Upload
joe-cross
View
215
Download
3
Embed Size (px)
DESCRIPTION
DNA Barcoding allows us to identify any species form its DNA
Citation preview
DNA Barcoding and Undergraduate Science
A Case Study
ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG
Organism is sampled DNA is extracted “Barcode” amplified
Sequenced DNA is compared with a barcode database
How DNA barcoding works
7/31/2014 3
Major database for DNA Barcode data is BOLD
DNA Barcoding-Why Do it?
•Species are vanishing quickly-barcoding allows non-expertsto identify species without needing to be a trained taxonomist and in a short period of time
•Allows us to document all species in an ecosystem relatively quickly, helps with conservation efforts
•Is now being used to test the labelling on food products and to aid quarantine efforts to stop the trade in endangered species
31/07/2014 4
DNA barcoding is engaging in the classroom, and directs curiosity to opportunities for practical inquiry…
7/31/2014 6
Education and DNA Barcode projects in the USA
2 MAJOR PROJECTS, 2 Different approaches
1. Urban Barcode Project: small groups of high students matched with a mentor, devise project, compete for a prize. Projects derive data from species and food products in NYC urban area
7/31/2014 7
2. Coastal Marine Biolabs are leading a student-centeredcampaign, Barcoding Life’s Matrix, to generate reference barcodes for fish and invertebrate species that provide vital signs of marine ecosystem health. Student groups attend a residential camp, and assist scientists in collection, DNA extraction, PCR and data analysis of species in an area of Southern California
Education and DNA Barcode projects in the USA
31 July 2014 8
Outline of Holmesglen Projects
Students doing Diploma of Laboratory Technology (2 years).
leads to jobs as lab techs or research assistants, or students go on to higher degrees.
Ages ~19-45.
Carried out over 8 weeks. Printed project booklet given out to each student.
Assessed by presentation at departmental seminar and printed report in scientific report format
Outline of Holmesglen Projects .
Holmesglen has incorporated elements of both the USA projects
2012 our projects similar to the NYC Urban Barcode Project.
2013 students spent an extended period in a remote area making collections, project more similar to CMB
2014………….??
31/07/2014 9
Week 1. Brainstorming Session
Decide on a question they would like to answer and draw
up a plan for how to do this. (eg what chillie species are
grown and sold in Melbourne, what species can be found
in a rainforest area in the Rubicon state forest?)
They should also develop a hypothesis (eg that you will
find a variety of species labeled as “flake”. flake is a
generic name for shark in Australia.)
31/07/2014 10
Weeks 2-4 Sample Collection, Genomic DNA Extraction, PCR
Students visiting
markets or out in field
Take pics of samples
and record other data
with DNA Barcode
app for iPad and
iPhone (Android app
in pipeline)
11
7/31/2014 12
RLC and Rubicon State Forest
7/31/2014 13
RLC and Rubicon State Forest
Week 5. Analysis of Sequencing Data
Then put forward and reverse
trace sequences into DNA
subway (part of the Urban
Barcode Project
Or
Student Data Portal of BOLD
(SDP) The SDP has a very
intuitive interface, and has extra
features which from an educator’s
point of view are very useful,
such as the ability to monitor
student groups easily, to accept
or reject data, and to record
which students did which work31/07/2014 14
Week 6. Input Data to Atlas of Living Australia and BOLD
Our students inputted
plant species data into the
Atlas, which has links with
the international site,
Barcode of Life Database (
BOLD).
Fish sample data was
inputted directly to BOLD
through the SPD
This data is real
scientific data
31/07/2014 15
7/31/2014 16
Week 8. Seminar Presentations
Final seminar: Invite other staff and students, people
from outside school
My students complained that the audience wasn’t big
enough!
31/07/2014 17
Holmesglen Barcoding
Website
31/07/2014 18
Educational Benefits!
•Student engagement, motivation
•Learning to do real science
•Resume building
•Using a range of skills (PBL) (chemistry, maths)
•Independence, problem solving31/07/2014 19