Transcript
Page 1: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Ventana Medical Systems, Inc.1910 E. Innovation Park DriveTucson, Arizona 85755USA+1 (520) 887 2155(800) 227 2155

www.ventana.com

© 2012 Ventana Medical Systems, Inc.

VENTANA, the VENTANA logo, BENCHMARK, ChipMap, CONFIRM, INFORM, NEXES, Optisure, PATHWAY, RiboMap, iScan, SYMPHONY, ultraView, VANTAGE, VIAS and VIRTUOSO are trademarks of Roche.All other trademarks are the properties of their respective owners.N2448 1211A

Ventana Medical System

s, Inc. 2012 Product Catalog | R

esearch Applications

2012 Product Catalog research applications

Page 2: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research
Page 3: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Advanced product portfoliofor exceptional life sciences research.

800.227.2155 | www.ventana.com iii

Page 4: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Smart Systems. |

iv Ventana Medical Systems, Inc. | 800.227.2155

Page 5: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

800.227.2155 | www.ventana.com v

Page 6: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

vi Ventana Medical Systems, Inc. | 800.227.2155

Page 7: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Smart Diagnostics. |

800.227.2155 | www.ventana.com vii

Page 8: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

viii Ventana Medical Systems, Inc. | 800.227.2155

Page 9: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Smart Results. |

800.227.2155 | www.ventana.com ix

Page 10: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Smart Systems |

Smart Diagnostics |

Smart Results |

We innovate staining platforms and workflow solutions that enable you to handle slides individually, even at your highest volumes. You can count on the people who delivered the first fully automated IHC, ISH, and FISH slide staining capabilities to deliver the highest level of sophistication and consistency to your lab.

Guided by science, we have developed the industry’s largest, most advanced portfolio of pre-diluted, ready-to-use reagents to support your lab. All of our exceptional reagents are specially optimized for use on our cutting-edge instrumentation, to maximize the efficiency, precision, and quality of all your research assays.

Our Smart Systems are a comprehensive set of the tools you need to deliver the results you want.

x Ventana Medical Systems, Inc. | 800.227.2155

Page 11: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Now available | The lab of the future.

Experience the ease and confidence that comes with one-stop shopping for optimized, ready-to-use reagents, fully-integrated, highly flexible automated staining platforms, and world-class technical support, training and customer care—all from a strategic partner who is uniquely positioned to deliver the most advanced research staining solutions to any lab, anywhere in the world, right now.

800.227.2155 | www.ventana.com xi

Page 12: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

xii Ventana Medical Systems, Inc. | 800.227.2155

Page 13: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

TABLE OF CONTENTS

VENTANA DISCOVERY 1

IHC / ISH 5DISCOVERY ULTRA 7DISCOVERY XT 11Primary antibodies 18Spring BioScience antibodies 132Detection 134Ancillary and bulks 145The CLAD process 150

Molecular probes 153

H&E 159SYMPHONY fully automated H&E system 161

Special stains 165NexES Special Stains 167Special stains 170Ancillary reagents 182

Digital pathology 183iScan Coreo Au slide scanner 185

IVD companion diagnostics services 187Translational diagnostics 188

Support 191Technical education 193Customer support center 196Support and maintenance agreements 198Field operations 201Customer care 203

Appendix 205General terms and conditions 206Index 207

800.227.2155 | www.ventana.com xiii

Page 14: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

xiv Ventana Medical Systems, Inc. | 800.227.2155

Page 15: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

VENTANA DISCOVERY |

800.227.2155 | www.ventana.com 1

Page 16: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

2 Ventana Medical Systems, Inc. | 800.227.2155

Page 17: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

VENTANA DISCOVERY

The VENTANA DISCOVERY product line provides best-in-class instrumentation and reagents to the life sciences research market. Structured within the broader Translational Diagnostics (TDx) organization, the mission of the DISCOVERY team is to foster strategic partnerships with key market influencers that support high medical value innovations in IHC, ISH, FISH, and IF research, ultimately advancing medical science.

The DISCOVERY business currently serves customers on a worldwide basis, anywhere tissue-based innovators are found. We have a dedicated DISCOVERY sales & support organization devoted exclusively to serving researchers within North America. The team includes seasoned account managers and highly trained scientists who provide on-site consultations & support. We also have dedicated training & support personnel based in Tucson, to assist in working up proof-of-principle or difficult applications for customers. Our product development organization remains focused on advancing capabilities & developing new products exclusively for research customers.

The DISCOVERY business is organized to serve a broad range of customers, including pharmaceutical & biotech companies, contract/clinical research organizations (CRO’s), government research laboratories, and key opinion leaders (KOL’s). The DISCOVERY series integrated systems, including instrumentation, reagents, and software, offer the following benefits:• Automation and optimization capabilities• End-user application support • Reproducibility, sensitivity, and high performance

All reagents are manufactured and quality-tested within our Tucson-based pilot plant. DISCOVERY instruments feature significantly advanced software & protocol development flexibility, enabling researchers to test the boundaries of tissue-based research, all while retaining reproducibility through standardization & automation.

VENTANA DISCOVERY | VENTANA DISCOVERY

800.227.2155 | www.ventana.com 3

Page 18: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

4 Ventana Medical Systems, Inc. | 800.227.2155

Page 19: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

IHC & ISH |DISCOVERY ULTRA independent slide staining system 7

DISCOVERY XT automated slide staining system 11Primary antibodies by alphabetical listing 18

Spring BioScience antibodies 132Detection chemistries 134

Ancillary and bulks 145The CLAD process 150

800.227.2155 | www.ventana.com 5

Page 20: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

6 Ventana Medical Systems, Inc. | 800.227.2155

Page 21: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

DISCOVERY ULTRAindependent slide staining system

Beyond traditional staining platforms that require you to fit your chemistries to their systems, the DISCOVERY ULTRA system is adaptable to a broad array of tissue testing capabilities. From developing novel assays on low-expressing biomarkers to enabling the highest level of experimental complexity, DISCOVERY ULTRA accelerates IHC and ISH research, offering innovators significant improvements in ease of use, workflow, and system flexibility.Flexibility• Unmatched protocol flexibility for rapid assay

development• Run 30 completely independent protocols for improved

workflow• Choose your own antibodies, probes, pretreatments,

fluorescence, linkers and blockers• Select the detection chemistry that best meets your

needs

Reproducibility• Fully automated slide processing, baking through

staining• Ready-to-use optimized reagents• Apply precise heating to each slide individually for

greater control over IHC/ISH reactions• Save 5,000 protocols for better assay development

recording/tracking

Features and benefits Advanced deparaffinization & pretreatment options• Improved staining quality & morphology• Increased signal to noise ratio• Easy to interpret & more reliable results

30 independent reaction chambers• Speed method development by employing a higher

level of testing complexity within a single run• Run manual applications and fully

automated protocols simultaneously• Conduct IHC and ISH dual stain sequences

on the same slide or side by side

Add and remove slides while system is running, to save valuable development time

Incubate offline for maximum flexibility

Flexible buffers and bulk reservoirs• Increase staining capacity without

replenishing bulk fluids• Add bulk reagents while system is

running to enhance workflow

For Research Use Only. Not for use in diagnostic procedures.

DISCOVERY ULTRA | IHC_ISH

800.227.2155 | www.ventana.com 7

Page 22: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

For Research Use Only. Not for use in diagnostic procedures.

IHC_ISH | DISCOVERY ULTRA

8 Ventana Medical Systems, Inc. | 800.227.2155

General characteristics

Capability • Automated baking, deparaffinization, cell conditioning and staining, including IHC, ISH, SISH, FITC, multiparameter staining (dual, triple); titration

Slide drawers • 30 independent slide reaction chambers with dedicated bulk reagent supply lines and individual slide heaters

Reagent carousel • 35 reagent positions

Slides • 25 x 75 mm, 1 x 3 inches or 26 x 76 mm

Modularity • One to eight staining systems may be controlled from one VENTANA system software computer system

Water quality • (S/B NCCLS) Type II water or equivalent

Bulk reagents • Up to 7 different bulk reagents in 3 to 6 liter on-board containers

Configuration • Free standing

Certifications • CSA and EMC compliant (research use only)

Catalog number • N750-DISU-FS

Environmental requirements

BTU/hour output • 400 BTU/Hr idle, 1000 BTU/hr running

Room temperature • 20ºC to 32ºC (68ºF to 90ºF)

Humidity • 10% to 90%, non-condensing

Location • Flat, level surface. No direct sunlight or drafts. Remove from direct source of heat and moisture.

Physical characteristics

Size - closed(Width x depth x height)

• 44.00" x 33.10" x 62.40" (111.76 x 84.07 x 158.50 cm)

Weight • 650 lbs. (294.8 kg)

Clearances Top Sides Rear

15" (38.1 cm) 4" (10.2 cm) 6" (15.2 cm)

Temperature control

Slide temperature range • Ambient to 100ºC

Electrical specifications US and Canada Europe Japan

Voltage 120 VAC ± 10% 230 VAC ± 10% 100 VAC ± 10%

Current 6 amps 4 amps 6 amps

Frequency 60 Hz 50 Hz 50/60 Hz

Power connection Cord suited to country. For U.S., standard 3-prong grounded.

DISCOVERY ULTRA

Specifications

Page 23: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Ordering information

Product Part number DescriptionDISCOVERY ULTRAautomated slide preparation system

N750-DISU-FS DISCOVERY ULTRA, full system(s) — ~110 v, 50/60 Hz. For US and Canada only.

Computer system17" Flat screen monitorPrinterStaining moduleAccessory kit #1Accessory kit #2Power strip

750-6022482000750-005750-60016974002505700750-000

E-Bar II bar code slide label systemSlide labeling system kit packWaste container and cartGraduated carboy (20L)Bottle kit, DISCOVERY ULTRA

163280014187021650800119670006376525001

DISCOVERY ULTRAadd-on Module(s)

N750-DISU-M DISCOVERY ULTRA Staining Module — ~100v, 50/60 Hz. For US and Canada only.

Staining ModuleAccessory Kit #1Accessory Kit #2Power Strip

750-60016974002505700753-000

Waste container and cartGraduated carboy (20L)Bottle kit, DISCOVERY ULTRA

1650800119670006376525001

For Research Use Only. Not for use in diagnostic procedures.

DISCOVERY ULTRA | IHC_ISH

800.227.2155 | www.ventana.com 9

Page 24: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

IHC_ISH | DISCOVERY ULTRA

10 Ventana Medical Systems, Inc. | 800.227.2155

Page 25: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

DISCOVERY XTautomated slide staining system

The DISCOVERY XT system brings full automation, reproducibility and productivity to immunohistochemistry (IHC), in situ hybridization (ISH) and microarray slide preparation and processing. Use the flexible DISCOVERY XT platform to accelerate the discovery of new targets and biomarkers, speed assay development and target validation, and quickly determine the toxicity of new drug candidates in the preclinical phase.

Flexibility• Process IHC, ISH, TMA or DNA microarray samples

independently or simultaneously• Develop protocols with flexible options to design matrix

experiments

Reproducibility• Minimize experiment repeats with the automation of all

slide processing steps – from baking through staining.• Enhance slide-to-slide and run-to run reproducibility

with ready-to-use, automation optimized reagents

Productivity• Automate all slide processing steps – from baking

through staining• Develop assays for validation and process up to 30

matrix experiments in a single run• Process up to 60 IHC slides in 7 hours or up to 480 slides

with additional modules• Increase your throughput with rapid turnaround time• Enhance your productivity with unattended overnight

slide processing• Reduce experimental repeats with standardized slide

handling• Reduce antibody utilization with optimized reaction

kinetics• Run up to 8 VENTANA slide processing modules from a

single command center• Save time and reduce errors with optimized, ready-to-

use reagents• Gain walk-away convenience and operational simplicity

with patented slide barcoding and protocol encryption

For Research Use Only. Not for use in diagnostic procedures.

DISCOVERY XT | IHC_ISH

800.227.2155 | www.ventana.com 11

Page 26: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

IHC_ISH | DISCOVERY XT

12 Ventana Medical Systems, Inc. | 800.227.2155

General characteristics

Slide tray • 1-30 slides with independent temperature control for each position

Capability • IHC, ISH, FISH, tissue microarray (TMA) and DNA microarray*

Reagent carousel • 35 reagent positions

Slides • 25 x 75 mm, 1 x 3 inches or 26 x 76 mm Superfrost Plus

Modularity • 1-8 DISCOVERY XT and/or other VENTANA systems may be controlled from one control center

Water quality • NCCLS Type II water or equivalent (referred to as deionized water)

Bulk reagents • Up to seven different bulk reagents in 3 to 6 liter on-board containers

Configurations • Floor mounted

Certifications • CSA and CE compliant (Research use only)

Temperature control

ThermoPad temperature range

• 37° C to 100° C ± 2.0° C

Environmental requirements

Heat • Output 400 BTU/Hour idle, 1000 BTU/Hour running

Operating temperature • 20° C to 32° C (68° F to 90° F). Note: The instrument may be unable to maintain proper reaction temperature if laboratory ambient temperature exceeds the specified temperature range.

Humidity • 10% to 90%, non-condensing

Location • Flat, level surface. No direct sunlight or drafts. Remove from sources of direct heat and moisture. Maximum altitude 6000’ (1828m) above sea level. For indoor use only. Do not position the instrument so that it is difficult to remove the main plug from the power outlet.

Electrical requirements U.S. Japan Europe

Voltage 120 VAC ±10% 100 VAC ±10% 230 VAC ±10%

Current 6 Amps 6 Amps 4 Amps

Frequency 60 Hz. 50/60 Hz. 50 Hz.

Power connection Cord suited to country. For U.S., standard 3-prong grounded

Physical characteristics Stainer assembly

Size (W x D x H) • 35" x 26" x 60.25" (88.9 x 66.0 x 153.0 cm)

Weight • 385 lbs (175 kg)

Clearances • Top 15" (38.1 cm)Sides 4" (10.2cm)Rear 6" (15.2 cm)

DISCOVERY XT

*Ventana is not licensed under any patents owned by Oxford Gene Technology Limited or related companies(“OGT”) and cannot pass any such license to its customers. A license under OGT’s patents may be necessaryto manufacture or use oligonucleotide arrays. To enquire about a license under OGT’s oligonucleotide arraypatents, please contact [email protected]. For information about OGT visit www.ogt.co.uk.

Specifications

For Research Use Only. Not for use in diagnostic procedures.

Page 27: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

DISCOVERY XT | IHC_ISH

800.227.2155 | www.ventana.com 13

Ordering information

Product Part Number Description

DISCOVERY XT automated slide staining system

750-DISXT-FS 30 slide positions with variable temperature control and flexible software options — 110v, 50/60Hz. For US and Canada only.

Computer systemStaining moduleAccessory kit #1Accessory kit#2

750-012750-70119635001981600

Power stripWaste container and cartGraduated carboy (20L)Assy, bottle ship kit

322-001165080011967001872600

DISCOVERY XT add-on module

750-DISXT-M 100v, 50/60 Hz. For US and Canada only.

Staining moduleAccessory kit #1Accessory kit #2Power stripWaste container and cartGraduated carboy (20L)

750-70019635001981600753-00016508001196700

DISCOVERY series accessories

Product Part Number Description

Dispenser rack 321-044 Reagent dispenser storage rack — gray

Graduated carboy 1196700 20L receptacle for storage of diluted bulk solutions

Temperature verifier slides (10) 970-021 Used for independent testing of slide heater function; 10 slides

Waste container 1468900 Replacement waste container with spigot

Waste container cart 1465200 Rolling cart used to hold waste container on DISCOVERY series systems

E-Bar II slide label system and accessories

Product Part Number Description

E-Bar II bar code slide label system

1632800 E-Bar electronic bar code labelling and printing system - printer ~100-240 v, 50/60 Hz.

Cable, parallel interfacePower cord (US/CAN)Power cord (INTL)Printer ribbon, E-BarHead cleaning pen

13471001490500149010016329001490000

Insert sheet, quick setupInsert sheet, ordering informationE-Bar mylar shields (5 shields/pkg)Power supplyE-Bar label kit

14904001490300182900014902001418702

E-Bar printer ribbon 1632900 Prints 8,100 labels.

Labels 1358501 1 roll of 500 labels.

E-Bar Label Kit 1418702 5 rolls of 500 labels and 5 mylar shields. Printer ribbon not included.

For Research Use Only. Not for use in diagnostic procedures.

Page 28: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

250 Test Antibody User Fillable Dispensers

Product Part Part Number250 Test Antibody # 1 770-001250 Test Antibody # 2 770-002250 Test Antibody # 3 770-003250 Test Antibody # 4 770-004250 Test Antibody # 5 770-005250 Test Antibody # 6 770-006250 Test Antibody # 7 770-007250 Test Antibody # 8 770-008250 Test Antibody # 9 770-009250 Test Antibody # 10 770-010250 Test Antibody # 11 770-011250 Test Antibody # 12 770-012250 Test Antibody # 13 770-013250 Test Antibody # 14 770-014250 Test Antibody # 15 770-015250 Test Antibody # 16 770-016250 Test Antibody # 17 770-017250 Test Antibody # 18 770-018250 Test Antibody # 19 770-019250 Test Antibody # 20 770-020250 Test Antibody # 21 770-021250 Test Antibody # 22 770-022250 Test Antibody # 23 770-023250 Test Antibody # 24 770-024250 Test Antibody # 25 770-025250 Test Antibody # 26 770-026250 Test Antibody # 27 770-027250 Test Antibody # 28 770-028250 Test Antibody # 29 770-029250 Test Antibody # 30 770-030250 Test Antibody # 31 770-031250 Test Antibody # 32 770-032250 Test Antibody # 33 770-033250 Test Antibody # 34 770-034250 Test Antibody # 35 770-035250 Test Antibody # 36 770-036250 Test Antibody # 37 770-037250 Test Antibody # 38 770-038250 Test Antibody # 39 770-039

Product Part Part Number250 Test Antibody # 40 770-040250 Test Antibody # 41 770-041250 Test Antibody # 42 770-042250 Test Antibody # 43 770-043250 Test Antibody # 44 770-044250 Test Antibody # 45 770-045250 Test Antibody # 46 770-046250 Test Antibody # 47 770-047250 Test Antibody # 48 770-048250 Test Antibody # 49 770-049250 Test Antibody # 50 770-050250 Test Antibody # 51 770-051250 Test Antibody # 52 770-052250 Test Antibody # 53 770-053250 Test Antibody # 54 770-054250 Test Antibody # 55 770-055250 Test Antibody # 56 770-056250 Test Antibody # 57 770-057250 Test Antibody # 58 770-058250 Test Antibody # 59 770-059250 Test Antibody # 60 770-060250 Test Antibody # 61 770-061250 Test Antibody # 62 770-062250 Test Antibody # 63 770-063250 Test Antibody # 64 770-064250 Test Antibody # 65 770-065250 Test Antibody # 66 770-066250 Test Antibody # 67 770-067250 Test Antibody # 68 770-068250 Test Antibody # 69 770-069250 Test Antibody # 70 770-070250 Test Antibody # 71 770-071250 Test Antibody # 72 770-072250 Test Antibody # 73 770-073250 Test Antibody # 74 770-074250 Test Antibody # 75 770-075250 Test Antibody # 76 770-076250 Test Antibody # 77 770-077250 Test Antibody # 78 770-078

IHC_ISH | DISCOVERY XT

14 Ventana Medical Systems, Inc. | 800.227.2155

Page 29: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Product Part Part Number250 Test Antibody # 79 770-079250 Test Antibody # 80 770-080250 Test Antibody # 81 770-081250 Test Antibody # 82 770-082250 Test Antibody # 83 770-083250 Test Antibody # 84 770-084250 Test Antibody # 85 770-085250 Test Antibody # 86 770-086250 Test Antibody # 87 770-087250 Test Antibody # 88 770-088250 Test Antibody # 89 770-089250 Test Antibody # 90 770-090250 Test Antibody # 91 770-091250 Test Antibody # 92 770-092250 Test Antibody # 93 770-093250 Test Antibody # 94 770-094250 Test Antibody # 95 770-095250 Test Antibody # 96 770-096250 Test Antibody # 97 770-097250 Test Antibody # 98 770-098250 Test Antibody # 99 770-099250 Test Antibody # 100 770-100250 Test Antibody # 101 770-101250 Test Antibody # 102 770-102250 Test Antibody # 103 770-103250 Test Antibody # 104 770-104250 Test Antibody # 105 770-105250 Test Antibody # 106 770-106250 Test Antibody # 107 770-107250 Test Antibody # 108 770-108250 Test Antibody # 109 770-109250 Test Antibody # 110 770-110250 Test Antibody # 111 770-111250 Test Antibody # 112 770-112250 Test Antibody # 113 770-113250 Test Antibody # 114 770-114250 Test Antibody # 115 770-115250 Test Antibody # 116 770-116250 Test Antibody # 117 770-117250 Test Antibody # 118 770-118

Product Part Part Number250 Test Antibody # 119 770-119250 Test Antibody # 120 770-120250 Test Antibody # 121 770-121250 Test Antibody # 122 770-122250 Test Antibody # 123 770-123250 Test Antibody # 124 770-124250 Test Antibody # 125 770-125250 Test Antibody # 126 770-126250 Test Antibody # 127 770-127250 Test Antibody # 128 770-128250 Test Antibody # 129 770-129250 Test Antibody # 130 770-130250 Test Antibody # 131 770-131250 Test Antibody # 132 770-132250 Test Antibody # 133 770-133250 Test Antibody # 134 770-134250 Test Antibody # 135 770-135250 Test Antibody # 136 770-136250 Test Antibody # 137 770-137250 Test Antibody # 138 770-138250 Test Antibody # 139 770-139250 Test Antibody # 140 770-140250 Test Antibody # 141 770-141250 Test Antibody # 142 770-142250 Test Antibody # 143 770-143250 Test Antibody # 144 770-144250 Test Antibody # 145 770-145250 Test Antibody # 146 770-146250 Test Antibody # 147 770-147250 Test Antibody # 148 770-148250 Test Antibody # 149 770-149250 Test Antibody # 150 770-150

DISCOVERY XT | IHC_ISH

800.227.2155 | www.ventana.com 15

Page 30: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

User-fillable Enzyme dispensers

Product Part Part Number250 Test Enzyme # 1 771-721250 Test Enzyme # 2 771-722250 Test Enzyme # 3 771-723250 Test Enzyme # 4 771-724250 Test Enzyme # 5 771-725250 Test Enzyme # 6 771-726250 Test Enzyme # 7 771-727250 Test Enzyme # 8 771-728250 Test Enzyme # 9 771-729250 Test Enzyme # 10 771-730

User-fillable Fixative dispensers

Product Part Part Number250 Test Fixative # 1 771-731250 Test Fixative # 2 771-732250 Test Fixative # 3 771-733250 Test Fixative # 4 771-734250 Test Fixative # 5 771-735250 Test Fixative # 6 771-736250 Test Fixative # 7 771-737250 Test Fixative # 8 771-738250 Test Fixative # 9 771-739250 Test Fixative # 10 771-740

User-fillable Counterstain dispensers

Product Part Part Number250 Test Counterstain # 1 771-741250 Test Counterstain # 2 771-742250 Test Counterstain # 3 771-743250 Test Counterstain # 4 771-744250 Test Counterstain # 5 771-745250 Test Counterstain # 6 771-746250 Test Counterstain # 7 771-747250 Test Counterstain # 8 771-748250 Test Counterstain # 9 771-749250 Test Counterstain # 10 771-750

User-fillable Option dispensers

Product Part Part Number250 Test Option # 1 771-751250 Test Option # 2 771-752250 Test Option # 3 771-753250 Test Option # 4 771-754250 Test Option # 5 771-755250 Test Option # 6 771-756250 Test Option # 7 771-757250 Test Option # 8 771-758250 Test Option # 9 771-759250 Test Option # 10 771-760

User-fillable ISH probe dispensers

Product Part Part NumberISH probe 1 253-4369ISH probe 2 253-4370ISH probe 3 253-4399ISH probe 4 253-4400ISH probe 5 253-4401ISH probe 6 253-4402ISH probe 7 253-4403ISH probe 8 253-4304ISH probe 9 253-4405ISH probe 10 253-4406

User-fillable dispenser Anti-Hapten dispensers

Product Part Part NumberAnti-Hapten Antibody 1 253-4565 Anti-Hapten Antibody 2 253-4566Anti-Hapten Antibody 3 253-4567Anti-Hapten Antibody 4 253-4568Anti-Hapten Antibody 5 253-4569250 Test Light Sensitive Dispenser 760-205 Replacement Filters (20 Filters) 772-100

IHC_ISH | DISCOVERY XT

16 Ventana Medical Systems, Inc. | 800.227.2155

Page 31: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

250 Test Detection

Product Part Part Number250 Test Detection # 1 960-911250 Test Detection # 2 960-912250 Test Detection # 3 960-913250 Test Detection # 4 960-914250 Test Detection # 5 960-915250 Test Detection # 6 960-916250 Test Detection # 7 960-917250 Test Detection # 8 960-918250 Test Detection # 9 960-919250 Test Detection # 10 960-920250 Test Detection # 11 960-921250 Test Detection # 12 960-922250 Test Detection # 13 960-923250 Test Detection # 14 960-924250 Test Detection # 15 960-925250 Test Detection # 16 960-926250 Test Detection # 17 960-927250 Test Detection # 18 960-928250 Test Detection # 19 960-929250 Test Detection # 20 960-930

250 Test Blockers

Product Part Part Number250 Test Blocker # 1 760-4206250 Test Blocker # 2 760-4207250 Test Blocker # 3 760-4208250 Test Blocker # 4 760-4209250 Test Blocker # 5 760-4210

250 Test Pretreatments

Product Part Part Number250 Test Pretreatment # 1 960-901250 Test Pretreatment # 2 960-902250 Test Pretreatment # 3 960-903250 Test Pretreatment # 4 960-904250 Test Pretreatment # 5 960-905250 Test Pretreatment # 6 960-906250 Test Pretreatment # 7 960-907250 Test Pretreatment # 8 960-908250 Test Pretreatment # 9 960-909250 Test Pretreatment # 10 960-910

250 Test Probes

Product Part Part Number250 Test Probe # 1 960-761250 Test Probe # 2 960-762250 Test Probe # 3 960-763250 Test Probe # 4 960-764250 Test Probe # 5 960-765250 Test Probe # 6 960-766250 Test Probe # 7 960-767250 Test Probe # 8 960-768250 Test Probe # 9 960-769250 Test Probe # 10 960-770250 Test Probe # 11 960-771250 Test Probe # 12 960-772250 Test Probe # 13 960-773250 Test Probe # 14 960-774250 Test Probe # 15 960-775250 Test Probe # 16 960-776250 Test Probe # 17 960-777250 Test Probe # 18 960-778250 Test Probe # 19 960-779250 Test Probe # 20 960-780250 Test Probe # 21 960-781250 Test Probe # 22 960-782250 Test Probe # 23 960-783250 Test Probe # 24 960-784250 Test Probe # 25 960-785

DISCOVERY XT | IHC_ISH

800.227.2155 | www.ventana.com 17

Page 32: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

a-1-Antichymotrypsin (ACT) (polyclonal)Catalog Number 760-2604Type Rabbit PolyclonalControl Histiocytic TumorsLocalization CytoplasmicQuantity 50 tests

Benign histiocytes

Descriptiona-1-Antichymotrypsin Primary Antibody reacts with histiocytes and histiocytic neoplasms. Its major application is defining the presence of a-1-Antichymotrypsin in histiocytes and tumors derived from them. In eosinophilic granuloma and malignant histiocytosis, the reaction for this marker is heterogeneous in intensity and distribution. In fibrous histiocytomas, on the other hand, a diffuse homogeneous reaction may be observed.

References1. Isaacson P, et al., Lancet. 2:964-965, 1979.2. Palmer PE, et al., Am J Clin Pathol. 62:350-354, 1974.3. Palmer PE, et al., Cancer. 45:1424-1431, 1980.

4. Kindblom LG, et al., Hum Pathol. 13:834-840, 1982.5. Raintoft I, et al., Hum Pathol. 10:419-424, 1979.

a-1-Antitrypsin (AAT) (polyclonal)Catalog Number 760-2605Type Rabbit PolyclonalControl Tonsil, Lymph Node, AppendixLocalization CytoplasmicQuantity 50 tests

Benign histiocytes

Descriptiona-1-Antitrypsin is considered to be very useful in the study of inherited AAT deficiency, benign and malignant hepatic tumors and yolk sac carcinomas. Positive staining for a-1-Antitrypsin may also be used in detection of benign and malignant lesions of an histiocytic nature. Sensitivity and specificity of the results have made this antibody a useful tool in the screening of patients with cryptogenic cirrhosis or other forms of liver disease with portal fibrosis of uncertain etiology.

References1. Isaacson P, et al., Lancet. 2:964-965, 1979.2. Palmer PE, et al., Am J Clin Pathol. 62:350-354, 1974.3. Palmer PE, et al., Cancer. 45:1424-1431, 1980.

4. Kindblom LG, et al., Hum Pathol. 13:834-840, 1982.5. Raintoft I, et al., Hum Pathol. 10:419-424, 1979.

Primary Antibodiesby alphabetical listing

IHC_ISH | Primary Antibodies

18 Ventana Medical Systems, Inc. | 800.227.2155

Page 33: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

a-1-Fetoprotein (AFP) (polyclonal)Catalog Number 760-2603Type Rabbit PolyclonalControl Fetal LiverLocalization CytoplasmicQuantity 50 tests

Hepatocellular carcinoma

DescriptionPositive staining with anti-AFP antibody is seen in hepatocytes of fetal liver and hepatoma. Since only the traces of AFP are found in adult serum, elevated levels suggest either a benign or malignant lesion of the liver, a yolk sac carcinoma or one of a few other tumors. In conjunction with elevated serum levels, AFP has been immunohistochemically demonstrated in yolk sac carcinomas of gonadal and extragonadal sites, in hepatic malignancies, and a few other neoplasms. The antigen is not denatured by most fixatives.

References1. Jacobsen GK, et al., Am J Surg Pathol. 5:257-66, 1981.2. Peyrol S, et al., Digestion. 18:351-370, 1978.3. Tsung SH, et al., Arch Pathol Lab Med. 101:572-574, 1977.

4. Goodman ZD, et al., Cancer. 55:124-135, 1985.5. Roth LM, et al., Cancer. 37:812-820, 1976.

Actin, Muscle (HUC1-1)Catalog Number 760-2502Type Mouse MonoclonalControl Skeletal MuscleLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Large intestine and vessel smooth muscle

DescriptionAnti-Actin, Muscle (HUC 1-1) may be used to aid in the identification of cells of normal and abnormal myocytic lineage as an aid in diagnosis of anaplastic tumors. Anti-Actin, Muscle (HUC 1-1) antibody is directed against an epitope present on muscle isoforms of actin, but not present on the cytoplasmic isoforms. Actin, at the ultrastructural level, consists of the diffusely distributed cytoplasmic microfilaments that characterize muscle cells. Monoclonal antibodies specific to muscle actins have allowed accurate localization to cell types. The clone HUC 1-1 shows similar immunocytochemical and biochemical characteristics to those reported for clone HHF35. In tissue sections, the HHF35 staining pattern and localization (cardiac, skeletal and smooth muscle cells, and myoepithelial cells) roughly parallels desmin reactivity.

References1. Sawtell NM, et al., Cell Motil Cytoskeleton. 11(4):318-25, 1988.2. True LD, Atlas of Diag Immunohistopathology. 1990; JB Lippincott Company Philadelphia.

3. Tsukada T, et al., Am J Pathol. 126(1):51-60, 1987.4. Tsukada T, et al., Am J Pathol. 127(2):389-402, 1987.5. Elias JM, Immunohistopathology. ASCP Press, Chicago, 1990.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 19

Page 34: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Actin, Muscle Specific (HHF35)Catalog Number 760-2601Type Mouse MonoclonalControl Skeletal MuscleLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Skeletal muscle

DescriptionActin is a major component of the cytoskeleton. This antibody recognizes actin of skeletal, cardiac and smooth muscle cells. It is not reactive with other mesenchymal cells except for Myoepithelium. Actin can be resolved on the basis of its isoelectric points into three distinctive components: alpha, beta, and gamma in order of increasing isoelectric point. Muscle Specific Actin recognizes alpha and gamma isotypes of all muscle groups. Non-muscle cells such as vascular endothelial cells and connective tissues are non-reactive. Also neoplastic cells of non-muscle-derived tissue such as carcinomas, melanomas and lymphomas are negative. This antibody is useful in the identification of rhabdoid cellular elements.

References1. Gown AM, et al., Am J Pathol. 125:191, 1986.2. Schmidt R, et al., Am J Pathol. 131:199, 1988.

3. Azumi N, et al., Modern Pathology. 1:469-474, 1988.

Actin, a-Smooth Muscle (1A4)Catalog Number 760-2833Type Mouse MonoclonalControl Appendix, UterusLocalization CytoplasmicQuantity 50 testsIsotype IgG

Colonic and blood

DescriptionActin is a major component of the cytoskeleton and is present in every cell type. Actin can be resolved on the basis of its isoelectric points into three distinctive components: alpha, beta, and gamma in order of increasing isoelectric point. Smooth Muscle Actin Ab does not stain cardiac or skeletal muscle, but, it will stain myofibroblasts and myoepithelial cells. This antibody could be used together with Muscle Specific Actin to distinguish leiomyosarcoma from rhabdomyosarcoma. In most cases of rhabdomyosarcoma, this antibody gives negative results, whereas Muscle Specific Actin is positive in the rhabdomyoblasts. Leiomyosarcomas are positive with both Muscle Specific Actin and Smooth Muscle Actin antibodies.

References1. Cooke PH, J Cell Biol. 68:539-556, 1976.2. Skalli O, et al., J Cell Biol. 103:2787-2796, 1986.3. Gown AM, et al., J Cell Biol. 100:807-813, 1985.

