Chapter 5
Gene expression study in dendritic/Langerhans cells
and Langerhans cell histiocytosis cases
Renata Rust, Joost Kluiver, Lydia Visser, Geert Harms, Tjasso Blokzijl,
Willem Kamps1, Sibrand Poppema, Anke van den Berg
Department of Pathology & Laboratory Medicine, 1Department of Pediatric Oncology,
University Medical Center Groningen and University of Groningen, Groningen, The
Netherlands
Accepted for publication in Journal of Pathology
Chapter 5
80
Abstract
Langerhans cell histiocytosis (LCH) is a neoplastic disorder resulting in clonal
proliferation of cells with a Langerhans cell (LC) phenotype. The pathogenesis of
LCH is still poorly understood. We applied serial analysis of gene expression (SAGE)
on LC generated from umbilical cord blood CD34+ progenitor cells to identify LC
specific genes and investigated the expression of these genes in LCH. Besides
expression of several genes known to be highly expressed in LC and LCH such as
CD1a, Lysozyme and CD207 we also identified a high expression of genes not
previously reported to be expressed in LC, such as GSN, MMP12, CCL17 and CCL22.
Further analysis of these genes in LCH cases by quantitative RT-PCR revealed high
expression of FSCN1 and GSN in all 12 LCH cases and of CD207, MMP12, CCL22,
and CD1a in the majority of the LCH cases, whereas CCL17 was expressed in 3 out
of 12 LCH cases. Immunohistochemistry confirmed protein expression in the
majority of the cases. The expression of MMP12 was most abundant in multi-system
LCH which is the LCH type with the worst prognosis. This suggests that expression
of MMP12 may play a role in the progression of LCH. This gene expression study
revealed a new insight in the pathology of LCH and has provided new starting points
for further investigation of this clonal proliferative disorder.
Gene expression in LC and LCH
81
Introduction
Dendritic cells (DC) and their specialized tissue counterparts, the Langerhans cells
(LC), play a key role in immunological reactions throughout the body. The LC is a
bone marrow derived cell that resides in the epidermis, the thymus and in several
mucosal epithelia. LC have long dendrites that form a network-like structure and
play an important role in the presentation of antigens.1 Immunophenotypically, LC
uniquely express the combination of S-100, a neuroprotein and CD1a, a β2-
microglobulin associated non-polymorphic MHC-like molecule that plays a role in
allogenic antigen presentation.2,3 Characteristic for the Langerhans cells are the
intracytoplasmic organelles called Birbeck granules.4 Birbeck granules are rod-
shaped and often tennis racket-shaped granules with unknown origin and function.
Langerhans cell histiocytosis (LCH) is a clonal proliferation of cells with a LC
phenotype. This rare disorder mainly affects children. The broad clinical spectrum of
the disease ranges from a lethal leukemia-like disorder in which multiple organs are
involved (multi system) that primarily affects infants to a curable solitary lytic lesion
of bone (single system, single site). Eosinophilic granuloma, another single-system
form of LCH usually affects older children or adults. The pathogenesis of LCH is
unknown, although many investigators consider LCH as an immunologic dysfunction
due to the altered expression of cytokines and cellular adhesion molecules,
important for migration and homing of the normal LC.5-10 Although an accumulation
of cells with a LC-phenotype is characteristic of LCH, lesions at different sites are
distinguished by the presence of a characteristic infiltrate of normal cells. These
cells may play important roles in controlling the behavior of LC. This suggests that
the infiltrate and location of a lesion determines the pathophysiology of LCH.11
To investigate the consistency of gene expression between LCH and LC we applied
serial analysis of gene expression (SAGE)12 on LC generated from umbilical cord
blood CD34+ progenitor cells. The SAGE technique allows the construction of a
comprehensive expression profile and results in the quantification of expression
levels of the corresponding genes.12 The highly expressed genes were verified by
quantitative (q)RT-PCR and immunohistochemistry on LCH cases of the skin, bone
and other locations to further establish the relation of LCH with LC.
Chapter 5
82
Materials and Methods
Cells and tissues
Langerhans cells (LC) generated from umbilical cord blood CD34+ progenitor cells
(MatTek corporation, Ashland, MA, USA) were used to construct a gene expression
profile using SAGE and for qRT-PCR and immunohistochemistry. The cryopreserved
LC from 1 batch were cultured for two days in maintenance medium (MatTek) and
harvested for RNA isolation and cytospins. Monocytes share a common progenitor
with LC13,14 and were used for comparison. Monocytes were isolated from total blood
from 2 donors with the Dynal® Monocyte Negative Isolation Kit (Dynal Biotech
GmbH, Hamburg, Germany). Frozen and paraffin embedded LCH tissue specimens
were obtained from the Tissue Bank of the Department of Pathology from the
University Medical Center Groningen. We randomly selected 14 LCH involved tissues
for qRT-PCR and immunohistochemical analysis (table 1). However, for 2 bone cases
the RNA quality was insufficient for qRT-PCR. All protocols for obtaining and
studying human tissues and cells were approved by the institution’s review board
for human subject research.
