Topic BIOSYTHESIS OF RNA

RNA

A polymeric constituent of all living cells and many viruses, consisting of a long, usually single-stranded chain of alternating phosphate and ribose units with the bases adenine, guanine, cytosine, and uracil bonded to the ribose. RNA molecules are involved in protein synthesis and sometimes in the transmission of genetic information. Also called ribonucleic acid.

 

RNA & DNA: Similarity

Both RNA & DNA:Unbranched polymers

Nucleoside monophosphate

Phosphodiester bonds

RNA & DNA: DifferencesRNASingle-Strand (mostly)Modified basesRiboseProtein BiosynthesisPost-transcriptional events

DNADoubleDeoxyriboseStorage &transferDNA Repair

The first product of transcription differs in prokaryotic cells from that of eukaryotic cells, as in prokaryotic cells the product is mRNA, which needs no post-transcriptional modification, whereas, in eukaryotic cells, the first product is called primary transcript, that needs post-transcriptional modification (capping with 7-methyl-guanosine, tailing with a poly A tail) to give hnRNA (heterophil nuclear RNA). hnRNA then undergoes splicing of introns (noncoding parts of the gene) via spliceosomes to produce the final mRNA.

Biosynthesis of RNAThe biosynthesis of RNA, called

transcription, proceeds in much the same fashion as the replication of DNA and also follows the base pairing principle. Again, a section of DNA double helix is uncoiled and only one of the DNA strands serves as a template for RNA polymerase enzyme to guide the synthesis of RNA. After the synthesis is complete, the RNA separates from the DNA and the DNA recoils into its helix.

One major difference

is that the

heterocyclic amine,

adenine, on DNA

codes for the

incorporation of

uracil in RNA rather

than thymine as in

DNA.

RNA Transcription ProcessThe RNA transcription process occurs

in three stages1. Initiation

2. Chain elongation 3. Termination

RNA Synthesis (Transcription)

Transcription: the copying process which uses one of the two DNA strands (template strand) to form RNAOther DNA strand: coding strand Similar to RNA strand (with exception)

Transcription is highly selective: Some DNA regions form many, other form few or no transcripts

Transcription The selectivity is due to

signals in the DNA nucleotide sequence

The signals convey a message toRNA polymerase to define:

Where polymerase should start? How often? (frequency) Where to stop? (termination)

RNA

Polymerase-

Promoter

Complex

The first stage occurs when the RNA Polymerase-Promoter Complex binds to the promoter gene in the DNA. This also allows for the finding of the start sequence for the RNA polymerase. The promoter enzyme will not work unless the sigma protein is present (shown in blue in graphic). Specific sequences on the non coding strand of DNA are recognized as the signal to start the unwinding process.

The recognition sequences are as follows:

Non-coding DNA -5' recognition sections in bold

GGCCGCTTGACAAAAGTGTTAAATTGTGCTATACT

RNA Polymerase - Elongation

The elongation begins when the RNA polymerase "reads" the template DNA. Only one strand of the DNA

is read for the base sequence. The RNA which is synthesized is the complementary strand of the DNA.

The RNA (top strand) and DNA (bottom strand) sequences in the model are:

5' -GACCAGGCA-3'3'-TCTGGTCCGTAAA-5'

In the next reaction step, uracil triphosphate (UTP) is the next to be added to the RNA by bind and pairing with the adenine (A) nucleotide on the template DNA strand. A phosphodiester bond is formed; the RNA chain is than elongated to 10 nucleotides; and diphosphate left over would dissociate.

The final event that must occur in the transcription process is the termination of chain elongation at a gene's end. Genetic signals that dictate this event are presumed to be encoded in the DNA, and there is evidence that a protein factor called rho (p) and discovered by J. Roberts (1969) in E. coli may participate as well. The rho termination factor is a protein which has a molecular weight of 200,000 daltons and four polypeptide chains of 50,000 dalton molecular weight. It is capable of recognizing some DNA sequences that function as termination signals

Transcription – 11Termination

A-The rho (ρ)-dependent termination:The ρ-factor binds to C-rich near 3’-end of RNAIt has ATP-dependent DNA-RNA helicase activity

Hydrolyzes ATP (Energy-dependent)Unwind 3’-end of the transcript from template

Movement of (ρ) protein along RNA/DNA hybrid 5’-3’Displacement of DNA template at termination site, releasing of RNA transcript

Thanks..!!!