4. Kuroda M, Biochem Biophys Acta. 843:20-213, 1985.5. Lazarides E, J Histochem Cytochem. 223:507-528, 1975.

IHC_ISH | Primary Antibodies

20 Ventana Medical Systems, Inc. | 800.227.2155

Page 35: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Adrenocorticotropin (ACTH) (polyclonal)Catalog Number 760-2708Type Rabbit PolyclonalControl Normal PituitaryLocalization CytoplasmicQuantity 50 tests

Pituitary

DescriptionACTH is a useful marker in classification of pituitary tumors. It reacts with ACTH-producing cells (corticotrophs). It also may react with other tumors (e.g., some small cell carcinomas of the lung) causing paraneoplastic syndromes by secreting ACTH.

References1. Pizarro CB, et al., Braz J Med Biol Res. 37(2):235-43, 20042. Viacava P, et al., J Endocrinol Invest. 26(1):23-8, 2003.3. Kageyama K, et al., Am J Med Sci. 324(6):326-30, 2002.

4. Fan X, et al., J Histochem Cytochem. 50(11):1509-16, 20025. Japon MA, et al., J Clin Endocrinol Metab. 87(4):1879-84, 2002.

CONFIRM ALK1 (ALK01)Catalog Number 790-2918Type Mouse MonoclonalControl Anaplastic Large Cell LymphomaLocalization Cytoplasmic, NuclearQuantity 50 testsIsotype IgG3/K

Anaplastic large cell lymphoma

DescriptionCONFIRM anti-ALK1 (ALK01) recognizes a formalin resistant epitope in both the p80 protein, identified as a hybrid of the anaplastic lymphoma kinase (ALK) protein and the nucleophosmin (NPM) protein and the 200 kD normal ALK proteins. CONFIRM anti-ALK1 (ALK01) may also recognize any ALK protein chimeric produced as a result of variant translocations involving the ALK gene on chromosome 2. CONFIRM anti-ALK1 (ALK01) recognizes varying degrees of ALK expression in both the cytoplasm and nucleus of anaplastic lymphoma cells. ALK protein expression is substantially specific for anaplastic lymphomas, except for weak expression in some normal cells in the central nervous system including neurons, glial cells, and endothelial cells. ALK expression may also be seen in inflammatory myofibroblastic tumors and rare rhabdomyosarcomas..

References1. Pulford K, et al., Blood. 89(4):1394-404, 1997.2. Griffin CA, et al., Cancer Res. 59(12):2776-80, 1999.

3. Falini B, et al., Am J Pathol. 153(3):875-86, 1998.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 21

Page 36: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Annexin A1 (MRQ-3)Catalog Number 760-4435Type Mouse MonoclonalControl Hairy Cell LeukemiaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1

Spleen, hairy cell leukemia

DescriptionAnnexin (ANXA1) is strongly expressed on the cell membrane and occasionally in the cytoplasm of tumor cells in 97% of samples from patients with hairy cell leukemia. By contrast, B-cell lymphomas other than hairy cell leukemia, including typical splenic lymphoma with villous lymphocytes and patients with variant hairy cell leukemia—as defined by current morphologic, phenotypic, and clinical criteria—are ANXA1-negative. In a study by Falini, et al. ANXA1 immunodetection was 100% sensitive and specific for hairy cell leukemia. Normal B cells from different lympho-hemopoietic tissues were ANXA1-negative. In this study the expression of ANXA1 in myeloid cells, macrophages, or T-cell subset served as positive control. These findings validated the results of gene expression profiling in hairy cell leukemia at the protein level by showing that ANXA1 is consistently expressed in this type of leukemic disease, but not in other B-cell lymphomas. Negativity for ANXA1 was also present in patients with splenic lymphoma with villous lymphocytes, variant hairy cell leukemia, prolymphocytic leukemia, marginal zone and lymphoplasmacytoid lymphomas. Thus, ANXA1 is a molecule specific to hairy cell leukemia that can be used to differentiate this disease from other B-cell lymphomas. Wang, et al. showed that high ANXA1 expression is frequent in esophageal and esophagogastric junction adenocarcinomas, is associated with more advanced pathologic T stage and the presence of distant metastasis, and is an independent prognostic factor for patient survival.

References1. Falini B, et al., Lancet. 363(9424):1869-70, 2004. Erratum in: Lancet. 363(9427):2194, 2004.2. Wang KL, et al., Clin Cancer Res. 12(15):4598-604, 2006.

3. Xia SH, et al., Oncogene. 21(43):6641-8, 2002.4. Dreier R, et al., Histochem Cell Biol. 110(2):137-48, 1998.

Basal Cell Cocktail (34βE12+4A4)Catalog Number 790-4536, 790-1010Type Mouse MonoclonalControl Normal basal cells in prostate tissueLocalization 4A4 = Nucleus, 34βe12 = CytoplasmQuantity 50 Tests (790-4536), 250 Tests (790-1010)Isotype IgG2a/K

Prostate carcinoma

DescriptionVENTANA Basal Cell Cocktail (34βE12+p63) is an antibody cocktail of anti-p63 (4A4) and anti-keratin (34βE12). Anti-p63 (4A4) reacts with the p63 molecule in the nuclei of human prostatic basal cells and urothelial tissues. Anti-keratin (34βE12) reacts with cytokeratins 1, 5, 10 and 14, and stains the cytoplasm of human prostatic basal cells. This antibody cocktail may be used to aid in the differentiation of benign and malignant prostatic lesions.

References1. Shah RB, et al., Am J Clin Pathol. 122:517-523, 2004.2. Zhou M, et al., Am J Surg Pathol. 27:365–371, 2003.3. Shah RB, et al., Am J Surg Pathol. 26:1161–1168, 2002

4. Yang A, et al., Mol Cell. 2:305-316, 1998.5. Dairkee SH, et al., J Natl Cancer Inst. 80:691-695, 1988.6. Gown AM, et al., Amer J Clin Pathol. 84:413-424, 1985.

IHC_ISH | Primary Antibodies

22 Ventana Medical Systems, Inc. | 800.227.2155

Page 37: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

BCA-225 (Cu-18)Catalog Number 760-2607Type Mouse MonoclonalControl Breast CarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

in situ and invasive breast carcinoma

DescriptionAnti-BCA-225 antibody recognizes a human breast carcinoma associated glycoprotein BCA-225 (220-225 kD). This protein differs in size and distribution from other breast carcinoma antigens. Unlike other antibodies against breast carcinoma antigens, this antibody does not react with benign or malignant colonic, stomach, prostate, liver, pancreas, thyroid or parotid tissues. Adenocarcinomas of the lung, ovary and endometrium also stain with this antibody.

References1. Ceriani RL, et al., Monoclonal Ab’s and Breast Cancer Boston, Martinus, Nijhoff, 1985.2. Mesa-Tejada R, et al., Am J Pathol. 130:305-314, 1988.

3. Loy TS, et al., Am J Clin Pathol. 96(3):326-9, 1991.4. Ma CK, et al., Am J Clin Pathol. 99(5):551-7, 1993.

CONFIRM bcl-2 (124)Catalog Number 790-4464Type Mouse MonoclonalControl B Cells of the Mantle Zone, Interfollicular T Cells in Tonsil.Localization CytoplasmicQuantity 50 testsIsotype IgG1

Lymphoma

DescriptionCONFIRM anti-bcl-2 (124) Mouse Monoclonal Primary Antibody is directed against human bcl-2 expressed by B cells of the mantle zone and interfollicular T cells. This antibody exhibits a cytoplasmic staining pattern and may be used to aid in the identification of follicular lymphomas and diffuse large cell lymphomas, and to differentiate follicular lymphomas from reactive lymph nodes.

References1. Chao DT, et al., Annu Rev Immunol. 16:395-419, 1998.2. Pezzella F, et al., N Engl J Med. 329:690-4, 1993.

3. Campos L, et al., Blood. 81:3091-6, 1993.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 23

Page 38: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

bcl-6 (GI191E/A8)Catalog Number 760-4241Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization NuclearQuantity 50 testsIsotype IgG1

Tonsil

DescriptionAnti-bcl-6 is a transcriptional regulator gene which codes for a 706-amino acid nuclear zinc finger protein. Antibodies to this protein stain the germinal center cells in lymphoid follicles, the follicular and interfollicular cells in follicular lymphoma, diffuse large B-cell lymphomas and Burkitt’s lymphoma, and the majority of the Reed-Sternberg cells in nodular lymphocyte predominant Hodgkin disease. In contrast, anti-bcl-6 rarely stains mantle cell lymphoma and MALT lymphoma. bcl-6 expression is seen in approximately 45% of CD30+ anaplastic large cell lymphomas but is consistently absent in other peripheral T-cell lymphomas.

References1. Dogan A, et al., Am J Surg Pathol. 24(6):846-852, 2000.2. Shaffer AL, et al., Immunity. 13:199-212, 2000.

3. Kraus Md, et al., Am J Surg Pathol. 24(8):1068-78, 2000.4. Carbone A, et al., Blood. 90(6):2445-2450, 1997.

Beta-catenin (14)Catalog Number 760-4242Type Mouse MonoclonalControl Fibromatosis of Breast or AbdomenLocalization NuclearQuantity 50 testsIsotype IgG1

Breast carcinoma

DescriptionBeta-catenin is a 92 kD protein normally found in the cytoplasm of the cell in the submembranous location. This protein is associated with E-Cadherin and may be essential for the function of E-Cadherin. Mutations in the Beta-catenin gene result in nuclear accumulation of this protein. Nuclear accumulation of this protein has been demonstrated in fibromatosis lesions of the breast and abdomen, and therefore is useful in differentiating this lesion from other spindle cell lesions that may occur in these locations. Nuclear accumulation of Beta-catenin has also been demonstrated in colorectal carcinoma.

References1. Alman BA, et al., Am J Pathol. 151(2):329-34, 1997.2. Li C, et al., Am J Pathol. 153(3):709-14, 1998.

3. Kuhnen C, et al., Pathol Rex Pract. 196(5):299-304, 2000.4. Abraham SC, et al., Hum Pathol. 33(1):39-46, 2002.

IHC_ISH | Primary Antibodies

24 Ventana Medical Systems, Inc. | 800.227.2155

Page 39: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

BG8, Lewisy (F3)Catalog Number 760-4450Type Mouse MonoclonalControl Lung AdenocarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Adenocarcinoma of colon

DescriptionBlood group antigens have been examined as potential discriminators between pulmonary adenocarcinoma (PACA) and epithelioid mesotheloma (EM). Lewisy is the only one of these that appears to have some merit. BG8 is raised from the SK-LU-3 lung cancer line and its ability to distinguish between PACA and EM was first reported by Jordon and colleagues in 1989. Three groups have since reported their results. These studies included 231 cases of PACA and 197 cases of EM. Sensitivity and specificity for PACA were both 93%. Yaziji H, et al. reported a sensitivity of nonmesothelial antigens for adenocarcinoma as organ dependent, with BG8 performing at 98% in the breast cancer group, and 100% in the lung cancer group. The specificity of the nonmesothelial (non-EM) antigens for adenocarcinoma was 98% for BG8. They concluded using logical regression analysis that a three-antibody immunohistochemical panel including calretinin, BG8, and MOC-31 would provide 96% sensitivity and specificity for distinguishing EM from adenocarcinoma from a variety of sources (lung, ovary, breast, stomach).

References1. Davidson B, et al., Virchows Arch. 435(1):43-9, 1999.2. Jordan D, et al., Am J Pathol. 135(5):931-7, 1989.3. King JE, et al., Histopathology. 48(3):223-32, 2006. Review.4. Marchevsky AM, et al., Appl Immunohistochem Mol Morphol. 15(2):140-4, 2007.5. Ordonez NG, et al., Am J Surg Pathol. 27(8):1031-51, 2003.

6. Ordonez NG, et al., Am J Surg Pathol. 24(4): 598-606, 2000.7. Pan CC, et al., Appl Immunohistochem Mol Morphol. 13(4):347-52, 2005.8. Yaziji H, et al., MMod Pathol. 19(4):514-23, 2006.

BOB.1 (SP92)Catalog Number 760-4593Type Rabbit MonoclonalControl TonsilLocalization Nuclear; CytoplasmicQuantity 50 tests

Follicular lymphoma

DescriptionBOB.1 (SP92) is used as an aid in the identification of B cells in germinal centers, mantle cells, and differentiation of lymphomas within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Steimle-Grauer SA, et al. Virchows Arch. 442:284-293, 2003.2. Valsami S, Pappa V, et al. Haematologica. 92(10):1343-50, 2007.3. Stein H, et al. Blood. 97:496-501, 2001.4. Hertel CB, et al. Oncogene. 21:4908-4920, 2002.5. Pileri SA, et al. Am J Pathology. 162:243- 253, 2003.6. Hoefnagel JJ, et al. Moder Pathology. 19 :1270-1276, 2006.7. Greiner A, et al. Am J Pathol. 156:501-507, 2000.

8. Kuroda H, et al. Breast Cancer. 14(3):317-22, 2007.9. Saez A-I, et al. Mod Pathol. 15(3):21-220, 2002.10. Loddenkemper C, et al. J Pathol. 202:60-69, 2004.11. Hoeller S, et al. Histopathology. 56, 217- 228, 2010.12. Browne P, et al. Am J Clin Pathol 120:767-777, 2003.13. Gibson SE, et al. Am J Clin Pathol. 126:916-924, 2006.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 25

Page 40: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

C3d (polyclonal)Catalog Number 760-4522Type Rabbit PolyclonalControl Acute Rejected Kidney TransplantLocalization Membranous, CytoplasmicQuantity 50 testsIsotype IgG

DescriptionComplement component C3 plays a central role in the activation of complement system. Its activation is required for both classical and alternative complement activation pathways. C3d deposition in the renal transplant PTCs (peritubular capillaries) is indicative of AR (acute rejection) with subsequent high probability of graft loss. Anti-C3d, combined with anti-C4d, can be utilized as a tool for diagnosis of AR and warrant prompt and aggressive anti-rejection treatment.

References1. Bickerstaff A, et. al., Am J Pathol, 173:347-357, 2008.2. Kuypers DR, et. al., Transplantation, 76:102-108, 2003.

3. Eggertsen G, et. al, APMIS, 109:825-834, 2001.4. Pfaltz K, et. al., J Cutan Pathol. 37:654-658, 2010.

C4d (polyclonal)Catalog Number 760-4436Type Rabbit PolyclonalControl Lymph Node, Tonsil, Kidney (Reject Transplant)Localization Membranous, CytoplasmicQuantity 50 testsIsotype IgG

Kidney, acute rejection

DescriptionC4d is a stable split product remnant of classical complement activation which becomes covalently bound to endothelium and basement membrane, after induction of the classical antibody-induced pathway. As an established marker of antibody-mediated acute renal allograft rejection and its proclivity for endothelium, this component can be detected in peritubular capillaries in both chronic renal allograft rejection as well as hyperacute rejection, acute vascular rejection, acute cellular rejection, and borderline rejection. It has been shown to be a significant predictor of transplant kidney graft survival and is therefore an aid in treating acute rejection.

References1. Jianghua C, et al., Clin Transplant. 19(6):785-91, 2005.2. Kayler LK, et al., Transplantation. 85(6):813-20, 2008.3. Ranjan P, et al., Nephrol Dial Transplant. 23(5):1735-41, 2008.4. Nadasdy GM, et al., Hum Pathol. 36(11):1178-85, 2005.

5. Seemayer CA, et al., Nephrol Dial Transplant. 22(2):568-76, 2007.6. Bouron-Dal Soglio D, et al., Hum Pathol. 39(7):1103-10, 2008.

IHC_ISH | Primary Antibodies

26 Ventana Medical Systems, Inc. | 800.227.2155

Page 41: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CA 19-9 (121SLE)Catalog Number 760-2609Type Mouse MonoclonalControl Colon, Salivary GlandLocalization CytoplasmicQuantity 50 testsIsotype IgM

Malignant gastrointestinal carcinoma

DescriptionCA 19-9 antigen is highly expressed in gastrointestinal (gastric, pancreatic, and colonic) adenocarcinomas and salivary gland mucoepidermoid carcinomas. Anti-CA 19-9 antibody is usually not reactive with breast, kidney, and prostate carcinomas.

References1. Gatalica Z, et al., Applied IHC. 2(3):205-211, 1994.2. Encabo G, et al., Bulletin Cancer (Paris). 73:256-9, 1986.

3. Basso D, et al., Med Sci Res. 17:13-4, 1989.4. Tabuchi Y, et al., Cancer. 66:1529-33, 1990.

CA 125 (OC125)Catalog Number 760-2610Type Mouse MonoclonalControl Ovarian CarcinomaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1/K

Serous adenocarcinoma of ovary

DescriptionCA-125 reacts with malignant ovarian epithelial cells. The antigen is formalin resistant permitting the detection of ovarian cancer by immunohistochemistry, although serum assays for this protein are widely used to monitor ovarian cancer. CA-125 also reacts with antigens in seminal vesicle carcinoma and anaplastic lymphoma.

References1. Dabawat S, et al., Int J Gyn Path. 2:275-285, 1983.2. Davis H, et al., Cancer Res. 46:6143-6148, 1986.3. Nouwen E, et al., Cancer Res. 46:866-876, 1986.

4. Quirk J, et al., J Obst Gyn. 159:644-649, 1988.5. Fukazawa I, et al., Gynecol Obstet. 243:41-50, 1988.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 27

Page 42: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Calcitonin (polyclonal)Catalog Number 760-2611Type Rabbit PolyclonalControl Medullary Carcinoma of ThyroidLocalization CytoplasmicQuantity 50 tests

Medullary carcinoma of thyroid

DescriptionImmunohistochemical staining with Anti-Calcitonin antibody has proven to be an effective way of demonstrating calcitonin-producing cells in the thyroid. C-cell hyperplasia and medullary thyroid carcinomas stain positive for calcitonin. Studies of calcitonin have resulted in the identification of a wide spectrum of C-cell proliferative abnormalities.

References1. Copp DH, et al., Endocrinology. 70:638-649, 1962.2. Kameda Y, et al., Cell Tissue Res. 206:403-415, 1980.3. Coombes RC, et al., Lancet. 1:1080-1083, 1974.

4. Dayal Y, et al., Cancer. 43:1331-1338, 1979.5. DeLellis RA, et al., Am J Clin Pathol. 7(4):587-294, 1978.

Caldesmon (E89)Catalog Number 760-4375Type Rabbit MonoclonalControl Smooth Muscle from Bowel, Esophagus, UterusLocalization CytoplasmicQuantity 50 testsIsotype IgG

Breast, sclerosing adenosis

DescriptionAnti-Caldesmon is a regulatory protein found in smooth muscle and other tissues which interacts with actin, myosin, tropomyosin and calmodulin. Anti-Caldesmon antibody labels smooth muscle and tumors of smooth muscle, myofibroblastic and myoepithelial differentiation. Anti-Caldesmon has also been used to differentiate epithelioid mesothelioma from serous papillary carcinoma of the ovary.

References1. Comin CE, et al., Am J Surg Pathol. 31(8): 1139-48, 2007.2. Watanabe K, et al., Hum Pathol. 30(4): 392-6, 1999.3. McCluggage WC, Adv Anat Pathol. 11(3): 162-71, 2004.

4. Miettinen M, et al., Arch Pathol Lab Med. 130(10): 1466-78, 2006.5. Comin CE, et al., Am J Surg Pathol. 30(4): 463-9, 2006.

IHC_ISH | Primary Antibodies

28 Ventana Medical Systems, Inc. | 800.227.2155

Page 43: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Calponin-1 (EP798Y)Catalog Number 760-4376Type Rabbit MonoclonalControl Smooth Muscle from Bowel, Esophagus, UterusLocalization CytoplasmicQuantity 50 testsIsotype IgG

Breast, sclerosing adenosis

DescriptionCalponin is a 34 kD polypeptide that interacts with actin, tropomyosin, and calmodulin. It is involved in smooth muscle contraction mechanism and is restricted exclusively to smooth muscle tissue. Anti-calponin has been found to be useful in differentiating benign sclerosing lesions of the breast from carcinoma. Calponin positivity has also been noted in malignant myoepithelioma and pleomorphic adenoma of salivary gland origin, as well as angiomatoid malignant fibrous histiocytoma.

References1. Wang NP, et al., Appl Immunohistochem. 5(3):141-151, 1997.2. Nagao T, et al., Cancer. 83(7):1292-9m, 1998.3. Savara AT, et al., Mod Pathol. 10(11):1093-1100, 1997.

4. Fanburg-Smith JC, et al., Hum Pathol. 30(11):1336-43, 1999.5. Hornick JL, et al., Am J Surg Pathol. 27(9): 1183-96, 2003.6. Werling RW, et al., Am J Surg Pathol. 27(1): 82-90, 2003.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 29

Page 44: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Calretinin (SP65)Catalog Number 790-4467Type Rabbit MonoclonalControl Mesothelioma, Normal AppendixLocalization Cytoplasmic, NuclearQuantity 50 tests

Pleura, malignant mesothelioma

DescriptionCONFIRM anti-Calretinin (SP65) Rabbit Monoclonal Primary Antibody is directed against the calcium binding protein, calretinin, expressed by normal and reactive mesothelium, eccrine glands of skin, Sertoli cells of the testis, ovarian stromal cells and adrenal cortical cells. This antibody exhibits a nuclear and cytoplasmic staining pattern and may be used to aid in the identification of mesothelioma, and in distinguishing mesothelioma from adenocarcinoma.

References1. Kuznicki J, et al., Biochem J. 308(Pt 2):607–612, 1995.2. Andressen C, et al., Cell Tissue Res. 271:181–208, 1993.3. Rogers JH, J Cell Biol. 105(3):1343-53, 1987.4. Lugli A, et al., Hum Pathol. 34(10):994-1000, 2003.5. Cao QJ, et al., Int J Gynecol Pathol. 20:346-52, 2001.6. Oates J, et al., Histopathology. 36(4):341-7, 2000.7. Doglioni C, et al., Am J Surg Pathol. 20:1037-46, 1996.8. Nagel H, et al., Pathol Res Pract. 194:759-64, 1998.

9. Ordonez NG, Mod Pathol. 11:929-33, 1998.10. Leers MP, et al., Histopathology. 32:209-16, 1998.11. McCluggage WG, et al., Histopathology. 38(5):403-8,2001.12. Nogales FF, et al., Int J Gynecol Pathol. 21(1):34-40, 2002.13. Cappello F, et al., Pathology. 33(2):142-8, 2001.14. Attanoos RL, et al., Histopathology. 37(3):224-31, 2000.15. Gotzos V, et al., Am J Surg Pathol. 23:701-11, 1999.

Carcinoembryonic Antigen (CEA) (TF3H8-1)Catalog Number 760-2507Type Mouse MonoclonalControl ColonLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Colon carcinoma

DescriptionCEA (TF 3H8-1) Primary Antibody may be used to aid in the identification of cells of normal and abnormal epithelial lineage as an aid in diagnosis of anaplastic tumors. CEA is a highly glycosylated protein with a molecular weight of approximately 180 kD, and has the cluster designation CD66e. Positive staining carcinomas have been reported in colon, pancreas, lung and breast.

References1. Gold P, et al., J Exp Med. 122(3): 467-481, 1965. 2. Taylor RT, et al., Immunomicroscopy. 1994; W.B. Saunders Co,

Philadelphia.

IHC_ISH | Primary Antibodies

30 Ventana Medical Systems, Inc. | 800.227.2155

Page 45: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD1a (EP3622)Catalog Number 760-4525Type Rabbit MonoclonalControl ThymusLocalization MembranousQuantity 50 testsIsotype IgG1

DescriptionCD1a, a protein of 43 to 49 kD, has been shown to be expressed on dendritic cells and cortical thymocytes. Langerhans cells in the skin and some epithelia also express this protein. This antigen is expressed on cells comprising Langerhans cell histiocytosis and Langerhans cell sarcoma. Anti-CD1a has been used to differentiate various cutaneous lymphomas (T-cell) from B-cell lymphomas and pseudolymphomas.

References1. Angel CE, et al., Blood. 113:1257-67, 2009.2. Emile JF, et. al., Am J Surg Pathol. 19:636-641, 1995.3. Stefano AP, et. al., Br J Haematol. 105:394-41, 1999.4. Han X, et. al., Am J Clin Pathol, 127:578-544, 2007.

5. Pomplun S, et. al., Histopathol, 40:152-158, 2002.6. Alexiev BA, et. al., Diagnostic Pathology, 2:13, 2007.7. Adachi Y, et. al., Pathol Intl., 58 :169-173, 2008.

CD2 (MRQ-11)Catalog Number 760-4377Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1/K

Tonsil

DescriptionCD2 is one of the earliest T-cell lineage restricted antigens to appear during T cell differentiation and only a rare CD2+ cell can be found in the bone marrow. It is found in all T lymphocytes and natural killer cells but not in B cells or any other cell population. CD2 can be considered a pan-T cell antigen and is therefore useful for the identification of virtually all normal T lymphocytes. It is also very useful in the assessment of lymphoid malignancies as it is expressed in the majority of precursor and post-thymic lymphomas and leukemias and is not expressed by B neoplasms (Foon & Todd, 1986). As with other pan-T-cell antigens, CD2 may be aberrantly deleted in some neoplastic T cell population, especially peripheral T-cell lymphomas. Rarely slg+ B-cell neoplasms have been described to form spontaneous E-rosettes but these reactions are not mediated via the CD2 receptor (Knowles, 1989).

References1. Aguilera NS, et al., Arch Pathol Lab Med. 130(12):1772-9, 2006.2. Barrionuevo C, et al., Appl Immunohistochem Mol Morphol. 15(1):38-44, 2007.

3. Bovenschen HJ, et al., Br J Dermatol. 153(1):72-8, 2005.4. Foon KA, et al., Blood. 68:1-31, 1986.5. Gonzalez L, et al., Journal of Comparative Pathology. 125:41-7, 2001.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 31

Page 46: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM CD3 (2GV6)Catalog Number 790-4341Type Rabbit MonoclonalControl Tonsil, SpleenLocalization Cytoplasmic, MembranousQuantity 50 tests

Tonsil

DescriptionCONFIRM anti-CD3 (2GV6) Primary Antibody is a rabbit monoclonal antibody (IgG) directed against the nonglycosylated epsilon chain of the human CD3 molecule. CD3 is expressed in the membrane and cytoplasm of normal and neoplastic T cells. The CD3 antigen is first detectable in early thymocytes and its appearance probably represents one of the earliest signs of commitment to the T-cell lineage. This antibody detects both normal and neoplastic T cells.

References1. Chetty R, et al., J Pathol. 173(4): 303-307, 1994.2. Clark EA, et al., Immunology Today. 10(7): 225-28, 1989.3. Clevers H, et al., Eur J Immunol. 18(5): 705-710, 1988.4. Clevers H, et al., Ann Rev of Immunology. 6: 629-662, 1988.5. Campana D, et al., J Immunol. 138(2): 648-655, 1987.

6. Dennings SM, et al., Oxford University Press, Oxford-New York-Tokyo, 1987: 144-147.7. Beverley, PC, et al., Eur J Immunol. 11(4): 329-334, 1981.8. Meuer SC, et al., Nature. 303(5920): 808-810, 1983.9. Mason DY, et al., J Clin Pathol. 42:1194-1200, 1989.

CONFIRM CD4 (SP35)Catalog Number 790-4423Type Rabbit MonoclonalControl Tonsil, LiverLocalization MembranousQuantity 50 tests

Lymphoma

DescriptionCONFIRM anti CD4 (SP35) Rabbit Monoclonal Primary Antibody is intended for the qualitative detection of CD4 in sections of formalin-fixed, paraffin-embedded normal and neoplastic human tissues. CD4 is present on helper-inducer T lymphocytes that recognize antigen in the context of MHC class 2 molecules. CD4 positive staining results may aid in identifying T-cell lymphomas and in identifying the T helper-inducer cell subset of T lymphocytes in normal tissues.

References1. Reinherz EL, et al. Proc. Natl. Acad. Sci. USA. 76(8):4061-5, 1979.2. Brady RL, et al. Curr. Topics Microbiol. Immunol. 205:1-18, 1996.3. Doyle C, et al. Nature. 330(6145):256-9, 1987.

4. Dalgleish AG, et al., Nature. 312(5996):763-7, 1984.5. Garcia-Herrera A, et al., J Clin Oncol. 26(20):3364-71, 2008.6. Maddon PJ, et al., Cell. 42(1):93-104, 1985.

IHC_ISH | Primary Antibodies

32 Ventana Medical Systems, Inc. | 800.227.2155

Page 47: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM CD5 (SP19)Catalog Number 790-4451Type Rabbit MonoclonalControl Tonsil, LymphomaLocalization Cytoplasmic, Cell MembraneQuantity 50 tests

Lymphoma

DescriptionCONFIRM anti-CD5 (SP19) Rabbit Monoclonal Primary Antibody is directed against human CD5 expressed on the plasma membrane of virtually all human T cells and the B1a subset of human B cells found in the follicular mantle zones, bone marrow and peripheral blood. Staining CD5 is commonly used as part of several IHC panels to determine T-cell and B-cell sub-classifications. CD5 may be used to aid in the identification of T-cell lymphomas, and certain B-cell lymphomas, including mantle cell lymphoma.

References1. Dalloul A, Autoimmun. 8:349-353, 2009.2. Dono M, et al., Int J Biochem Cell Biol. 36:2105-2111, 2004.3. De Leon ED, et al., Mod Pathol. 11:1046-1051, 1998.

4. Cabezudo E, et al., Hematologica. 84:413-418, 1999.5. Matolcsy A, et al., Am J Pathol. 147:207-216, 1995.6. Suguro M, et al., Cancer Sci. 97:868-874, 2006.

CD7 (SP94)Catalog Number 790-4558Type Rabbit MonoclonalControl Tonsil, ThymusLocalization MembranousQuantity 50 testsIsotype Rabbit Ig

T-cell lymphoma

DescriptionAnti-CD7 (SP94) Rabbit Monoclonal Primary Antibody is directed against the 40kD transmembrane glycoprotein, CD7 which is present in thymocytes and mature T cells. Anti-CD7 (SP94) may be used to aid in the identification of T-cell lymphomas.

References1. Sempowski GD, et al. Crit Rev Immunol. 19:331-348, 1999.2. Cotta AC, et al. Appl Immunohistochem Molec Morphol. 14: 291-295, 2006.3. Al Saati T, et al. Appl Immunohistochem Molec Morphol. 9: 289-296, 2001.

4. Ormsby A, et al. J Am Acad Dermatol. 45:405–413, 2001.5. Inaba T, et al. Leuk Lymphoma. 42:1161-1171, 2001.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 33

Page 48: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM CD8 (SP57)Catalog Number 790-4460Type Rabbit MonoclonalControl Tonsil, T-cell lymphomaLocalization Cell MembraneQuantity 50 tests

T-cell lymphoma

DescriptionCONFIRM anti-CD8 (SP57) Rabbit Monoclonal Primary Antibody is intended for the qualitative detection of CD8 in sections of normal and neoplastic human tissues. The CD8 glycoprotein is present on cytotoxic/suppressor T lymphocytes that recognize antigen in the context of MHC class 1 molecules. CD8 positive staining results may aid in identifying T-cell lymphomas and in identifying the T cytotoxic/suppressor cell subset of T lymphocytes in normal tissues.

References1. Reinherz EL, et al., Immunol Today. 4:5-8, 1983.2. Reinherz EL, et al., Nature. 294:168-170, 1981.

3. Perussia B, et al., J Immunol. 131:223-231, 1983.4. Bierer BE, et al., Ann Rev Immunol. 7:579-599, 1989.

CD10 (SP67)Catalog Number 790-4506Type Rabbit MonoclonalControl TonsilLocalization Membranous, CytoplasmicQuantity 50 testsIsotype Rabbit Ig

Lymphoma

DescriptionVENTANA anti-CD10 (SP67) Rabbit Monoclonal Primary Antibody is directed against the CD10 molecule, or common acute lymphoblastic leukemia antigen (CALLA), expressed on the surface of early lymphoid cells, and on various nonlymphoid tissues including breast myoepithelial cells, bile canaliculi, fibroblasts, kidney tubular brush borders and small intestine epithelium. This antibody exhibits a cell membranous and/or cytoplasmic staining pattern and may be used to aid in the identification of Burkitt’s lymphoma and follicular germ cell lymphoma, and in the classification of some carcinomas such as renal cell carcinoma.

References1. Gregory CD, et al. Apoptosis. 4:11-20, 1999.2. Shipp MA, et al. Proc Natl Acad Sci USA. 85:4819-4823, 1988.3. Kaufmann O, et al. Am J Clin Pathol. 111:117-122, 1999.4. Shipp MA, et al. Proc Natl Acad Sci USA. 86:297-301, 1989.

5. Arber DA, et al. Appl Immunohistochem. 5:125-140, 1997.6. Chu P, et al. Appl Immunohistochem & Molec Morphol. 8:257-262, 2000.7. Avery A, et al. Am J Surg Pathol. 24:203-210, 2000.

IHC_ISH | Primary Antibodies

34 Ventana Medical Systems, Inc. | 800.227.2155

Page 49: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD14 (EPR3653)Catalog Number 760-4523Type Rabbit MonoclonalControl TonsilLocalization Membranous, CytoplasmicQuantity 50 testsIsotype IgG

DescriptionCD14 is a surface protein preferentially expressed on monocytes/macrophages. It binds lipopolysaccharide binding protein and recently has been shown to bind apoptotic cells. Anti-CD14 antibody labels Kupffer cells in liver sinusoids. In lymphoid tissues, dendritic cells are distinctly stained. Most other normal tissues are negative. This antibody labels monocyte-macrophages and Langerhans cells in Langerhans cell histiocytosis. Tumor cells are positive in monocytic leukemia and true histiocytic lymphomas for CD14. Sinusoidal histiocytes express CD14 and CD 169, whereas most of the other monocyte-derived cells in reactive lymph node lack these markers. Anti-CD14 labels numerous diffuse large B-cell lymphomas and splenic marginal zone lymphoma but not in other B-cell lymphomas.