Serial analysis of gene expression
A SAGE library for LC was generated using the I-SAGE kit (Invitrogen, Carlsbad, CA,
USA) according to the manufacturer’s protocol. The resulting clones were sequenced
and analyzed with the SAGE2000 (version 4.12) software that was kindly provided
by Dr. K. W. Kinzler (John Hopkins Oncology Center, Baltimore, MD, USA).12 The
SAGE tags were linked to the CGAP best gene for a tag map
(http://cgap.nci.nih.gov/SAGE, release 25-05-2005) to identify the corresponding
genes.15
qRT-PCR analysis
Total RNA from the cells and tissues was isolated with the Absolutely RNA RT-PCR
Miniprep kit which included a DNase treatment step (Stratagene, La Jolla, CA, USA).
The integrity of the RNA was routinely checked using a 1% agarose gel. All RNA
samples were checked for DNA contamination with primer sets that specifically
amplify genomic DNA. The first-strand cDNA synthesis, primed with random
primers, was performed using the protocol provided by the manufacturer (Life
Technologies Inc., Gaithersburg, MD, USA). Quantitative PCR (qPCR) was performed
for highly expressed genes, using primers and probes listed in table 2.
Gene expression in LC and LCH
83
Table 1. Overview of the LCH cases and the results of immunohistochemical stainings LCH Tissue Age % tumor
cells
CD1a Lysozyme CD207 TARC MDC MMP12 Fascin Gelsolin
Single system
Single site 1 Skin 0 months >90 + + + + + + +/- +
Single site 2 Skin 1 year 50 + + + + + + + +
Single site 3 Lymph node 57 years 30 + + ± - - + +/- +
Multiple site 1 Bone 3 years >90 + + ± - + + + +
Multiple site 2 Bone 2 years >90 + + + - +/- + - +
Multiple site 3 Bone 17 years >90 + + ± + + + +/- +
Multi system
Low risk 1 Lymph node 3 years 20 + + ± +/- +/- + +/- +
Low risk 2 Skin 1 year 50 + + + + + + + +
High risk 1 spleen 2 years 70 + + ± + + + + +
High risk 2 Bone 1 year 50 + + ± + + + + +
AEG
1 Skin 45 years 10 + + + + - + + +
2 Bone 39 years 80 + + ± + + + + +
3 Lung 23 years 70 + + ± + +/- + + +
4 Lung 57 years 80 + + ± - + + - +
± weak positive staining
+/- part of the lesional cells stain positive AEG = Adult Eosinophilic Granuloma
RNA polymerase II (RPII) was used as a positive control and for normalization. LYZ,
CD1a and CD207 were included as positive controls for LC and LCH cells. qPCR
reactions were performed in a 20µl reaction volume containing 1 × SYBRgreen mix
(Applied Biosystems, Foster City, CA, USA), 600nM primers, and 1ng cDNA. For
CCL17 (Hs00171074_m1) and CCL22 (Hs01574247_m1) Assays-on-demandTM Gene
Expression Products (Applied Biosystems) were used. These qPCR reactions were
performed in a 20 µl reaction volume with 1 × qPCR master mix (Eurogentec, Liege,
Belgium), 1 × Assays-on-Demand Gene Expression Assay mix (Applied
Biosystems) for either CCL17 or CCL22 and 1ng cDNA. Reactions were performed on
an ABI7900HT Sequence Detection System device (Applied Biosystems) using the
standard program (10 min at 95°C followed by 40 cycles of 15 sec at 95°C, and 60
sec at 55°C). All PCR reactions were performed in triplicate, positive and negative
controls were included in each run. Fluorescence was quantified with the sequence
detection system software (SDS, version 2.0, Applied Biosystems). Mean cycle
threshold values (Ct) and standard deviations (SD) were calculated for all genes.
The amount of target gene was normalized relative to the amount of RPII
(∆Ct=∆Ct(gene)−∆Ct(RPII)) and the SD of the ∆Ct (SD(∆Ct)) was calculated
(SD(∆Ct)=√((SDgene)2+(SDRPII)
2). The factor difference is calculated (2−∆Ct).
