA1�

MHCIIlowmTEClow CD45�MHCIIlowUEA1�

Thymic fibroblasts (MTS-15) CD45� MTS-15�

Thymic endothelium (CD31) CD45�CD31�

Thymic DC (ThyDC) CD11c�MHCII�

Splenic DC (SplDC) CD11c�MHCII�

TN thymocytes CD3� CD4�CD8�

DP thymocytes CD4�CD8�

CD4� SP thymocytes (4 SP) CD3�CD4�CD8�

CD8� SP thymocytes (8 SP) CD3�CD4�CD8�

5387The Journal of Immunology

of UEA-1 (EpCAM�UEA-1low mean � SD; wt 35.3% � 7.28,Lta�/� 67.3% � 6.82, Ltb�/� 74.75 � 6.21; p � 0.001; Fig. 3A).

To determine whether the reduction in UEA-1 staining reflectedloss of this mTEC subset or a change in phenotype, other mTECmarkers were analyzed. Differential expression of MHCII mole-cules highlights further heterogeneity within mTEC and correlateswith differentiation (8). Strikingly, the reduction in UEA-1 bindingobserved in both Lta�/� and Ltb�/� mice was found to occur

specifically within the mTEClow, not mTEChigh subset (Fig. 3B).Despite reduced UEA-1 binding, expression of MHC class I mol-ecules and the costimulatory molecules CD80, CD86, and CD40were unaltered on both mTEChigh and mTEClow subsets (data notshown). Costaining of anti-Ly-51 and UEA-1 to define cTEC andmTEC compartments showed they were present in equivalent pro-portions and number in wt, Lta�/� and Ltb�/� mice (Fig. 3, C andF), despite the drop in UEA-1 intensity within the mTEC popula-tion of LT-deficient mice (Fig. 3C). Consistent with a recent report(16), Aire expression was also normal in Lta�/� and Ltb�/�

mTEC in terms of staining intensity and cell number (Fig. 3, D andF). In addition, Aire� mTEC in Lta�/� and Ltb�/� mice remainedUEA-1high, consistent with the reduction of UEA-1 staining spe-cifically in the Aire�mTEClow subset observed by FACS (Fig.3D). Although some Aire� cells appeared to be UEA-1� by his-tology in wt and LT�/� thymic sections, this is likely to reflect insitu epitope masking, differences in the subcellular localizationbetween Aire and UEA-1 and/or the sensitivity of FACS and im-munohistology. The high expression of LT�R by non-TECprompted a detailed analysis of this subset in Lta�/� and Ltb�/�

mice. Thymic fibroblasts can be distinguished by expression of the� variant of the platelet-derived growth factor receptor �(PDGFR�) (27) and a subset therein by the Forssman glycolipidrecognized by the MTS-15 Ab (28). Interestingly, CD45�MTS-15� thymic fibroblasts were dramatically reduced in both propor-tion and number in Lta�/� and Ltb�/� mice (Fig. 3, E and F),while CD45�PDGFR��MTS15� cells were not obviously af-fected. This suggests that, in accordance with the high levels ofLT�R transcript found in MTS-15� cells, LT�R signals are criticalfor expansion and/or maintenance of this population. CD31� en-dothelium, which is closely associated with surrounding MTS-15�

regions, did not show this dependence (data not shown). In sum-mary, both LT�- and LT�-deficient mice exhibited a more com-plex phenotype than previously appreciated, characterized by re-duced levels of UEA-1 binding specifically on Aire�mTEClow

cells and severe loss of MTS-15� fibroblasts.

Reduced transcription of TRA independent of Aire inLT-deficient� TEC

In view of the broader TSC defects observed in LT-deficient mice,we undertook an assessment of TRA expression in all major TECsubsets, not just the mTEChigh explored in previous studies (9, 16).We first established the relative expression of a panel of Aire-dependent and Aire-independent TRA as defined previously (3, 4,14) within TEC subsets of wt mice. Consistent with previous re-ports (4), mTEChigh cells from control mice were the predominantsource of Aire and the Aire-dependent TRA transcripts casein �(Csna), casein � (Csng), insulin 2 (Ins2), and salivary protein 1(Sp1) (Fig. 4B). The Aire-independent TRA transcripts casein �(Csnb), casein � (Csnk), glutamic acid decarboxylase 1 (GAD1),fatty acid-binding protein 9 (Fabp9; note, partial Aire dependencyreported) (3), and thyroglobulin (Tgn) were also highly expressedin mTEChigh cells, while collagen type 2 (Col2) and C-reactiveprotein (CRP) were higher in the mTEClow subset. Relative TRAexpression in cTEC was very low. Transcription of K14, a markerfor mTEC subsets by histology (26), was almost 3-fold higher inmTEClow than mTEChigh (Fig. 4B), indicating marked differentialexpression of this molecule between these subsets.