References1. Gregory CD, et. al., Apoptosis. 4:11-20, 1999.2. Larregina AT, et. al., Nature Immunol. 2:1151-1158, 2001.3. Ziegler-Heitbrock HW, et. al., Immunol Today. 14:121-125, 1993.4. Steiniger B, et. al., Immunology. 92:307-316, 1997.5. Buckley PJ, et. al., Am J Pathol 128:505-520, 1987.

6. Hartnell A, et. al., Blood. 97:288-296, 2001.7. Marmey B, et. al., Hum Pathol. 37:68-77, 2006.8. Hsiao CH, et. al., J Formos Med Assoc. 105:701-707, 2006.9. Qubaja M, et. al., Vichows Arch. 454:411-419, 2009.

CONFIRM CD15 (MMA)Catalog Number 760-2504Type Mouse MonoclonalControl Hodgkin LymphomaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgM

Hodgkin lymphoma, Reed-Sternberg cells

DescriptionAntibodies against CD15 normally react in a strong cell surface membrane staining pattern with granulocytes and granulocyte precursors, monocytes, a subset of tissue macrophages, and activated T lymphocytes. CONFIRM anti-CD15 (MMA) also reacts against the Reed-Sternberg cells of Hodgkin disease and, because it recognizes a carbohydrate antigen, is also expressed by a variety of carcinoma types but is negative in malignant mesotheliomas. Antibodies against CD15 are used diagnostically to (1) support a diagnosis of acute myeloid leukemia, (2) help support a diagnosis of Hodgkin disease, and (3) help separate poorly differentiated adenocarcinomas from malignant mesothelioma.

References1. Pinkus GS, et al., Am J Pathol. 119:244-252, 1985.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 35

Page 50: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD19 (SP110)Catalog Number 790-4587Type Rabbit MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 tests

B-cell acute lymphocytic leukemia

DescriptionAnti-CD19 is directed against the CD19 protein. This antibody may be used to detect the CD19 standard and variant proteins in the vast majority of B-cell lymphomas including follicular lymphoma, diffuse large B-cell lymphoma and Burkitt lymphoma.

References1. Mehra R, et al. Mod Path, 20:538-544, 2007.2. Tedder T, et al. Immunol Today. 15:437-442, 1994.3. Scheuermann R, et al. Leuk Lym. 18:385-3977, 1995.4. Ginaldi L, et al. J Clin Pathol. 51:364-369, 1998.

5. Masir N, et al. Histopath. 2006;48:239-246.6. Kraj M, et al. Leuk Res. 35:169-176, 2011.7. Hultin LE, et al. Cytometry. 14:196–204, 1993.8. Foss H, et al. Blood. 94:3108-31013, 1999.

CONFIRM CD20 (L26)Catalog Number 760-2531Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 testsIsotype IgG2a/K

Tonsil

DescriptionCONFIRM anti-CD20 (L26) specifically binds to antigens located in the plasma membrane and cytoplasmic regions of normal B lymphocytes and may also be expressed in Reed-Sternberg cells. This phosphoprotein is found on the surface of normal and malignant B cells and is thought to act as a receptor during B cell activation and differentiation. Plasma cells are negative for CD20. CONFIRM anti-CD20 (L26) can be used to detect B cells from peripheral blood, lymph node, spleen, tonsil and bone marrow. It is also used in the classification of a majority of B-cell malignancies, including many acute leukemias and chronic lymphocytic leukemias.

References1. Coles FB, et al., Mod Pathol. 1(4): 274-278, 1988.

IHC_ISH | Primary Antibodies

36 Ventana Medical Systems, Inc. | 800.227.2155

Page 51: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD21 (2G9)Catalog Number 760-4245Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 testsIsotype IgG2a

Tonsil, germinal center

DescriptionCD21 antigen is an integral membrane glycoprotein of molecular weight 145 kD. Anti-CD21 is useful in the identification of follicular dendriditic cell matrix found in normal lymph nodes and tonsillar tissue. This antibody also labels follicular dendritic cell tumor/sarcomas. The antigen is absent on T lymphocytes, monocytes, and granulocytes.

References1. Dillon KM, et al., J Clin Pathol. 55(10):791-4, 2002.2. Pileri SA, et al., Histopathology. 41:1-29, 2002.3. Kunihiko M, et al., J Histochem Cytochem. 50:1475-1485, 2002.4. Herrmann LM, et al., Am J Pathol. 162:1075-1081, 2003.

5. Biddle DA, et al., Modern Pathology. 15:50-58, 2002.6. Cheuk W, et al., Am J Surg Pathol. 25(6):721-31, 2001.7. Chang KC, et al., J Pathol. 201(3):404-12, 2003.8. Chan AC, et al., Histopathol. 38(6):510-8, 2001.

CD21 (EP3093)Catalog Number 760-4438Type Rabbit MonoclonalControl Lymph Node, TonsilLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1

Tonsillar hypertrophy

DescriptionCD21 antigen is an integral membrane glycoprotein of molecular weight 140 kD. Anti-CD21 is useful in the identification of follicular dendriditic cell matrix found in normal lymph nodes and tonsillar tissue. This antibody also labels follicular dendritic cell tumor/sarcomas. The antigen is absent on T lymphocytes, monocytes, and granulocytes.

References1. Dillon KM, et al. J Clin Pathol. 55(10):791-4, 2002.2. Pileri SA, et al. Histopathology. 41(1):1-29, 2002.3. Maeda K, et al. J Histochem Cytochem. 50(11):1475-1485, 2002.

4. Herrmann LM, et al. Am J Pathol. 162(4):1075-1081, 2003.5. Biddle DA, et al. Modern Pathology. 15(1):50-58, 2002. Erratum in: Mod Pathol. 15(4):475, 2002.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 37

Page 52: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD22 (SP104)Catalog Number 790-4588Type Rabbit MonoclonalControl Tonsil, lymphomaLocalization Membranous, CytoplasmicQuantity 50 tests

Tonsil

DescriptionAnti-CD22 is directed against the type 1 integral membrane glycoprotein, CD22. Anti-CD22 (SP104) exhibits a cell membranous and/or cytoplasmic staining pattern and may be used to aid in the identification of B-cell lymphomas.

References1. Townsend MJ, et al. Immunol Rev. 237:264-283, 2010.2. Poe JC, et al. Nature Immunol. 5:1078- 1087, 2004.3. Tedder TF, et al. Annu Rev Immunol. 15:481-504, 1997.

4. Polson Ag, et al. Leukemia. 24:1566-1573, 2010.5. Boue DR, et al. Blood. 71:1480-1486, 1988.

CONFIRM CD23 (SP23)Catalog Number 790-4408Type Rabbit MonoclonalControl TonsilLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Normal tonsil

DescriptionExpression of CD23 has been detected in neoplastic cells from cases of B-cell chronic lymphocytic leukemias and B-cell small lymphocytic lymphomas. Some hairy cell leukemias and diffuse large B-cell lymphomas are likewise positive. CD23 is generally absent on mantle cell lymphomas. Accordingly, CD23 staining may be used in the classification of small lymphocytic lymphomas (usually positive) and mantle cell lymphomas (usually negative).

References1. Kaiserlian D, et. al., Immunology. 80:90-95, 1993.2. Aubry JP, et al., The CD23 antigen is the human lymphocyte receptor for IgE. In:McMichael AJ, Beverley PCL, Cobbold S, Crumpton MJ, Gilks W, Gotch FM, et al. Leukocyte Typing III, White Cell Differentiation Antigens. Oxford University Press, Oxford, 1987: 417-419.3. Kikutani H, et al., CD23 is a low affinity Fcε receptor (FcεR): regulation of FcεR expression. In: McMichael AJ, Beverley PCL, Cobbold S, Crumpton MJ, Gilks W, Gotch FM, et al. Leukocyte Typing III, White Cell Differentiation Antigens. Oxford University Press, Oxford, 1987: 419-422.

4. Pallesen G. The distribution of CD23 in normal human tissues and in malignant lymphomas. In: McMichael AJ, Beverley PCL, Cobbold S, Crumpton MJ, Gilks W, Gotch FM, et al. Leukocyte Typing III, White Cell Differentiation Antigens. Oxford University Press, Oxford, 1987: 383-386.

IHC_ISH | Primary Antibodies

38 Ventana Medical Systems, Inc. | 800.227.2155

Page 53: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD25 (4C9)Catalog Number 760-4439Type Mouse MonoclonalControl Lesions of Mastocytosis, Small BowelLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG2b

Spleen, hairy cell leukemia

DescriptionAccording to the World Health Organization classification system, the major diagnostic criterion for bone marrow involvement by systemicmastocytosis (SM) is the presence of dense aggregates (>15 cells) of mast cells. Expression of CD25, a low-affinity receptor for interleukin-2 (IL-2), is a reliable diagnostic tool for distinguishing neoplastic mast cell aggregates from reactive proliferations, and has therefore recently become a minor criterion for the diagnosis of SM. Hahn, et al. demonstrated that aberrant staining of mast cell clusters by anti-CD25 antibody in GI biopsies was essentially diagnostic of SM. Anti-CD25 antibody has also been useful in identifying mast cells in skin biopsies in the setting of urticaria pigmentosa, which is predictive of systemic mastocytosis. Quantitation of regulatory T cells (Treg) in the setting of hepatocellular carcinoma (HCC) has been used as an independent predictive factor of tumor recurrence after hepatic resection for HCC. Also, the percentage of tumor infiltrating CD25+FOXP3+ regulatory T cells among tumor cells, inside tumor parenchyma and at its periphery, is significantly higher in recurrent cutaneous melanoma than in non-recurrent melanoma.

References1. Hahn HP, et al., Am J Surg Pathol. 31(11):1669-76, 2007.2. Hollmann TJ, et al., Am J Surg Pathol. 32(1):139-45, 2008.3. Miracco C, et al., Oncol Rep. 18(5):1115-22, 2007.

4. Siddiqui SA, et al., Clin Cancer Res. 13(7):2075-81, 2007.5. Yang XH, et al., J Hepatol. 45(2):254-62, 2006.

CONFIRM CD30 (Ber-H2)Catalog Number 790-2926Type Mouse MonoclonalControl Hodgkin LymphomaLocalization MembranousQuantity 50 testsIsotype IgG1/K

Hodgkin lymphoma, Reed-Sternberg cells

DescriptionCD30 antigen is expressed in mononuclear Hodgkin cells and multinucleated Reed Sternberg cells of Hodgkin lymphoma as well as on anaplastic large cell lymphomas. This antibody variably produces membranous, cytoplasmic and Golgi staining of both lymphoma cells and of scattered large activated B and T cells in lymph nodes, spleen, tonsil, and thymus. This antibody may also stain a small proportion of plasma cells.

References1. Froese P, et al., J Immunology. 139(6): 2081-2087, 1987.2. Stein H, et al., Blood. 66: 848-858, 1985.

3. Stein H, et al., Int J Cancer. 30(4): 445-459, 1982.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 39

Page 54: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD31 (JC70)Catalog Number 760-4378Type Mouse MonoclonalControl Appendix, Placenta, TonsilLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1/K

Tonsil

DescriptionCD31 is expressed by stem cells of the hematopoietic system and is primarily used to identify and concentrate these cells for experimental studies as well as for bone marrow transplantation. Endothelial cells also express this marker, therefore, antibodies to CD31 have been used as a tool to identify the vascular origin of neoplasms. CD31 has shown to be highly specific and sensitive for vascular endothelial cells. Staining of nonvascular tumors (excluding hematopoietic neoplasms) has not been observed.

References1. Parums DV, et al., J Clin Pathol. 43(9):752-7, 1990.2. De Young BR, et al., Applied Immunohistochemistry. 1: 97-100, 1993.

3. Alles JU, et al., J Histochem Cytochem. 34(2):209-14, 1986.4. Alexander-Sefre F, et al., J Clin Pathol. 56(10):786-8, 2003.

CONFIRM CD34 (QBEnd/10)Catalog Number 790-2927Type Mouse MonoclonalControl Tonsil, Placenta, AppendixLocalization MembranousQuantity 50 testsIsotype IgG1

Tonsil

DescriptionCD34 is selectively expressed on human lymphoid and myeloid hematopoietic progenitor cells. The antigen is also expressed on vascular endothelium. CD34 antibody is of value for the identification of vascular tumors and for the characterization of leukemias.

References1. Anthony PP, et al., J Clin Path. 44(1):29-32, 1991.2. Sankey EA, et al., J Path 161(3): 267-271, 1990.

3. Fletcher CD, et al., J Path. 162(3) 273-274, 1990.4. Ramani P, et al., Histopathology. 17(3):237-242, 1990.

IHC_ISH | Primary Antibodies

40 Ventana Medical Systems, Inc. | 800.227.2155

Page 55: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD34 (QBEnd/10)Catalog Number 760-2620Type Mouse MonoclonalControl Appendix, Placenta, TonsilLocalization MembranousQuantity 50 testsIsotype IgG1

Breast carcinoma

DescriptionCD34 monoclonal antibody recognizes a cell surface antigen of approximately 110 kD that is expressed selectively on human hematopoietic progenitor cells, including myeloid and lymphoid lineage progenitors, and a significant portion of acute leukemia. In addition to this stem cell recognition, this marker is expressed by vascular endothelium. Additionally, it appears that proliferating endothelial cells express this molecule in greater amounts than non-proliferating endothelial cells.

References1. Civin CL, et al., London Academic Press. 818-825, 1989.2. Fina L, et al., Blood. 75:2417-2426, 1990.3. Sankey EA, et al., J Pathol. 43:752-757, 1990.4. Ramani P, et al., Histopathology, 17:237-242, 1990.

5. Aziza J, et al., Am J Clin Pathol. 96:25-31, 1990. 6. Torlakovic G, et al., Arch Pathol Lab Med. 126(7):823-8, 2002.7. Salizzoni M, et al., Transplantation. 15;76(5):844-8, 2003.8. Fanburg-Smith JC, et al., Mod Pathol. 16(3):263-71, 2003.

CD43 (L60)Catalog Number 760-2511Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 testsIsotype IgG1

Tonsil, cytoplasmic membrane staining of T lymphocytes

DescriptionCD43 (also known as leucosialin or sialophorin) is a glycoprotein antigen expressed on the membrane and in the cytoplasm of T cells, cells of myeloid origin and some B cells. Anti-CD43 (L60) binds specifically to antigens located in the plasma membrane and cytoplasmic regions of normal granulocytes, monocytes, histiocytes, T cells and some B cells. Tumors expressing this antigen include most T-cell lymphomas and some B-cell lymphomas.

References1. Strickler JG, et al., Hum Pathol. 18(8):808-14, 1987. 2. Stross WP, et al., J Clin Pathol. 42(9):953-61, 1989.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 41

Page 56: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD44 (SP37)Catalog Number 790-4537Type Rabbit MonoclonalControl TonsilLocalization MembranousQuantity 50 testsIsotype IgG

DescriptionAnti-CD44 (SP37) Rabbit Monoclonal Primary Antibody is directed against the CD44 protein. CD44 is a type I transmembrane receptor protein expressed in several cell types including T and B lymphocytes, monocytes, granulocytes, erythrocytes, fibroblasts, epithelial, and mast cells. This antibody exhibits a membranous staining pattern and may be used to detect the CD44 standard and variant proteins in a variety of neoplastic tissues, including squamous cell and urothelial carcinoma.

References1. Aruffo A, et al., Cell. 61:1303-13,1990.2. Hascall V, et al., Cold Spring Harbor Laboratory Press. 2008.3. Endo K, et al., J. of Hepatology. 32:78-84, 2000.

4. Southgate J, et al., Int. J. Cancer. 62:449-456, 1995.5. Bartolazzi A, et al., JCB. 132(6):1199-1208, 1996.

CONFIRM CD45 (LCA) (RP2/18)Catalog Number 760-2505Type Mouse MonoclonalControl TonsilLocalization MembranousQuantity 50 testsIsotype IgG1/K

Lymphoma

DescriptionCD45, LCA is expressed on the cytoplasmic membrane of T and B lymphocytes, monocytes, macrophages, mast cells, and weakly on granulocytes. CONFIRM anti-CD45, LCA (RP2/18) is directed against the CD45RB epitope found on the membrane of leukocytic cells. CONFIRM anti-CD45, LCA (RP2/18) has been shown to react with the 220-, 205-, and 190 kD isoforms of CD45.

References1. Zapata JM, et al., J Immunol. 152(8): 3852-3861, 1994. 2. Pulido R, et al., J Immunol. 140(11): 3851-3857, 1988.

IHC_ISH | Primary Antibodies

42 Ventana Medical Systems, Inc. | 800.227.2155

Page 57: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD45 (LCA) (2B11 & PD7/26)Catalog Number 760-4279Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 testsIsotype IgG1/K

Tonsil

DescriptionAnti-Leukocyte Common Antigen (Anti-LCA) monoclonal antibody is routinely used to aid in the differential diagnosis of undifferentiated neoplasms, whenever malignant lymphoma is suspected by the morphological or clinical data. It is a highly specific antibody therefore a positive result is highly indicative of lymphoid or myeloid origin. Certain types of lymphoid neoplasms may lack CD45 (Hodgkin disease, some T-cell lymphomas and some leukemias) so its absence does not rule out a hematolymphoid tumor. This antibody is expressed almost exclusively by cells of hematopoietic lineage and is present in most benign and malignant lymphocytes, erythrocytes, and plasma cell precursors.

References1. Mason DY, et al., Am J Pathol. 128:1-4, 1987.2. Hall PA, et al., Histopathology. 13:149-160, 1988.3. Kurtin PJ, et al., Hum Path. 16:353-365, 1985.4. Maluf HM, et al., Mod Pathol. 8(2): 155-9, 1995.

5. Caballero T, et al., J Clin Pathol. 48(8): 743-8, 1995.6. Vasef MA, et al., Am J Clin Pathol. 108(1): 54-9, 1997.7. Saxena A, et al., Am J Clin Pathol. 112(4): 495-512, 1999.8. Kraus MD, et al., Am J Surg Pathol. (8): 1068-78, 2000.

CD45R (MB1)Catalog Number 760-2624Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 testsIsotype IgG1

Large B-cell lymphoma

DescriptionCD45R antibody stains preferentially B cells and their neoplasms, but is less specific as it will also react with some T-cell lymphomas and non-lymphoid tumors. The antigen for this antibody is in the membrane of all B cells with the exception of plasma cells and some mature T cells.

References1. Hall PA, et al., J Clinical Pathology. 40:870-873, 1987.2. Myskow MW, et al., Am J Pathology. 90:564-574, 1988.

3. West KP, et al., J Pathology. 150:89-101, 1986.4. Poppema S, et al., Am J Pathology. 127:418-429, 1987.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 43

Page 58: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM CD45RO (UCHL-1)Catalog Number 790-2930Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 testsIsotype IgG2a

Lymph node, normal

DescriptionCONFIRM anti-CD45RO (UCHL-1) reacts predominantly with the p180 component of the Leukocyte Common Antigen (LCA) antigen family and weakly with the 190 kD and 205 kD isoforms. This reagent reacts with most T lymphocytes, macrophages and Langerhan’s cells of normal tissue.

References1. Berti E, et al., Am J Clin Pathol. 95(2):188-193, 1991.

CD56 (MRQ-42)Catalog Number 760-4596Type Rabbit MonoclonalControl Panreatic Islet Cells, Pancreatic Endocrine Cells, NeuroblastomaLocalization Cytoplasmic, MembranousQuantity 50 tests

Pancreatic neuroendocrine carcinoma

DescriptionCD56 (MRQ-42) is used as an aid in the identification of neural/neurodendocrine tissues, natural killer (NK) cells, NK-like T cells, and diagnosis of related neoplasms within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Gerardy-Schahn, R et al. Int J Canc Suppl 8:38- 42, 1994.2. Michalides, R et al. Int J Canc Suppl 8:34-37, 1994.3. Kibbelaar, RE et al. Euro J of Cancer. 27(4):431-435, 1991.

4. Langdon, SP et al. Cancer Research. 48(21):6161-6165, 1988.5. Sumi, M et al. Leuk Lymphoma. 44(1): 201-4, 2003.6. Trejo, O et al. J Cutan Pathol. 29(7): 397-406, 2002.

IHC_ISH | Primary Antibodies

44 Ventana Medical Systems, Inc. | 800.227.2155

Page 59: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM CD56 (123C3)Catalog Number 790-4465Type Mouse MonoclonalControl Normal Pancreas, BrainLocalization Membrane, CytoplasmicQuantity 50 testsIsotype IgG1

Lung, small cell carcinoma

DescriptionCONFIRM anti-CD56 (123C3) Mouse Monoclonal Primary Antibody is directed against the CD56 molecule or neural cell adhesion molecule expressed by most neuroectodermally derived cell lines, tissues and neoplasms. It is also expressed on some mesodermally derived tumors, on natural killer cells, and NK cell lymphomas. This antibody exhibits a membrane/cytoplasmic staining pattern and may be used to aid in the identification of small cell carcinomas, neuroblastoma, and rhabdomyosarcoma.

References1. Lanier LL, et al., J Exp Med. 169:2233-2238, 1989.2. Lantuejous S, et al., Am J Surg Pathol. 22:1267-1276, 1988.3. Gattenlohner S, et al., Am J Pathol. 174:1160-1171, 2009.

4. Chekhonin VP, et al., Neurochemical J. 2:239-251, 2008.5. Jensen M, et al., Cancer Letters. 258:9-21, 2007.

CD57 (NK-1)Catalog Number 760-2626Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization MembranousQuantity 50 testsIsotype IgM/K

Tonsil

DescriptionAnti-CD57 antibody marks a subset of lymphocytes known as natural killer (NK) cells. Follicular center cell lymphomas often contain many NK cells within the neoplastic follicles. NK-1 also stains neuroendocrine cells and their derived tumors, including carcinoid tumor, and medulloblastoma. NK-1 reportedly also reacts with a variety of cell types in non-lymphoid tissues.

References1. Lanier LL, et al., Journ Immun. 131(4):1789-1796, 1983.2. Ritchie AW, et al., Clin and Exp Imm. 51(3):439-447, 1983.3. Caillaud JM, et al., Cancer Res. 44(10):4432-4439, 1984.

4. Tucker GC, et al., Cell Differentiation. 14(3):223-230, 1984.5. Abo T, et al., Cellular Immun. 73(2):376-384, 1982.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 45

Page 60: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD61 (2f2)Catalog Number 760-4249Type Mouse MonoclonalControl Bone MarrowLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Bone marrow

DescriptionAnti-CD61 labels the IIIa subunit of the non-covalently linked glycoprotein heterodimer IIb/IIIa complex present on human platelets and their precursors. This antibody is useful in identifying megakaryoblastic differentiation as seen in megakaryoblastic leukemia.

References1. Thiele J, et al., Eur J Haematol. 44:63-70, 1990.2. Thiele J, et al., Virchows Archiv B Cell Pathol. 58:295-302, 1990.3. Goldman BI, et al., Modern Pathology. 14:589-594, 2001.4. Fox SB, et al., Histopathology. 17(1):69-74, 1990.

5. Duperray A, et al., Blood. 74(5):1603-11, 1989.6. Campana D, et al., Leukemia. 4(9):620-4, 1990.7. Thiele J, et al., Anal Quant Histol. 12(4):285-9, 1990.

CD63 (NKI/C3)Catalog Number 760-4379Type Mouse MonoclonalControl Malignant MelanomaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1/K

Malignant melanoma in tonsil

DescriptionThis antibody reacts with a 53 kDa protein which forms a part of the family of tetraspan moieties. The antigen was originally designated as a lysosomal membrane protein characterized as an activation dependent platelet surface antigen. In fact the CD63 antigen has a diverse distribution on the surface and in the cytoplasm of many cell types including lymphoid, myeloid, endothelial cells and melanoma. It has been quite useful in identifying malignant melanoma. Mete, et al. found it useful in differentiating renal oncocytomas (RO) from eosinophilic renal cell carcinomas (eRCC). In his series of 35 ROs, 94% demonstrated apical and/or polar CD63 positivity. Of his 77 eRCCs, 96% showed diffuse cytoplasmic staining.

References1. Azorsa DO, et al., Blood. 15:78(2):280-4, 1991.2. Barrio MM, et al., Hybridoma. 17(4):355-64, 1998.3. Demetrick DJ, et al., J Natl Cancer Inst. 84(6):422-9, 1992.

4. Mete O, et al., Virchows Arch. 447(6):938-46, 2005. Epub 2005 Aug 17.5. Kwon MS, et al., Lung Cancer. 57(1):46-53, 2007. Epub 2007 Mar 12.

IHC_ISH | Primary Antibodies

46 Ventana Medical Systems, Inc. | 800.227.2155

Page 61: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM CD68 (KP-1)Catalog Number 790-2931Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1/K

Tonsil, histiocytes

DescriptionCONFIRM anti-CD68 reacts with a 110 kD intracellular glycoprotein associated with the cell membrane of macrophages and some myeloid elements.

References1. Facchetti F, et al., Histopathology. 19:141-5, 1991.2. Ruco LP, et al., Am J Clin Pathol. 92:273-9, 1989.3. Cordell JL, et al., Oxford Univ. Press-Oxford, New York 1995; 925-927.

4. Pulford KAF, et al., J Clin Pathol. 42:414-21, 1989.5. Vergier B, et al., Blood. 959(7):2212-8, 2000.

CD74 (LN2)Catalog Number 760-2628Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1

Normal Tonsil

DescriptionAnti-CD74 stains predominantly germinal center lymphocytes and B-cell lymphomas but rarely T-cell lymphomas. It stains the cell membrane, but a paranuclear globular labeling is also noted. It is a useful addition to the lymphoma phenotyping panel when B5 or alcohol fixed tissue is used. Anti-CD74 has been shown to be useful in differentiating atypical fibroxanthoma from malignant fibrous histiocytoma, as well as small cell lung carcinomas from non-small cell lung carcinomas.

References1. Chan JKC, et al., Histopathology. 25:517-536, 1994.2. Kasaian MT, et al., Proc of the Soc for Exp Bio and Med. 197:226-241, 1991.3. Jones NH, et al., Nature. 323:346-349, 1986.4. Lazova R, et al., Cancer. 79(11):2115-24, 1997.

5. Ioachim HL, et al., Am J Surg Pathol. 20(1): 64-71, 1996.6. Tang X, et al., Pathol Int. 45(1):34-44, 1995.7. Ohsawa M, et al., J Clin Pathol. 47(10):928-32, 1994.8. Ross CW, et al., Cancer. 70(10):2517-23, 1992.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 47

Page 62: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM CD79a (SP18)Catalog Number 790-4432Type Rabbit MonoclonalControl B-Cell Lymphoma, TonsilLocalization Cytoplasmic, MembranousQuantity 50 tests

Non-Hodgkin lymphoma

DescriptionCONFIRM anti-CD79a (SP18) Rabbit Monoclonal Primary Antibody is intended for the detection of CD79a in normal and neoplastic human tissues. Anti-CD79a is directed against a protein expressed on the surface of B lymphocytes at all stages of maturation, from B lymphocyte precursors through plasma cells. Expression of CD79a may aid in the identification of B-cell lineage in malignant lymphomas.

References1. Berg JM, et al., Biochemistry, 5th Ed. WH Freeman and Company, NY, 2002.2. Chu PG, et al., Appl Immunohistochem Mol Morphol. 9(2): 97-106, 2001.

3. Bhargava P, et al., Am J Clin Pathol. 128(2):306-313, 2007.4. Blakolmer K, et al., Mod Pathol. 13(7):766-772, 2000.5. Mason DY, et al. Blood. 86(4):1453-9, 1995.

CONFIRM CD99 (O13)Catalog Number 790-4452Type Mouse MonoclonalControl Pancreatic Islet Cells, Sertoli Cells of the TestisLocalization MembranousQuantity 50 testsIsotype IgG1

Ewing’s sarcoma

DescriptionCONFIRM anti-CD99 (O13) Mouse Monoclonal Primary Antibody is directed against human CD99 expressed on T lymphocytes, cortical thymocytes, granulosa cells of the ovary, pancreatic islet cells, CNS ependymal cells and Sertoli’s cells. CD99 shows a plasma membrane location. This antibody may be used as part of a panel to aid in the identification of Ewing’s sarcoma and related peripheral neuroectodermal tumors.

References1. Ambros IM, et al., Cancer. 67:1886-1893, 1991.2. Scotlandia K, et al., Cancer Research. 60(18):5134-5142, 2000.3. Milanezi F, et al., Histopathology. 39:578–583, 2001.

4. Pelosi G, et al., Virchows Arch. 437:270–274, 2000.5. Gordon MD, et al., Mod Pathol. 11:769–773, 1998.6. Ozdemirli M, et al., Mod Pathol. 14:1175–1182, 2001.

IHC_ISH | Primary Antibodies

48 Ventana Medical Systems, Inc. | 800.227.2155

Page 63: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CD138 (Syndecan-1) (B-A38)Catalog Number 760-4248Type Mouse MonoclonalControl Tonsil, PlasmacytomaLocalization MembranousQuantity 50 testsIsotype IgG

Tonsil, plasma cells

DescriptionAnti-CD138/syndecan-1 is a useful marker for labeling normal and neoplastic plasma cells and plasmacytoid lymphomas. Various forms of Hodgkin disease have also shown positive staining with this antibody.

References1. Chilosi M, et al., Mod Pathol. 12(12):1101-6, 1999.2. Sebestzen A, et al., Br J Haematol. 104(2):412-9, 1999.3. Carbone A, et al., Blood. 91(3):747-55, 1998.4. Bayer-Garner IB, et al., Mod Pathol. 14(10):1052-8, 20015. Lampert IA, et al., Appl Immunohistochem Mol Morphol. 13(2):124-31, 2005.

6. Oksanen A, et al., J Clin Pathol. 58(4):376-81, 2005.7. O’Connell FP, et al., Am J Clin Pathol. 121(2):254-63, 2004.8. Coloma L, et al., Am J Surg Pathol. 28(6):736-47, 2004.

CD163 (MRQ-26)Catalog Number 760-4437Type Mouse MonoclonalControl Inflamed TissueLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1

Placenta, normal

DescriptionCD163 was recently identified as an acute phase-regulated transmembrane protein whose function is to mediate the endocytosis of haptoglobinhemoglobin complexes. This receptor is expressed on the surface of monocytes (low expression) and tissue macrophages [also known as histiocytes] (high expression). It is a member of the cysteine-rich scavenger receptor superfamily, encoded by a gene localized on human chromosome 12p13.3. Solubilized in plasma, CD163 functions as an anti-inflammatory signal and has many roles in disease processes that range from autoimmune conditions such as rheumatoid arthritis to atherosclerosis. Previous work has shown that the CD163 gene can be regulated by glucocorticoids, IL-10, and other inflammatory modulators, and is highly expressed in inflamed tissues, consistent with its role in the resolution of inflammation. Staining for CD163 has been helpful in distinguishing synovial macrophages from synovial intimal fibroblasts in the setting of rheumatoid arthritis, where its specificity for macrophages was found to be superior to that of CD68, which does not discriminate between these cell types. Increased levels of CD163 were also detected in patients with microbial infections and myelomonocytic leukemias by an enzyme-linked immunosorbent assay. Flow cytometry studies have confirmed that CD163 expression is limited to leukemias with monocytic differentiation. Another recent study showed that all 5 cases of synovial-type giant cell tumors of the vertebral column stained for CD163.

References1. Backe E, et al., J Clin Pathol. 44(11):936-945, 1991.2. Buechler C, et al., J Leukoc Biol. 67(1):97-103, 2000.3. Hiraoka A, et al., Pathol Res Pract. 201(5):379-84, 2005.

4. Hogger P, et al., J Immunol. 161(4):1883-1890, 1998.5. Kristiansen M, et al., Nature. 409(6817):198-201, 2001.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 49

Page 64: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CDX-2 (EPR2764Y)Catalog Number 760-4380Type Rabbit MonoclonalControl Adenocarcinoma of Colon, Normal ColonLocalization NuclearQuantity 50 testsIsotype IgG

Colon adenoma

DescriptionCDX-2 is a caudal-related homeobox transcription factor whose expression in the adult is normally restricted to the intestinal epithelium. It is implicated in the development and maintenance of the intestinal mucosa. This protein is expressed immunohistochemically in the nuclei of normal intestinal epithelium. Loss of CDX-2 protein expression has been correlated with loss of differentiation in colorectal cancers. Anti-CDX-2 antibody has been useful in distinguishing gastrointestinal origin of metastatic adenocarcinomas and carcinoids. A high percentage of mucinous carcinomas of the ovary also stain positively with this antibody as well as carcinomas from the upper gastrointestinal tract.

References1. Levine PH, et al., Diagn Cytopathol. 34(3):191-5, 2006.2. Mazziotta RM, et al., Appl Immunohistochem Mol Morphol. 13(1):55-60, 2005.3. Saqi A, et al., Am J Clin Pathol. 123(3):394-404, 2005.4. Erickson LA, et al., Endocr Pathol. 15(3):247-52, 2004.

5. Saad RS, et al., Am J Clin Pathol. 122(3):421-7, 2004.6. Kaimaktchiev V, et al., Mod Pathol. 17(11):1392-9, 2004.7. Groisman GM, et al., Int J Gynecol Pathol. 23(1):52-7, 2004.8. Moskaluk CA, et al., Mod Pathol. 16(9):913-9, 2003.9. Werling RW, et al., Am J Surg Pathol. 27(3):303-10, 2003.

CEA (CEA31)Catalog Number 760-4594Type Mouse MonoclonalControl Adenocarcinoma of Colon, Colon MucosaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Colorectal carcinoma

DescriptionCEA (CEA31) used as an aid in the identification and diagnosis of adenocarcinomas within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Go, VLW et al. Cancer. 37:562-566, 1976.2. Delellis, RA et al. Am J Clin Pathol 50:587-594, 1978.3. Kamino, H et al. Cancer. 61:1142-1148, 1988.4. Tron, V et al. Arch Pathol Lab Med. 111:291-293, 1987.