Immunohistochemistry
Immunohistochemistry was applied on frozen tissue sections using standard
laboratory procedures. The following antibodies were used, for CD1a monoclonal
mouse anti-CD1a (clone O10, Dako, Copenhagen, Denmark); for Lysozyme
polyclonal rabbit anti-Lysozyme (Dako); for Langerin monoclonal mouse anti-
Chapter 5
84
Langerin (clone 12D6, Novocastra, Newcastle upon Tyne, UK); for TARC polyclonal
goat anti-TARC (R&D systems Inc., Abingdon, UK); for MDC polyclonal rabbit anti-
MDC (Peprotech EC Ltd., London, UK); for MMP12 monoclonal mouse anti-MMP12
(clone 82902, R&D systems); for Fascin monoclonal mouse anti-human Fascin
(clone 55K-2, Dako) and for Gelsolin monoclonal mouse anti-human Gelsolin (clone
GS-2C4, Abcam, Cambridge, UK). In each run, positive control tissue sections and
negative controls (first incubation step without primary antibody) were included
routinely.
Table 2. Primers selected for qRT-PCR
Gene Forward primer Reverse primer
Amplicon
length Exon
CFL1 gcgccccttaagagcaaaat tgcttgcaattcatgcttgatc 87 2-3
SIAT6 gctgctgccggaatcact tcccccctacccaaattcac 70 13
FSCN1 cgtccaatggcaagtttgtg gctctgagtcccctgctgtct 78 3-3/4
GSN tgaggtccagggcttcga atcctgatgccacacctcctt 86 3-4
LGALS1 catcctcctggactcaatcatg tcgcactcgaaggcactct 82 1-2
BAK1 cacggcagagaatgcctatga cccaattgatgccactctca 71 4-5
MMP12 ggcccgtatggaggaaacat gtcaacatcctcacggttcatg 77 2-3
ZNF216 catgtgcagaaagaaagttggtctt aacggtgaagtccacaaaacaaat 74 6-7
CST3 acaactgccccttccatgac gcacagcgtagatctggaaaga 72 2-3
RAB5C tctgcggtaggcaaatcca ggcagacagtctgtgtgaggaa 106 2-3
ZYX tgaccaagaatgatcctttcaaag ggtactggacttggaactgaatgg 89 4-5
S100A10 aggagttccctggatttttgg tacactggtccaggtccttcatta 78 2-3
LYZ ggagcagttaatgcctgtcattt gctacagcatcagcgatgttatct 68 2-3
CD207 gtggatgacacgccattcaa ttgttgggctcacctggaa 65 5-6
CD1A gacctgttcctgtcgggtgaa gaagcccacggaactgtgat 84 4-5
RPII cgtacgcaccacgtccaat caagagagccaagtgtcggtaa 139 16-17
Results
Morphology and immunophenotype of LC
Before generation of the SAGE library, the morphology and phenotype of the LC was
determined after culturing the cells for 2 days. A small aliquot of the LC culture was
used to prepare cytospots to confirm LC phenotype and expression of LC specific
genes. Large cells with dendrites and smaller cells were observed in the HE staining.
Staining for CD1a and CD207 revealed positivity in all cells, confirming the
morphology and immunophenotype that is characteristic for LC (Fig 1).
Gene expression in LC and LCH
85
SAGE analysis of LC
Five hundred and fifty-nine clones were sequenced to generate the SAGE library of
LC. The SAGE library contained 10,299 tags which represented 4,805 different
genes. The SAGE tags were linked to the Unigene database, which revealed
identification of the corresponding genes for the vast majority of SAGE tags.
Analysis of the top 100 most abundantly expressed genes revealed 27 ribosomal, 3
house keeping, 8 unknown, 8 MHC genes and 11 mitochondrial genes. The
remaining 43 genes included several genes known to be expressed in LC (Table 2).
LC specific expression pattern
Fifteen genes were selected for qRT-PCR to confirm a high expression in LC and to
determine specificity for LC by comparing the expression level to monocytes (Table
2). LYZ, CD1a, and CD207 were added as positive controls for LC and LCH. Fifteen
out of 18 genes demonstrated an expression level similar to or higher than the
housekeeping gene RPII, confirming the high expression levels observed by SAGE.
Three genes demonstrated expression levels lower than the house keeping gene
RPII (Fig 2). Seven out of 18 genes, i.e. CCL17, FSCN1, GSN, MMP12, CD207,
CCL22 and CD1a, demonstrated a high expression level specifically in LC and not in
monocytes.