Consistent with the flow cytometric analyses, similar levels ofAire transcript were found in mTEChigh from wt, Lta�/� (Fig. 4C),and Ltb�/� (Fig. 4E) mice. Interestingly there was slightly de-creased expression of Aire-dependent TRA in mTEChigh fromLta�/� and Ltb�/� mice, with transcripts between 40 and 60% ofnormal levels (Fig. 4, C and E). A similar trend was observed for

FIGURE 3. Flow cytometric analysis of TSC subsets in Lta�/� andLtb�/� mice. A, UEA-1 expression on CD45�, EpCAM� TEC withregions gating UEA-1high and UEA-1low subsets. B, UEA-1 expression onCD45�MHCII� TEC with regions gating MHChighUEA-1high and MHClow

UEA-1high TEC subsets. C, Expression of Ly-51 and UEA-1 positivelyidentify cTEC and mTEC populations, respectively, on CD45�EpCAM�

TEC. D, UEA-1 and Aire expression on CD45�EpCAM� TEC with re-gions gating UEA1highAire� and UEA1highAire� populations. E, Regionsshow MTS-15�PDGFR�� and MTS15�PDGFR�� thymic fibroblast pop-ulations, gated on CD45� TSC. Dot plots are representative of 6–10 in-dividual thymic digests. F, Enumeration of TSC populations, defined inTable II, in Lta�/�, Ltb�/� and control mice. Mean and SE were generatedfrom two experiments each using five individual thymus digestions pergroup. �, p � 0.05.

5388 BROAD IMPACT OF LT SIGNALS ON THE THYMIC STROMA

some Aire-independent TRA in Lta�/�and Ltb�/� mTEChigh. Itwas the mTEClow population of Lta�/�and Ltb�/� mice, however,that was most severely compromised in its ability to produce TRAtranscripts compared with wt levels; Csnb, Csnk, and Fabp9 were�2-fold reduced, while Col2 and CRP were reduced 7- and 33-fold in Lta�/� mice and 5-fold and 13-fold in Ltb�/� mice, re-spectively (Fig. 4, D and F). Despite these differences, K14 tran-scription was normal in Lta�/� mTEClow.

Thus, extensive analysis of mTEC subsets revealed that LT�and LT� signals were not required for the expression of Aire, butwere critical for normal expression of Aire-independent TRAwithin the Aire�mTEClow population.

LT deficiency disrupts chemokine and cytokine expressionof TSC

In secondary lymphoid tissues, LT�1�2- LT�R signaling regu-lates the expression of the lymphoid-organizing chemokinesCCL19/ELC (EBL-1 ligand chemokine), CCL21/SLC (secondarylymphoid tissue chemokine), CXCL12/SDF1 (stromal cell-derivedfactor 1), and CXCR13/BLC (B lymphocyte chemokine) by lym-phoid stromal cells (11). In light of the thymic architecture defectsobserved in LT-deficient mice, we hypothesized that the LT�Rpathway may similarly regulate chemokine expression and orga-nization of the thymic stroma. The chemokines CCL19 and CCL21are important for proper organization and development of the thy-mic medulla (29). Fig. 5 shows that mTEChigh and mTEClow sub-sets from Lta�/� mice had reduced CCL19 transcripts comparedwith wt controls (2- and 7-fold decreases, respectively), while ex-pression of CCL21 and other CC chemokines was normal. Otherchanges included an approximate 3-fold reduction in the LT� tran-script in both Lta�/� mTEChigh and mTEClow subsets. Analysis ofLtb�/�mTEChigh and mTEClow subsets recapitulated the findingsin Lta�/� TEC subsets, with a reduction in expression of CCL19but not other CC chemokines (Fig. 5, E and F). Interestingly,Lta�/� mice demonstrated an 5- to 6-fold increase in the IL-6transcript, an indicator of thymic injury in other models (28), incTEC, mTEClow, and non-TEC subsets (Fig. 5, B–D). This was notfound in Ltb�/� TSC subsets, suggesting that disruption of alter-nate LT� signaling pathways, such as LT�3-TNFR as opposed toLT�1�2- LT�R, underlies this defect.