5. Abutaily, AS et al. J Clin Pathol. 55(9):662-8, 2002.6. Bhatnagar, J et al. Anticancer Res. 22(3):1849-57, 2002.7. Carella, R et al. Am J Surg Pathol. 25(1):43-50, 2001.8. Lagandijk, JH et al. J Clin Pathol. 52(4):283-90, 1999.

IHC_ISH | Primary Antibodies

50 Ventana Medical Systems, Inc. | 800.227.2155

Page 65: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Chromogranin A (LK2H10)Catalog Number 760-2519Type Mouse MonoclonalControl PancreasLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Pancreatic islet cells

DescriptionAnti-Chromogranin A (LK2H10) specifically binds to the chromogranin A protein located in the secretory granules of normal and neoplastic neuroendocrine cells. Chromogranin A is also expressed by adrenal (medulla), parathyroid, anterior pituitary cells, islet cells of the pancreas, gastrointestinal cells, bronchial endocrine cells, and thyroid C cells. Chromogranin A is expressed in tumors of neuroendocrine origin, including pheochromocytomas, pituitary adenomas, islet cell tumors, medullary thyroid carcinomas, carcinoids and Merkel cell tumors. This reagent may be used to aid in the identification of cells of normal or neoplastic neuroendocrine lineage.

References1. Wilson BS, et al., Am J Clin Pathol. 115(3): 458-468, 1984.

PATHWAY c-KIT (9.7)Catalog Number 790-2951Type Rabbit MonoclonalControl GIST, Skin, BreastLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG

Membranous — GIST FDA APPROVED

DescriptionVENTANA PATHWAY anti-c-KIT (9.7) Primary Antibody is intended for laboratory use, via light microscopy, for the qualitative detection of KIT protein in formalin-fixed, paraffin-embedded gastrointestinal stromal tumors (GISTs) using either an automated immunohistochemistry staining system or a manual assay. It is indicated as an aid in the selection of GIST within the context of the patient’s clinical history, tumor morphology, and other diagnostic tests evaluated by a qualified pathologist. It may be used after the diagnosis of GIST as an aid in the selection of GIST patients who may qualify for imatinib mesylate (Gleevec/Glivec) therapy. PATHWAY anti-c-KIT (9.7) Primary Antibody is optimized for use on a VENTANA automated slide stainer and for manual application in combination with VENTANA iVIEW DAB Detection Kit and accessories. The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests. Prescription only.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 51

Page 66: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PATHWAY c-KIT (9.7), continued

DescriptionThe Role of KIT Gene Mutations in the Development of GISTs:In their landmark 1998 publication, Dr. Hirota and his colleagues established not only that GISTs express KIT, but that KIT gene mutations are present in these tumors. Furthermore, they showed that the resulting mutant KIT isoforms demonstrate kinase activity in the absence of stem cell factor, the natural ligand for KIT. These observations have been confirmed by a growing number of groups and it is now established that KIT mutations are present in >85% of GISTs. The majority of mutations occurs in exon 11 (65-70% of GISTs) and includes a wide range of deletions, insertions, point mutations, or combinations thereof. An insertion/reduplication of six base pairs in exon 9 is found in ~15% of GISTs, almost exclusively in those arising in the small intestine. Mutations also occur in exons 13 and 17, but are much rarer. Regardless of the exon involved, KIT gene mutations in GISTs are invariably in-frame and, when cloned and expressed in vitro, have constitutive kinase activation. Moreover, phosphorylation of KIT is consistently detectable in GIST tumor extracts, supporting a direct role for KIT in intracellular signaling.

Clinical Significance:GISTs arise predominantly in the stomach (60%) and small intestine (25%), but also occur in the rectum (5%), esophagus (5%) and a variety of other locations (5%), including appendix, gallbladder, mesentery, and omentum. Affected patients range in age from the teens to the 90’s, but the majority are older and the peak is around age 60. A slight male predilection has been observed in most studies. There are no solid figures on the true incidence of GISTs, but it is estimated that ~4,500 new cases are diagnosed each year in the United States. In 1998, Drs. Seichi Hirota (Osaka University) and Lars-Gunnar Kindblom (University of Gothenburg) each independently observed that GISTS express the receptor tyrosine kinase KIT (CD117). Their observations provided a clue to the possible cell of origin for GISTs, namely the interstitial cells of Cajal (ICC). These inconspicuous, dendritic-like cells are widely distributed throughout the muscularis propria of the esophagus, stomach, small and large bowel. They play an important role in gut motility by regulating slow-wave contractions. Like GISTs, ICC express KIT and the majority are also positive for CD34. The hypothesis that GISTs are pathogenetically related to ICC in the gut wall, as proposed by both Dr. Hirota and Dr. Kindblom, is now widely accepted. Subsequent studies from a large number of different laboratories have confirmed that KIT is the single most specific marker of GISTs. Immunodetectable KIT is present on the cell surface and/or cytoplasm of GIST tumor cells in approximately 90% of cases.

Highly Sensitive and SpecificThe scientifically advanced rabbit monoclonal antibody technology of PATHWAY c-KIT clone 9.7 is the source of optimized assay sensitivity and specificity. Directed against the c-terminal domain of the c-KIT protein, PATHWAY c-KIT recognizes both wild-type and mutant forms of the c-KIT protein. PATHWAY c-KIT (9.7) specifically binds to antigen located in the cell membrane and cytoplasmic regions of mast cells, interstitial cells of Cajal (ICC), and GIST cells. The advanced performance of the PATHWAY c-KIT rabbit monoclonal antibody and standardized slide preparation assist the pathologist with the clear differentiation of positives and negatives in this qualitative assay. The following are examples of staining for c-KIT in GIST and physiologic tissues (intestine) using PATHWAY c-KIT.

References1. Blechman J, et al., J. Biol. Chem. 228:(6)4399-4406, 19932. Corless C, et al., Am. J. of Pathol. 160:1567-1572, 2002.3. Fletcher C, et al., Human Pathol. 33:459-465, 2002.4. Heinrich MC, et al., J. Clin. Oncol. 20:1692-703, 2002.5. Heinrich M, et al., Proceedings of ASCO. 21:2a(abstract #6), 2002.6. Hirota S, et al., Int. J .Clin. Oncol. 6:1-5, 2001.7. Hirota S, et al., Science. 279:577-80, 1998.8. Hirota S, et al., Am. J. Surg. Pathol. 24:326-7, 2000.9. Isozaki K, et al., Am. J. of Pathol. 157:1581-5, 2000.

10. Kindblom LG, et al., Am. J. Pathol. 152:1259-69, 1998.11. Maeyama H, et al., Gastroenterology. 120:210-5, 2001.12. Miettinen M, et al., Virchows Arch. 438:1-12, 2001.13. Nishida T, et al., Nat. Genet. 19:323-4, 1998.14. Rubin BP, et al., Int. J. Surg. Pathol. 8:5-10, 2000.15. Rubin BP, et al., Cancer Res. 61:8118-8121, 2001.16. Taniguchi M, et al., Cancer Res. 59:4297-300, 1999.17. Yarden Y, et al., EMBO Journal. 6:3341-3351, 1987.

As shown, the PATHWAY anti-c-KIT (9.7) has the characteristic-specific doublet band of 140-145 kD in lysates from GIST 822 cells. It does not cross-react with lysates from homologous receptor tyrosine kinases PDGFR alpha, c-FMS, or Flt-3.

c-KI

T

Flt-

3

c-FM

S

PDG

FR α

IHC_ISH | Primary Antibodies

52 Ventana Medical Systems, Inc. | 800.227.2155

Page 67: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Total c-MET (SP44)Catalog Number 790-4430Type Rabbit MonoclonalControl Kidney, Gastric Carcinoma, Non-Small Cell Lung CarcinomaLocalization Cytoplasmic, MembranousQuantity 50 tests

Colon carcinoma

DescriptionCONFIRM anti-Total c-MET (SP44) Rabbit Monoclonal Primary Antibody is directed against a membranous and/or cytoplasmic epitope present in human normal epithelial or tumor cells. This antibody may be used to aid in the identification of normal and neoplastic c-MET expressing cells.

References1. Prat M, et al., Int J Cancer. 49(3):323-328, 1991.2. Comoglio PM, et al., Nature Reviews Drug Disc. 7(6):504-516, 2008.

3. Lutterbach B, et al., Cancer Research. 67(5):2081-2088, 2007.4. Engelman JA, et al., Science. 316(5827):1039-1043, 2007.

Collagen Type IV (CIV22)Catalog Number 760-2632Type Mouse MonoclonalControl Muscle, LungLocalization Basement MembraneQuantity 50 testsIsotype IgG1/K

Lung

DescriptionCollagen Type IV is the major component of the basal lamina, so antibodies to this molecule confirm its presence and reveal the morphological appearance of the structure. Normal tissue stains with this antibody in a fashion consistent with the sites of mesenchymal elements and epithelial basal laminae. Anti-Collagen IV can also be useful in the classification of soft tissue tumors; schwanomas, leiomyomas and their well differentiated, malignant counterparts usually immuno react with this antibody. The vascular nature of neoplasms, hemangiopericytoma, angiosarcoma and epithelioid hemangioendothelioma can be revealed by this antibody with greater reliability than non-specific stains (e.g. silver reticulum).

References1. Gould VE, et al., Pathol Annul. 11:353-386, 1976.2. McArdle JP, et al., Int J Cancer. 34:633-638, 1984.

3. Sakr WA, et al., Hum Path. 18:1043-1050, 1987.4. Barsky SH, et al., Am J Surg Path. 7:667-677, 1983.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 53

Page 68: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

COX-2 (Cyclooxygenase 2) (SP21)Catalog Number 760-4254Type Rabbit MonoclonalControl Colon AdenocarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG

Colon adenocarcinoma

DescriptionCyclooxygenase 2 (COX-2) catalyzes the conversion of arachidonic acid to prostaglandin H2 in the first step in the biosynthesis of prostaglandins, thromboxanes, and prostacyclins. COX-2 inhibition by nonsteroidal antiinflamatory agents has been shown to decrease angiogenesis and tumor growth, and promote apoptosis. COX-2 overexpression has been associated with increased microvascular density. COX-2 overexpression has also been suggested as a poor prognostic indicator in carcinomas of the colon, breast, pancreas, and adenocarcinoma of the lung.

References1. Stoehlmacker J, et al., Semin Oncol. (3)suppl 6:10-16, 2003.2. Gallo O, et al., Hum Pathol. 33(7):708-714, 2002.3. Sano H, et al., Cancer Res. 55(17):3785-9, 1995.

4. Denkert C, et al., Cancer. 97(12):2978-87, 2003.5. Sheehan KM, et al., Hum Pathol. 34:1242-1246, 2003.

Cyclin D1 (SP4-R)Catalog Number 790-4508Type Rabbit MonoclonalControl TonsilLocalization NuclearQuantity 50 testsIsotype IgG

DescriptionAnti-Cyclin D1 (SP4-R) Rabbit Monoclonal Primary Antibody is directed against the cyclin D1 molecule, a key cell cycle regulator, expressed primarily during the G1 phase of the cell cycle. This antibody exhibits a nuclear staining pattern, and may be used to aid in the identification of mantle cell lymphoma, and breast carcinoma.

References1. Milenkovic S, et al., Cell Mol Neurobiol. 28:907-913, 2008.2. Yang K, et al., Cell Division. 1:1-8, 2006.3. Lesage D, et al., Int J Cancer. 115:171-176, 2005.4. Arnold A, et al. J Clin Oncol. 23:4215-4224, 2005.

5. Dobashi Y, et al., Int J Cancer. 110:532-541, 2004.6. Yang C, et al., Urologia Internationalis. 69:190-194, 2002.7. Aguilera NS, et al., Am J of Path. 153:1969-76, 1998.

IHC_ISH | Primary Antibodies

54 Ventana Medical Systems, Inc. | 800.227.2155

Page 69: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Cytokeratin (CAM 5.2)Catalog Number 790-4555Type Mouse MonoclonalControl Pancreatic Carcinoma and ColonLocalization CytoplasmicQuantity 50 testsIsotype IgG

Colon adenocarcinoma

DescriptionAnti-Cytokeratin (CAM 5.2) Mouse Monoclonal Primary Antibody is directed against cytokeratin 7 and cytokeratin 8 present on secretory epithelia but not on stratified squamous epithelia. This antibody may be used to aid in the identification of tumors of epithelial origin such as colorectal, pancreatic, and non-small cell lung cancer, and in distinguishing carcinomas from other malignant tumors of non-epithelial origin.

References1. Makin CA, et al. J Clin Pathol. 37:975-983, 1984.2. Chu PG, et al. Endocr Pathol. 20:1-10, 2009.

3. Quinlan RA, et al. Annals New York Academy of Sciences. 282-306, 1985.

CONFIRM Cytokeratin (34βE12)Catalog Number 790-4373Type Mouse MonoclonalControl ProstateLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Prostate carcinoma

DescriptionCONFIRM anti-Cytokeratin (34βE12) Mouse Monoclonal Primary Antibody recognizes cytokeratins 1, 5, 10, and 14 of the Moll catalog and is used as an aid in the identification of basal cells in prostate, and myoepithelial cells in breast. Clone 34βE12 has been characterized as identifying high molecular weight (HMW) cytokeratins found in squamous and ductal epithelium over a wide range of organ tissues. Clone 34βE12 reacts with basal cells in normal epithelia of the prostate.

References1. Gown A, et al., Amer J Clin Pathol. 84: 413-424, 1985.2. Brawer M, et al., Canc Res. 45: 3663-3667, 1985.

3. Moll R, et al., Cell. 31: 11-24, 1982.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 55

Page 70: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Cytokeratin (AE1)Catalog Number 760-2521Type Mouse MonoclonalControl Prostate, Salivary GlandLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Prostate

DescriptionCONFIRM anti-Cytokeratin (AE1) may be used to aid in the identification of cells of normal and abnormal epithelial lineage as an aid in diagnosis of anaplastic tumors. CONFIRM anti-Cytokeratin (AE1) recognizes an epitope found on human callus cytokeratins; it reacts with the 56.5 kD, 50 kD, 50’ kD, 48 kD, and 40 kD cytokeratins of the acidic subfamily. Because specific combinations of cytokeratin peptides are associated with different epithelial cells, these peptides are clinically important markers for classifying carcinomas (tumors of epithelial origin) and for distinguishing carcinomas from malignant tumors of non epithelial origin such as lymphomas, melanomas, and sarcomas.

References1. Robbins SL, et al., Pathol Basis of Disease 3rd Ed. W.B. Saunders, New York, 1984.2. Woodcock-Mitchell J, et al., J Cell Biol. 95(2 Pt 1): 580-588, 1982.

3. Spagnolo DV, et al., Am J Clin Pathol. 84(6): 697-704, 1985.4. Thomas P, et al., Hum Pathol. 18(7): 728-734, 1987.

CONFIRM Cytokeratin (AE3)Catalog Number 790-2909Type Mouse MonoclonalControl Prostate, Salivary Gland, BladderLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Stratified squamous epithelium

DescriptionCONFIRM anti-Keratin (AE3) recognizes basic cytokeratins of 65-67, 64, 59, 56, and 52 kD. The antibody is a marker used to distinguish carcinomas from non-epithelial tumors.

References1. Pinkus GS, et al., J. Histochem and Cytochem. 33(5): 465-473, 1985.2. Weiss RA, et al., J Cell Biol. 98(4): 1397-1406, 1984.

3. Tseng SC, et al., Cell. 30(2): 361-372, 1982.4. Woodcock-Mitchell J, et al., J. Cell Biol. 95(2 pt 1):580-588, 1982.

IHC_ISH | Primary Antibodies

56 Ventana Medical Systems, Inc. | 800.227.2155

Page 71: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Cytokeratin (Pan) (AE1/AE3 & PCK26)Catalog Number 760-2595, 760-2135Type Mouse MonoclonalControl Intestine, LiverLocalization CytoplasmicQuantity 50 Tests (760-2595), 250 Tests (760-2135)Isotype IgG1

Skin

DescriptionAnti-Pan Cytokeratin (AE1/AE3/PCK26) may be used to aid in the identification of normal and abnormal epithelial cells and to determine the lineage of poorly differentiated malignant tumors. This antibody cocktail recognizes most of the acidic and all of the basic cytokeratins, making it a useful stain for nearly all epithelial tissues and their tumors. Anti-Pan Keratin (AE1/AE3/PCK26) specifically binds to antigens located in the cytoplasm of simple and complex epithelial cells; it reacts with the 56.5kD, 50kD, 50’kD, 48kD, and 40kD cytokeratins of the acidic subfamily and 65-67kD, 64kD, 59kD, 58kD, 56kD, and 52kD cytokeratins of the basic subfamily.

References1. Woodkcock-Mitchell J, et al., J Cell Biol. 95(2 pt 1): 580-588, 1982.2. Spagnolo DV, et al., Am J Clin Pathol. 84(6):,697-704, 1985.3. Lane EB, et al., Nature. 356(6366): 244-246, 1992.

4. Sun TT, et al., Annals NY Acad Sci. 455: 307-329, 1985.5. Eichner R, et al., Cell Biol. 98(4): 1388-1396, 1984.

Cytokeratin 5/6 (D5/16B4)Catalog Number 790-4554Type Mouse MonoclonalControl Prostate and TonsilLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Lung squamous cell carcinoma

DescriptionAnti-Cytokeratin 5/6 (D5/16B4) Mouse Monoclonal Primary Antibody detects cytokeratins 5 and 6. Cytokeratin 5 is expressed in various epithelia and mesothelial cells, while cytokeratin 6 is expressed by proliferating squamous epithelium. This antibody exhibits a cytoplasmic staining pattern and may be used to aid in the identification of squamous cell carcinoma and in distinguishing malignant mesothelioma from lung adenocarcinomas. The detection of cytokeratin 5 in myoepithelial cells with this antibody may also be used to aid in the determination of breast and prostate malignancies.

References1. Pu RT, et al. Diagn Cytopathol. 36:20-25. 2008.2. Moll R, et al. Cell. 31:11-24, 1982.3. Clover J, et al. AntiHistopathol. 31:140-143, 1997.4. Cury PM, et al. Mod. Pathol. 13:107-112, 2000.

5. Otterbach F, et al. Histopathol. 37:232-240, 2000.6. Trokov K, et al. Am J Clin Pathol. 132:211-220, 2009.7. Chu PG, et al. Mod Pathol. 15:6-10, 2002.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 57

Page 72: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Cytokeratin 7 (SP52)Catalog Number 790-4462Type Rabbit MonoclonalControl Glandular and Ductal Epithelium of Lung, Salivary Gland, Breast TissueLocalization CytoplasmicQuantity 50 tests

Lung adenocarcinoma

DescriptionCONFIRM anti-Cytokeratin 7 (SP52) Rabbit Monoclonal Primary Antibody is directed against a type II cytokeratin protein expressed by most ductal, glandular and transitional epithelia. Cytokeratin 7 exhibits a cytoplasmic localization. This antibody may be used to aid in the identification of normal and neoplastic cells of ovary, lung and breast epithelial origin which express Cytokeratin 7, and those of colonic and prostate epithelial lineage which lack Cytokeratin 7 production.

References1. Wick MR, et al., Immunohistology of the Gastrointestinal Tract, Pancreas, Bile Ducts, Gallbladder, and Liver. Diagnostic Immunohistochemistry, 2nd Edition. Philadelphia, PA. Elsevier Inc; 2006:464-465.2. Rubin BP, et al., Euro J of Cancer Prevent. 10:77-82, 2001.3. Wang HL, et al., Am J Surg Path. 25 (11):1380-1387, 2001.

4. Inamura K., et al., Am J Surg Pathol. 29:660-665, 2005.5. Rekhi B, et al., Diagn Pathol. 3:39-45, 2008.6. Rossi G, et al., J Thorac Oncol. 2:115–120, 2007.7. Sack MJ, et al., Diagn Cytopathol. 16:132-136, 1997.8. Tsao SC, et al., Kaohsiung J Med Sci. 23:325–331, 2007.

Cytokeratin 8 (35betaH11)Catalog Number 760-2637Type Mouse MonoclonalControl ProstateLocalization CytoplasmicQuantity 50 testsIsotype IgM/K

Andenocarcinoma

DescriptionCytokeratin 8 is reactive with the majority of epithelium and epithelial tumors; non-squamous tumors stain positive and squamous tumors stain negative. This antibody stains positive for adenocarcinomas of the breast, ovary, gastrointestinal tract, thyroid, pancreas, bile duct, and salivary glands. This antibody does not react with skeletal muscle or nerve cells.

References1. Gown AM, et al., Am J Pathol. 114:309, 1984.2. O’Malley FP, et al., Virch Arch. A. 417:191, 1990.

3. Mahul B, et al., Arch Pathol Lab Med. Vol. 118:260-264, 1994.4. Wojno KJ, et al., Am J Surg Pathol. 19(3):251-60, 1995.

IHC_ISH | Primary Antibodies

58 Ventana Medical Systems, Inc. | 800.227.2155

Page 73: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Cytokeratin 8 & 18 (B22.1 & B23.1)Catalog Number 760-4344Type Mouse MonoclonalControl Pancreas, Prostate, Salivary GlandLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Breast

DescriptionAnti-Cytokeratin 8 & 18 (B22.1 & B23.1) Primary Antibody is a cocktail of two mouse monoclonal antibodies. Cytokeratins 8 & 18 can be found in most simple epithelium, e.g. thyroid, female breast, gastrointestinal tract, and respiratory tract. Adenocarcinomas and most non-keratinizing squamous carcinomas will stain, but keratinizing squamous carcinomas will not. This cocktail is used when attempting to demonstrate the presence of Paget cells; there is very little keratin 18 in the normal epidermis so this will only stain Paget cells. This approach facilitates the interpretation using immunostains and is more sensitive than mucin histochemistry.

References1. Angus B, et al., Journal of Pathology. 155:377-384, 1987.2. Corson JM., Pathol Annual 21 (part 2). 47-81, 1986.

3. Sasaki M et al., Histopathology. 32(3):199-208, 1998.

Cytokeratin 10 (SP99)Catalog Number 790-4562Type Rabbit MonoclonalControl SkinLocalization CytoplasmicQuantity 50 testsIsotype Rabbit Ig

Rectal squamous cell carcinoma

DescriptionAnti-Cytokeratin 10 (SP99) Rabbit Monoclonal Primary Antibody is directed against the 56.5kD member of the type 1 cytokeratin family, cytokeratin 10. Cytokeratin 10 is expressed in keratinizing stratified epithelia, but is absent from the basal layer, in various organs including the skin. Anti-Cytokeratin 10 (SP99) exhibits a cytoplasmic staining pattern and may be used to aid in the identification of well differentiated squamous carcinomas of the cervix and anus.

References1. Moll R, et al. Cell. 31:11-24, 1982.2. Fillies T, et. al. BMC Can. 6:1186-1194, 2006.

3. Parks JM, et al. Human Path. 41:431-437, 2010.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 59

Page 74: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Cytokeratin 14 (LL002)Catalog Number 760-4251Type Mouse MonoclonalControl Squamous Mucosa, Squamous CarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG3

Squamous mucosa

DescriptionCytokeratin 14 is a 50 kD polypeptide found in basal cell of squamous epithelia, some glandular epithelia, myoepithelium, and mesothelial cells. Anti-Cytokeratin 14 has been demonstrated to be useful in differentiating squamous cell carcinomas from other epithelial tumors. This antibody has also been useful in separating oncocytic tumors of the kidney from its renal mimics, as well as in determining metaplastic carcinomas of the breast.

References1. Reis-Filho JS, et al., Appl Immunohistochem Mol Morphol. 11(1):1-8, 2003.2. Chu PG, et al., Histopathology. 39(1):9-16, 2001.

3. Chu PG, et al., Histopathology. 39(5):455-62, 2001.4. Dabbs DJ, et al., Diagnostic Immunohistochemistry, Churchill-Livingstone, Philadelphia, 2002; 166-176.

Cytokeratin 17 (SP95)Catalog Number 790-4560Type Rabbit MonoclonalControl Cervical Carcinoma, Normal SkinLocalization Membranous, CytoplasmicQuantity 50 testsIsotype Rabbit Ig

Rectal squamous cell carcinoma

DescriptionAnti-Cytokeratin 17 (SP95) Rabbit Monoclonal Primary Antibody is directed against Cytokeratin 17 expressed in basal cells of complex epithelia, glandular epithelium with myoepithelial component, and transitional and pseudostratified epithelia. This antibody may be used to aid in the identification of squamous cell carcinomas in various tissues including the cervix, lung, and oral cavity.

References1. Troyanovsky S, et al. J Cell Sci. 93:419-426, 1989.2. Quinlan R, et al. Ann NY Acad Sci. 455:282-306, 1985.3. Martens J, et al. Anticancer Res. 24:771-776, 2004.

4. Toyoshima T, et al. J Cancer Res. Clin. Oncol. 134:515-521, 2008.5. Blobel G, Moll, et al. Cell Pathol. 45:407-429, 1984.6. Rijn M, et al. Am J Pathol. 161,6:1991-1996, 2002.

IHC_ISH | Primary Antibodies

60 Ventana Medical Systems, Inc. | 800.227.2155

Page 75: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Cytokeratin 19 (A53-B/A2.26)Catalog Number 760-4281Type Mouse MonoclonalControl Colon and Thyroid CarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Colon carcinoma

DescriptionAnti-Cytokeratin 19 reacts with a wide variety of epithelium and epithelial malignancies including adenocarcinomas of the colon, stomach, pancreas, biliary tract, liver, and breast. Perhaps the most useful application is the identification of thyroid carcinoma of the papillary type, although, follicular carcinoma is also labeled by this antibody approximately 50-60% of the time.

References1. Zubair W, et al., Hum Pathol. 30:1166-1171, 1999.2. Judkins AR, et al., Hum Pathol. 30:1373-1376, 1999.

3. Cerilli LA, et al., Am J Clin Pathol. 118:186-193, 2002.4. Nasser SM, et al., Cancer (Cancer Cytopathol). 90:307-11, 2000.

CONFIRM Cytokeratin 20 (SP33)Catalog Number 790-4431Type Rabbit MonoclonalControl Colon AdenocarcinomaLocalization CytoplasmicQuantity 50 tests

Colon carcinoma

DescriptionCONFIRM anti-Cytokeratin 20 (SP33) Rabbit Monoclonal Primary Antibody is directed against a type I cytokeratin protein of mature enterocytes and goblet cells of the gastric and intestinal mucosa. This antibody produces a cytoplasmic staining pattern, and may be used to aid in the identification of normal cytokeratin 20 expressing cells and neoplastic cells of colonic epithelial lineage.

References1. Zhou Q, et al., Mol Biology of the Cell. 14(7):2959-71, 2003.2. Moll R, et al., Differentiation. 53(2):75-93, 1993.3. Moll R, et al., Am J of Path. 140(2):427-447, 1992.4. Chan J, et al., Am J of Surg Path. 21(2):226-234, 1997.

5. Zhou Q, et al., J of Biol Chem. 281(24):16453-16461, 2006.6. Kyung-Joon M, et al., Path Res and Practice. 202(7):531-535, 2006.7. Tot T, Annals of Diag Path. 3(6):350-356, 1999.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 61

Page 76: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Desmin (DE-R-11)Catalog Number 760-2513Type Mouse MonoclonalControl IntestineLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Rhabdomyosarcoma

DescriptionCONFIRM anti-Desmin (DE-R-11) identifies normal muscle cells and myogenic neoplasms bearing the desmin antigen. The most obvious application of anti-desmin antibodies is in the characterization of myogenic neoplasms or in the recognition of myogenic cell lines in mixed sarcomas. Among neoplasms, carcinomas do not react with anti-desmin antibodies, leiomyosarcomas, and rhabdomyosarcomas are positive, and other sarcomas (with some exceptions) are negative. Myogenic sarcomas can be classified as such, due to their positive staining with antibodies to muscle (specific) actin and desmin. Because of the different sensitivities and specificities of these antibodies, they are best used in combination.

References1. Debus E, et al., EMBO J. 2(12): 2305-2312, 1983.2. True LD, Atlas of Diag Immuno Histopathol Lippincott Co Philadelphia, 1990.

3. Taylor RT, et al., Immunomicroscopy 2nd Edition, WB Saunders Co., Philadelphia, 1994.

DOG1 (SP31)Catalog Number 760-4590Type Rabbit MonoclonalControl GISTLocalization Cytoplasmic, MembranousQuantity 50 tests

GIST

DescriptionDOG1 is used as an aid in the identification and diagnosis of gastrointestinal stromal tumors (GIST) within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Espinosa, I et al. Am J Surg Pathol. 32(2):210-8, 2008.2. Miwa, S et al. Mutation. J Gastroen-terol. 43(7):531-7, 2008.

3. Parfitt, JR et al. Gastrointestinal. Histopathology. 52(7):816-23, 2008.4. West, RB et al. Am J Pathol. 165(1):107-13, 2004.

IHC_ISH | Primary Antibodies

62 Ventana Medical Systems, Inc. | 800.227.2155

Page 77: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

E-cadherin (36)Catalog Number 790-4497 Type Mouse MonoclonalControl Ductal Breast CarcinomaLocalization MembranousQuantity 50 testsIsotype IgG2a/k

Breast carcinoma

DescriptionVENTANA anti-E-cadherin (36) Mouse Monoclonal Primary Antibody is directed against human transmembrane protein E-cadherin expressed as a part of the cell-cell adhesion complex in epithelial tissues. Reduction or loss of expression is associated with invasive carcinoma and possibly metastasis in a variety of carcinomas. This antibody may be used to aid in the differentiation of in situ and/or invasive lobular carcinoma from in situ and/or invasive ductal carcinoma of the breast.

References1. Berx G, et al., Breast Cancer Res. 3:289-293, 2001.2. Van Roy F, et al., Cell Mol Life Sci. 65:3756-3788, 2008.3. Beavon IRG., European Journal of Cancer. 36:1607-1620, 2000.4. Siitonen SM, et al., Am J Clin Pathol. 105: 394-402, 1996.5. Geza A, et al., Am J Clin Pathol. 115:85-98, 2001.

6. Choi YJ, et al., Mod Pathol. 21:1224-1237, 2008.7. Qureshi HS, et al., Am J Clin Path. 125:377-385, 2006.8. Kowalski PJ, et al., Breast Cancer Res. 5:R217-R222, 2003.9. Abutaily AS, et al., J Pathol. 201:355-362, 2003.

E-cadherin (EP700Y)Catalog Number 760-4440Type Rabbit MonoclonalControl Pancreas, Lung Adenocarcinoma, BreastLocalization MembranousQuantity 50 testsIsotype IgG

Infiltrating carcinoma of the breast

DescriptionE-Cadherin is an adhesion protein that is expressed in cells of epithelial lineage. Anti-E Cadherin stains positively in glandular epithelium as well as adenocarcinomas of the lung, G.I. tract, and ovary. It has been useful in distinguishing adenocarcinoma from mesothelioma. Another application involves the differentiation of ductal (which stains positive) vs. lobular cancer of the breast. It has also been shown to be positive in some thyroid carcinomas. Loss of E-Cadherin expression has been suggested to be a poor prognostic sign in breast carcinoma and nonsmall cell lung carcinoma.

References1. Krishnadath KK, et al., J Pathol. 182(3):331-8, 1997.2. Schofield K, et al., Cancer. 81(5):293-8, 1997.3. Han AC, et al., Hum Pathol. 28(6):641-5, 1997.4. Simsir A, et al., Diagn Cytopathol. 20(3):125-30, 1999.5. Han AC, et al., Cancer. 87(2):83-6, 1999.6. Lear MP, et al., Histopathology. 32(3):209-16, 1998.

7. Karayiannakis AG, et al., Hepatogastroenterology. 45(24):2437-42, 1998.8. Peralta Soler A, et al., Hum Pathol. 28(6):734-9, 1997.9. Abutaily AS, et al., J Clin Pathol. 55(9):662-8, 2002.10. Wahed A, et al., Ann Diagn Pathol. 6(6):349-51, 2002.11. Acs G, et al., Am J Clin Pathol. 115(1):85-98, 2001.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 63

Page 78: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM EGFR (Epidermal Growth Factor Receptor) (3C6)Catalog Number 790-2988Type Mouse MonoclonalControl Colorectal Adenocarcinoma, SkinLocalization MembranousQuantity 50 testsIsotype IgG1

Squamous cell carcinoma

DescriptionCONFIRM anti-Epidermal Growth Factor Receptor (EGFR) (3C6) Primary Antibody is directed against the extracellular domain of human EGFR, a protein of 170 kD. The antibody also recognizes the type III variant of 145 kD. EGFR is a member of the receptor tyrosine kinase HER family. Also known as HER1, EGFR is structurally related to HER2, HER3, and HER4. Members of this family are capable of forming heterodimers to elicit signal transduction. EGFR is expressed at low levels in most normal epithelial tissues, but can be overexpressed in cancers of the breast, brain, bladder, lung, gastric, head and neck, esophagus, cervix, ovary, endometrium, and particularly in squamous cell carcinomas.

References1. Ciardello F, et al., Eur J Cancer. 39:1348-54, 2003.

CONFIRM EGFR (Epidermal Growth Factor Receptor) (5B7)Catalog Number 790-4347Type Rabbit MonoclonalControl Skin, Non Small Cell Lung Carcinoma, PlacentaLocalization Cytoplasmic, MembranousQuantity 50 tests

Squamous cell carcinoma, lung

DescriptionCONFIRM anti-EGFR (5B7) is a rabbit monoclonal antibody produced against a synthetic peptide from the carboxy terminal (cytoplasmic) region of EGFR. The epitope recognized by anti-EGFR (5B7) is associated with an internal domain of EGFR, and therefore EGFR staining with antibodies that recognize extracellular domains may not always correlate with CONFIRM anti-EGFR (5B7) staining. EGFR is a member of the receptor tyrosine kinase HER family. Also known as HER 1, EGFR is structurally related to HER 2, HER 3, and HER 4. Members of this protein family are capable of forming heterodimers to mediate signal transduction. EGFR is expressed at low levels in most normal epithelial tissues, but can be overexpressed in cancers of the breast, brain, bladder, lung, gastric, head and neck, esophagus, cervix, ovary, endometrium, and particularly in squamous cell carcinomas.

