18
Interdisciplinary Approaches To Metadata Tom Lombardi

Interdisciplinary Approaches to Metadata

Embed Size (px)

Citation preview

Page 1: Interdisciplinary Approaches to Metadata

Interdisciplinary Approaches To Metadata

Tom Lombardi

Page 2: Interdisciplinary Approaches to Metadata

Interdisciplinary Metadata Analysis Washington & Jefferson College Computational Science Understanding computing cultures Bioinformatics and art history

Page 3: Interdisciplinary Approaches to Metadata

Black Death and its Effect on Iconography

Andrea Orcagna. (1354-1357). Strozzi Altarpiece. Tempera on Wood.

“Certainly there have been plenty of skillful painters, and they have painted in a manner that is impossible for human hand to equal; but this art has grown and continues to grow worse day by day.” ~ Franco Sacchetti (c. 1390) attributed to Taddeo Gaddi

Page 4: Interdisciplinary Approaches to Metadata

Possible effects of the Black Death New conservatism in technique New workshop practices New markets

Pietro Lorenzetti. (1335-1342). Nativity of the Virgin.

Page 5: Interdisciplinary Approaches to Metadata
Page 6: Interdisciplinary Approaches to Metadata

Possible computational approaches Compute vanishing points Connect colors to material culture Measure brushstroke

Pietro Lorenzetti. (1335-1342). Nativity of the Virgin.

Page 7: Interdisciplinary Approaches to Metadata

Pietro Lorenzetti. (1335-1342). Nativity of the Virgin.

Page 8: Interdisciplinary Approaches to Metadata

New approach: Focus on art-historical metadata Analyze art historians’ metadata Index of Christian Art William R. Cook. (1996). Images of St. Francis of Assisi in Painting, Stone and Glass from the Earliest Images to Ca. 1320 in Italy. A Catalogue.

Page 9: Interdisciplinary Approaches to Metadata

Test Case 1: Networks and Iconography

Christ

Mary John

Giotto. (1290-1300). Crucifixion. Tempera on wood.

Page 10: Interdisciplinary Approaches to Metadata
Page 11: Interdisciplinary Approaches to Metadata
Page 12: Interdisciplinary Approaches to Metadata

Clare: 1255

Legenda Maior: 1263

Louis: 1317

Page 13: Interdisciplinary Approaches to Metadata

Test Case 2: Metadata from the Index of Christian Art

Page 14: Interdisciplinary Approaches to Metadata

Black Death as a Natural Experiment

1300 - 1349 1350 – 1399 Sailko/CC-BY-SA-3.0

Page 15: Interdisciplinary Approaches to Metadata

Bioinformatics, Annotations, Ontologies GCATTAATGGCATACGTGGCCCCA

GCAUUAAUGGCAUACGUGGCCCCA

ALALEUMETALATYRVALALAPRO

DNA to RNA (Transcription)

RNA to Amino Acid (Translation)

AA to Protein (Folding)

Page 16: Interdisciplinary Approaches to Metadata

Differential Expression in Bioinformatics Compare Wild Type and Mutant Plot expression levels in a heat map Label genes with annotations

Page 17: Interdisciplinary Approaches to Metadata

Differential Expression in Iconography Symbol 1300-1349 1350-1399

Virgin Mary and Christ Child 168 93

Madonna of Humility 2 25

Lawrence of Rome, Deacon 4 25

Fra Angelico. (c. 1430). Madonna of Humility.

Page 18: Interdisciplinary Approaches to Metadata

Differential Expression in Iconography Symbol 1300-1349 1350-1399 Anthony the Great 7 63