Expression of these 7 LC specific genes and of LYZ was analyzed by qRT-PCR on 12
LCH cases. A relative expression level similar to or higher than the housekeeping
gene was observed in all 12 cases for FSCN1 and GSN. A higher or similar relative
expression level as RPII was observed in 11/12 cases for CD207, 10/12 for MMP12,
10/12 for CCL22, 8/12 for CD1a, and 3/12 for CCL17. Overall, expression levels of
the 7 selected genes were relatively low in adult eosinophilic granuloma compared
Figure 1. Hematoxylin/eosin
(HE) staining and
immunohistochemical staining
for CD1a on LC generated from
umbilical cord blood CD34+ progenitor cells. A; HE staining
demonstrating large cells with
dendrites. B; Cells all stain
positive for CD1a. Original
magnification, 800x.
Chapter 5
86
to the other LCH types (Fig 3). Chemokines CCL17 and CCL22 were most
abundantly expressed in lymph node and skin LCH cases whereas CD1a, CD207 and
GSN were most abundant in skin and bone LCH (Fig 3).
Table 3. Genes highly expressed in LC.
Tag sequence LC Gene symbol Protein
GTTCACATTA 554 CD74 CD74 antigen
ATGTAAAAAA 118 LYZ* Lysozyme
TAGGTTGTCT 105 TPT1 Tumor protein, translationally-controlled 1
TTGGTGAAGG 97 TMSB4X Thymosin, beta 4, X-linked
GAAGCAGGAC 48 CFL1 Cofilin
TGTACCTGTA 44 K-ALPHA-1 Tubulin, alpha, ubiquitos
GGCACAAAGG 39 CCL17 Thymus and activation-regulated chemokine (TARC)
CCTAGCTGGA 35 PPIA Cyclophilin A
GAAGCAATAA 33 SIAT6 Sialyltransferase 6
ATAGTAGCTT 31 FSCN1* Fascin
GCCTTCCAAT 29 DDX5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
CCCTGGGTTC 24 FTL Ferritin
ATCAAGAATC 24 IFI30 Interferon, gamma-inducible protein 30
AAGCACAAAA 22 TYROBP TYRO protein tyrosine kinase binding protein
TCACCGGTCA 21 GSN Gelsolin
GGGCTGGGGT 20 SPAG7 Sperm associated antigen 7
GAAAAATGGT 19 LAMR1 Laminin receptor 1
GGCTGGGGGC 19 PFN1 Profilin 1
GCCCCCAATA 19 LGALS1 Galectin 1
CTCTGTAAGT 16 MMP12 Macrophage elastase
TACAGAGGGA 15 ZNF216 Zinc finger protein 216
GCAGTGGGAA 14 LTB Lymphotoxin beta
GCCCTGAAAG 14 HERPUD1 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain
member 1
CAGGATGCTT 13 LSP1* Lymphocyte-specific protein 1
GTGTGTTTGT 13 TGFB1 Transforming growth factor, beta-induced
TGCCTGCACC 13 CST3 Cystatin C
AGCACCTCCA 12 EEF2 Eukaryotic translation elongation factor 2
TAACCAATCA 12 RAB5C Member RAS oncogene family
CATTACAAAC 12 IL7R Interleukin 7 receptor
CTGCCAAGTT 12 ZYX Zyxin
GCATTTAAAT 11 EEF1B2 Eukaryotic translation elongation factor 1 beta 2
ACATCATCGA 11 NBEAL Neurobeachin-like 1
GACCACGAAT 11 CTSH Cathepsin H
AGCAGATCAG 11 S100A10 S100 calcium binding protein A10
TGAAATAAAA 10 NPM Nucleophosmin
TTGTAATCGT 10 OAZ1 Ornithine decarboxylase antizyme 1
GCTCCCAGAC 10 SYNGR2 Synaptogyrin 2
CGTGGGTGGG 10 HMOX1 Heme oxygenase (decycling) 1
ATTGTTTATG 9 HMGN2 High-mobility group nucleosomal binding domain 2
AATTCACCTT 9 CD207* CD207 antigen (Langerin)
AACGGGGCCC 8 CCL22 Macrophage-derived chemokine (MDC)
TTCTCAATAA 6 CD1A* CD1A antigen
The grey rows indicate the genes selected for qRT-PCR
The number in column LC indicates the number of times the tag is present in the SAGE library
* Genes known to be expressed in LCH
Gene expression in LC and LCH
87
Immunohistochemistry
Immunohistochemical staining of LC cytospots for CD1a, Lysozyme and MMP12
revealed positivity in all cells. Staining for TARC, MDC and Fascin was weak but
showed a few strongly positive cells.