References1. Ciardello F, et al., Eur J Cancer. 39:1348-54, 2003.

IHC_ISH | Primary Antibodies

64 Ventana Medical Systems, Inc. | 800.227.2155

Page 79: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM EMA (Epithelial Membrane Antigen) (E29)Catalog Number 790-4463Type Mouse MonoclonalControl Normal PancreasLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG2a

Breast, ductal carcinoma

DescriptionCONFIRM anti-EMA (E29) Mouse Monoclonal Primary Antibody is directed against epithelial membrane antigen expressed on the apical surface of glandular epithelia. This glycoprotein is primarily membrane localized on normal and tumor tissue, although it may exhibit a cytoplasmic localization in less differentiated carcinomas. This antibody may be used to aid in the identification of epithelial membrane antigen in adenocarcinomas derived from secretory epithelia, malignant mesothelioma, renal cell carcinomas and meningiomas.

References1. Heyderman E, et al., Br J Cancer. 52:355-361, 1985.2. Cordell J, et al., Br J Cancer. 52:347-354, 1985.3. Metze D, et al., J Cutan Pathol. 23:518-529, 1996.4. Dejmek A, et al., Cytopathol. 11:8-17, 2000.

5. Murakata LA, et al., Mod Pathol. 13:874-881, 2000.6. Schnitt SJ, et al., Amer J Surg Pathol. 10:640-649, 1986.7. Gupta RK, et al., Cytopathol. 11:312-321, 2000.

Epithelial Related Antigen (MOC-31)Catalog Number 790-4561Type Mouse MonoclonalControl Kidney, Breast, Lung, and ColonLocalization Membranous, CytoplasmicQuantity 50 testsIsotype IgG1

Lung adenocarcinoma

DescriptionAnti-Epithelial Related Antigen (MOC-31) Mouse Monoclonal Primary Antibody is directed against the 40kD epithelial cell adhesion molecule, Epithelial Related Antigen. Epithelial Related Antigen is expressed in most normal epithelial cells in tissues including lung, breast, pancreas, and colon. This antibody exhibits a membranous and/or cytoplasmic staining pattern in neoplastic and normal tissue. Anti-Epithelial Related Antigen (MOC-31) Mouse Monoclonal Primary Antibody may be used as an aid in the differentiation of lung adenocarcinoma and mesothelioma.

References1. Oates J, et al. Histopathology. 36:341-347, 2000.2. Morrison C, et al. Mod Pathol. 15:1279-1287, 2002.3. Hecht JL, et al. Cancer Cytopathology. 108:56-59, 2005.4. De Leij L, et al. Int J Cancer Suppl. 8:60-63, 1994.5. Stauss H, et al. CRC Press; 2003.6. Ordońez N. Am J Surg Pathol. 27:1031-1051, 2003.

7. Pu RT, et al. Diagnostic Citopathology. 36:20-25, 2007.8. Porcell AI, et al. Mod Pathol. 13:773-778, 2000.9. King JE, et al. Histopathology. 48:223-232, 2006.10. Winter MJ, et al. Am J Pathol. 163:2139-2148, 2003.11. Bartnetson RJ, et al. Am J Clin Pathol. 125:67-76, 2006.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 65

Page 80: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Ep-CAM (Epithelial Specific Antigen) (Ber-EP4)Catalog Number 760-4383Type Mouse MonoclonalControl Columnar Epithelium, AdenocarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Colon carcinoma

DescriptionEp-CAM consists of two glycoproteins, 34 and 39 kDa, sometimes designated epithelial antigen, epithelial specific antigen, and epithelial glycoprotein. The glycoproteins are located on the cell membrane surface and in the cytoplasm of virtually all epithelial cells with the exception of most squamous epithelia, hepatocytes, renal proximal tubular cells, gastric parietal cells and myoepithelial cells. However, focal positivity may be seen in the basal layer of squamous cell epithelium of endoderm (e.g., palatine tonsils) and mesoderm (e.g., uterine cervix). In liver lesions like hepatitis and cirrhosis, the hepatocytes frequently become Ep-CAM positive. Normal mesothelial cells are Ep-CAM negative, but may express focal reaction when undergoing reactive changes. Mesenchymal cells and cells from the neural crest are negative, with the exception of olfactory neurons.

Ep-CAM is found in the large majority of adenocarcinomas of most sites (50-100% in various studies; as well as neuroendocrine tumors, including small cell carcinoma. Renal cell carcinoma and hepatocellular carcinoma stain in about 30% of the cases. Squamous cell carcinoma of endoderm and mesoderm is usually Ber-EP4 positive, while that of ectoderm is negative. Basal cell and basosquamous carcinoma are Ber-EP4 positive in almost all cases. Choroid plexus papilloma and carcinoma are usually negative. Malignant mesothelioma (epithelioid and biphasic) is Ep-CAM positive in 4-26% of the cases. The staining is usually focal, but may occasionally be widespread. Synovial sarcoma (epitheloid and biphasic) and desmoplastic small round cell tumour stain for Ep-CAM in most cases.

Seminoma, embryonal carcinoma, yolk sac tumor and choriocarcinoma reveal Ber-EP4 positivity in a minor proportion of cases. Among neural tumors, Ep-CAM positivity is seen only in olfactory neuroblastoma. Ep-CAM can be of great help in the differential diagnosis of malignant involvement in the peritoneal and pleural cavities. The lack of reactivity in the majority of malignant mesothelioma can in an appropriate panel be utilized in the discrimination between this tumor and adenocarcinoma.

References1. Latza, et al., J Clin Pathol. 43:213-19, 1990.2. Ma CK, et al., Am J Clin Pathol. 99(5):551-7, 1993.3. Carella R, et al., Am J Surg Pathol. 25(1):43-50, 2001.

4. Ordóñez NG, Adv Anat Pathol. 13(1):16-25, 2006.5. Ordóñez NG, Mod Pathol. 19(3):417-28, 2006.6. Ordonez NG, Am J Clin Pathol. 109(1):85-89, 1998.

IHC_ISH | Primary Antibodies

66 Ventana Medical Systems, Inc. | 800.227.2155

Page 81: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

ERG (EPR3864)Catalog Number 790-4576Type Rabbit MonoclonalControl SpleenLocalization Nuclear, CytoplasmicQuantity 50 tests

Prostate carcinoma

DescriptionAnti-ERG (EPR3864) Rabbit Monoclonal Primary Antibody (anti-ERG (EPR3864) is directed against the C-terminus of the ETS transcription regulator, ERG, and is capable of detecting both wildtype ERG, and truncated ERG resulting from ERG gene rearrangement. This antibody exhibits a nuclear staining pattern and may be used to aid in the identification of prostate adenocarcinomas through the detection of truncated ERG.

References1. Mehra R, et al. Mod Path, 20:538-544, 2007.2. Perner S, et al. Am J Surg Pathol, 31:882-888. 2007.3. Carver B, et al. Nature Genet. 41(5):619-624. 2009.

4. Mosquera J-M, et al. J Pathol. 212:91-101. 2007.5. Park K, et al. Neoplasia12, (7):590-598. 2010.

CONFIRM Estrogen Receptor (ER) (SP1)Catalog Number 790-4324, 790-4325Type Rabbit MonoclonalControl BreastLocalization NuclearQuantity 50 Tests (790-4324), 250 Tests (790-4325)Isotype IgG

Breast lobular carcinoma

DescriptionCONFIRM anti-Estrogen Receptor (ER) (SP1) Primary Antibody is a rabbit monoclonal antibody (IgG) that is intended for laboratory use for the qualitative detection of estrogen receptor (ER) antigen in sections of formalin-fixed, paraffin-embedded tissue on a VENTANA automated slide stainer and has been optimally diluted for use with iVIEW DAB Detection Kit. CONFIRM anti-ER (SP1) is directed against an epitope present on human ER protein located in the nucleus of ER positive normal and neoplastic cells. CONFIRM anti-ER (SP1) is indicated as an aid in the management, prognosis, and prediction of therapy outcome of breast cancer.

References1. Huang Z, et al., Appl Immun Mol Morph. 13(1): 91-5, 2005.2. PDQ. http://icisun.nci.nih…t_cancer_Physician.html.

3. Stierer M, et al., Cancer Res and Treat. 36:11-21, 1995.4. Cheang M, et al., J Clin Oncol. 24:5637-5644, 2006.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 67

Page 82: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Factor VIII Related Antigen (polyclonal)Catalog Number 760-2642Type Rabbit PolyclonalControl Skin, PlacentaLocalization CytoplasmicQuantity 50 tests

Placenta

DescriptionAnti-Factor VIII-Related Antigen antibody reacts with endothelial cells and neoplastic blood cells. This antibody has helped to establish the endothelial nature of some lesions of disputed histogenesis, e.g. Kaposi’s sarcoma and cardiac myxoma. Not all endothelial cells synthesize (or store) this molecule; therefore, it should be expected that not all tumors of endothelial differentiation (benign or malignant) react with this antigen.

References1. Wick MR, et al., Lab Invest. 52:75A, 1985.2. Bhawan J, et al., Cancer. 55:570-576, 1985.

3. Ansell J, et al., Cancer. 50:1506-1512, 1982.4. Fulling KH, et al., Cancer. 51:1107-1118, 1983.

Factor XIIIa (AC-1A1)Catalog Number 760-4384Type Mouse MonoclonalControl DermatofibromaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Dermatofibroma

DescriptionFactor XIIIa is a blood proenzyme that has been identified in platelets, megakaryocyte, and fibroblastlike mesenchymal or histiocytic cells present in the placenta, uterus, and prostate; it is also present in monocytes and macrophages and dermal dendritic cells. Anti- Factor XIIIa has been found to be useful in differentiating between dermatofibroma (90% (+)), dermatofibrosarcoma protuberans (25%(+)) and desmoplastic malignant melanoma (0%(+)). Factor XIIIa positivity is also seen in capillary hemagioblastoma (100%(+)), hemangioendothelioma (100%(+)), hemangiopericytoma (100%(+)), xanthogranuloma (100%(+)), xanthoma (100(+)), hepatocellular carcinoma (93%(+)), glomus tumor (80%(+)), and meningioma (80 % (+)).

References1. Abenoza P, et al., Am J Dermatopathol. 15(5):429-34, 1993.2. Anstey A, et al., Am J Dermatopathol. 16(1):14-22, 1994.3. Glusac EJ, et al., Am J Surg Pathol. 18(6): 583-90, 1994.4. Nemes Z, Hum Pathol. 23(7):805-10, 1992.5. Demetris AJ, et al., Am J Surg Pathol. 21(3):263-70, 1997.

6. Horenstein MG, et al., Am J Surg Pathol. 24(7):996-1003, 2000.7. Kraus MD, et al., Am J Dermatopathol. 23(2):104-11, 2001.8. Dehner LP, Am J Surg Pathol. 27(5):579-93, 2003.9. Deguchi M, et al., Arch Dermatol Res. 294(7):297-302, 2002.

IHC_ISH | Primary Antibodies

68 Ventana Medical Systems, Inc. | 800.227.2155

Page 83: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Factor XIIIa (EP3372)Catalog Number 760-4441Type Rabbit MonoclonalControl DermatofibromaLocalization CytoplasmicQuantity 50 testsIsotype IgG

Placenta, normal

DescriptionFactor XIIIa is a blood proenzyme that has been identified in platelets, megakaryocytes, and fibroblast-like mesenchymal or histiocytic cells present in the placenta, uterus, and prostate; it is also present in monocytes and macrophages and dermal dendritic cells. Anti- Factor XIIIa has been found to be useful in differentiating between dermatofibroma (90% (+)), dermatofibrosarcoma protuberans (25%(+)) and desmoplastic malignant melanoma (0%(+)). Factor XIIIa positivity is also seen in capillary hemagioblastoma (100%(+)), hemangioendothelioma (100%(+)), hemangiopericytoma (100%(+)), xanthogranuloma (100%(+)), xanthoma (100(+)), hepatocellular carcinoma (93%(+)), glomus tumor (80%(+)), and meningioma (80 % (+)).

References1. Abenoza P, et al., Am J Dermatopathol. 15(5):429-34, 1993.2. Anstey A, et al., Am J Dermatopathol. 16(1):14-22, 1994.3. Glusac EJ, et al., Am J Surg Pathol. 18(6):583-90, 19944. Nemes Z, et al., Hum Pathol. 23(7):805-10, 1994.5. Demetris AJ, et al., Am J Surg Pathol. 21(3):263-70, 1997.

6. Horenstein MG, et al., Am J Surg Pathol. 24(7):996-1003, 2000.7. Kraus MD, et al., Am J Dermatopathol. 23(2):104-11, 2001.8. Dehner LP, et al., Am J Surg Pathol. 27(5):579-93, 2003.9. Deguchi M, et al., Arch Dermatol Res. 294(7):297-302, 2002.

Fascin (55k-2)Catalog Number 760-2702Type Mouse MonoclonalControl Hodgkin Lymphoma, Lymph NodeLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Hodgkin lymphoma, Reed-Sternberg cells

DescriptionAnti-Fascin is a very sensitive marker for Reed-Sternberg cells and variants in nodular sclerosis, mixed cellularity, and lymphocyte depletion Hodgkin disease. It is uniformly negative in lymphoid cells, plasma cells and myeloid cells. Anti-Fascin is positive in dendritic cells. This marker may be helpful in distinguishing between Hodgkin disease and non-Hodgkin lymphoma in difficult cases. Also, the lack of expression of fascin in the neoplastic follicles in follicular lymphoma can be helpful in distinguishing these lymphomas from reactive follicular hyperplasia in which the number of follicular dendritic cells is normal or increased.

References1. Pinkus GS, et al., Am J of Pathol. 150(2):543-562, 1997.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 69

Page 84: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Follicular Dendritic Cell (CNA.42)Catalog Number 760-4255Type Mouse MonoclonalControl Lymph node, tonsilLocalization CytoplasmicQuantity 50 testsIsotype IgM/K

Tonsil, normal

DescriptionAnti-FDC is useful in the identification of follicular dendriditic cell matrix found in normal lymph nodes and tonsilar tissue. This antibody has been found to label cells in approximately 60% of anaplastic large cell lymphomas, and approximately 45% of T-cell lymphomas. This antibody also labels follicular dendritic cell tumor/sarcomas. Several normal non-lymphoid tissues are labeled with anti-FDC; pancreatic islet cells, gastric chief cells, myelin sheaths, salivary gland, Leydig cells of the testis, and endothelial cells.

References1. Raymond I, et al., Am J Pathol. 151(6):1577-85, 1997.2. Chan AC, et al., Histopathology. 38(6):510-8, 2001.3. Cheuk W, et al., Am J Surg Pathol. 25(6):721-31, 2001.4. Baur AS, et al., Histopathology. 32(6):512-20, 1998.

5. Kunihiko M, et al., J Histochem and Cytothem. 50(11): 1475-85, 2002.6. Pileri SA,et al., Histopathology. 2002, 41, 1-29.

FSH (Follicle Stimulating Hormone) (polyclonal)Catalog Number 760-2710Type Rabbit PolyclonalControl Normal PituitaryLocalization CytoplasmicQuantity 50 tests

Pituitary

DescriptionAnti-Follicle Stimulating Hormone (FSH) is a useful marker in classification of pituitary tumors and the study of pituitary disease. It reacts with FSH-producing cells (gonadotrophs).

References1. Schmid M, et al., Pathol Res Pract. 197(10):663-9, 2001.2. Uccella S, et al., Pituitary. 3(3):131-9, 2000.3. La Rosa S, et al., Virchows Arch. 437(3):264-9, 2000.

4. Zheng W, et al., Gynecol Oncol. 76(1):80-8, 2000.5. Ben-Josef E, et al., J Urol. 161(3):970-6, 1999.

IHC_ISH | Primary Antibodies

70 Ventana Medical Systems, Inc. | 800.227.2155

Page 85: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Galectin-3 (9C4)Catalog Number 760-4256Type Mouse MonoclonalControl Papillary or Follicular Carcinoma of ThyroidLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Papillary carcinoma of the thyroid

DescriptionGalectin-3 is a 31 kD beta-galactosidase binding lectin. It has been associated with binding to the basement membrane glycoprotein laminin. Anti-Galectin-3 has been demonstrated to be valuable in differentiating between benign and malignant thyroid neoplasms in both histologic sections and fine needle aspiration biopsy material. Anti-Galectin-3 antibody has also been useful in identifying anaplastic large cell lymphoma.

References1. Inohara H, et al., Cancer. 85:2475-84, 1999.2. Herrmann ME, et al., Arch Pathol Lab Med. 126:710-713, 2002.3. Papotti M, et al., Eur J of Endo. 147:515-521, 2002.

4. Bartolazzi A, et al., Lancet. 357:1644-50, 2001.5. Orlandi F, et al., Cancer Res. 58:3015-3020, 1998.6. Gasbarri A, et al., J Clin Oncol. 17:3494-3502, 1999.

Gastrin (polyclonal)Catalog Number 760-2643Type Rabbit PolyclonalControl StomachLocalization CytoplasmicQuantity 50 tests

Stomach

DescriptionAnti-Gastrin antibody gives positive staining of G cells of human antral/pyloric mucosa and cells producing gastrin or a structural gastrin analogue as is seen in the stomach; no staining of other cells or tissue types has been observed. This antibody may react with sulfated and non-sulfated forms of gastrin. The antibody cross-reacts with more than 50% of the present choleocystokinin octa peptide.

References1. Rehfeld JF, et al., J Biol Chem. 256:10426-9, 1981. 2. Kirchner T, et al., Am J Surg Path. 11:909-17, 1987.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 71

Page 86: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

GCDFP-15 (EP1582Y)Catalog Number 760-4386Type Rabbit MonoclonalControl Breast, Breast CarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG

Breast carcinoma

DescriptionGCDFP-15 is a 15,000-dalton glycoprotein which is localized in the apocrine metaplastic epithelium lining breast cysts and in apocrine glands in the axilla, vulva, eyelid, and ear canal. Approximately 70% of breast carcinomas stain positive with antibody to GCDFP-15. Colorectal carcinomas, as well as mesotheliomas do not stain with this antibody. Lung adenocarcinoma rarely stains with this antibody.

References1. Mazoujian G, et al., Am J Dermatopathol. 10(1):28-35, 1988.2. Ansai S, et al., Am J Dermatopathol. 17(3):249-55, 1995.3. Mazoujian G, et al., Am J Pathol. 110(2):105-12, 1983.4. Wich MR, et al., Hum Pathol. 20(3):281-7, 1989.5. Cohen C, et al., Arch Pathol Lab Med. 117(3):291-4, 1993.

6. Raju U, et al., Mod Pathol. 6(5):516-20, 1993.7. Bhargava R, et al., Am J Clin Pathol. 127:103-113, 2007.8. Tornos C, et al., Am J Surg Pathol. 29(11):1482-9, 2005.9. Takeda Y, et al., Arch Pathol Lab Med. 132(2):239-43, 2008.10. Liegl B, et al., Histopathology. 50(4):439-47, 2007.

GFAP (Glial Fibrillary Acidic Protein) (EP672Y)Catalog Number 760-4345Type Rabbit MonoclonalControl BrainLocalization CytoplasmicQuantity 50 testsIsotype IgG

Astrocytoma

DescriptionAnti-GFAP antibody detects astrocytes, Schwann cells, satellite cells, enteric glial cells, and some groups of ependymal cells. This marker is mainly used to distinguish neoplasms of astrocytic origin from other neoplasms in the central nervous system.

References1. Viale G, et al., Virchow’s Arch A Pathol Anat. 418:339-348, 1991.2. Choi BH, et al., Science. 223:407-409, 1984.3. Funata N, et al., Bull Tokyo Med Dent Univ. 32:9-18, 1985.4. Jessen KR, et al., J Neurosci. 3:2206-2218, 1983.5. Kawahara E, et al., Am J Surg Pathol. 12:115-120, 1988.

6. Nagashima G, et al. Clin Neurol Neurosurg. 2002 May;104(2):125-31.7. Regner A, et al. J Neurotrauma. 2001 Aug;18(8):783-92.8. Giangaspero F, et al. Acta Neuropatahol (Berl). 2002 Feb;103(2):152-6. Epub 2001 Nov 10.

IHC_ISH | Primary Antibodies

72 Ventana Medical Systems, Inc. | 800.227.2155

Page 87: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Glucagon (polyclonal)Catalog Number 760-2644Type Rabbit PolyclonalControl PancreasLocalization CytoplasmicQuantity 50 tests

Pancreas, islets of Langerhans

DescriptionAnti-Glucagon antibody detects glucagon-secreting cells and tumors such as glucagonomas. Studies show that approximately 80% of glucagonomas are malignant and these patients have a syndrome often initially recognized by dermatologists. Symptoms include necrolytic migratory erythema as well as diabetes, anemia, stomatitis, weight loss, frequent venous thromboses, and in some instances, diarrhea and psychiatric disturbances. The diagnosis may be readily confirmed by the demonstration of elevated plasma glucagon concentration.

References1. Unger RH, et al., N Eng J Med. 304:1518-1524, 1981.2. Larson L, et al., Hum Pathol. 9:401-416, 1978.

3. Erlandsen SL, Williams and Wilkins, Baltimore, 40-155, 1980.4. Friesen SR, et al., N Eng J Med. 306:580-590, 1982.

GLUT-1 (polyclonal)Catalog Number 760-4526Type Rabbit PolyclonalControl Malignant Mesothelioma, Colorectal CarcinomaLocalization MembranousQuantity 50 tests

DescriptionGlucose transporter type I (GLUT1), a prototype member of GLUT super family, reacts with a 55 kD protein, is a membrane-associated erythrocyte glucose transport protein. It is a major glucose transporter in the mammalian blood-brain barrier, and also mediates glucose transport in endothelial cells of the vasculature, adipose tissue and cardiac muscle. GLUT1 is detectable in many human tissues including those of colon, lung, stomach, esophagus, and breast. GLUT1 is overexpressed in malignant cells and in a variety of tumors that include the breast, pancreas, cervix, endometrium, lung, mesothelium, colon, bladder, thyroid, bone, soft tissues, and oral cavity.

References1. Kato Y, et. al., Mod Pathol. 20:215-220, 2007.2. Afify A, et. al., Acta Cytol. 49:621-626, 2005.

3. Parente P, et. al. J Exp Clin Can Res. 27;34, 2008.4. Zimmerman RL, et. al., Cancer. 96: 53-57, 2002.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 73

Page 88: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Glycophorin A (GA-R2 & HIR2)Catalog Number 760-4257Type Mouse MonoclonalControl Bone MarrowLocalization MembranousQuantity 50 testsIsotype IgG2b/K

Bone marrow, erythroid elements

DescriptionGlycophorin A is a sialoglycoprotein present on human red blood cells and their precursors. Anti-Glycophorin A has been used to characterize erythroid cell development and in the diagnosis of erythroid leukemia.

References1. van der Valk P, et al., Am J Surg Pathol. 13(2): 97-106, 1989.2. Muller M, et al., J Vet Med A Physiol Pathol Clin Med. 48(1):51-7, 2001.3. Sadahira Y, et al., J Clin Pathol. 52(12):919-21, 1999.

4. Chang CC, et al., Am J Clin Pathol. 114(5):807-11, 2000.5. Muller M, et al., J Vet Med A Physiol Pathol Clin Med. 48(1):51-7, 2001.

Glypican-3 (1G12)Catalog Number 760-4442Type Mouse MonoclonalControl Hepatocellular CarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Hepatocellular carcinoma

DescriptionGlypican-3 (GPC3) is a glycosylphosphatidyl inositol-anchored membrane protein, which may also be found in a secreted form. Recently, GPC3 was identified as a useful tumor marker for the diagnosis of HCC, hepatoblastoma, melanoma, testicular germ cell tumors, and Wilms tumor. In patients with HCC, GPC3 was overexpressed in neoplastic liver tissue and elevated in serum but was undetectable in normal liver, benign liver, and the serum of healthy donors. GPC3 expression was also found to be higher in HCC liver tissue than in cirrhotic liver or liver with focal lesions such as dysplastic nodules and areas of hepatic adenoma (HA) with malignant transformation. In the context of testicular germ cell tumors, GPC3 expression is up-regulated in certain histologic subtypes, specifically yolk sac tumors and choriocarcinoma. A high level of GPC3 expression has also been found in some types of embryonal tumors, such as Wilms’ tumor and hepatoblastoma, with a low or undetectable expression in normal adjacent tissue.

References1. Capurro M, et al., Gastroenterology. 125(1):89-97, 2003.2. Coston WMP, et al., Am J Surg Pathol. 32(3):433-444, 2008.3. Kandil D, et al., Cancer. 111(5):316-22, 2007.

4. Kakar S, et al., Arch Pathol Lab Med. 131(11):1648-54, 2007. Review.5. Libbrecht L, et al., Am J Surg Pathol. 30(11):1405-11, 2006.

IHC_ISH | Primary Antibodies

74 Ventana Medical Systems, Inc. | 800.227.2155

Page 89: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Glypican 3 (GC33)Catalog Number 790-4564Type Mouse MonoclonalControl Placenta, Hepatocellular CarcinomaLocalization Granular Cytoplasmic/MembraneQuantity 50 testsIsotype IgG2a

Hepatocellular carcinoma

DescriptionAnti-Glypican 3 (GC33) Mouse Monoclonal Primary Antibody is directed against the heparan sulfate proteoglycan, glypican 3. This antibody may be used to aid in the differentiation of hepatocellular carcinoma from normal liver or benign lesions.

References1. Akutsu, N, et al. World J Gastroenterol. 16,28;3521-3528, 2010.2. Ishiguro, T, et al. Cancer Res. 68,23;9832-9838, 2008.3. Capurro MI, et al. Cancer Res. 65;6245-6254, 2005.

4. Midorikawa Y, et al. Int J Cancer. 103;455-465, 2003.5. Stigliano I, et al. Breast Cancer Res Treat. 114;251-262, 2009.

Granzyme B (polyclonal)Catalog Number 760-4283Type Rabbit PolyclonalControl TonsilLocalization Granular Cytoplasmic, Cytotoxic Thymphocytes, Natural Killer CellsQuantity 50 tests

Tonsil

DescriptionGranzymes are serine proteases which are stored in specialized lytic granules of cytotoxic T lymphocytes and in natural killer cells. Anti-Granzyme B has been useful in diagnosing natural killer/T-cell lymphoma as well as anaplastic large cell lymphoma. High percentages of cytotoxic T cells have been shown to be an unfavorable prognostic indicator in Hodgkin disease.

References1. Oudejans JJ, et al., Blood. 89(4):1376-82, 197.2. Oudejans JJ, et al., Am J Pathol. 148(1):233-40, 1996.3. Liu J, et al., J Dermatol. 30(10):735-41, 2003.

4. Kato N, et al., Am J Dermatopathol. 25(2):142-7, 2003.5. Kummer JA, et al., Clin Exp Immunol. 100:164-172, 1995.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 75

Page 90: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Helicobacter pylori (polyclonal)Catalog Number 760-2645Type Rabbit PolyclonalControl Infected Stomach MucosaLocalization Cell Wall of H. pyloriQuantity 50 tests

Gastric mucosa, H. pylori

DescriptionAnti-H. pylori antibody reacts with a spiral bacillus bacteria located on the surface of the pyloric and stomach mucosa. Studies have shown that H. pylori plays an important role in the etiology of chronic gastritis and the development of peptic ulcer disease.

References1. Denning SM, et al., Oxford University Press. 144-147, 1987.2. Beverley PCL, et al., Europ. J. Immunology. 11:329-334, 1981.

3. Clevers H, et al., Eur. J. Immunology. 18:705-710, 1988.4. Meuer SC, et al., Immun. Today. 10:225-228, 1989.

IHC_ISH | Primary Antibodies

76 Ventana Medical Systems, Inc. | 800.227.2155

Page 91: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PATHWAY HER-2/neu (4B5)Catalog Number 790-100 Kit (US ONLY)

790-2991 Antibody ONLY (outside US)Type Rabbit MonoclonalControl Breast CarcinomaLocalization MembranousQuantity 790-100 (US ONLY)

kit includes: PATHWAY HER-2/neu (4B5) Primary Antibody (50 tests), PATHWAY HER-2 4in1 Control Slides (10), Interpretation Guide790-2991 (outside US) 50 tests

Breast carcinoma FDA APPROVED

DescriptionThis antibody is intended for in vitro diagnostic use. VENTANA PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody (PATHWAY HER-2 (4B5)) is a rabbit monoclonal antibody intended for laboratory use for the semi-quantitative detection of HER-2 antigen in sections of formalin-fixed, paraffin-embedded normal and neoplastic tissue on a VENTANA automated immunohistochemistry slide staining device. It is indicated as an aid in the assessment of breast cancer patients for whom Herceptin treatment is considered. Note: All of the patients in the Herceptin clinical trials were selected using a clinical trial assay. None of the patients in those trials were selected using PATHWAY anti-HER-2/neu (4B5). PATHWAY anti-HER-2/neu (4B5) was compared to PATHWAY HER-2 (clone CB11) Primary Antibody on an independent sample set and found to provide acceptably concordant results. The actual correlation of PATHWAY anti-HER-2/neu (4B5) to clinical outcome has not been established.

VENTANA VIAS Image Analysis System is an adjunctive optional computer-assisted image analysis system functionally connected to an interactive microscope. It is intended for use as an aid to the pathologist in the detection, classification and counting of cells of interest based on marker intensity, size and shape using appropriate controls to assure the validity of the VIAS scores. Prescription use only.

PATHWAY anti-HER-2/neu is a rabbit monoclonal antibody (clone 4B5) directed against the internal domain of the c erbB 2 oncoprotein (HER-2). c erbB 2 oncoprotein was cloned and characterized by Akiyama et al in 1986.1 It is an approximately 185 kD transmembrane glycoprotein which is structurally similar to epidermal growth factor receptor (EGFR). The protein is associated with tyrosine kinase activity similar to that of several growth factor receptors, and to that of the transforming proteins of the src family. The coding sequence is consistent with an extracellular binding domain and an intracellular kinase domain. This suggests that HER-2 may be involved in signal transduction and stimulation of mitogenic activity.1 Clone 4B5 has been shown to react with a 185 kD protein from SK BR 3 cell lysates via Western blotting. SK BR 3 is a breast carcinoma cell line which has a 128 fold over expression of HER-2 mRNA.2 The size of the band identified correlates well with that reported by Akiyama et al for HER-2 protein (185 kD).1 Immunohistochemistry has been used to detect specific antigens in cells or tissue since 1950.3 The use of enzymes and peroxidase as markers for immunohistochemistry was reported by Nakane and Pierce in 1967.4 The increased sensitivity of the avidin biotin peroxidase detection system over the enzyme labeled antibody method was documented by Hsu et al in 1981.5 The HER-2 protein is expressed at a level detectable by immunohistochemistry in up to 20 percent of adenocarcinomas from various sites. Between 15 and 30 percent of invasive ductal cancers are positive for HER-2.6 Almost all cases of Paget’s disease of breast7 and up to 90 percent of cases of ductal carcinoma in situ of comedo type are positive.6 The immunohistochemical detection of HER-2 protein overexpression is also used as an aid in determination of patients for whom Herceptin therapy is indicated.8 Staining results in normal tissues, neoplastic tissues, and 322 cases of breast carcinoma with PATHWAY HER-2 (4B5) were evaluated by VENTANA Medical Systems, Inc. In the normal tissues tested, expression was consistent with the published literature in that there was no unexpected specific cytoplasmic/membrane staining, with the following exceptions: two cases of tonsil showing with epithelial cell membrane staining, one case of parathyroid, and one case of esophageal epithelium. Of the neoplastic tissues tested, cytoplasmic/membrane staining was seen in cancer cells of the breast, colon and ovary. Three hundred twenty-two (322) breast carcinomas were evaluated with VENTANA PATHWAY HER-2 (4B5) in a method comparison study with PATHWAY HER-2 (CB11). There is a significant correlation of staining between these two tests. See Summary of Expected Results section for further information. VENTANA PATHWAY HER-2 (4B5) in combination with VENTANA iVIEW DAB Detection Kit, utilizes biotinylated secondary antibodies to locate the bound PATHWAY HER-2 (4B5) primary antibody (produced by using a synthetic peptide corresponding to a site on the internal domain of the HER-2 protein). This is followed by the binding of an avidin/streptavidin enzyme conjugate to the biotin. The complex is then visualized using a precipitating enzyme generated product. The use of VENTANA pre-diluted PATHWAY HER-2 (4B5) and ready to use iVIEW DAB detection kits, in combination with a VENTANA automated slide stainer, reduces the possibility of human error and inherent variability resulting from individual reagent dilution, manual pipetting, and manual reagent application.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 77

Page 92: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PATHWAY HER-2/neu (4B5), continued

Description

CLINICAL SIGNIFICANCEBreast cancer is the most common carcinoma occurring in women, and the second leading cause of cancer-related death. In North America, a woman’s chance of contracting breast cancer is one in eight.9 Early detection and appropriate treatment therapies can significantly affect overall survival.10 Small tissue samples may be easily used in routine immunohistochemistry (IHC), making this technique, in combination with antibodies that detect antigens important for carcinoma interpretation, an effective tool for the pathologist in his/her diagnosis and prognosis of disease. One important marker in breast cancer today is cerbB 2 oncoprotein (HER-2). HER-2 is an intracellular membrane protein detected in the cellular membrane.11 It is closely related to EGFR and, like EGFR, has tyrosine kinase activity.1 Gene amplification and the corresponding overexpression of cerbB 2 has been found in a variety of tumors, including breast carcinomas.11,12 The therapeutic drug Herceptin has been shown to benefit some breast carcinoma patients by arresting, and in some cases reversing the growth of their cancer.8 The drug is a humanized monoclonal antibody that binds to HER-2 protein on cancer cells. Thus only patients with HER-2/neu positive breast carcinomas should benefit from treatment with Herceptin. In vitro diagnostics for the determination of HER-2 status in breast carcinomas are important to aid the clinician in determination of therapy with Herceptin. Interpretation of the results of any detection system for HER-2 must take into consideration the fact that HER-2 is expressed in both breast cancer tumors and healthy tissue, albeit at differing levels and with different patterns of expression.13 Histological tissue preparations have the advantage of intact tissue morphology to aid in the interpretation of the HER-2 positivity of the sample. All histological tests should be interpreted by a specialist in breast cancer morphology, and/or pathology, and the results should be complemented by morphological studies and proper controls and used in conjunction with other clinical and laboratory data.

