Upload
karan-veer-singh
View
5.117
Download
3
Embed Size (px)
DESCRIPTION
Primer desing tutorial,primer cane be desinged using web sources,details properties of PCR primers etc
Citation preview
PCR & Primer Designing
Karan Veer Singh
NBFGR
04/12/23 NBFGR karan veer singh
What is a primer?
A primer is a short synthetic oligonucleotide which is used in many molecular techniques. These primers are designed to have a sequence which is the reverse compliment a region of template or target DNA to which we wish the primer to anneal.
3’ 5’ TGACCTGAAAAGAC Primer GATGGACTGATTACCGATGACTGGACTTTTCTG Template 5’ 3’
3’ 5’ TGACCTGAAAAGAC : : : : : : : : : : : : : GATGGACTGATTACCGATGACTGGACTTTTCTG Annealing 5’ 3’
04/12/23 NBFGR karan veer singh
Diagram for PCR Primer Design
Primer Design
PCR reaction parameters
Sequence from which to choose primers
Primer Selection Rules
Results of search, including suggested annealing temperatures shown in list
Primer design is an artart when done by human beings, and a far far better done by machinesbetter done by machines.
04/12/23 NBFGR karan veer singh
• Primer uniquenessPrimer uniqueness• Primer lengthPrimer length• Melting temperatureMelting temperature• GC content rangeGC content range• 3'-clamp properties (terminal residue, 3'-clamp properties (terminal residue,
CG-content)CG-content)• Avoid hairpins in primersAvoid hairpins in primers• Length of amplified regionLength of amplified region• Avoid primer-primer interactionAvoid primer-primer interaction• Melting temperature compatabilityMelting temperature compatability
Primer Design CriteriaPrimer Design Criteria
04/12/23 NBFGR karan veer singh
A simple set of rules for primer sequence design is as follows
;Primers should be 17-28 bases in length٭
¼ chance (4ˉ¹) of finding an A, G, C or T in any given DNA sequence;
1/16 chance (4ˉ²) of finding any dinucleotide sequence (eg. AG);
1/256 chance of finding a given 4-base sequence. Thus, a sixteen base sequence will statistically be present only once in every 4¹6 bases (=4 294 967 296, or 4 billion) about the size of the human or maize genome
04/12/23 NBFGR karan veer singh
;Base composition should be 50-60% (G+C)٭
Primers should end (3') in a G or C, or CG or٭GC: this prevents "breathing" of ends and increases efficiency of priming;
;Tms between 55-80ºC are preferred٭
Tm = 4(G + C) + 2(A + T) ºC.
04/12/23 NBFGR karan veer singh
Runs of three or more Cs or Gs at the 3'-ends of primers٭may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided;
ends of primers should not be complementary-'3٭
Primer self-complementarity (ability to form 2º structures٭such as hairpins) should be avoided.
Common problems in primer designCommon problems in primer design
04/12/23 NBFGR karan veer singh
04/12/23 NBFGR karan veer singh
Hairpin formationHairpin formation
04/12/23 NBFGR karan veer singh
04/12/23 NBFGR karan veer singh
When is a “PRIMER” a Primer?
04/12/23 NBFGR karan veer singh
Designing Degenerative Oligonucleotide
A group of degenerate oligonucleotides contain related sequences with differences at specific locations.
One common use of degenerative oligonucletides is when the amino acid sequences of a protein is known. One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence. A set of degenerate oligonucleotides would then be produce matching those DNA sequences .
http:// cvmbs.colostate.edu/molkit/rtranslate/
AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA C G C CT CAGC C C T C C C G
A A A A A G G G G G
04/12/23 NBFGR karan veer singh
Primer3 http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi٭
Web Primer http://seq.yeastgenome.org/cgi-bin/web-primer٭
Gene Fisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/)٭
GeneWalker ((http://www.cybergene.se/primerdesign/)٭
CODEHOP (http://www.blocks.fhcrc.org/codehop.html)٭
Net Primer٭(http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html )
…….and many others
Related Bioinformatics Programs:
04/12/23 NBFGR karan veer singh
PCR Mastermix Box Titration Calculator - http://www.attotron.com/pub/pcrtitr.htm
PCR Optimization Program Helper – http://www.molbiol.ru/eng/scripts/01_14.html
MGH-PGA Proteomic Tools PCR Primer design for٭
peptide sequences
Oligo Calculator -- to calculate Tm, GC%, etc for a٭
given oligo.