CD1a stained positive in the neoplastic cells of 14 LCH cases. Staining for Lysozyme,
a marker that is often observed in the neoplastic cells of LCH, also revealed
positivity in all LCH cases. Positive staining for CD207 (Langerin) was prominent in
the 4 LCH cases that involve skin tissue and in 1 bone case whereas the staining
was only weak in the remaining 9 cases. Staining for MMP12 and Gelsolin revealed
strong positivity in all 14 LCH cases consistent with RT-PCR results. Positive staining
for MDC was observed in the tumor cells of the majority of the LCH cases. Staining
for TARC revealed weak positivity in 5/14 LCH cases (Table 3, Fig 4).
Discussion
The biology of LCH is poorly understood and until now there is relatively little data
on gene expression in the pathologic cells of this disorder. In this study, a
comprehensive gene expression profile was generated from in vitro generated
Dendritic Langerhans cells (LC), to identify LC specific genes and investigate their
expression in LCH. We identified several genes previously reported to be specifically
expressed in LC, like CD1a, CD207 and LYZ, demonstrating the validity of our SAGE
library. For 15 out of 18 selected genes, a high expression was confirmed in LC by
qRT-PCR. However, the high expression of SIAT6 and RAB5C could not be confirmed
in LC. Revision of the tag to gene mapping results of these 2 genes indicated that
the tags appear to be specific and it is unclear why the SAGE results could not be
confirmed.
To our knowledge, this is the first whole genome gene expression study in LC. We
identified seven genes that are specifically expressed in LC in comparison to
monocytes. The high expression of these 7 genes could be confirmed in all LCH
cases for FSCN1 and GSN and in the majority of the LCH cases for CD207, MMP12,
CCL22, and CD1a, whereas CCL17 was expressed in only 3 out of 12 LCH cases.
Expression of cytokines and cell cycle-related genes was investigated previously in
LCH.16,17 The majority of cytokines showed no statistically different expression levels
in LC obtained from normal versus diseased tissue.
Chapter 5
88
Figure 2. qRT-
PCR results for
CFL1, SIAT6,
FSCN1, FTL, GSN,
IFI30, LGALS1,
MMP12, ZNF216,
CST3, RAB5C,
ZYX, S100A10,
CCL17, CCL22,
LYZ, CD1a and
CD207 on LC and
monocytes. The
monocytes
represent 2
different donors
and the LC
originate from one
donor cultured at
different time
points. The bars
indicate the
relative
expression levels
normalized to the
housekeeping
gene RPII. The
relative
expression levels
of FSCN1, GSN,
MMP12, CCL17,
CCL22, CD1a and
CD207 are high in
the LC compared to monocytes.
Gene expression in LC and LCH
89
A study on cell cycle-related gene products in LCH by immunohistochemistry
revealed the expression of TGFβ receptor I and II, MDM2, p53, p21, p16, Rb and
Bcl2 in more than 90% of the cases.16 In our SAGE library we identified the tag
belonging to the p21 gene 7 times, the other genes were not present.
LCH lesions at different locations have different clinical outcomes which might be
reflected by different gene expression profiles. We indeed observed a remarkable
difference in gene expression in LCH presenting at different locations. Expression of
CD1a, CD207 and GSN was most abundantly in skin and bone LCH whereas Fascin
expression is high in all LCH types and tissues. Chemokines CCL17 and CCL22 were
most abundantly expressed in lymph node and skin LCH cases and the expression of
MMP12 is most abundant in multi-system LCH. Expression levels of all 7 genes were
relatively low in adult eosinophilic granuloma compared to the other LCH types.
McClain et al.17 also observed differences in cytokine expression levels between
multi-system disease, involving liver and spleen, and bone-only disease. These data
suggest that LCH cases presenting at different locations might have different
pathogenic mechanisms.