FIGURE 5. Chemokine and cytokine expression in Lta�/� and Ltb�/�

TSC populations. PCR analysis of chemokine and cytokine transcription inLta�/� mTEChigh (A), Lta�/� cTEC (B), Lta�/� mTEClow (C), Lta�/�

non-TEC (D), Ltb�/� mTEChigh (E), and Ltb�/� mTEClow (F). Transcriptlevels are shown relative to age-matched wt coda standardized to 1 (dashedline). Means and SE were generated from three to four different experi-ments for each populations.

FIGURE 4. TRA expression in Lta�/�

and Ltb�/� TEC subsets. A, Dot plots gatedon CD45�MHCII� TEC showing regionsused for sorting of mTEChigh, mTEClow, andcTEC populations for control and Lta�/�

mice. B, PCR analysis of: Aire, casein �(Csn�), casein � (Csng), insulin 2 (Ins2),salivary protein 1 (Sp1), casein � (Csn �),casein � (Csnk), glutamic acid decarboxyl-ase 1 (GAD1), fatty acid-binding protein 9(Fabp9), type 2 collagen (Col2), C-reactiveprotein (CRP), thyroglobulin (Tgn), and ker-atin 14 (K14) in control TEC subsets, rela-tive to highest expression level, standardizedto 1. C–F, PCR analysis of TRA expression inLta�/� mTEChigh (C), Lta�/� mTEClow (D),Ltb�/� mTEChigh (E), and Ltb�/� mTEClow

(F). Fold change in transcript levels areshown relative to age-matched controls,standardized to 1 (dashed line). Means andSE generated were from three to four exper-iments for each population.

5389The Journal of Immunology

LT�R agonist treatment corrects defects in mTEClow in Lta�/�

mice

To confirm the defects in LT-deficient mTEC were primarily dueto lack of LT�R signaling, Lta�/� mice were injected with an Abagonist for the LT�R (LT�R-ag) or an isotype control Ab. Med-ullary TEC subsets were analyzed 8 h after LT�R-ag treatment fornormalization of phenotype and TRA and chemokine expression.The activity of LT�R-ag was confirmed by analysis of wholespleen, revealing greater than 2-fold increases in several chemo-kines as previously reported (12) (Fig. 6A). Fig. 6B demonstratesthat transcription of all genes analyzed in Lta�/� mTEChigh cellsremained unchanged 8 h after LT�R-ag treatment, including Aire,Aire-dependent, and -independent TRA and chemokines. In con-trast, the Lta�/� mTEClow subset demonstrated increased expres-sion of most genes normally depressed, including 4-fold up-regu-lation of CCL19 and increased transcription of Aire-independentTRA: Csnb, Csnk, Fabp9, Col2, and CRP (Fig. 6C). CCL21, whichwas not depressed in TSC from Lta�/� or Ltb�/� mice, was alsoincreased 2-fold after LT�R-ag treatment in mTEClow fromLta�/� mice. Interestingly, the increased gene transcription inLta�/� mTEClow following LT�R ligation was accompanied bypartial restoration of UEA-1high binding levels within this subsetcompared with Lta�/� mice treated with isotype control Ab (iso-type-Ig). Further LT�R-ag treatment (three times daily injections)increased the percentage of UEAhigh cells specifically within theLta�/� mTEClow population, while UEA-1 intensity on the Lta�/�

mTEChigh population remained unchanged (Fig. 6D and data not

shown). Together, these data show that the compromised mTEClow

compartment in Lta�/� mice is a primary defect that can be re-stored by LT�R stimulation.

DiscussionThe thymic medulla is critical for the comprehensive induction ofcentral tolerance (30). Autoimmunity observed with deficiencies inthe CCR7-CCR7L chemokine (31) and LT�R pathways (9, 14)have emphasized this importance; however, in the case of the lat-ter, the underlying reasons for defective central tolerance are notclear. In this study, we demonstrate that rather than specificallyeffecting the Aire� mTEC population, the LT pathway is necessaryfor the normal activity and organization of mTEClow and MTS-15� fibroblast subsets. Importantly, LT�R stimulation regulatesthe expression of chemokines critical for the migration of thymo-cytes to medullary regions and many Aire-independent TRA ex-pressed by mTEClow.