References1.Akiyama T, et al., Science 232: 1644-1646, 1986.2. Kraus MH, et al., EMBO. 6: 605-610, 1987.3. Coons AH, et al., J. Exp. Med. 91: 1-13, 1950.4. Nakane PK, et al., J. Histochem. Cytochem. 14:929-931, 1967.5. Hsu SM, et al., J. Histochem. Cytochem. 29:577-580, 1981.6. Dickson RB, Lippman, ME, Genes, Oncogenes, and Hormones. Boston, Kluwer Academic Publishers, 1992.7. Keatings L, et al., Histopathology. 17:234-247, 1990.

8. Herceptin (Trastuzamab) Package Insert. February 2005.9. Roche PC, Immunohistochemical stains for breast cancer. Mayo Clin. Proc. 69:57-58, 1994.10. Charpin C, et al., Br. J. Cancer. 75: 1667-1673, 1997.11. Corbett IP, et al., J. Pathol. 161:15-25, 1990.12. Nicholson RI, et al., Eur. J. Cancer. 29A:1018-1023, 1993.13. DePotter CR, et al., Histopathology. 15:351-362, 1989.

Criteria for Intensity of Cell Membrane Staining with PATHWAY HER-2/neu

Staining Pattern Score (report to physician) HER-2 Staining Assessment

No membrane staining is observed 0 Negative

Faint, partial staining in > 10% of cancer cells with rare or absent circumferential staining

1+ Negative

Weak circumferential membrane staining in > 10% of cancer cells but the membrane staining ring is thin

2+ Positive

Intense circumferential membrane staining in > 10% of cancer cells and the membrane staining ring is thick

3+ Positive

1+ Membrane Staining

2+ Membrane Staining

2+ Membrane Staining

3+ Membrane Staining

3+ Membrane Staining

IHC_ISH | Primary Antibodies

78 Ventana Medical Systems, Inc. | 800.227.2155

Page 93: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

HGAL (MRQ-49)Catalog Number 760-4597Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization CytoplasmicQuantity 50 testsIsotype IgG2a/K

Follicular lymphoma

DescriptionHGAL used as an aid in the identification of follicular lymphoma within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Natkunam, Y et al. Blood. 105:3979–3986, 2005.2. Natkunam, Y et al. Blood. 109:298-305, 2007.

3. Younes, SF et al. Am J Surg Pathol. 34:1266-1276, 2010.4. Higgins, RA et al. Arch Pathol Lab Med. 132:441-446, 2008.

HHV-8 (Human Herpes Virus Type 8) (13B10)Catalog Number 760-4260 (US ONLY)Type Mouse MonoclonalControl Kaposi’s SarcomaLocalization NuclearQuantity 50 testsIsotype IgG1

Kaposi’s sarcoma

DescriptionHuman herpes virus type 8 (HHV-8) is the likely etiological agent of Kaposi’s sarcoma (KS). HHV-8 DNA sequences have been found in Kaposi’s sarcoma lesions, primary effusion lymphoma, and multicentric Castleman’s disease via polymerase chain reaction and in situ hybridization. Latent nuclear antigen (LNA-1, LNA, LANA-1), also known as ORF73, is a 222- or 234 kD protein that is consistently expressed in HHV-8 infected cells. Anti-HHV-8 labels the latent nuclear antigen protein via immunohistochemistry.

References1. Corbellino M, et al., AIDS Res Hum Retroviruses. 12(8):651-7, 1996.2. Katano H, et al., Am J Pathol. 155(1):47-52, 1999.3. Katano H, et al., J Med Virol. 59(3):346-55, 1999.

4. Katano H, et al., Mod Pathol. 13(1):77-85, 2000.5. Kaaya E, et al., Med Oncol. 17(4):325-32, 2000.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 79

Page 94: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

HSA (Hepatocyte Specific Antigen) (0CH1E5)Catalog Number 760-4350Type Mouse MonoclonalControl LiverLocalization CytomplasmicQuantity 50 testsIsotype IgG1/K

Liver

DescriptionAnti-Hepatocyte Specific Antigen (OCH1E5) Primary Antibody is a mouse monoclonal antibody that recognizes both benign and malignant liver including such tumors as hepatoblastoma, hepatocellular carcinoma, and hepatic adenoma. It recognizes both normal adult and fetal liver tissue. The typical pattern is a granular cytoplasmic staining. This antibody is useful in differentiating hepatocellular carcinomas with adenoid features from adenocarcinomas, either primary in the liver or metastatic lesions to the liver. In recognizing hepatoblastoma, it is useful in differentiating this entity from other small round cell tumors.

References1. Minervini MI, et al., Mod Pathol. 10(7):686-692, 1997.2. Fasano M, et al., Mod Pathol. 11(10):934-938, 1998.3. Tsui WMS, et al., Am J Surg Pathol. 23(1): 34-48, 1999..

4. Wieczorek T, et al., Am J Clin Pathol. 118(6):911-21, 2002.5. Chu PG, et al., Am J Surg Pathol. 26(8):978-88, 2002.6. Maitra A, et al., Am J Clin Pathol. 115(5):689-94, 2001.

Human Chorionic Gonadotropin (hCG) (polyclonal)Catalog Number 760-2650Type Rabbit PolyclonalControl PlacentaLocalization CytoplasmicQuantity 50 tests

Placenta, cytotrophoblasts

DescriptionHuman chorionic gonadotropin (hCG) is a protein secreted in large quantities by normal trophoblasts; the antibody detects cells and tumors of trophoblastic origin such as choriocarcinoma. Large cell carcinoma and adenocarcinoma of the lung demonstrate hCG positivity in 90% and 60% of cases respectively. 20% of squamous cell lung carcinomas are positive for hCG. hCG expression by non-trophoblastic tumors may indicate aggressive behavior since it has been observed that hCG may play a role in the host response to a given tumor.

References1. Morrish DW, et al., J Histochem Cytochem. 35:39-101, 1987.2. Kurman RJ, et al., Cancer. 38:2404-2419, 1976.

3. Kurman RJ, et al., Int J Gyn Pathol. 3:101-12, 19844. Boucher LD, et al. Human Pathol. 26(11):1201-6, 1995.

IHC_ISH | Primary Antibodies

80 Ventana Medical Systems, Inc. | 800.227.2155

Page 95: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Human Growth Hormone (hGH) (polyclonal)Catalog Number 760-2804Type Rabbit PolyclonalControl Normal PituitaryLocalization CytoplasmicQuantity 50 tests

Pituitary

DescriptionAnti-Growth Hormone is a useful marker in classification of pituitary tumors and the study of pituitary disease (acromegaly). It reacts with GH-producing cells.

References1. Fukaya T, et al., Cancer. 45:1598, 1980.2. Kovacs K, et al., Virch Arch Pathol Anat. 395:59, 1982.3. Cunha KS, et al., J Clin Pathol. 56(10):758-63, 2003.

4. Chopin LK, et al., Growth Horm. IGF. Res. 12(2):126-36, 2002.5. Matsuno A, et al., Pathol Res Pract. 197(1):13-20, 2001.6. Garcia-Caballero T, et al., Endocrine. 12(3):265-71, 2000.

Human Placental Lactogen (hPL) (polyclonal)Catalog Number 760-4443Type Rabbit PolyclonalControl PlacentaLocalization CytoplasmicQuantity 50 testsIsotype IgG

Placenta, normal

DescriptionHuman placental lactogen (hPL), also previously known as ‘human chorionic somatomammotropin’, is a 22 kD protein with partial homology to growth hormone. hPL is first detectable in the maternal serum in the fifth week of gestation and reaches a plateau by the thirty-fourth week. hPL has been demonstrated by immunochemistry in the syncytiotrophoblastic cells of choriocarcinoma. A rare variant of trophoblastic tumor has been reported in the testis with resemblance to uterine placental site trophoblastic tumor. It consisted purely of intermediate trophoblasts, which was diffusely positive for hPL and focally for B-hCG.

References1. Shih IM, et al., Am J Surg Pathol. 28(9):1177-83, 2004. 2. Ulbright TM, et al., Am J Surg Pathol. 21(3):282-288, 1997.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 81

Page 96: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

IgA (Immunoglobulin A) (polyclonal)Catalog Number 760-2652Type Rabbit PolyclonalControl Tonsil, Lymph NodeLocalization CytoplasmicQuantity 50 tests

Tonsil, germinal center

DescriptionAnti-IgA antibody reacts with surface immunoglobulin IgA alpha chains. It is useful when identifying leukemias, plasmacytomas, and B-cell lineage derived Hodgkin lymphomas. Due to the restricted expression of heavy and light chains in these diseases, demonstration of B-cell lymphomas is possible with clonal gene rearrangement studies.

References1. Arnold A, et al., New Eng J Med. 309:1593-1599, 1983.2. Geenwich Medical Media Ltd. 217-219, 1999.3. Hertel BF, et al., New Eng J Med. 302:1293-1297, 1980.

4. Taylor CR, et al., Arch Path Lab Med. 102:113-121, 1978.5. Warnake R, et al., Masson Publishing USA. 203-221, 1981.

IgD (polyclonal)Catalog Number 760-4444Type Rabbit PolyclonalControl Lymph Node, TonsilLocalization CytoplasmicQuantity 50 testsIsotype IgG

Tonsillitis, sub-epithelial plasma cells

DescriptionAnti-IgD antibody reacts with surface immunoglobulin IgD delta chains. This antibody is useful when identifying leukemias, plasmacytomas, and B-cell lineage derived lymphomas (in particular marginal zone lymphoma). Cytoplasmic staining is easily identified on paraffin tissue. Surface immunoglobulin is difficult to demonstrate on paraffin sections but can be demonstrated on frozen sections.

References1. Campo E, et al., Am J Surg Pathol. 23(1):59-68, 1999.2. Mori S, et al., Acta Pathol Jpn. 36(1):1429-40, 1986.3. Oka K, et al., Acta Haematol. 90(2):84-9, 1993.4. Bertero M, et al., J Am Acad Dermatol. 30(1):23-30, 1994.

5. Mollego M, et al., Am J Surg Pathol. 21(7):772-80, 1997.6. Tang X, et al., Pathol Int. 45(1):34-44, 1995.7. Gupta D, et al., Mod Pathol. 13(11):1161-6, 2000.8. Anagnostopoulos I, et al., Histopathology. 39(6):561-5, 2001.

IHC_ISH | Primary Antibodies

82 Ventana Medical Systems, Inc. | 800.227.2155

Page 97: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM IGF-1 Receptor (G11)Catalog Number 790-4346Type Rabbit MonoclonalControl Breast Carcinoma, PlacentaLocalization MembranousQuantity 50 tests

Breast carcinoma

DescriptionCONFIRM anti-IGF-1R (G11) is a rabbit monoclonal antibody produced against a synthetic peptide from the internal domain of the beta chain receptor near the carboxy terminal region and binds to the IGF-1R epitope in paraffin embedded tissue sections. IGF-1R is a type 2 tyrosine kinase receptor that shares a 60% homology at the amino acid sequence level with Insulin Receptor (IR).

References1. Samani A, et al., Endocrine Reviews, 28(1):20-47, 2007.

IgG (Immunoglobulin G) (polyclonal)Catalog Number 760-2653Type Rabbit PolyclonalControl Tonsil, Lymph NodeLocalization CytoplasmicQuantity 50 tests

Tonsil, germinal center

DescriptionAnti-IgG antibody reacts with surface immunoglobulin IgG gamma chains. This antibody is useful when identifying leukemias, plasmacytomas, and B-cell lineage derived Hodgkin lymphomas. Due to the restricted expression of heavy and light chains in these diseases, demonstration of B-cell lymphomas is possible with clonal gene rearrangement studies.

References1. Arnold A, et al., New Eng J Med. 309:1593-1599, 1983.2. Geenwich Medical Media Ltd. 217-219, 1999.3. Hertel BF, et al., New Eng J Med. 302:1293-1297, 1980.

4. Taylor CR, et al., Arch Path Lab Med. 102:113-121, 1978.5. Warnake R, et al., Masson Publishing USA. 203-221, 1981.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 83

Page 98: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

IgM (Immunoglobulin M) (polyclonal)Catalog Number 760-2654Type Rabbit PolyclonalControl Tonsil, Lymph NodeLocalization CytoplasmicQuantity 50 tests

Tonsil, germinal center

DescriptionAnti-IgM antibody reacts with surface immunoglobulin IgM mu chains. IgM is one of the predominant surface immunoglobulins on B lymphocytes. This antibody is useful when identifying lymphomas, plasmacytomas, and B-cell lineage derived Hodgkin lymphomas. Due to the restricted expression of heavy and light chains in these diseases, demonstration of B-cell lymphomas is possible with clonal gene rearrangement studies.

References1. Arnold A, et al., New Eng J Med. 309:1593-1599, 1983.2. Geenwich Medical Media Ltd. 217-219, 1999.3. Hertel BF, et al., New Eng J Med. 302:1293-1297, 1980.

4. Taylor CR, et al., Arch Path Lab Med. 102:113-121, 1978.5. Warnake R, et al., Masson Publishing, USA. 203-221, 1981.

Inhibin, alpha (R1)Catalog Number 760-2834Type Mouse MonoclonalControl Adrenal Cortex, Placenta, TestisLocalization CytoplasmicQuantity 50 testsIsotype IgG2a

Placenta

DescriptionAnti–Inhibin alpha is an antibody against a peptide hormone which has demonstrated utility in the differentiation between adrenal cortical tumors and renal cell carcinoma. Sex cord stromal tumors of the ovary as well as trophoblastc tumors also demonstrate cytoplasmic positivity with this antibody.

References1. Arora DS, et al., J Pathol. 181(4):413-8, 1997.2. Stewart CJ, et al., Histopathology. 31(1):67-74, 1997.3. Yamashita K, et al., Am J Obstet Gynecol. 177(6):1450-7, 1997.

4. McCluggage WG, et al., Am J Surg Pathol. 22(5):615-9, 1998.5. Kommoss F, et al., Mod Pathol. 11(7):656-64, 1998.6. Matias-Guiu X, et al., Hum Pathol. 29(8):840-5, 1998.

IHC_ISH | Primary Antibodies

84 Ventana Medical Systems, Inc. | 800.227.2155

Page 99: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Insulin (polyclonal)Catalog Number 760-2655Type Rabbit PolyclonalControl PancreasLocalization CytoplasmicQuantity 50 tests

Pancreas, islets of Langerhans

DescriptionInsulin is produced in the beta cells of the pancreas. The presence of insulin in the cytoplasm of islet tumors is the most reliable indication of functional insulinomas. Defective insulin storage occurs in insulinomas, therefore, many sections of the tumor should be stained with both insulin and C peptide.

References1. Akagi T, et al., Cancer. 47:417-424, 1981.2. Scully RE, et al., N Eng J Med. 308:30-37, 1983.

3. Erlandsen SL, et al., Williams and Wilkins, Baltimore. 140-155, 1980.4. Friesen SR, et al., N Eng J Med. 306:580-590, 1982.

CONFIRM Kappa (polyclonal)Catalog Number 760-2514Type Rabbit PolyclonalControl Tonsil, Lymph NodeLocalization Surface Membrane and/or CytoplasmicQuantity 50 tests

Tonsil, germinal center

DescriptionCONFIRM anti-Kappa (polyclonal) specifically binds to antigens located in the cell membrane and cytoplasmic regions of normal B cells and plasma cells. Kappa light chains are polypeptide chains which in combination with heavy chains form immunoglobulin molecules. There are two classes of light chains found in immunoglobulins, kappa light chains and lambda light chains. Light chain production by lymphoid cells is genetically restricted such that the immunoglobulin molecules produced by an individual cell will only contain a single light chain class. This clonal restriction may be used to indicate the polyclonal or monoclonal nature of B cell and plasma cell populations. Because clonality is a clinically important attribute to aid in the subclassification of lymphomas, the identification of light chain class has gained increasing importance in immunopathology.

References1. Landaas TO, et al., Acta Path Microbiol Scand. 89(2):91-101, 1981.2. Pangalis GA, et al., Cancer. 45(6):1334-1339, 1980.

3. Woda BA, et al., Cancer. 43(1):303-307, 1979.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 85

Page 100: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Ki-67 (30-9)Catalog Number 790-4286Type Rabbit MonoclonalControl Lymph Node, TonsilLocalization NuclearQuantity 50 tests

DescriptionCONFIRM anti-Ki-67 (30-9) Primary Antibody is directed against C-terminal portion of Ki-67 antigen. Staining for Ki-67 can aid in assessing the proliferative activity of normal and neoplastic tissue. This antibody is intended for use to identify stained proliferating cells by light microscopy in sections of formalin- fixed, paraffin-embedded tissue on a VENTANA automated slide stainer. Ki-67 is a nuclear protein expressed in proliferating cells. During the cell cycle, the Ki-67 antigen is present in the G1, S, G2, and M phase but is absent in the G0 (quiescent) phase.

References1. Keng PC, et al., Radiat Oncol Investig. 6(3):120-7, 1998.2. Rey A, et al., Arch Esp Urol. 51(2): 204-10, 1998.3. Bacchi CE, et al., Braz J Med Biol Res. 26(7):677-87, 1993.

4. Alliegro M, et al., Exp Cell Res. 279(1):111-17, 2002.5. Scholzen T, et al., J Cell Physiol. 182(3):311-22, 2000.

Ksp-Cadherin (MRQ-33)Catalog Number 760-4387Type Mouse MonoclonalControl Kidney, Chromophobe Renal Cell CarcinomaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1

Kidney

DescriptionKidney-specific cadherin (KSP-Cadherin) is a novel, kidney-specific member of the cadherin family of cell adhesion molecules. Within the kidney, KSP-Cadherin is found exclusively in the basolateral membrane of renal tubular epithelial cells and collecting duct cells, and not in glomeruli, renal interstitial cells, or blood vessels. Different cadherins, including E-cadherin, cadherin-6 and N-cadherin, have been investigated in renal cell cancers, demonstrating possible correlations of tumor dedifferentiation and the presence of lymph node metastasis with loss of cadherins. Mazal, et al. investigated the utility of using KSP-Cadherin to distinguish chromophobe renal cell carcinoma from oncocytoma. He found a membranous pattern of staining in 96% of 30 chromophobe carcinomas, and in only 6% of 31 oncocytomas leading them to conclude that this is a useful antibody in differentiating these two lesions. Shen, et al., on the other hand, found KSP-Cadherin positivity in 100% of 13 chromophobe RCCs, and 95% of 20 oncocytomas.

References1. Mazal PR, et al., Hum Pathol. 36(1):22-8, 2005.2. Shen SS, et al., Mod Pathol. 18(7):933-40, 2005.

3. Thedieck C, et al., Br J Cancer. 92(11):2010-7, 2005.

IHC_ISH | Primary Antibodies

86 Ventana Medical Systems, Inc. | 800.227.2155

Page 101: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Lambda (polyclonal)Catalog Number 760-2515Type Rabbit PolyclonalControl TonsilLocalization Surface Membrane and/or CytoplasmicQuantity 50 tests

Tonsil, germinal center

DescriptionCONFIRM anti-Lambda specifically binds to antigens located in the cell membrane and cytoplasmic regions of normal B cells and plasma cells. Lambda light chains are polypeptide chains which in combination with heavy chains form immunoglobulin molecules. There are two classes of light chains found in immunoglobulins, kappa light chains and lambda light chains. Light chain production by lymphoid cells is genetically restricted such that the immunoglobulin molecules produced by an individual cell will only contain a single light chain class. This clonal restriction may be used to indicate the polyclonal or monoclonal nature of B cell and plasma cell populations. Because clonality is a clinically important attribute to aid in the subclassification of lymphomas, the identification of light chain class has gained increasing importance in immunopathology.

References1. Landaas TO, et al., Acta Path Microbiol Scand. 89(2):91-101, 1981.2. Pangalis GA, et al., Cancer. 45(6):1334-1339, 1980.

3. Woda BA, et al., Cancer. 43(1):303-307, 1979.

CONFIRM LMO2 (1A9-1)Catalog Number 790-4368Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization NuclearQuantity 50 testsIsotype IgG1/K

Normal tonsil

DescriptionCONFIRM anti-LMO2 (1A9-1) is a mouse IgG1 monoclonal antibody and is directed against a 24 kD protein in the LIM only family. LMO2 is expressed in normal germinal center (GC) B cells and in a subset of GC derived B-cell lymphomas and normal hematopoietic lineages. LMO2 is essential for the regulation of hematopoietic stem cells and is expressed in erythroid and myeloid precursors playing a crucial role in hematopoietic development. Preliminary studies demonstrate LMO2 expression in GC-derived B-cell lymphomas such as follicular, Burkitt, lymphocyte-predominant Hodgkin, and diffuse large B-cell (DLBCL) neoplasms. LMO2 staining was absent in mature B-cell and T-cell lymphomas and in classical Hodgkin lymphomas.

References1. Natkunam Y, et al., Blood. 109:1636-1642, 2007. 2. Lossos I, et al., N Engl J Med. 350:1828-1837, 2004.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 87

Page 102: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Luteinizing Hormone (LH) (polyclonal)Catalog Number 760-2802Type Rabbit PolyclonalControl Normal PituitaryLocalization CytoplasmicQuantity 50 tests

Pituitary

DescriptionAnti-Luteinizing Hormone (LH) is a useful marker in classification of pituitary tumors and the study of pituitary disease. It reacts with LH-producing cells (gonadotrophs).

References1. La Rosa S, et al., Virchows Arch. 437(3):264-9, 2000.2. Saccomanno K, et al., J Clin Endocrinol Metab. 78(5):1103-7, 1994.3. Kovalitc JJ, J Neurooncol. 16(3):227-32, 1993.

4. Felix I, et al., Hum Pathol. 22(7):179-21, 1991.5. Sano T et al. Virchows Arch A Pathol Anat Histopathol. 1990;417(4):361-7.

Lysozyme (polyclonal)Catalog Number 760-2656Type Rabbit PolyclonalControl Tonsil, Lymph NodeLocalization CytoplasmicQuantity 50 tests

Tonsil

DescriptionAnti-Lysozyme stains myeloid cells, histiocytes, granulocytes, macrophages, and monocytes in human tonsil, colon, and skin. It is an important marker that may demonstrate the myeloid or monocytic nature of acute leukemia. The restrictive nature of anti-Lysozyme antibody staining suggests that lysozyme may be synthesized predominantly in reactive histiocytes rather than in resting, unstimulated phagocytes. It has not been determined whether lysozyme stains any other cell or tissue type. Anti-Lysozyme may aid in the identification of histiocytic neoplasias, large lymphocytes and classifying lymphoproliferative disorders.

References1. Morsky P, et al., Clin Chim Acta. 178:327-36, 1988.2. Krugliak L, et al., Am J Hematol. 21:99-109, 1986.

3. Delaflor-Weiss E, et al., Acta Cytol. 43(6):1124-30, 1999.4. Yuen ST, et al., Histopathology. 32(2):126-32, 1998.

IHC_ISH | Primary Antibodies

88 Ventana Medical Systems, Inc. | 800.227.2155

Page 103: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Macrophage (HAM-56)Catalog Number 760-2657Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization CytoplasmicQuantity 50 testsIsotype IgM/K

Tonsil, macrophages

DescriptionAnti-Macrophage reacts with tingible macrophages, interdigitating macrophages of lymph nodes and tissue macrophages, e.g. Kupffer cells of the liver and alveolar macrophages of the lung. The antibody also stains a subpopulation of endothelial cells, most prominently those of the capillaries and smaller blood vessels. Anti-Macrophage antibody reacts with monocytes, but is unreactive with B and T lymphocytes.

References1. Gown AM, et al., Am J Pathol. 125:191-207, 1986.2. Alpers CE, et al., Am J Clin Pathol. 92:662-665, 1989.

3. Bosman C, et al., J Pediatr Hematol Oncol. 21(1):31-7, 1999.4. Soini Y, et al., Pathol Res Pract. 186(6):759-67, 1990.

Mammaglobin (31A5)Catalog Number 760-4263Type Rabbit MonoclonalControl Breast CarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgM/K

Breast carcinoma

DescriptionMammaglobin (10 kD) is a breast-associated glycoprotein distantly related to secretoglobin family that includes human uteroglobin and lipophilin. Mammaglobin mRNA is present in high levels in human breast cancer cell lines, which has been shown to be a sensitive marker of breast cancer. When combined with other breast-restricted markers such as GCDFP-15, an overall sensitivity for breast carcinoma of 84% has been achieved. Anti-Mammaglobin can also be used to determine breast origin in the setting of metastatic carcinoma.

References1. Watson MA, et al., Cancer Research. 59:3028-3031, 1999.2. Fleming TP, et al., Ann N Y Acad Sci. 923:78- 89, 2000. 3. Han JH, et al., Arch Pathol Lab Med. 127:1330-1334, 2003.

4. Bhargava R, et al., Am J Clin Pathol. 127(1):103-13, 2007.5. Sasak E, et al., Breast Mod Pathol. 20 (2):208-14. 2007.6. Wang Z, et al., Int J Clin Exp Pathol. 2(4):384-9, 2009.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 89

Page 104: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM MART-1/melan A (A103)Catalog Number 790-2990Type Mouse MonoclonalControl Normal Skin, MelanomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Melanoma

DescriptionMelanoma is a malignant tumor deriving from melanocytes. Melanocytes are derivative cells originating from the neuroectodermal crest, which migrate during the early fetal period into the skin, where they settle within the epidermis and become part of the complex skin structure. One of the most prominent functional features of melanocytes is to produce the melanin pigment as a response to UV radiation in order to protect the skin structures from sun damage. Approximately 47,700 cases per year are diagnosed in the United States alone, and the incidence is increasing at the rate of 4.3% per year. In about 2% of occurrences, the disease is present even though no skin discoloration occurs. The American Cancer Society estimates that there are currently 480,000 cases of melanoma in America today and that there are 7,700 deaths per year. It has been reported that in the US, Europe and Australia there are 90,000 new cases diagnosed per year and 15,000 deaths annually. To aid in the diagnosis of these potentially lethal lesions, monoclonal antibodies have been raised against an antigenic determinate localized to a glycoprotein that is restricted to cells of melanocytic lineage. The molecule is located in the inner membranes of type 1, 2, and 3 premelanosomes and serves as a potential target of cytotoxic T lymphocytes, probably in concert with MHC2A. MART-1/melan A, was named specifically for that property (melanoma antigen recognized by T cells-1) and is recognized by T cells.

In practice, HMB-45 and MART-1/melan A have enjoyed the greatest use as agents to confirm the identity of polyclonal S100 positive neoplasms as melanocytic in nature. MART-1/melan A and HMB-45 behave differently depending on the tissue fixation. MART-1/melan A is suitable for formalin-fixed tissues and archival material which requires heat-induced epitope retrieval (HIER). Both HMB-45 and MART-1/melan A show increased sensitivity with HIER, though HMB-45’s immunoreactivity is stronger in ethanol-fixed tissues than formalin-fixed. Prolonged fixation in formalin significantly diminishes HMB-45’s immunoreactivity. HMB-45 is also vulnerable to a high degree of non-specific staining when used with Mercury-based fixatives.

The two monoclonal antibodies also differ in their detection rates of melanoma. MART-1/melan A has demonstrated positive rates of 81-90% versus HMB-45 at 75-80% on primary and metastatic malignant melanoma. Unlike HMB-45, MART-1/melan A is purported to yield a homogeneous cytoplasmic staining pattern in both melanomas and melanocytic nevi, with a stronger intensity and greater percentage of tumor cell immunopositivity. HMB-45 stains mainly the intraepidermal and superficial dermal component of compound nevi. MART-1/melan A is useful for the detection of primary and metastatic melanomas, especially with an epithelioid morphology, yet it has a limited role in the differential diagnosis of desmoplastic melanomas.

In a study published by AA Jungbluth, et al., additional information as to the detection rates of melanoma is as follows: Of the 75 metastatic melanomas tested 81% were A-103 positive and 75% were HMB-45 positive. Of the positive cases, A-103 showed homogeneous staining in a significantly higher number of cases than HMB-45 (72% vs. 52%, respectively). Focal staining with less than 5% reactive tumor cells was seen more frequently in HMB-45 (12 of 56) than in A-103 (5 of 61).

References1. Dabbs DJ, et al., Immunohistochemistry, Churchill Livingstone, Philadelphia, 2002.2. Leong AS-Y, et al., Diagnostic Antibodies for Immunohistology, 2nd Edition. Greenwich Medical Media Ltd., London, 2003.

3. Jungbluth AA, et al., Am J Surg Pathol. 22(5): 595-602, 1998.4. Jungbluth AA, et al., Virchows Arch. 434:429-435, 1999.

IHC_ISH | Primary Antibodies

90 Ventana Medical Systems, Inc. | 800.227.2155

Page 105: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Melanoma Associated Antigen (KBA.62)Catalog Number 760-4527Type Mouse MonoclonalControl MelanomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

DescriptionMelanoma Associated Antigen is a novel anti-melanoma antibody. Studies thus far have shown a similar sensitivity to melanocytic proliferations as that seen with S-100 protein staining, which is somewhat higher than that seen with HMB-45. This has been confirmed by one study on a series of 215 sentinel lymph nodes. Moreover, anti-KBA.62 identified 6 patients (3%) who had confirmed sentinel lymph node metastasis but stained negative for HMB-45. In this setting, the resolution appears to be higher than S-100 protein in that the staining pattern (membranous) is quite distinct.

References1. Morris LG, et. al., Head Neck. 30:771-775, 2008.2. Busam KJ, et. al., Am J Surg Pathol. 29: 400-406, 2005.3. Rochaix P, et. al., Mod Pathol. 16:481-490, 2003.

4. Nonaka D, et. al., Am J Clin Pathol. 127:787-791, 2003.5. Zhe X, et. al., J Histochem Cytochem. 52:1537-1542, 2004

Melanoma Associated Antigen (PNL2)Catalog Number 760-4528Type Mouse MonoclonalControl MelanomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

DescriptionMelanoma Associated Antigen is a novel monoclonal antibody, which has recently been introduced as an immunohistochemical reagent to stain melanocytes and tumors derived therefrom. Anti-PNL2 yields a strong cytoplasmic staining of skin and oral mucosal melanocytes, and staining of granulocytes when used at high concentration. Anti-PNL2 labels intraepidermal nevi while the dermal component of compound nevi are largely non-reactive with anti-PNL2. Antibodies against PNL2, melan-A and HMB-45 stain most clear cell sarcoma cells and a few cells in angiomyolipomas and lymphangioleiomyomatosis. Non-melanocytic lesions found to be positive with this marker include PEComas and melanotic schwannoma. Anti-PNL2 is a useful antibody for the identification of melanomas and clear cell sarcomas.

References1. Shah RB, et. al., Am J Clin Pathol. 122:517-523, 2004.2. Morris LG, et. al., Head Neck. 30:771-5, 2008.3. Busam KJ, et. al., Am J Surg Pathol. 29: 400-6, 2005.

4. Rochaix P, et. al., PNL2, Mod Pathol. 16:481-90, 2003.5. Nonaka D, et. al., Am J Clin Pathol. 127:787-91, 2007.6. Zhe X, et. al., J Histochem Cytochem. 52:1537-42, 2004.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 91

Page 106: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Melanosome (HMB45)Catalog Number 790-4366Type Mouse MonoclonalControl Melanoma, SkinLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Melanoma, with area showing normal melanoctyes

DescriptionCONFIRM anti-Melanosome (HMB45) has been shown to react with immature melanosomes in fetal and neonatal melanocytes and infantile retinal pigment epithelium. It does not react with normal resting adult melanocytes, regardless of the degree of pigmentation. In malignant cells, HMB45 stains most primary and metastatic melanomas. Desmoplastic malignant melanomas infrequently express the HMB45 antigen, possibly because they contain few melanosomes and have a mesenchymal pattern of differentiation. Non-melanocytic tumor cells of epithelial, lymphoreticular, glial, and mesenchymal origin are not labeled except for renal angiomyolipomas (PAML), a type of mesenchymal hamartoma.

References1. Kapur R, et al., J Histochem Cytochem. 40(2):207-212, 1992.2. Gown A, et al., Am J Pathol. 123(2):195-203, 1986.3. Esclamado R, et al., Am J Surg. 152(4): 376-385, 1986.4. Colombari R, et al., Virchows Archiv A Pathol Anat. 413(1):17-24, 1988.

5. Skelton H, et al., Am J Dermapathol. 13(6): 543-550, 1991.6. Ordonez N, et al., Am J Clin Pathol. 90(4): 385-390, 1988.7. Pea M, et al., Pathol. 23(3): 185-188, 1991.8. Ashfaq R, et al., Cancer. 71(10): 3091-3097, 1993.

Mesothelial Cell (HBME-1)Catalog Number 760-4445Type Mouse MonoclonalControl Mesothelioma, Thyroid CarcinomaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgM/K

Pleural biopsy, malignant mesothelioma

DescriptionAnti-HBME-1 has been demonstrated to label mesothelial cells, both benign and malignant (malignant mesothelioma) and thus has been used in distinguishing mesothelioma from adenocarcinomas of various origins. More recently this antibody has been used to distinguish thyroid carcinomas (both follicular and papillary) from benign thyroid lesions.

References1. Coli A, et al., J Exp Clin Cancer Res. 26(2):221-7, 2007.2. Cabibi D, et al., Thyroid. 17(7):603-7, 2007.