In our study, actin bundling protein, Fascin, and actin binding protein Gelsolin were
most consistently expressed in LC and LCH. Actin is the component of the
cytoskeletal system that gives shape to the cell and allows movement of the cell
itself as well as movements within the cell.18 Fascin represents a highly selective
marker for dendritic cells of lymphoid tissues and peripheral blood. In a previous
study on the expression of Fascin during maturation of murine LC, expression was
not detected in freshly isolated LC, however, after culturing, high levels of Fascin
expression were demonstrated. These results suggest that Fascin is involved in the
formation of dendritic processes in maturing epidermal Langerhans cells.19
Immunohistochemistry for Fascin on 34 LCH cases revealed immunoreactivity in all
LCH cases while epidermal Langerhans cells were non-reactive for Fascin.20
Consistent with the findings of Ross et al.,19 we demonstrated high expression of
Fascin mRNA and protein in cultured LC. We also observed high expression of Fascin
mRNA in all 12 LCH cases and immunohistochemistry for Fascin revealed positivity
in 12/14 LCH cases. Gelsolin typically severs and caps actin filaments in a Ca2+, pH
and phospholipid dependent manner and is involved in cell motility, phagocytosis,
and apoptosis (one of the targets of caspase-3). Gelsolin has for a long time been
considered to act as a tumor suppressor for breast and other carcinomas due to its
inhibitory capacity of tumor progression and the apparent abrogation of
carcinogenesis.21
Chapter 5
90
Figure 3. qRT-PCR results for FSCN1, GSN, MMP12, CCL17, CCL22, LYZ, CD1a, and CD207 on
single system, multi system and adult eosinophilic LCH cases. The bars indicate the relative
expression levels normalized to the housekeeping gene RPII.
Gene expression in LC and LCH
91
However, in a subset of breast tumors overexpressing the tyrosine kinase receptors
erbB-2 and EGFR, Gelsolin overexpression correlates with negative prognosis.22
Gelsolin expression appears to act downstream of Ras and phosphoinositides to
promote motility and invasive potential of transformed cell lines.23 We observed high
expression of Gelsolin mRNA and protein in LC and all LCH cases. For both Fascin
and Gelsolin no differences in expression level between the location of the LCH
lesion and/or type of disease was observed indicating that there is no correlation
between Fascin and Gelsolin expression and the prognosis of LCH. LC originate from
the epidermis whereas in LCH they accumulate at different tissues throughout the
body like bone liver and spleen indicating the motility of LC. Fascin and Gelsolin
both promote cell motility23,24 suggesting their role in LCH might be associated with
the movement of LC out of the epidermis.
Expression of MMP12 was observed at high levels in 10/12 LCH cases by qRT-PCR
and by immunohistochemistry in all cases. Matrix metalloproteinases (MMPs) are
proteinases that participate in extracellular matrix (ECM) degradation and therefore
play an important role in biological processes such as embryogenesis, normal tissue
remodeling, wound healing, and angiogenesis. Metalloelastase (MMP12) hydrolyzes
a number of substrates, such as elastin, type IV collagen, fibronectin, laminin,
gelatin, vitronectin, entactin, heparin, and chondroitin sulphates.25 In normal cells
MMP12 is mainly expressed in alveolar macrophages.26 Tumor invasion and
metastasis formation require lysis of extracellular matrix and metalloelastase plays
a critical role in both processes. High expression of MMP12 is associated with tumor
progression and poor prognosis in skin, vulvar and pancreatic cancer.27-29 In LCH the
expression of MMP12 mRNA was most abundantly in Multi-system disease, which
has the worst prognosis, suggesting that the expression of MMP12 might also play a
role in the progression of LCH.
LCH lesions consist of a mixture of Langerhans cell histiocytes, lymphocytes
(predominantly CD4+ T-cells), eosinophils, and macrophages. These cells produce a
high level of cytokines and chemokines creating a ‘chemokine/cytokine storm’ that
is similar to Hodgkin Lymphoma. This leads to stimulation of the cells in the lesions,
in particular the LCH cells and CD4+ T-cells.30 In a recent study, high expression of
cytokines GM-CSF, TGFβ-R, and IL-1α was demonstrated in LCH.17 We identified
high expression of the chemokines CCL22 and CCL17 in LC and in 10/12 and 3/12
LCH cases respectively. A remarkable observation is that the expression of these
chemokines, especially for CCL17, was most abundant in lymph node and skin LCH
Chapter 5
92
tissue. However, only low levels of protein were observed in the affected lymph
nodes, which might indicate that the proteins rapidly diffuse into the circulation.
CCL22 (MDC) and CCL17 (TARC) bind specifically to the CC chemokine receptor
CCR4 which is highly expressed in activated Th2 cells. This might explain the small
lymphocytes that are often observed within the LCH lesions. TARC and MDC are also
produced by the Reed-Sternberg cells of Hodgkin lymphoma and attract a similar
population of CCR4 positive T-helper 2 cells.31,32 This makes TARC and MDC two
additional markers that LC and Hodgkin Reed-Sternberg cells have in common.33
Figure 4. Immunohistochemical staining in LCH cases. A; CD1a positive staining of a LCH case
of the skin (magnification 200x). B; Positive staining of CD207 in the neoplastic LCs of a skin
LCH case (magnification 600x). C; LCH cells staining positive for Lysozyme in bone tissue
(magnification 600x). D; Fascin positive LCH cells in lung tissue (magnification 400x). E; LCH
cells staining strongly positive for Gelsolin (magnification 600x). F; Positive staining of MMP12
in LCH cells of the bone (magnification 600x). G; Skin LCH case staining positive for MDC
(magnification 400x). H; LCH cells staining positive for TARC (magnification 600x).