Medullary TEC govern the maturation and negative selection ofthymocytes and are composed of phenotypically distinct subsetsspecialized to perform their unique function. Our data indicate thatall mTEC in normal mice show high levels of UEA-1 staining byflow cytometry, but the reduced labeling observed in Lta�/� orLtb�/� mice was due to a specific decrease within the mTEClow,not mTEChigh subset. Recent reports have shown that mTEClow

can give rise to mTEChigh (8, 15); however, despite the defects weobserved in Lta�/� and Ltb�/� mTEClow, their differentiation intothe mTEChighAire�-expressing subset was not apparently im-peded. In addition, there was no numerical deficiency in any TECpopulation including the Aire-expressing mTEChigh subset. Twoseparate reports, however, have shown a loss of mTEChigh in theLtbr�/� mouse model (9, 16). Thus, it seems that LT�R signalscontribute to maintenance of optimal mTEC numbers, but ligandsother than LT�- or LT�-containing molecules can provide suffi-cient stimuli for this function. For example, LIGHT expression byTSC observed in this study may fulfill this role.

Conversely, lack of LT� and LT� caused a mild reduction insome Aire-dependent and -independent TRA in mTEChigh and asevere decrease in TRA expression in mTEClow. The TRA phe-notype we observed in mTEChigh contrasts with two earlier studiesthat found similar TRA transcripts in mTEChigh from Ltbr�/� andLta�/� mice using gene microarray (16) or in mTEChigh fromLtbr�/� mice using end-point PCR (9). This discrepancy may re-flect the greater sensitivity of quantitative PCR used in our studyand/or differences in animal age (4–8 wk compared with 4–6 moin our study). Importantly, we show that the impairment of TRAproduction was much greater in the mTEClow subset, particularlyfor CRP and Col2, which were markedly decreased. This is note-worthy because mTEClow are a major source of CRP and Col2 innormal mice, and reduced central tolerance to Col2 has been re-vealed by an increased susceptibility to collagen-induced arthritis(14). This suggests that the mTEClow subset may play a moresignificant role in the negative selection of autoreactive thymo-cytes then previously appreciated (7), be it via direct contact withthymocytes or the provision of Ag to DC, which process and cross-present TRA peptides to delete self-reactive thymocytes (25, 32).In this way, LT�- or LT�-mediated TRA expression in mTEClow

might buffer negative selection and indeed be essential for toler-ance in certain models.

Our data reveal a function for LT� and LT� signals in regulat-ing the expression of the tissue-organizing chemokine CCL19 inthe thymus, in a fashion similar to that observed in peripherallymphoid stroma. Reduced expression of both CCL19 and CCL21in the spleen of Lta�/� and Ltb�/� mice caused disruption of the

FIGURE 6. Direct stimulation of LT�R restores mTEClow defects inLta�/� mice. Lta�/� mice were injected with a LT�R agonist (LT�R-ag)and changes in the spleen and thymic stroma were assessed 8 h later.Whole wt spleen (A), Lta�/� mTEChigh (B), and Lta�/� mTEClow (C)subsets with fold changes for each are shown relative to Lta�/� mice in-jected with isotype control Ab, standardized to 1 (dashed line). Meansand SE generated from two experiments. D, Flow cytometric analysisof UEA-1 binding in Lta�/� mTEClow showing the percentage ofUEA1highmTEClow cells after a one-time LT�R injection (8 h later) orthree-time daily LT�R-ag injections compared with injection with iso-type control (isotype-Ig).

5390 BROAD IMPACT OF LT SIGNALS ON THE THYMIC STROMA

splenic microenvironment, including loss of T cell zone compart-mentalization (11, 17). Thus, a model has been proposed where theLT�1�2-LT�R pathway regulates expression of CCL19, CCL21,and CXCL13 chemokines by lymphoid stromal cells, which in turnregulate LT expression on lymphocytes, establishing cytokine cir-cuits leading to organization and homeostasis of peripheral lym-phoid tissues (11). A similar mechanism may contribute to theformation of the thymic medulla, whereby expression of LT�Rligands by maturing thymocytes induces CCL19 and CCL21 ex-pression by mTEC. Expression of CCL19 and CCL21 has beenshown to be critical for the migration of positively selected thy-mocytes to the medulla and, in turn, cross-talk-mediated inductionof mTEC (29). LT�R signals may establish or reinforce this path-way to a degree critical for central tolerance. In this context, itshould be noted that LT�R-deficient mice exhibit greater disrup-tion of the thymic medulla than Lta�/� or Ltb�/� mice (9, 16),again pointing to an important role for other LT�R ligands.