3. Torregrossa L, et al., Hum Pathol. 38(10):1482-8, 2007.4. Barroeta JE, et al., Endocr Pathol. 17(3):225-34, 2006.

IHC_ISH | Primary Antibodies

92 Ventana Medical Systems, Inc. | 800.227.2155

Page 107: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM MITF (C5/D5)Catalog Number 790-4367Type Mouse MonoclonalControl MelanomaLocalization NuclearQuantity 50 testsIsotype IgG1

Melanoma

DescriptionCONFIRM anti-MITF (C5/D5) Mouse Monoclonal Primary Antibody is a mouse monoclonal cocktail. This antibody cocktail reagent detects microphthalmia transcription factor (MITF) proteins 52-56 KD of MITF expressing cells in normal and neoplastic tissues. This antibody is used in the identification of melanotic lesions such as malignant melanoma and melanotic neurofibroma.

References1. Tachibana M, et al., Hum Mol Genet. 3(4):553, 1994.2. Chang KL, et al., Adv Anat Pathol. 8(5):273, 2001.3. Widlund HR, et al., Oncogene. 22(20):3035, 2003.

4. King R, et al., Am J Pathol. 155(3):731, 1999.5. Granter SR, et al., Appl Immunohistochem Mol Morphol. 10(1):47, 2002.6. Dorvault CC, et al., Cancer. 93(5):337, 2001.

MLH1 (G168-728)Catalog Number 760-4264Type Mouse MonoclonalControl Colon Mucosa, Colon CarcinomaLocalization NuclearQuantity 50 testsIsotype IgG2a

Colon carcinoma

DescriptionMLH1 is a mismatch repair gene that is deficient in a high proportion of patients with microsatellite instability (MSI-H). This finding is associated with the autosomal dominant condition known as Hereditary Non-Polyposis Colon Cancer (HNPCC). The anti-MLH1 antibody is useful in screening patients and families for this condition. Colon cancers that are microsatellite unstable have a better prognosis than their microsatellite stable counterparts.

References1. Wright CL, et al., Am J Surg Pathol. 27:1393-1406, 2003.2. Brueckl WM, et al., Anticancer Res. 23:1773-1778, 2003.3. Rigau V, et al., Arch Pathol Lab Med. 127:694-700, 2003.4. Renkonen E, et al., J Clin Oncol. 21:3629-3637, 2003.

5. Hoedema R, et al., The Am Surgeon. 69(5):387-92, 2003.6. Christensen M, et al., Cancer. 95:2422-30, 2002.7. Wahlberg SS, et al., Cancer Res. 62, 3485-3492, 2002.8. Lanza G, et al., Modern Pathol. 15:741-749, 2002.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 93

Page 108: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

MLH-1 (M1)Catalog Number 790-4535Type Mouse MonoclonalControl Colon, Breast, Appendix, Testis, and OvaryLocalization NuclearQuantity 50 testsIsotype IgG2a

Colon carcinoma

DescriptionAnti-MLH-1 (M1) Mouse Monoclonal Primary Antibody is used to qualitatively identify human DNA mismatch repair (MMR) protein MLH1, expressed in the nucleus of normal proliferating cells. Deficient or low levels of MLH1 are associated with colorectal and other cancers.

References1. Aaltonen LA, et al. N Engl J Med. 338:1481-1487, 1998.2. Boyer J, et al. Cancer Res. 55:6063-6070, 1995.3. Lawes, D, et al. Br J Cancer. 93:472-477, 2005.4. Chen Y, et al. Cancer Res. 61(10):4112-2, 2001.

5. Chen Y, et al. Cancer Res. 61(10):4112-2, 2001.6. Caldés, T. Oncol Rep. 12:621-629, 2004.7. Ellis NA. Am J Surg Pathol. Jan 29(1):96-104, 2005.8. Berends MJW, et al. Am J Hum Genet. 70:26-37, 2002.

MSH2 (G219-1129)Catalog Number 760-4265Type Mouse MonoclonalControl Colon Mucosa, Colon CarcinomaLocalization NuclearQuantity 50 testsIsotype IgG1

Colon

DescriptionMSH2 is a mismatch repair gene which is deficient in a high proportion of patients with microsatellite instability (MSI-H). This finding is associated with the autosomal dominant condition known as Hereditary Non-Polyposis Colon Cancer (HNPCC). The anti-MSH2 antibody is useful in screening patients and families for this condition. Colon cancers that are microsatellite unstable have a better prognosis than their microsatellite stable counterparts.

References1. Wright CL, et al., Am J Surg Pathol. 27: 1393-1406, 2003.2. Brueckl WM, et al., Anticancer Res. 23:1773-1778, 2003.3. Rigau V, et al., Arch Pathol Lab Med. 127:694-700, 2003.4. Renkonen E, et al., J Clin Oncol. 21:3629-3637, 2003.

5. Hoedema R, et al., The Am Surgeon. 69(5):387-92, 2003.6. Christensen M, et al., Cancer. 95:2422-30, 2002.7. Wahlberg SS, et al., Cancer Res. 62:3485-3492, 2002.8. Lanza G, et al., Modern Pathol. 15:741-749, 2002.

IHC_ISH | Primary Antibodies

94 Ventana Medical Systems, Inc. | 800.227.2155

Page 109: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM MSH6 (44)Catalog Number 790-4455Type Mouse MonoclonalControl Colon Carcinoma, Breast CarcinomaLocalization NuclearQuantity 50 testsIsotype IgG1

Gastric, normal

DescriptionCONFIRM anti-MSH6 (44) Mouse Monoclonal Antibody is used to qualitatively identify human DNA mismatch repair (MMR) protein MSH6, expressed in the nucleus of normal proliferating cells. Deficient or low levels of MSH6 are associated with colorectal and other cancers.

References1. Lawes DA, Br J Cancer. 93:472-477, 2005.2. Miyaki M, Nat Genet. 17:271-272, 1997.3. Offit K, J Clin Oncol. 22:4449-4451, 2004.4. Acharya S, et al., Proc Natl Acad Sci USA. 93:13629-13634, 1996.5. Guerrette S, et al., Mol Cell Biol. 18:6616-6623, 1996.

6. Aaltonen LA, et al., N Engl J Med. 338:1481-1487, 1998.7. Caldés, T. et al., Oncol Rep. 12:621-629, 2004.8. Ellis NA. Am J Surg Pathol. 29(1):96-104, 2005.9. Berends MJW, et al., Am J Hum Genet. 70:26-37, 2002.

MUC1 (H23)Catalog Number 790-4574Type Mouse MonoclonalControl Breast, Lung, PancreasLocalization Membranous, CytoplasmicQuantity 50 testsIsotype IgG

Lung adenocarcinoma

DescriptionAnti-MUC1 (H23) Mouse Monoclonal Primary Antibody is directed against the membrane bound, glycosylated phosphoprotein MUC1. This antibody may be used to aid in the identification of normal and neoplastic MUC1 expressing cells.

References1. Guddo F, et al. J Clin Pathol. 51:667-71, 1998. 2. Guddo F, et al. Anticancer Res. 18:1915-20, 1998.

3. Barratt-Boyes S. Cancer Immunol Immunother. 43:142–151, 1996.4. Taylor-Papadimitriou J, et al. Trends Biotechnol. 12:227–233, 1994.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 95

Page 110: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

MUC2 (MRQ-18)Catalog Number 760-4388Type Mouse MonoclonalControl Colon, Colon AdenocarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Colon

DescriptionMucins are high molecular weight glycoproteins which constitute the major component of the mucus layer that protects the gastric epithelium from chemical and mechanical aggressions. In humans, at least 14 mucin genes have been identified that code for the mucin proteins. They are designated as MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC6 , MUC7, MUC8, MUC9, MUC11, MUC12, MUC13 and MUC16. Mucins share a common feature of a tandem-repeat domain rich in serine and threonine residues. These amino acid residues are potential O-glycosylation sites for attachment of the O-glycan chains that constitute up to 80% of the molecular weight of the final mucin glycoprotein.

The heterogeneous pattern of mucin expression, including the expression of the intestinal mucin MUC2, may provide new insights into the differentiation pathways of gastric carcinoma. The pattern of mucin expression may also be used as a clue to bring new insights into the biological behavior of distinct clinicopathological entities related to the localization of gastric carcinoma, namely proximal and distal gastric carcinomas. Pinto-de-Sousa et al. have shown in a comprehensive study of gastric carcinomas evaluated for expression of several mucins (MUC1, MUC2, MUC5AC and MUC6) that: (1) mucin expression is associated with tumor type (MUC5AC with diffuse and infiltrative carcinomas and MUC2 with mucinous carcinomas) but not with the clinico-biological behavior of the tumors; and (2) mucin expression is associated with tumor location (MUC5AC with antrum carcinomas and MUC2 with cardia carcinomas), indirectly reflecting differences in tumor differentiation according to tumor location. The following generalities apply to the patterns of Mucin expression: MUC1 expression: apical surfaces of most epithelial cells in breast, GI, respiratory, and GU tracts. MUC2 expression: specifically expressed in goblet cells of the small intestine & colon. Colonic CAs – 65%, Gastric CAs – 42%, Esophageal CAs – 17% Rare outside of GI tract – with exception of; mucinous ca of breast, clear cell-type CAs of the ovary.

References1. Chaves P, et al., Dis Esophagus. 18(6):383-7, 2005.2. Leteurtre E, et al., World J Gastroenterol. 12(21):3324-31, 2006.3. Mino-Kenudson M, et al., Arch Pathol Lab Med. 131(1):86-90, 2007.4. Mizoshita T, et al., Histol Histopathol. 22(3):251-60, 2007.

5. O’Connell FP, et al., Arch Pathol Lab Med. 129(3):338-47, 2005.6. Park SY, et al., Arch Pathol Lab Med. 131(10):1561-7, 2007.7. Rakha EA, et al., Mod Pathol. 18(10):1295-304, 2005.

IHC_ISH | Primary Antibodies

96 Ventana Medical Systems, Inc. | 800.227.2155

Page 111: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

MUC5AC (MRQ-19)Catalog Number 760-4389Type Mouse MonoclonalControl Stomach, Associated AdenocarcinomasLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Stomach

DescriptionMucins are high molecular weight glycoproteins which constitute the major component of the mucus layer that protects the gastric epithelium from chemical and mechanical aggressions. In humans, at least 14 mucin genes have been identified that code for the mucin proteins. They are designated as MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC6 , MUC7, MUC8, MUC9, MUC11, MUC12, MUC13 and MUC16. Mucin genes are expressed in a regulated cell- and tissue-specific manner. The stomach provides a good example of such differential expression of mucin genes. MUC1 is detected in mucous cells of the surface epithelium and neck region of the gastric antrum, as well as in pyloric glands and oxynthic glands of the body region. MUC5AC is highly expressed in foveolar epithelium of both body and antrum, whereas MUC6 protein expression is limited to mucous neck cells of the body and pyloric glands of the antrum. The mucin expression pattern of gastric carcinoma is heterogeneous. It includes mucins normally expressed in gastric mucosa (MUC1, MUC5AC and MUC6) and de novo expression of the intestinal mucin MUC2. The heterogeneous pattern of mucin expression, including the expression of the intestinal mucin MUC2, may provide new insights into the differentiation pathways of gastric carcinoma. Pinto-de-Sousa, et al. have shown in a comprehensive study of gastric carcinomas evaluated for expression of several mucins (MUC1, MUC2, MUC5AC and MUC6) that: (1) mucin expression is associated with tumor type (MUC5AC with diffuse and infiltrative carcinomas and MUC2 with mucinous carcinomas) but not with the clinico-biological behavior of the tumors; and (2) mucin expression is associated with tumor location (MUC5AC with antrum carcinomas and MUC2 with cardia carcinomas), indirectly reflecting differences in tumor differentiation according to tumor location.The following generalities apply to the patterns of Mucin expression:

MUC5AC expression:• preferentially expressed in the normal stomach and respiratory

tract• GI & pancreatobiliary ACAs• Esophageal CAs (67%)• Gastric CAs (58%)• Colonic CAs (6-25%)• Pancreatic ductal CAs (73%)• Cholangiocarcinomas (45%)• Endocervical ACAs (70%)• Endometrial ACAs (22%)• Lung ACAs (14%) MUC1+/MUC2-/MUC5AC+ pattern:

• Endocervical adenoCAs (50%)• Pancreatic ductal adenoCAs (64%) MUC1+/MUC2-/MUC5AC-

pattern:• Ductal and lobular breast CAs (100%)• Urothelial CAs (bladder) (93%)• Renal CAs (75%)• Ovarian ACAs of various types• Most pulmonary adenocarcinomas (81%)• Endometrial (78%) adenoCAs (small subset expresses MUC5AC)

MUC1-/MUC2-/MUC5AC- pattern:• Hepatocellular CA• Adrenocortical CA• Prostate CA

References1. Chaves P, et al., Dis Esophagus. 18(6):383-7, 2005.2. Leteurtre E, et al., World J Gastroenterol. 12(21):3324-31, 2006.3. Mino-Kenudson M, et al., Arch Pathol Lab Med. 131(1):86-90, 2007.4. Mizoshita T, et al., Histol Histopathol. 22(3):251-60, 2007.

5. O’Connell FP, et al., Arch Pathol Lab Med. 129(3):338-47, 2005.6. Park SY, et al., Arch Pathol Lab Med. 131(10):1561-7, 2007.7. Rakha EA, et al., Mod Pathol. 18(10):1295-304, 2005.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 97

Page 112: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

MUC6 (MRQ-20)Catalog Number 760-4390Type Mouse MonoclonalControl Stomach, Associated AdenocarcinomasLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Stomach

DescriptionMucins are high molecular weight glycoproteins which constitute the major component of the mucus layer that protects the gastric epithelium from chemical and mechanical aggressions. In humans, at least 14 mucin genes have been identified that code for the mucin proteins. They are designated as MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, MUC6 , MUC7, MUC8, MUC9, MUC11, MUC12, MUC13 and MUC16.

Mucin genes are expressed in a regulated cell- and tissue-specific manner. The stomach provides a good example of such differential expression of mucin genes. MUC1 is detected in mucous cells of the surface epithelium and neck region of the gastric antrum, as well as in pyloric glands and oxynthic glands of the body region. MUC5AC is highly expressed in foveolar epithelium of both body and antrum, whereas MUC6 protein expression is limited to mucous neck cells of the body and pyloric glands of the antrum. The mucin expression pattern of gastric carcinoma is heterogeneous. It includes mucins normally expressed in gastric mucosa (MUC1, MUC5AC and MUC6) and de novo expression of the intestinal mucin MUC2.

The heterogeneous pattern of mucin expression, including the expression of the intestinal mucin MUC2, may provide new insights into the differentiation pathways of gastric carcinoma. Pinto-de-Sousa, et al. have shown in a comprehensive study of gastric carcinomas evaluated for expression of several mucins (MUC1, MUC2, MUC5AC and MUC6) that: (1) mucin expression is associated with tumor type (MUC5AC with diffuse and infiltrative carcinomas and MUC2 with mucinous carcinomas) but not with the clinico-biological behavior of the tumors; and (2) mucin expression is associated with tumor location (MUC5AC with antrum carcinomas and MUC2 with cardia carcinomas), indirectly reflecting differences in tumor differentiation according to tumor location.The following generalities apply to the patterns of Mucin expression:

MUC5AC expression:• preferentially expressed in the normal stomach and respiratory

tract• GI & pancreatobiliary ACAs• Esophageal CAs (67%)• Gastric CAs (58%)• Colonic CAs (6-25%)• Pancreatic ductal CAs (73%)• Cholangiocarcinomas (45%)• Endocervical ACAs (70%)• Endometrial ACAs (22%)• Lung ACAs (14%) MUC1+/MUC2-/MUC5AC+ pattern:• Endocervical adenoCAs (50%)

• Pancreatic ductal adenoCAs (64%) MUC1+/MUC2-/MUC5AC- pattern:

• Ductal and lobular breast CAs (100%)• Urothelial CAs (bladder) (93%)• Renal CAs (75%)• Ovarian ACAs of various types• Most pulmonary adenocarcinomas (81%)• Endometrial (78%) adenoCAs (small subset expresses MUC5AC) • MUC1-/MUC2-/MUC5AC- pattern:• Hepatocellular CA• Adrenocortical CA• Prostate CA

References1. Chaves P, et al., Dis Esophagus. 18(6):383-7, 2005.2. Leteurtre E, et al., World J Gastroenterol. 12(21):3324-31, 2006.3. Mino-Kenudson M, et al., Arch Pathol Lab Med. 131(1):86-90, 2007.4. Mizoshita T, et al., Histol Histopathol. 22(3):251-60, 2007.

5. O’Connell FP, et al., Arch Pathol Lab Med. 129(3):338-47, 2005.6. Park SY, et al., Arch Pathol Lab Med. 131(10):1561-7, 2007.7. Rakha EA, et al., Mod Pathol. 18(10):1295-304, 2005.

IHC_ISH | Primary Antibodies

98 Ventana Medical Systems, Inc. | 800.227.2155

Page 113: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

MUM1 (MRQ-43)Catalog Number 760-4529Type Rabbit MonoclonalControl TonsilLocalization Nuclear, CytoplasmicQuantity 50 testsIsotype IgG1

DescriptionMUM1 is a 50 kD protein encoded by MUM1 gene, and a member of the interferon regulatory factor family of transcription factors. MUM1/IRF4 is expressed in the nuclei and cytoplasm of plasma cells and a small percentage of germinal center (GC) B cells located in the “light zone.” This antibody stains MUM1 protein, which is expressed in a subset of B cells in the light zone of the germinal center, plasma cells, activated T cells and a wide spectrum of related hematolymphoid neoplasms derived from these cells. Therefore, this antibody is useful for the subclassification of lymphoid malignancies and an excellent marker for Hodgkin and Reed-Sternberg cells of classic Hodgkin disease in combination with anti-CD30.

References1. Falini B, et. al., Blood. 95:2084-92, 2000.2. Grossman A, et. al., Genomics. 37:229-33, 1996.3. Neresh KN, Hematologica. 92:267-8, 2007.

4. Van Imhoff GW, et. al., J Clin Oncol. 34:4135-42, 2006.5. Gualco G, et. al., Appl Immunohistochem Mol Morphol. 18:301-10, 2010.

Myelin Basic Protein (polyclonal)Catalog Number 760-2658Type Rabbit PolyclonalControl BrainLocalization CytoplasmicQuantity 50 tests

Cerebral cortex, normal

DescriptionMBP is present in the central and peripheral nervous system, the antibody reacts with soft tissue tumors. MBP has been demonstrated in neuromas, neurofibromas, and neurogenic sarcomas; other spindle cell neoplasms do not stain with this antibody. Immunoreactivity for anti-MBP in granular cell tumors strengthens the concept of a Schwann cell derivation of these lesions. Unlike other nervous system proteins e.g., GFAP and S-100, MBP has not been demonstrated in melanocytes or tumors derived from them.

References1. Martenson RE, et al., J Neurochem. 36:1543-1560, 1981.2. Uyemura K, et al., Adv Exp Med Biol. 100:95-11, 1977.

3. Buss A, et al. Brain. 127(1):34-44, 2004. Epub 2003 Oct 08.4. Neuen-Jacob E, et al., Int J Legal Med. 105(6):339-50, 1993.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 99

Page 114: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Myeloperoxidase (polyclonal)Catalog Number 760-2659Type Rabbit PolyclonalControl Bone MarrowLocalization CytoplasmicQuantity 50 tests

Peripheral blood, granulocytes

DescriptionAnti-Myeloperoxidase detects granulocytes and monocytes in blood and precursors of granulocytes in the bone marrow. This antibody can detect myeloid cell populations of the bone marrow as well as in other sites.

References1. Pinkus GS, et al., Mod Pathol. 4(6): 733-41, 1991.2. Hudock J, et al., Am J Clin Pathol. 102(1): 55-60, 1994.

3. Hamoudi WH, et al., Arch Pathol Lab Med. 124(2):315-8, 2000.

Myogenin (F5D)Catalog Number 760-2832Type Mouse MonoclonalControl RhabdomyosarcomaLocalization NuclearQuantity 50 testsIsotype IgG1/K

Rhabdomyosarcoma

DescriptionAnti-Myogenin labels the nuclei of myoblasts in developing muscle tissue and is expressed in tumor cell nuclei of rhabdomyosarcoma and some leiomyosarcomas. Positive nuclear staining may occur in Wilm’s tumor.

References1. Miller JB, et al., J Cell Biol. 111(3):1149-59, 1990.2. Wang NP, et al., Am J Pathol. 147(6):1799-810, 1995.

3. Cui S, et al., Pathol Int. 49(1):62-8, 1999.4. Cessna MH, et al., Am J Surg Pathol. 25(9):1150-7, 2001.

IHC_ISH | Primary Antibodies

100 Ventana Medical Systems, Inc. | 800.227.2155

Page 115: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Myoglobin (polyclonal)Catalog Number 760-2660Type Rabbit PolyclonalControl Skeletal MuscleLocalization CytoplasmicQuantity 50 tests

Skeletal muscle with degenerative changes

DescriptionImmunostaining with anti-Myoglobin is useful for the identification of tumors of muscle origin. Since myoglobin is found exclusively in skeletal and cardiac muscle and is not present in any other cells of the human body, it may be used to distinguish rhabdomyosarcoma from other soft tissue tumors. Anti-Myoglobin staining is also useful when demonstrating rhabdomyoblastic differentiation in other tumors, e.g. neurogenic sarcomas and malignant mixed mesodermal tumors of the uterus and ovary.

References1. Mukai K, et al., Am J Surg Pathol. 3:373-376, 1979.2. Corson JM, et al., Am J Pathol. 103:384-389, 1981.3. Kindblom LG, et al., Acta Pathol Miro. 1982; SCand C90(Sec A):167-174.

4. Brooks JJ, et al., Cancer. 50:1757-1763, 1982.5. Kahn HJ, et al., Cancer. 50:1897-1903, 1983.

Myosin, Smooth Muscle (SMMS-1)Catalog Number 760-2704Type Mouse MonoclonalControl Intestine, BreastLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Vascular smooth muscle

DescriptionSmooth Muscle Myosin, heavy chain (SMMS-1) is a cytoplasmic structural protein that is a major component of the contractile apparatus of the smooth muscle cells. SMMS-1 is also a myoepithelium-associated protein. Anti-SMMS-1 is a mouse monoclonal antibody to smooth muscle myosin, heavy chain that reacts with human visceral and vascular smooth muscle cells. The antibody also reacts with human myoepithelial cells. It is very helpful in distinguishing between benign sclerosing breast lesions and infiltrating carcinomas in difficult cases since it strongly stains the myoepithelial layer in the benign lesions while it is negative in the infiltrating carcinomas.

References1. Nan Ping Wang, et al., Appl Immunohistochem. 5(3):141-151.2. Werling RW, et al., Am J Surg Pathol. 27(1):82-90, 2003.3. Dabbs DJ, et al., Diagn Cytopathol. 20(4):203-7, 1999.

4. Agoff SN, et al., Appl Immunohistochem Mol Morphol. 9(2):164-9, 2001.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 101

Page 116: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Napsin A (polyclonal)Catalog Number 760-4446Type Rabbit PolyclonalControl Lung Adenocarcinoma, KidneyLocalization CytoplasmicQuantity 50 testsIsotype IgG

Adenocarcinoma of lung

DescriptionNapsin is a pepsin-like aspartic proteinase in the A1 clan of the AA clade of proteinases. There are two closely related napsins, napsin A and napsin B. Napsin A is expressed as a single chain protein with the molecular weight of approximately 38 kD. Immunohistochemical studies revealed high expression levels of napsin A in human lung and kidney but low expression in spleen. Napsin A is expressed in type II pneumocytes and in adenocarcinomas of lung. The high specificity expression of napsin A in adenocarcinomas of lung is useful to distinguish primary lung adenocarcinomas from adenocarcinomas of other organs.

References1. Tatnell PJ, et al., FEBS Lett. 441(1):43-48, 1998.2. Schauer-Vukasinovic V, et al., FEBS Lett. 462(1):135-9, 1999.3. Hirano T, et al., J Cancer Res. 91(10):1015-1021, 2000.

4. Dejmek A, et al., Diagnostic Cytopathology. 35(8):493-7, 2007.5. Jagirdar J, et al., Arch Pathol Lab Med. 132(3):384-96, 2008.6. Suzuki A, et al., Pathol Res Pract. 201(8-9):579-86, 2005.

Negative Control Mouse Ig (MOPC21)Catalog Number 760-2014Type Mouse MonoclonalQuantity 250 tests

DescriptionNegative Control Mouse Ig is not directed against a known epitope present in human tissue. The reagent is intended for use as a negative control in qualitative staining of sections of routine formalin fixed, paraffin embedded tissue on a VENTANA automated slide stainer.

CONFIRM Negative Control Rabbit IgCatalog Number 760-1029Type Rabbit PolyclonalControl Tonsil, Lymph NodeQuantity 250 tests

DescriptionCONFIRM Negative Control Rabbit Ig is purified rabbit Ig which is not directed against a known epitope present in human tissue. The reagent is intended for use as a negative control for qualitative assessment of background staining for rabbit primary antibodies.

IHC_ISH | Primary Antibodies

102 Ventana Medical Systems, Inc. | 800.227.2155

Page 117: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Neurofilament (2F11)Catalog Number 760-2661Type Mouse MonoclonalControl Intestine, BreastLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Cerebellum

DescriptionAnti-Neurofilament antibody stains an antigen localized in a number of neural, neuroendocrine, and endocrine tumors. Neuromas, ganglioneuromas, gangliogliomas, ganglioneuroblastomas, and neuroblastomas stain positively for neurofilament. Neurofilaments are also present in paragangliomas and adrenal and extra-adrenal pheochromocytomas. Carcinoids, neuroendocrine carcinomas of the skin, and oat cell carcinomas of the lung also express neurofilament.

References1. Wood JN, et al., Biosci Rep, 1:263, 1981.2. Anderton BH, et al., Nature. 298:84, 1982.3. Miettinen M, et al., Lab Invest. 52:429-436, 1985.4. Van Muijen GNP, et al., Am J Pathol. 116:363-369, 1984.

5. Trojanowski JQ, et al., N Eng J Med. 313:101-104, 1985.6. Morrison CD, et al., Semin Diagn Pathol. 17(3):204-15, 2000.7. Dubovy SR, et al., Br J Opthalmol.85(8):949-51, 2001.8. Erana-Rojas IE, et al. Ann Diagn Pathol. 6(5):265-71, 2002.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 103

Page 118: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

NGFR (MRQ-21)Catalog Number 760-4391Type Mouse MonoclonalControl Neurons, Ganglia, Malignant Melanoma Cells, Myoepithelial Cells

of Breast DuctsLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Breast, sclerosing adenosis

DescriptionNGFR, a 75 kd glycoprotein (also known as P-75NTR), is the first of neurotrophin receptors to be isolated and is a member of the tumor necrosis factor (TNF) receptor family. It is expressed not only in sympathetic and sensory neurons, but also in various neural crest cell or tumor derivatives such as melanocytes, melanomas, neuroblastomas, pheochromocytomas, neurofibromas, and neurotized nevi (type C melanocytes). NGFR has been shown to be a reliable marker for desmoplastic and neurotropic melanoma by several groups. Although the sensitivity of NGFR staining in desmoplastic melanomas has not been systematically analyzed, all reported cases stain with NGFR. A review of 9 cases of desmoplastic melanomas diagnosed in the Dermatopathology Section of the Department of Dermatology at Boston University School of Medicine between 2001 and 2004 disclosed that all 9 cases of desmoplastic melanomas tested stained positively with NGFR. These findings are in contrast to a study reported by Huttenbach, et al in which only 33% of their desmoplastic melanomas stained with NGFR. This difference emphasizes the importance of the choice of monoclonal antibody to obtain consistent results. This staining property of desmoplastic melanoma cells can be useful in diagnosing challenging cases, namely early lesions, suspected cases with negative or weak S-100 staining, and those that must be distinguished from a scar.

It is now apparent that expression of NGFR is ubiquitous and not limited to the nervous system, being expressed in mature nonneural cells such as perivascular cells, dental pulp cells, lymphoidal follicular dendritic cells, basal epithelium of oral mucosa and hair follicles, prostate basal cells and myoepithelial cells. Unlike the high-affinity nerve growth factor tyrosine kinase receptors (TrkA, TrkB and TrkC), NGFR has no intrinsic tyrosine kinase activity. Studies in prostate and urothelial cancer suggest that NGFR may act as a tumor suppressor, negatively regulating cell growth and proliferation. Anti-NGFR labels the myoepithelial cells of breast ducts and intralobular fibroblasts of breast ducts and thus aides in the diagnosis of malignancy in the breast.

References1. Laskin WB, et al., Hum Pathol. 31(10):1230-41, 2000.2. Lewis Kelso R, et al., Dermatol Surg. 32(2):177-83, 2006.3. Liang Y, et al., J Invest Dermatol. 111(1):114-8, 1998.

4. Liang Y, et al., J Cutan Pathol. 25(4):189-98, 1998.5. Liang Y, et al., Arch Dermatol Res. 291(1):14-21, 1999.

IHC_ISH | Primary Antibodies

104 Ventana Medical Systems, Inc. | 800.227.2155

Page 119: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

NSE (Neuron Specific Enolase) (E27)Catalog Number 760-2662Type Mouse MonoclonalControl PancreasLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Pancreas, islets of Langerhans

DescriptionNeuron Specific Enolase is present in high concentration in neurons and in central and peripheral neuroendocrine cells, therefore, anti-NSE reacts with cells of neural and neuroendocrine lineage. If neoplastic cells co-express keratins and NSE, neuroendocrine differentiation is probable, however, neural tumors that do not express keratin, and show no staining with NSE would not exclude neural or neuroendocrine differentiation. Thus, detection of neural and neuroendocrine lineage requires the use of panels that include NSE and other markers such as keratin, chromogranin, synaptophysin and neurofilament.

References1. Perentes E, et al., Arch Pathol Lab Med. 111:796-812. 1987.2. Cras P, et al., Ann Neurol. 20:106-17, 1986.

3. Schmechal D, et al., Lab Invest. 52:239-242, 1985.4. Dhillon AP, et al., Histopathology. 6:81-92, 1982.

Oct-2 (MRQ-2)Catalog Number 760-4447Type Mouse MonoclonalControl Lymph Node, TonsilLocalization NuclearQuantity 50 testsIsotype IgG1/K

Tonsillar hypertrophy

DescriptionOct-2 is a transcription factor of the POU homeo-domain family that binds to the Ig gene octamer sites, regulating B-cell-specific genes. These are involved in proliferation and differentiation, and despite the scarce evidence for Oct-2 expression in T cells, it has been shown that this factor participates in transcriptional regulation during T-cell activation. Oct-2 activity is dependent on phosphorylation and alternative splicing, although it seems that the level of its expression can be used as a marker of B-cell lineage and differentiation. The following show high levels of Oct-2 expression: germinal center B cells, mantle B cells, monocytoid B cells, and plasma cells. Various lymphomas are also positive for this marker including the following: B-chronic lymphocytic leukemia, mantle cell lymphoma, follicular lymphoma, marginal zone lymphoma, plasmacytoma, Burkitt lymphoma, diffuse large cell lymphoma, diffuse large B-cell lymphoma, T-cell rich B-cell lymphoma, nodular lymphocyte predominant Hodgkin lymphoma, classic Hodgkin lymphoma.

Several studies of Oct-2 expression have shown a low level expression in pre-B, T-cell, myelomonocytic, and epithelial cell lines, whereas all mature B-cell lines display high levels of expression. Analysis of Oct-2 expression in primary Hodgkin lymphoma (HLs) and cell lines derived from it showed that the tumor cells analyzed had high levels of expression and activity, suggesting a common B-cell origin for all types of HLs.

References1. Browne P, et al., Am J Clin Pathol. 120(5):767-77, 2003.2. García-Cosío M, et al., Mod Pathol. 17(12):1531-8, 2004.

3. Gibson SE, et al., Am J Clin Pathol. 126(6):916-24, 2006.4. Hallermann C, et al., J Am Acad Dermatol. 56(4):588-97, 2007.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 105

Page 120: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Oct-4 (MRQ-10)Catalog Number 760-4392Type Mouse MonoclonalControl Seminoma, DysgerminomaLocalization NuclearQuantity 50 testsIsotype IgG

Seminoma

DescriptionOCT-4 is a transcription factor that maintains and regulates pluripotency in embryonic stem and germ cells. It has a very high sensitivity and specificity in seminoma/dysgerminoma and embryonal carcinoma and the germ cell component of gonadoblastoma by nuclear immunostaining. Clear cell carcinoma may enter the differential diagnosis of dysgerminoma as both may grow in nests or tubules, contain clear cells, and have a prominent inflammatory infiltrate (lymphocytes in dysgerminoma and plasma cells in clear cell carcinoma). In one study that looked at OCT-4 staining in clear cell carcinomas, 4 of 14 tumors were found to be focally positive. In another study, 49 endometrioid carcinomas were OCT-4 negative. Rarely dysgerminoma may have a morphologic appearance that overlaps with sex cord-stromal tumors, especially poorly differentiated Sertoli cell tumors. In two studies, however, all sex cord-stromal tumors of the testis and granulose cell tumors of the ovary were OCT-4 negative.

References1. Baker PM, et al., Int J Gynecol Pathol. 24(1):39-55, 2005. Review.2. Biermann K, et al., Histopathology. 49(3):290-7, 2006.3. Cheng CJ, et al., J Biomed Sci. 14(6):797-807, 2007. Epub 2007 Aug 8.