04/12/23 NBFGR karan veer singh
http://pga.mgh.harvard.edu/primerbank/index.html
PCR Primers for Gene Expression Detection and Quantification
Primer Bank
04/12/23 NBFGR karan veer singh
RTPrimerDB - Real Time PCR Primer and Probe Database (submitted by researchers).
Real Time PCR Primer Sets Real time PCR primers (submitted by researchers).
The Quantitative PCR Primer Database (QPPD) provides information about primers and probes that can be used for human and mouse real time RT–PCR assays (published articles)
IMGT/PRIMER-DB, the IMGT database for primers of the immunoglobulins (IG), T cell receptors (TR) and related proteins of the immune system (RPI).
Other Primer Databases:
04/12/23 NBFGR karan veer singh
Components Volume Per sample
Concentration reaction
DDW 38.8 µl -
Buffer 5.00 µl 1X
dNTP’s 1.00 µl (0.25 µl each)
200 μM each
Primer F 0.04 µl 5-10 p moles
Primer R 0.04 µl 5-10 p moles
MgCl2 2.00 µl -
Taq Polymerase 0.04 µl 1.5 U
Total Volume 48.00 µl -
04/12/23 NBFGR karan veer singh
1X, usually comes as 10X stock.
For 25µL reactions, this means 2.5µL.
Buffer:
04/12/23 NBFGR karan veer singh
•a 2mM stock of dNTPs means that the final concentration of EACH dNTP (dATP, dCTP, dGTP, and dTTP) is 2mM -- NOT that all dNTPs together make 2mM.
•dNTPs come as 100mM stocks -- thaw and add 10µL of each dNTP to 460µL of ddH20 to make 2mM. Store at -20°C.
dNTP’s:
04/12/23 NBFGR karan veer singh
A good place to start with primer concentration is 50pmol of each primer per reaction.
If you don’t get your desired product, you can increase to 75pmol or 100pmol. This usually does the trick.
Primers:
04/12/23 NBFGR karan veer singh
•Mg2+ ions form complexes with dNTPs, primers and DNA templates, the optimal concentration of MgCl2 has to be selected for each experiment.
Too few Mg2+ ions result in a low yield of PCR product, and too many increase the yield of non-specific products and promote misincorporation.
Lower Mg2+ concentrations are desirable when fidelity of DNA synthesis is critical.
MgCl2 Concentration.
04/12/23 NBFGR karan veer singh
Usually 1-1.5u of Taq DNA Polymerase are used in 50µl of reaction mix. Higher Taq DNA Polymerase concentrations may cause synthesis of nonspecific products.
However, if inhibitors are present in the reaction mix (e.g., if the template DNA used is not highly purified), higher amounts of Taq DNA Polymerase (2-3u) may be necessary to obtain a better yield of amplification products.
Taq DNA Polymerase:
04/12/23 NBFGR karan veer singh
It’s not usually necessary to be incredibly fastidious about how much template you add to a reaction. You can get product with incredibly small amounts of starting DNA.
Template:
04/12/23 NBFGR karan veer singh
Steps Temperature (°C) Time Cycle
Initial denaturation 950 120 sec 1 Cycle
Denaturation 940 30 sec
35 CycleAnnealing 540 30 sec
Extension 720 60 sec
Elongated extended 720 600 sec 1 cycle
Storage 40 Forever -