During review of this manuscript, a similar finding was pub-lished by the Fu group (33) demonstrating a loss of CCL19 andCCL21 in the thymus of LT�R-deficient mice which effected thy-mocyte differentiation in a TCR-transgenic model. Our data refinethis study by pinpointing deficiencies and LT�R-dependent in-creases in CCL19 and CCL21 to the mTEClow subset of both LT�-and LT�-deficient mice. The relative importance of CCL19 pro-duction by TSC subtypes and the quantitative threshold belowwhich this impinges on thymocyte selection are interesting newquestions that should be addressed in future studies.

Administration of LT�R-ag Abs in vivo affected increased TRAand chemokine expression only in the mTEClow subset within 8 hof treatment and was paralleled by increased UEA-1 binding, spe-cifically within this subset. This rapid response indicates a primaryand ongoing requirement for LT�R for the phenotype and functionof mTEClow and that the less severe mTEChigh defects may besecondary, derived perhaps from their differentiation from im-paired mTEClow precursors or a lack of LT�R-dependent signalsfrom mTEClow or fibroblasts.

The broader analysis of the LT pathway in TSC also revealed asurprisingly high dependence on LT� or LT� in MTS-15�PDGFR�� thymic fibroblasts. MTS-15� fibroblasts are foundthroughout the microenvironment of both thymus and spleen, pre-dominantly associated with CD31� blood vessels (28). In the thy-mus, MTS-15� fibroblasts have been shown to provide growthfactors such as fibroblast growth factor (FGF) 7 and FGF-10 crit-ical for TEC proliferation (28, 34). The loss of these cells due toLT deficiency may indirectly affect mTEC phenotype through lossor reduction of important mesenchymal-epithelial interactions.MTS-15�PDGFR�� fibroblasts, however, were not effected byloss of LT signaling, and further study is needed to ascertain theroles of the these two phenotypically distinct thymic fibroblastpopulations in the thymic microenvironment.

It is becoming increasingly clear that many ligand-receptorpathways are involved in cross-talk-dependent differentiation andmaintenance of mTEC, including but not limited to RANK (15),LT�R (9, 10), and CD40 (7) molecules on TSC. The dependenceof mTEC on these signals is mediated through NF-�B signalingand, in general, severe medullary defects are found in mice defi-cient or mutant for downstream NF-�B members (35). However,despite significant overlap and redundancy, the overall NF-�B sig-nal resulting from differential receptor activation is likely to varyslightly and thereby elicit distinctive cellular response patterns(36). By analyzing all of the major TSC subsets individually, thepresent study further delineates the direct and indirect effects ofLT�R signals on specific TSC populations. This highlights thecomplexity of the thymic microenvironment and emphasizes the

need to integrate the impact of such pathways on its variouselements.

AcknowledgmentsWe thank Mark Malin for invaluable technical assistance and Darren El-lemor and Andrew Fryga for expert cell sorting.

DisclosuresRichard Boyd is Chief Scientific Officer of Norwood Immunology. RichardBoyd and Ann Chidgey receive consultancies from Norwood Immunlogy.Norwood Immunology provides research support for this program.

References1. Anderson, G., W. E. Jenkinson, T. Jones, S. M. Parnell, F. A. M. Kinsella,

A. J. White, J. E. Pongrac’z, S. W. Rossi, and E. J. Jenkinson. 2006. Establish-ment and functioning of intrathymic microenvironments. Immunol. Rev. 209:10–27.

2. Kyewski, B., and L. Klein. 2006. A central role for central tolerance. Annu. Rev.Immunol. 24: 571–606.

3. Anderson, M. S., E. S. Venanzi, L. Klein, Z. Chen, S. P. Berzins, S. J. Turley,H. von Boehmer, R. Bronson, A. Dierich, C. Benoist, and D. Mathis. 2002.Projection of an immunological self shadow within the thymus by the Aire pro-tein. Science 298: 1395–1401.