In summary, we report a gene expression study of LC cells and also investigated the
highly expressed genes in LCH. Among the expression of several genes known to be
highly expressed in LC and LCH such as CD1a, LYZ and CD207 we identified a high
Gene expression in LC and LCH
93
expression of actin involved genes FSCN1 and GSN, of metalloproteinase MMP12,
and of chemokines CCL17 and CCL22. In LCH, Fascin and Gelsolin may play a role in
the movement of LCH cells out of the epidermis while TARC and MDC may function
as attractants of the other cells in the lesions surrounding the LCH cells. High
expression of MMP12 was most abundant in multi-system disease, suggesting a role
for MMP12 in the progression of LCH.
Chapter 5
94
References 1. Wolff K, Stingl G. The Langerhans cell. J Invest Dermatol 1983;80:17s-21s
2. Murphy GF, Bhan AK, Sato S, Mihm MC Jr, Harrist TJ. A new immunologic marker for
human Langerhans cells. N Engl J Med 1981;304:791-792.
3. Moulon C, Peguet-Navarro J, Schmitt D. A potential role for CD1a molecules on
human epidermal Langerhans cells in allogeneic T-cell activation. J Invest Dermatol
1991;97:524-528.
4. Birbeck MS, Breathnach AS, Everall JD. An electron microscopic study of basal
melanocyte and high level clear cell (Langerhans cell) in vitiligo. J Invest Dermatol
1961; 37: 51-63.
5. de Graaf JH, Tamminga RY, Kamps WA, Timens W. Expression of cellular adhesion
molecules in Langerhans cell histiocytosis and normal Langerhans cells. Am J Pathol
1995;147:1161-1171.
6. Emile JF, Fraitag S, Andry P, Leborgne M, Lellouch-Tubiana A, Brousse N. Expression
of GM-CSF receptor by Langerhans cell histiocytosis cells. Virchows Arch
1995;427:125-129.
7. de Graaf JH, Tamminga RYJ, Dam-Miering A, Kamps WA, Timens W. The presence of
cytokines in Langerhans cell histiocytosis. J Pathol 1996;180:400-406.
8. Geissmann F, Emile JF, Andry P, et al. Lack of expression of E-cadherin is associated
with dissemination of Langerhans cell histiocytosis and poor outcome. J Pathol
1997;181:301-304.
9. Egeler RM, Favara BE, Laman JD, Claassen E. Differential In situ cytokine profiles of
Langerhans-like cells and T cells in Langerhans cell histiocytosis: abundant expression
of cytokines relevant to disease and treatment. Blood 1999;94:4195-4201.
10. Tazi A, Moreau J, Bergeron A, Dominique S, Hance AJ, Soler P. Evidence that
Langerhans cells in adult pulmonary Langerhans cell histiocytosis are mature dendritic
cells: importance of the cytokine microenvironment. J Immunol 1999;163:3511-
3515.
11. Geissmann F, Lepelletier Y, Fraitag S, Valladeau J, Bodemer C, Debre M, Leborgne M,
Saeland S, Brousse N. Differentiation of Langerhans cells in Langerhans cell
histiocytosis. Blood 2001;97:1241-1248.
12. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW. Serial analysis of gene expression.
Science 1995;270:484-487.
13. Reid CD, Fryer PR, Clifford C, Kirk A, Tikerpae J, Knight SC. Identification of
hematopoietic progenitors of macrophages and dendritic Langerhans cells (DL-CFU) in
human bone marrow and peripheral blood. Blood 1990;76:1139-1149.
14. Fogg DK, Sibon C, Miled C, Jung S, Aucouturier P, Littman DR, Cumano A, Geissmann
F. A clonogenic bone marrow progenitor specific for macrophages and dendritic cells.
Science 2006;311:83-87.
15. Boon K, Osorio EC, Greenhut SF, Schaefer CF, Shoemaker J, Polyak K, Morin PJ,
Buetow KH, Strausberg RL, De Souza SJ, Riggins GJ. An anatomy of normal and
malignant gene expression. Proc Natl Acad Sci U S A 2002;99:11287-11292.
16. Schouten B, Egeler RM, Leenen PJ, Taminiau AH, van den Broek LJ, Hogendoorn PC.
Expression of cell cycle-related gene products in Langerhans cell histiocytosis. J
Pediatr Hematol Oncol 2002;24:727-732.