4. Derbinski, J., J. Gabler, B. Brors, S. Tierling, S. Jonnakuty, M. Hergenhahn,L. Peltonen, J. Walter, and B. Kyewski. 2005. Promiscuous gene expression inthymic epithelial cells is regulated at multiple levels. J. Exp. Med. 202: 33–45.

5. Mathis, D., and C. Benoist. 2007. A decade of AIRE. Nat. Rev. 7: 645–650.6. DeVoss, J., Y. Hou, K. Johannes, W. Lu, G. I. Liou, J. Rinn, H. Chang,

R. R. Caspi, L. Fong, and M. S. Anderson. 2006. Spontaneous autoimmunityprevented by thymic expression of a single self-antigen. J. Exp. Med. 203:2727–2735.

7. Gray, D. H. D., N. Seach, T. Ueno, M. K. Milton, A. Liston, A. M. Lew,C. C. Goodnow, and R. L. Boyd. 2006. Developmental kinetics, turnover, andstimulatory capacity of thymic epithelial cells. Blood 108: 3777–3785.

8. Gray, D., J. Abramson, C. Benoist, and D. Mathis. 2007. Proliferative arrest andrapid turnover of thymic epithelial cells expressing Aire. J. Exp. Med. 204:2521–2528.

9. Boehm, T., S. Scheu, K. Pfeffer, and C. C. Bleul. 2003. Thymic medullary epi-thelial cell differentiation, thymocyte emigration, and the control of autoimmu-nity require lympho-epithelial cross talk via LT�R. J. Exp. Med. 198: 757–769.

10. Chin, R. K., J. C. Lo, O. Kim, S. E. Blink, P. A. Christiansen, P. Peterson,Y. Wang, C. Ware, and Y. X. Fu. 2003. Lymphotoxin pathway directs thymicAire expression. Nat. Immunol. 4: 1121–1127.

11. Schneider, K., K. G. Potter, and C. F. Ware. 2004. Lymphotoxin and LIGHTsignaling pathways and target genes. Immunol. Rev. 202: 49–66.

12. Dejardin, E., N. M. Droin, M. Delhase, E. Haas, Y. Cao, C. Makris, Z.-W. Li,M. Karin, C. F. Ware, and D. R. Green. 2002. The lymphotoxin-� receptorinduces different patterns of gene expression via two NF-�B pathways. Immunity17: 525–535.

13. Tumanov, A. V., D. V. Kuprash, and S. A. Nedospasov. 2003. The role of lym-photoxin in development and maintenance of secondary lymphoid tissues. Cyto-kine Growth Factor Rev. 14: 275–288.

14. Chin, R. K., M. Zhu, P. A. Christiansen, W. Liu, C. Ware, L. Peltonen, X. Zhang,L. Guo, S. Han, B. Zheng, and Y.-X. Fu. 2006. Lymphotoxin pathway-directed,autoimmune regulator-independent central tolerance to arthritogenic collagen.J. Immunol. 177: 290–297.

15. Rossi, S. W., M. Y. Kim, A. Leibbrandt, S. M. Parnell, W. E. Jenkinson,S. H. Glanville, F. M. McConnell, H. S. Scott, J. M. Penninger, E. J. Jenkinson,et al. 2007. RANK signals from CD4�3� inducer cells regulate development ofAire-expressing epithelial cells in the thymic medulla. J. Exp. Med. 204:1267–1272.

16. Venanzi, E. S., D. H. D. Gray, C. Benoist, and D. Mathis. 2007. Lymphotoxinpathway and Aire influences on thymic medullary epithelial cells are uncon-nected. J. Immunol. 179: 5693–5700.

17. Ngo, V. N., H. Korner, M. D. Gunn, K. N. Schmidt, D. Sean Riminton,M. D. Cooper, J. L. Browning, J. D. Sedgwick, and J. G. Cyster. 1999. Lym-photoxin �� and tumor necrosis factor are required for stromal cell expression ofhoming chemokines in B and T cell areas of the spleen. J. Exp. Med. 189:403–412.

18. Riminton, S., D., H. Korner, D. H. Strickland, F. A. Lemckert, J. D. Pollard, andJ. D. Sedgwick. 1998. Challenging cytokine redundancy: inflammatory cellmovement and clinical course of experimental autoimmune encephalomyelitis arenormal in lymphotoxin-deficient, but not tumor necrosis factor-deficient, mice.J. Exp. Med. 187: 1517–1528.

19. Godfrey, D. I., D. J. Izon, C. L. Tucek, T. J. Wilson, and R. L. Boyd. 1990. Thephenotypic heterogeneity of mouse thymic stromal cells. Immunology 70: 66–74.

20. Gray, D. H. D., A. P. Chidgey, and R. L. Boyd. 2002. Analysis of thymic stromalcell populations using flow cytometry. J. Immunol. Methods 260: 15–28.

21. Gray, D. H., A. L. Fletcher, M. Hammett, N. Seach, T. Ueno, L. F. Young,J. Barbuto, R. L. Boyd, and A. P. Chidgey. 2008. Unbiased analysis, enrichment,and purification of thymic stromal cells. J. Immunol. Methods 329: 56–66.

22. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(-��CT) method. Methods 25:402–408.

5391The Journal of Immunology

23. Gommerman, J. L., and J. L. Browning. 2003. Lymphotoxin/LIGHT, lymphoidmicroenvironments and autoimmune disease. Nat. Rev. Immunol. 3: 642–655.

24. Browning, J. L., and L. E. French. 2002. Visualization of lymphotoxin-� andlymphotoxin-� receptor expression in mouse embryos. J. Immunol. 168:5079–5087.

25. Kyewski, B., and J. Derbinski. 2004. Self-representation in the thymus: an ex-tended view. Nat. Rev. Immunol. 4: 688–698.

26. Klug, D. B., C. Carter, E. Crouch, D. Roop, C. J. Conti, and E. R. Richie. 1998.Interdependence of cortical thymic epithelial cell differentiation and T-lineagecommitment. Proc. Natl. Acad. Sci. USA 95: 11822–11827.

27. Jenkinson, W. E., S. W. Rossi, S. M. Parnell, E. J. Jenkinson, and G. Anderson.2007. PDGFR�-expressing mesenchyme regulates thymus growth and the avail-ability of intrathymic niches. Blood 109: 954–960.

28. Gray, D. H. D., D. Tull, T. Ueno, N. Seach, B. J. Classon, A. Chidgey,M. J. McConville, and R. L. Boyd. 2007. A unique thymic fibroblast populationrevealed by the monoclonal antibody MTS-15. J. Immunol. 178: 4956–4965.

29. Ueno, T., F. Saito, D. H. D. Gray, S. Kuse, K. Hieshima, H. Nakano, T. Kakiuchi,M. Lipp, R. L. Boyd, and Y. Takahama. 2004. CCR7 Signals are essential forcortex-medulla migration of developing thymocytes. J. Exp. Med. 200: 493–505.

30. Hogquist, K. A., T. A. Baldwin, and S. C. Jameson. 2005. Central tolerance:learning self-control in the thymus. Nat. Rev. Immunol. 5: 772–782.

31. Kurobe, H., C. Liu, T. Ueno, F. Saito, I. Ohigashi, N. Seach, R. Arakaki,Y. Hayashi, T. Kitagawa, M. Lipp, et al. 2006. CCR7-dependent cortex-to-me-dulla migration of positively selected thymocytes is essential for establishingcentral tolerance. Immunity 24: 165–177.

32. Gallegos, A. M., and M. J. Bevan. 2004. Central tolerance to tissue-specificantigens mediated by direct and indirect antigen presentation. J. Exp. Med. 200:1039–1049.

33. Zhu, M., R. K. Chin, A. V. Tumanov, X. Liu, and Y.-X. Fu. 2007. Lymphotoxinreceptor is required for the migration and selection of autoreactive T cells inthymic medulla. J. Immunol. 179: 8069–8075.

34. Jenkinson, W. E., E. J. Jenkinson, and G. Anderson. 2003. Differential require-ment for mesenchyme in the proliferation and maturation of thymic epithelialprogenitors. J. Exp. Med. 198: 325–332.

35. Derbinski, J., and B. Kyewski. 2005. Linking signalling pathways, thymic stromaintegrity, and autoimmunity. Trends Immunol. 26: 503–506.

36. Yin, L., L. Wu, H. Wesche, C. D. Arthur, J. M. White, D. V. Goeddel, andR. D. Schreiber. 2001. Defective lymphotoxin-� receptor-induced NF-�B tran-scriptional activity in NIK-deficient mice. Science 2162–2165.

5392 BROAD IMPACT OF LT SIGNALS ON THE THYMIC STROMA