17. McClain KL, Cai YH, Hicks J, Peterson LE, Yan XT, Che S, Ginsberg SD. Expression
profiling using human tissues in combination with RNA amplification and microarray
analysis: assessment of Langerhans cell histiocytosis. Amino Acids 2005;28:279-290.
18. Weeds A. Actin-binding proteins--regulators of cell architecture and motility. Nature
1982;296:811-816.
19. Ross R, Ross XL, Schwing J, Langin T, Reske-Kunz AB. The actin-bundling protein
fascin is involved in the formation of dendritic processes in maturing epidermal
Langerhans cells. J Immunol. 1998;160:3776-3782.
20. Pinkus GS, Lones MA, Matsumura F, Yamashiro S, Said JW, Pinkus JL. Langerhans cell
histiocytosis immunohistochemical expression of fascin, a dendritic cell marker. Am J
Gene expression in LC and LCH
95
Clin Pathol. 2002;118:335-343.
21. Sagawa N, Fujita H, Banno Y, Nozawa Y, Katoh H, Kuzumaki N. Gelsolin suppresses
tumorigenicity through inhibiting PKC activation in a human lung cancer cell line,
PC10. Br J Cancer 2003;88:606-612.
22. Thor AD, Edgerton SM, Liu S, Moore DH 2nd, Kwiatkowski DJ. Gelsolin as a negative
prognostic factor and effector of motility in erbB-2-positive epidermal growth factor
receptor-positive breast cancers. Clin Cancer Res 2001;7:2415-2424.
23. De Corte V, Bruyneel E, Boucherie C, Mareel M, Vandekerckhove J, Gettemans J.
Gelsolin-induced epithelial cell invasion is dependent on Ras-Rac signaling. EMBO J
2002;21:6781-6790.
24. Yamashiro S, Yamakita Y, Ono S, Matsumura F. Fascin, an actin-bundling protein,
induces membrane protrusions and increases cell motility of epithelial cells. Mol Biol
Cell 1998;9:993-1006.
25. Gronski TJ Jr, Martin RL, Kobayashi DK, Walsh BC, Holman MC, Huber M, Van Wart
HE, Shapiro SD: Hydrolysis of a broad spectrum of extracellular matrix proteins by
human macrophage metalloelastase. J Biol Chem 1997, 272:12189-12194.
26. Shapiro SD, Kobayashi DK, Ley TJ. Cloning and characterization of a unique
elastolytic metalloproteinase produced by human alveolar macrophages. J Biol Chem
1993;268:824-823.
27. Balaz P, Friess H, Kondo Y, Zhu Z, Zimmermann A, Buchler MW. Human macrophage
metalloelastase worsens the prognosis of pancreatic cancer. Ann Surg 2002;235:519-
527.
28. Kerkela E, Ala-Aho R, Jeskanen L, Rechardt O, Grenman R, Shapiro SD, Kahari VM,
Saarialho-Kere U: Expression of human macrophage metalloelastase (MMP-12) by
tumor cells in skin cancer. J Invest Dermatol 2000;114:1113-1119.
29. Kerkela E, Ala-aho R, Klemi P, Grenman S, Shapiro SD, Kahari VM, Saarialho-Kere U:
Metalloelastase (MMP-12) expression by tumour cells in squamous cell carcinoma of
the vulva correlates with invasiveness, while that by macrophages predicts better
outcome. J Pathol 2002;198:258-269.
30. Hicks J, Flaitz CM. Langerhans cell histiocytosis: current insights in a molecular age
with emphasis on clinical oral and maxillofacial pathology practice. Oral Surg Oral Med
Oral Pathol Oral Radiol Endod 2005;100:S42-66.
31. Van den Berg A, Visser L, Poppema S. High expression of the CC chemokine TARC in
Reed-Sternberg cells. A possible explanation for the characteristic T-cell infiltratein
Hodgkin's lymphoma. Am J Pathol 1999;154:1685-1691.
32. Maggio E, van den Berg A, Diepstra A, Kluiver J, Visser L, Poppema S. Chemokines,
cytokines and their receptors in Hodgkin's lymphoma cell lines and tissues. Ann
Oncol. 2002;13 Suppl 1:52-56.
33. Pinkus GS, Pinkus JL, Langhoff E, Matsumura F, Yamashiro S, Mosialos G, Said JW.
Fascin, a sensitive new marker for Reed-Sternberg cells of hodgkin's disease.
Evidence for a dendritic or B cell derivation? Am J Pathol 1997;150:543-562.
Chapter 5
96
Recommended