4. Cools M, et al., J Clin Endocrinol Metab. 91(6):2404-13, 2006. Epub 2006 Apr 11.5. Gidekel S, et al., Cancer Cell. 4(5):361-70, 2003.

p21WAF1 (DCS-60.2)Catalog Number 760-4453Type Mouse MonoclonalControl Non-small Cell Lung Carcinoma, ColonLocalization NuclearQuantity 50 testsIsotype IgG2a

Colon mucosa, hyperplastic polyp

Descriptionp21 is a nuclear 21kD protein, a product of the WAF1/CIP1 gene. It is a cyclin-dependent kinase inhibitor 1A (p21, Cip1), also known as CDKN1A, which in humans is encoded by the CDKN1A gene located on chromosome 6p21.2. It is a constituent of a large complex of nuclear proteins, including cyclins, cyclin dependent kinases, and PCNA (Proliferating Cell Nuclear Antigen). Cell cycle progression is regulated by cyclins and their cognate Cdks. p21 inhibits the activity of each member of the cyclin/Cdk family. The expression of this gene acts as an inhibitor of the cell cycle during G1 phase and is tightly controlled by the tumor suppressor protein p53. Normal cells generally display a rather intense nuclear p21 expression. Loss of p21 expression has been associated with poor prognosis in several carcinomas (gastric carcinoma, non-small cell lung carcinoma and thyroid carcinoma).

References1. DiGiuseppe JA, et al., Am J Pathol. 147(4):884-8, 1995.2. Gomyo Y, et al., Cancer. 79(11):2067-2072, 1997.3. Ikeguchi M, et al., Dig Dis Sci. 43(5):964-70, 1998.

4. Marone M, et al., Leuk Lymphoma. 43(1):51-7, 2003.5. Kwon MS, et al., Pathol Res Pract. 202(12):849-56, 2006.6. Merola E, et al., J Cell Physi. 207(2):512-519, 2006.

IHC_ISH | Primary Antibodies

106 Ventana Medical Systems, Inc. | 800.227.2155

Page 121: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

p27kip1 (SX53G8)Catalog Number 760-4268Type Mouse MonoclonalControl Non-small Cell Lung Carcinoma, ColonLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Lymph node

Descriptionp27 is a cyclin-dependent kinase inhibitor which regulates progression from G1 to S phase by binding and inhibiting cyclin-dependent kinases. Low p27 expression has been associated with unfavorable prognosis in renal cell carcinoma, colon carcinoma, small breast carcinoma, non-small cell lung carcinoma, hepatocellular carcinoma, multiple myeloma, lymph node metastases in papillary carcinoma of the thyroid, and more aggressive phenotype in a carcinoma of the cervix.

References1. Lloyd RV, et al., Am J Pathol. 154:313-323, 1999.2. Migita T, et al., Cancer. 94:973-9, 2002.3. Haitel A, et al., Urology. 58:477-481, 2001.

4. Tan P, et al., Cancer Research. 57-1259-1263, 1997.5. Esposito V, et al., Cancer Research. 57:3381-3385, 1997.6. Khoo MLC, et al., J Clin Endocrinol Metab. 87:1814-1818, 2002.

p53 (Bp-53-11)Catalog Number 760-2542Type Mouse MonoclonalControl Colon AdenocarcinomaLocalization NuclearQuantity 50 testsIsotype IgG2a

Bladder transitional cell carcinoma

DescriptionAnti-p53 (Bp53-11) is directed against both the mutant and wild type of the p53 nuclear phosphoprotein. Very rare normal cells express p53, but alterations in the p53 suppressor gene result in an overproduction of this protein in malignancies. This reagent may be used to aid in the identification of abnormally proliferating cells in neoplastic cell populations. Anti-p53 (Bp53-11) specifically binds to nuclear antigen(s) associated with the normal down regulation of cell division. Increased expression of p53 in actively dividing cells is an indication of loss of function due to mutation of the p53 gene.

References1. Mayall FG, et al., J Pathol. 168:377-381, 1992. 2. Van den Berg FM, et al., Am J Pathol. 142:381-385, 1993.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 107

Page 122: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM p53 (DO-7)Catalog Number 790-2912Type Mouse MonoclonalControl Colon AdenocarcinomaLocalization NuclearQuantity 50 testsIsotype IgG1/K

Colon carcinoma

DescriptionThe wild type p53 molecule has a role in transcription, in cell cycle control, and in many other metabolic functions. It is also a tumor suppressor in that it halts abnormal growth in normal cells; however, a mutation in one of its 393 amino acids can eliminate the surveillance capability of the protein and allow expression of malignant phenotype. Approximately 50% of all human cancers contain a mutation in p53. The wild type molecule has a short half life, is present in low concentrations, and cannot usually be detected by IHC. Many of the mutations in p53 increase its half life and cause intranuclear accumulation of the mutant protein. Thus in many malignancies of the colon, stomach, bladder, breast, lung, and testes and in melanomas and soft tissue sarcomas, p53 protein can be readily detected in the malignant cells by IHC, and immunostaining closely correlates with the presence of a mutation. The staining pattern with the CONFIRM p53 (DO-7) is exclusively nuclear, and may be present in a heterogeneous pattern.

References1. Mayall FG, et al., J Pathol. 168:377-381, 1992. 2. Van den Berg FM, et al., Am J Pathol. 142:381-385, 1993.

p63 (4A4)Catalog Number 790-4509Type Mouse MonoclonalControl Prostate, TonsilLocalization NuclearQuantity 50 testsIsotype IgG2a/K

Prostate

DescriptionVENTANA anti-p63 (4A4) Mouse Monoclonal Primary Antibody is directed against the p63 molecule which is highly expressed in the nuclei of human prostatic basal cells and urothelial tissues. This antibody may be used to aid in the differentiation of benign and malignant prostatic lesions.

References1. Yang A, et al., Mol Cell. 2:305-16, 1998.2. Grisanzio C, et al., J Cell Biochem. 103:1354-1368, 2008.3. Yang A, et al., Nature. 398:714-718, 1999.4. Signoretti S, et al., J Pathol. 157:1769-1775, 2000.

5. Wu HH, et al., Appl Immunohistochem Mol Morph. 12:285-289, 2004.6. Shah RB, et al., Am J Surg Pathol. 26:1161-1168, 2002.7. Weinstein MH, et al., Mod Pathol. 15:1302-1308, 2002.8. Harton AM et al., Am J Clin Pathol. 128:80-85, 2007.

IHC_ISH | Primary Antibodies

108 Ventana Medical Systems, Inc. | 800.227.2155

Page 123: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

p120 (98)Catalog Number 790-4517Type Mouse MonoclonalControl TonsilLocalization Membranous (ductal), Cytoplasmic (lobular)Quantity 50 testsIsotype IgG1

DescriptionAnti-p120 catenin (98) Mouse Monoclonal Primary Antibody is directed against human juxtamembrane protein p120 expressed as a part of the cell-cell adhesion complex in epithelial tissues. Cytoplasmic accumulation of p120 is associated with lobular breast carcinoma, whereas ductal neoplasms retain membranous localization.

References1. Dabbs DJ, et al., Am J Surg Pathol. 31(3):427-37, 2007.2. Anastasiadis PZ., Biochimica et Biophysica Acta. 1773:34-46, 2007.3. Mastracci TL, et al., Modern Pathology. 18:741-751, 2005.

4. Thoreson MA, et al., Differentiation. 70:583-589, 2002.5. Thoreson MA, et al., J of Cell Bio. 148(1):189-201, 2000.

Parathyroid Hormone (PTH) (MRQ-31)Catalog Number 760-4532Type Mouse MonoclonalControl ParathyroidLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG2a

DescriptionAnti-PTH antibody is useful to distinguish parathyroid hyperplasia/neoplasms from thyroid and metastatic neoplasms; although the pathologist is typically aware of the preoperative hypercalcemic status. Occasionally when the surgeon does not supply this information PTH immunohistochemistry is essential. Even more problematic are situations in which clear cell parathyroid carcinomas are nonsecretory without an abnormality in mineral metabolism.

References1. Brown E, Mineral Electrolyte Metal. 8:130-50, 1982.2. Chen HL, et. al. Journal of Biology and Chemistry. 277:19374-81, 2002.3. Wick MR, et. al., Seminars in Diagnostic Pathology. 14:183-202, 1997.

4. Permanetter W, et. al., American Journal of Surgical Pathology. 7:535-46, 1983.5. Aldinger KA, et. al., Cancer. 49:388-97, 1982.6. Murphy MN, et. al. Cancer. 58:2468-76, 1986.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 109

Page 124: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PAX-2 (polyclonal)Catalog Number 760-4393Type Rabbit PolyclonalControl Renal Cell CarcinomaLocalization NuclearQuantity 50 testsIsotype IgG

Renal cell carcinoma

DescriptionPAX-2 is a homeogene strongly expressed during kidney development. PAX-2 gene is expressed in the metanephric mesenchyma after ureter bud induction and is a key factor for the mesenchyma-epithelium conversion. Animals transgenic for PAX-2 have severe renal abnormalities and cysts but no solid tumoral features. The oncogenic potential of the PAX gene family has been reported in vitro with transformation of cell cultures and in vivo with cell injections in nude mice. Gnarra, et al. showed PAX-2 expression in renal carcinoma cell lines and underlined its potential role in cell proliferation in these lines. Mazal, et al. demonstrated PAX-2 nuclear expression in 88% of clear cell renal cell carcinomas as well as 18% of papillary renal cell carcinoma, and 13% of chromophobe renal cell carcinomas. More recently, O’Connor, et al. demonstrated utility in distinguishing ovarian serous papillary carcinoma (PAX-2 positive) from primary breast carcinoma (PAX-2 negative). PAX-2 antibody has also been used to distinguish Hepatocellular carcinoma (PAX-2 negative) from clear cell renal cell carcinoma.

References1. Browne LW, et al., Poster #229 at 2008 USCAP meeting; 3-05-08.2. Daniel L, et al., Hum Pathol. 32(3):282-7, 2001.3. Gnarra JR, et al., Cancer Res. 15:55(18):4092-8, 1995.

4. Mazal PR, et al., Mod Pathol. 18(4):535-40, 2005.5. O’Conner SM, et al., Poster #150 at 2008 USCAP meeting; 3-05-08.

CONFIRM PAX5 (SP34)Catalog Number 790-4420Type Rabbit MonoclonalControl Tonsil, SpleenLocalization NuclearQuantity 50 tests

Lymphoma

DescriptionCONFIRM anti-PAX5 (SP34) Rabbit Monoclonal Primary Antibody is directed against a nuclear epitope present in human B lymphocytes. This antibody may be used to aid in the identification of normal and neoplastic cells of B-lymphocytic lineage.

References1. Adams B, et al., Genes Dev. 6(9):1589-1607, 1992.2. Cobaleda C, et al., Nat Immunol. 8(5):463-470, 2007.3. Holmes ML, et al., Immunol Cell Biol. 86(1):47-53, 2008.

4. Feldman AL, et al., Adv Anat Path. 14(5):323-334, 2007.5. Jensen KC, et al., Mod Pathol. 20(8):871-877, 2007.6. Mhawech-Fauceglia P, et al., J Clin Pathol. 60(6):709-714, 2007.

IHC_ISH | Primary Antibodies

110 Ventana Medical Systems, Inc. | 800.227.2155

Page 125: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PD-1 (MRQ-22)Catalog Number 760-4448Type Mouse MonoclonalControl Lymph Node, TonsilLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Tonsillar hypertrophy

DescriptionProgrammed death-1 (PD-1) is a member of the CD28 family of receptors that includes CD28, cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4), inducible costimulator (ICOS), and Band T-lymphocyte attenuator. These receptors play a role in the cellular immune response. For example, CD28 serves as a costimulatory receptor that enhances T-cell activation, whereas CTLA-4 serves as an inhibitor of T-cell activation. PD-1 also has an inhibitory function on T cells and B cells, and is important in peripheral tolerance. There are at least 2 ligands for PD-1: PD-L1 and PD-L2, which are expressed on a range of cells.

CD28 is constitutively expressed on most or all CD4+ T cells and approximately 50% of CD8+ T cells, whereas CTLA-4 is not expressed on resting T cells. PD-1 is also expressed on activated T cells, B cells, and myeloid cells. Iwai and coworkers studied the microanatomic distribution of PD-1 in human tonsil and found that PD-1 is expressed on most T cells and a small subset of B cells in the light zone of germinal centers, but not elsewhere in the tonsil. On that basis, it was postulated that PD-1 may play a role in the process of clonal selection of centrocytes, which occurs in this subanatomic site in germinal centers.

PD-1 is a new marker of angioimmunoblastic lymphoma and suggests a unique cell of origin for this neoplasm. Unlike CD10 and bcl-6, PD-1 is expressed by few B cells, so it may be a more specific and useful diagnostic marker in angioimmunoblastic lymphoma. It also seems to stain a greater percentage of CD3-positive neoplastic cells in angioimmunoblastic lymphoma than either CD10 or bcl-6. In addition, PD-1 expression provides new evidence that angioimmunoblastic lymphoma is a neoplasm derived from germinal center-associated T cells. PD-1 expression in angioimmunoblastic lymphoma lends further support to this model of T-cell oncogenesis, in which specific subtypes of T cells may undergo neoplastic transformation and result in specific distinct histologic, immunophenotypic, and clinical subtypes of T-cell neoplasia.

References1. Bolstad AI, et al., Arthritis Rheum. 48(1):174-85, 2003.2. Dorfman DM, et al., Am J Surg Pathol. 30(7):802-10, 2006.3. Hamanishi J, et al., Proc Natl Acad Sci U S A. 104(9):3360-5, 2007.4. Iwai Y, et al., Immunol Lett. 83(3):215-20, 2002.

5. Kobayashi M, et al., J Rheumatol. 32(11):2156-63, 2005.6. Konishi J, et al., Clin Cancer Res. 10(15):5094-100, 2004.7. Mataki N, et al., Am J Gastroenterol. 102(2):302-12, 2007.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 111

Page 126: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Perforin (MRQ-23)Catalog Number 760-4394Type Mouse MonoclonalControl Tonsil, Lymph NodeLocalization Perinuclear CytoplasmicQuantity 50 testsIsotype IgG1

Lymphoma

DescriptionPerforin is a pore-forming protein that leads to osmotic lysis of the target cells and subsequently enables granzymes to enter the target cells and activate apoptosis, the cell death program. The expression of perforin is upregulated in activated CD8+ T cells, but in NK cells the expression is constitutively very high and stable. Perforin expression can also be stimulated in some activated CD4+ T cells. CD8+ T cells and NK cells use both the perforin ⁄ granzyme and the Fas ⁄ FasL pathways, while CD4+ T cells preferentially use the Fas ⁄ FasL pathway.

Although some investigators report a cytolytic potential of CD4+ T cells, it appears more likely that CD8+ T cells are the major effector population in Th1- associated inflammatory skin diseases. The role of perforin-mediated cytotoxicity has been demonstrated in various autoimmune diseases. In vitro and in vivo studies suggest that the cytotoxicity of CTLs may be mediated by cytotoxic granules in certain inflammatory diseases in humans. In addition, it seems that T-cell cytotoxicity against keratinocytes is mediated by perforin in some inflammatory skin diseases.

Other authors suggest that perforin may have a dual role in alloimmune response (organ transplant applications). In one regard, it has a cytolytic function in acute rejection, and, in contrast, it may be responsible for downregulating both CD4- and CD8-mediated alloimmune response.

References1. Chu PG, et al., Ann Diagn Pathol. 3(2):104-33, 1999. Review.2. Bittmann I, et al., Virchows Arch. 445(4):375-81, 2004. Epub 2004 Jul 29.

3. d’Amore ES, et al., Pediatr Dev Pathol. 10(3):181-91, 2007.

PGP 9.5 (polyclonal)Catalog Number 760-4434Type Rabbit PolyclonalControl Nerve Tissue, Bowel Wall (Interstitial Cells of Cajal)Localization CytoplasmicQuantity 50 testsIsotype IgG

Small bowel wall, peritonitis

DescriptionProtein gene product 9.5 (PGP 9.5), also known as ubiquitin carboxylterminal hydrolase-1 (UCH-L1), is a 27-kD protein originally isolated from whole brain extracts (1). Although PGP 9.5 expression in normal tissues was originally felt to be strictly confined to neurons and neuroendocrine cells (2), it has been subsequently documented in distal renal tubular epithelium, spermatogonia, Leydig cells, oocytes, melanocytes, prostatic secretory epithelium, ejaculatory duct cells, epididymis, mammary epithelial cells, Merkel cells, and dermal fibroblasts. LK Campbell, et al. demonstrated immunostaining of a plethora of different mesenchymal neoplasms with this antibody.

References1. Bassotti G, et al., J Clin Pathol. 58(9):973-7, 2005.2. Campbell LK, et al., Mod Pathol. 16(10):963-9, 2003.3. Kasprzak A, et al., Pol J Pathol. 58(1):23-33, 2007. Review.

4. Mahalingam M, et al., J Cutan Pathol. 28(6):282-6, 2001.5. Mahalingam M, et al., J Cutan Pathol. 33(1):51-6, 2006.

IHC_ISH | Primary Antibodies

112 Ventana Medical Systems, Inc. | 800.227.2155

Page 127: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Phosphohistone-H3 (PHH3)Catalog Number 760-4591Type Rabbit PolyclonalControl TonsilLocalization NuclearQuantity 50 tests

Breast infiltrating ductal carcinoma

DescriptionPhosphohistone-H3 is used as an aid in identification of mitotic activity in tumor cells and diagnosis of tumor grade differentiation within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Mehra R, et al. Mod Path, 20:538-544, 2007.2. Gurley, LR. Et al. J Biol Chem. 268:18431-4, 1993.3.Hendzel, MJ, et al. J Biol Chem. 273:24470-8, 1998.

4. Colman H. et al. Am J Surg Pathol. 30:657-64, 2006.5. Nasr MR, et al. Am J Dermatopathol. 30:117-22, 2008.6. Kim YJ, et al. Am J Clin Pathol 128:118-25, 2007.

Placental Alkaline Phosphatase (PLAP) (NB10)Catalog Number 760-2664Type Mouse MonoclonalControl PlacentaLocalization CytoplasmicQuantity 50 testsIsotype IgG

Placenta, cytotrophoblasts

DescriptionAnti-PLAP antibody immunoreacts with germ cell tumors and can discriminate between these and other neoplasms. Somatic neoplasms e.g. breast, gastrointestinal, prostatic, and urinary cancers may also immunoreact with antibodies to PLAP. Anti-PLAP positivity in conjunction with keratin negativity favors seminoma over carcinoma. Germ cell tumors are usually keratin positive, but they regularly fail to stain with anti-EMA, whereas most carcinomas stain with anti-EMA. This antibody has shown cross-reaction with human intestinal alkaline phosphatase.

References1. Jacobsen GK, et al., Acta Path Microb Immuno Scand Sect A. 92:323-329, 1984.2. Paiva J, et al., Am J Pathol. 111:156-165, 1984.

3. Burke AP, et al., Hum Path. 19:663-670, 1988.4. Manivel JC, et al., Am J Surg Path. 11:21-29, 1987.5. Wick MR, et al., Hum Path. 18:946-954, 1987.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 113

Page 128: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PMS2 (EPR3947)Catalog Number 760-4531Type Rabbit MonoclonalControl ColonLocalization NuclearQuantity 50 testsIsotype IgG

DescriptionMicrosatellite instability (MSI) is characterized by genome-wide alterations in short, repetitive DNA sequences. It is caused by defects in the nucleotide mismatch repair (MMR) system. Biologically, defective MMR results in a general increase in the mutation rate and the development of a “mutator phenotype.” In colorectal cancer (CRC), high-level MSI was first described in tumors from patients with hereditary non-polyposis colorectal cancer (HNPCC). PMS2 is a useful diagnostic and prognostic marker for hereditary non-polyposis colorectal cancer (HNPCC).

References1. Hampel H, et. al., N Engl J Med. 352:1851-60, 2005.2. Gologan A, et. al., Clin Lab Med. 25:179-96, 2005.3. Lagerstedt Robinson K, J Natl Cancer Inst. 99:291-9, 20074. Hendriks YM, et. al., Gastroenterology. 130:312-22, 2006.

5. Truninger K, et. al., Gastroenterology. 128:1160-71, 2005.6. Warusavitarne J, et al., J Colorectal Dis. 22: 739-748, 2007.7. Gill S, et. al., Clin Cancer Res. 11:6466, 2005.

Podoplanin (D2-40)Catalog Number 760-4395Type Mouse MonoclonalControl Lymph Node, LymphangiomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Tonsil

DescriptionPodoplanin is a transmembrane mucoprotein (38 kd) recognized by the D2-40 monoclonal antibody. Podoplanin is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas and in a subset of angiosarcomas with probable lymphatic differentiation. Podoplanin has also been shown to be expressed in epithelioid mesotheliomas hemangioblastomas and seminomas.

References1. Ordonez N, Adv Anat Pathol. 13(2):83-8, 2006.2. Ordonez N, Hum Pathol. 36(4):372-80, 2005.3. Niakosari F, et al., Arch Dermatol. 141(4):440-4, 2005.4. Galambos C, et al., Pediatr Dev Pathol. 8(2):191-9, 2005.5. Fukunaga M, Histopathology. 46(4):396-402, 2005.

6. Chu AY, et al., Mod Pathol. 18(1):105-10, 2005.7. Franke FE, et al., J Cutan Pathol. 31(5):362-7, 2004.8. Fogt F, et al., Oncol Rep. 11(1):47-50, 2004.9. Kahn HJ, et al., Mod Pathol. 15(4):434-40, 2002.

IHC_ISH | Primary Antibodies

114 Ventana Medical Systems, Inc. | 800.227.2155

Page 129: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Progesterone Receptor (PR) (1E2)Catalog Number 790-2223, 790-4296Type Rabbit MonoclonalControl BreastLocalization NuclearQuantity 50 tests (790-2223), 250 tests (790-4296)Isotype IgG

Breast Ductal Carcinoma

DescriptionCONFIRM anti-PR (1E2) Primary Antibody is intended for laboratory use for the qualitative detection of progesterone receptor (PR) antigen in sections of formalin-fixed, paraffin-embedded tissue on a VENTANA automated slide stainer with VENTANA detection kits and ancillary reagents. CONFIRM anti-PR (1E2) that recognizes the A and B forms of human progesterone receptor and is indicated as an aid in the management, prognosis, and prediction of therapy outcome of breast cancer. One of the important markers in breast cancer today is progesterone receptor (PR), due to its role in determining the functionality of estrogen receptors present in breast cancer cells. The presence of estrogen receptor (ER), however, does not guarantee a response to endocrine therapy. Half of all patients with ER positive primary tumors fail to respond. In tumor cells, genetic expression is often inaccurate, leading to variant protein expression. It is proposed that mutant ER, that no longer bind estrogen or that no longer perform signal transduction, may be the cause of the failure to respond to endocrine therapy. One way to evaluate the functionality of the ER present in a breast carcinoma is to determine if proteins regulated by ER are expressed. Progesterone receptor is such a protein, and has been used to monitor for functional ER for many years.

References1. Bevitt DJ, Milton ID, et al., J. Pathol. 83(2):228-232, 1997.2. Dickson RB, Lippman ME, et al., Kluwer Acad, Publ. 1992; 285-286.3. Wei LL, et al., Cancer Res. 54(2):340-3, 1994.4. Doglioni C, et al., Am. J. Pathol. 137(5):999-1005, 1990.5. Greene GL, et al., Immun. Appr. Diag. and Ther. Breast Cancer. 119-135, 1987.6. Press MF, Greene GL, et al., Endocrinology. 122(3):1165-1175, 1988.

7. Winborn WB, Sheridan PJ, et al., Pancreas. 2(3):289-94, 1987.8. Money SR, Muss W, et al., Surgery. 106(6):975-8, 1989.9. Roche PC, et al., Mayo Clin. Proc. 69(1):57-58, 1994.10. PDQ. http://icisun.nci.nih…t_cancer_Physician.html.11. Horwitz KB, et al., J. Steroid Biochem. Mol. Biol. 49(4-6):295-302, 1994.12. Van Agthoven T, Timmermans M, et al., Int. J. Cancer. 63(6):790-793, 1995.

Prolactin (polyclonal)Catalog Number 760-2803Type Rabbit PolyclonalControl Normal PituitaryLocalization CytoplasmicQuantity 50 tests

Pituitary

DescriptionAnti-Prolactin is a useful marker in classification of pituitary tumors and the study of pituitary disease. It reacts with prolactin-producing cells. Such prolactin-producing cells can also be found in prostate epithelium.

References1. Asa SL, et al., Arch Pathol Lab Med. 106:360, 1982.2. Duello TM, et al., Amer J Anat. 158:463, 1980.3. Minniti G, et al., Surg Neurol. 57(2):99-103, 2002.

4. Popadic A, et al., Surg Neurol. 51(1):47-54, 1999.5. Nevalainen MT, et al., J Clin Invest. 99(4):618-27, 1997.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 115

Page 130: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PSA (Prostate Specific Antigen) (ER-PR8)Catalog Number 760-4271Type Mouse MonoclonalControl Prostate AdenocarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Prostate

DescriptionPSA is an antigen present in prostatic tissue and in the majority of prostatic carcinomas. This antibody recognizes primary and metastatic prostatic neoplasms and rarely in tumors of non-prostatic origin. These include breast and a minority of salivary gland tumors. The antigen is a 33-34 kD glycoprotein that is restricted to epithelial cells of the prostate. An immunohistochemical study showed more than 95% of prostatic carcinomas stained with anti-PSA8. PSA is demonstrable in the cytoplasm of acinar and ductal cells of normal or malignant prostate tissue.

References1. Gallee MPW, et al., Prostate. 9:33-45, 1986.2. Nadji M, et al., Cancer. 48(5):1229-1232, 1981.3. Genega EM, et al., Mod Pathol. 13(11):1186-91, 2000.

4. Green LK, et al., Hum Pathol. 22(3):242-6, 1991.5. van Krieken JH, et al., Am J Surg Pathol. 17(4):410-4, 1993.

CONFIRM PSA (Prostate Specific Antigen) (polyclonal)Catalog Number 760-2506Type Rabbit PolyclonalControl ProstateLocalization CytoplasmicQuantity 50 testsIsotype IgG

Prostate

DescriptionCONFIRM anti-Prostate Specific Antigen (PSA) is directed against both free and bound human prostate specific antigen (PSA). PSA is a 33-34 kD chymotrypsin like serine protease (kallikrein family) specifically expressed by prostate epithelium. PSA is present in the cytoplasm of benign and malignant prostate epithelium. It is useful for identification of adenocarcinoma of the prostate in metastatic sites and for differentiating prostate adenocarcinoma from urothelial carcinoma.

References1. Nadji M, et al., Cancer. 48(5):1229-1232, 1981. 2. Oesterling JE, J Urology. 145(5):907-923, 1991.

IHC_ISH | Primary Antibodies

116 Ventana Medical Systems, Inc. | 800.227.2155

Page 131: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

PSAP (Prostatic Acid Phosphatase) (PASE/4LJ)Catalog Number 760-4272Type Mouse MonoclonalControl ProstateLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Prostate

DescriptionAnti-PSAP reacts with prostatic acid phosphatase in the glandular epithelium of normal and hyperplastic prostate, carcinoma of the prostate, and metastatic cells of prostatic carcinoma. This marker may be helpful in pinpointing the site of origin in cases of metastatic carcinoma of the prostate, and is considered a more sensitive marker than PSA. However, it offers less specificity. Nevertheless, PSAP complements PSA in the right clinical context.

References1. Ansari MA, et al., Am J Clin Path. 76:94-98, 1981.2. Nadji M, et al., Ann NY Acad Sci. 390:133-141, 1982.3. Kimura N, et al., Virchows Arch A. 4:247-251, 1986.

4. Kidwai N, et al., Breast Cancer Res. 6(1):R18-23, 2004.5. Kuroda N, et al., Pathol Int. 49(5):457-61, 1999.6. Elgamal AA, et al., Urology. 44(1):84-90, 1994.

Renal Cell Carcinoma (RCC) (PN-15)Catalog Number 760-4273Type Mouse MonoclonalControl Kidney, Renal Cell CarcinomaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1/K

Kidney

DescriptionRenal Cell Carcinoma antibody recognizes a 200 kD glycoprotein localized in the brush border of the proximal renal tubule. This antibody immunoreacts with approximately 90% of primary renal cell carcinomas and approximately 85% of metastatic renal cell carcinomas. Other tumors that may react with this antibody are parathyroid adenoma, an occasional breast carcinoma. Nephroblastoma, oncocytoma, mesoblastic nephroma, transitional cell carcinoma, and angiomyolipoma are not labeled with this antibody.

References1. Avery AK, et al., Am J Surg Pathol. 24(2):203-210, 2000.2. McGregor DK, et al., Am J Surg Pathol. 25(12):1485-1492, 2001.

3. Gokden N, et al., Appl Immunohistochem Mol Morphol. 11(2):116-9, 2003.4. Ordonez NG, et al., Human Pathology. 35(6):697-710, 2004.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 117

Page 132: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM S100 (polyclonal)Catalog Number 760-2523Type Rabbit PolyclonalControl MelanomaLocalization CytoplasmicQuantity 50 tests

Melanoma

DescriptionCONFIRM anti-S100 (Polyclonal) Primary Antibody contains rabbit antiserum directed against an epitope found on S100 protein and may be used to aid in the identification of cells of normal and abnormal neuronal and neuroendocrine lineage and as an aid in the diagnosis of anaplastic tumors. S100 is a sensitive marker for melanoma. It stains amelanotic melanomas more strongly than pigmented tumors and detects melanomas that are often negative for other melanocytic markers such as desmoplastic melanomas. The staining is cytoplasmic, the proportion of positive cells varying from 10 to 70 percent or more.

Although S100 is highly sensitive for melanomas, many non melanocytic tumors also show S100 positivity. S100 typically is present in neural cells (glial cells and Schwann cells) and their corresponding tumors.1 An advantage of the ubiquity of strongly immunoreactive S100 protein in peripheral nerves, which are present in almost any section of normal or diseased tissue, is that it provides a built in positive control for most immunostains for S100.

References1. Taylor RT, et al., WB Saunders Co, Philadelphia, 1994.2. Kahn HJ, et al., Amer J Clin Pathol. 79(3):341-347, 1983.

3. True L. Atlas of Diagnostic Immunohistopathology. 1990.

CONFIRM S100 (4C4.9)Catalog Number 790-2914Type Mouse MonoclonalControl MelanomaLocalization CytoplasmicQuantity 50 testsIsotype IgG2a

Melanoma

DescriptionS100 was first detected in nervous tissue and has subsequently been found in a number of other cell types including glial and neural cells, Schwann cells, melanocytes and nevus cells, cells of cartilaginous and fatty tissue, myoepithelial cells, and also Langerhans cells. S100 is a sensitive marker for melanoma. Antibodies against S100 stain amelanotic melanomas more strongly than pigmented tumors and detect melanomas that are often negative for other melanocytic markers, such as desmoplastic melanomas. Although S100 is highly sensitive for melanomas, many non melanocytic tumors also show S100 positivity. S100 typically is present in neural cells (glial cells and Schwann cells) and their corresponding tumors.

References1. Taylor RT, et al., W.B. Saunders Co, Philadelphia, 1994. 2. Kahn HJ, et al., Amer. J. Clin. Pathol. 1983; 79(3): 341-347.

IHC_ISH | Primary Antibodies

118 Ventana Medical Systems, Inc. | 800.227.2155

Page 133: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Smoothelin (R4A)Catalog Number 760-4592Type Mouse MonoclonalControl Bladder, LeiomyosarcomaLocalization Cytoplasmic (MP), NuclearQuantity 50 testsIsotype IgG1

Urinary transitional cell carcinoma

DescriptionSmoothelin (R4A) is used as an aid in the distinction of terminally differentiated smooth muscle cells, smooth muscle neoplasms of the gastrointestinal tract and other organs, and staging of bladder carcinoma within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Kramer, J et al. J Mol Med. 77:294-8, 1999.2. van der Loop, FT et al. J Cell Biol. 134:401-411, 1996.3. Maake, C et al. J Urol. 175:1152-1157, 2006.4. Jimenez, RE et al. Adv Anat Pathol. 7:13-25, 2000.5. Kuijpers, et al. Eur Urol. 52:1213-21, 2007.

6. Paner, GP et al. Am J Surg Pathol. 33:91-8, 2009.7. Paner, GP et al. Am J Surg Pathol. 34:792-9, 2010.8. Council, L et al. Mod Pathol. 22:639-650, 2009.9. Coco, DP et al. Am J Surg Pathol. 33(12):1795-801, 2009.

Somatostatin (polyclonal)Catalog Number 760-2667Type Rabbit PolyclonalControl PancreasLocalization CytoplasmicQuantity 50 tests

Pancreas

DescriptionAnti-Somatostatin is a useful marker of D cells of pancreatic islet cells. D-cell identification can be used to identify hyperplasia of the pancreatic islets as well as islet cell tumors such as somatostatinomas. Somatostatin can also be found in gastrointestinal and broncho-pulmonary endocrine cells, thymic endocrine cells, and thyroid C cells. Somatostatin suppresses gastric acid secretion, gallbladder contractions, and pancreatic enzyme secretion.

References1. Krejs GJ, et al., N. Eng J Med. 301:285-292, 1979.2. Somers G, et al., Gastroenterology. 85:1192-1198, 1983.3. Erlandsen SL, et al., Williams and Wilkins, Baltimore. 140-155, 1980.

4. Friesen SR, et al., N Eng J Med. 306:580-590, 1982.5. Tzaneva MA, et al., Acta Histochem. 105(2):191-201, 2003.6. Quartu M, et al., J Chem Neuroanat. 6(2):79-99, 1993.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 119

Page 134: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Spectrin (RBC2/3D5)Catalog Number 760-4274Type Mouse MonoclonalControl Bone MarrowLocalization MembranousQuantity 50 testsIsotype IgG2b/K

Bone Marrow, red blood cell precursors

DescriptionSpectrin is a cytoskeletal protein which is found in muscles, red blood cells, and red blood cell precursors. Anti-Spectrin antibody is useful in the diagnosis of erythroid leukemias.

References1. Sadahira Y, et al., J Clin Pathol. 52(12):919-21, 1999.2. Nehls V, et al., Am J Pathol. 142(5):1565-73, 1993.3. Muller M, et al., J Vet Med A Physiol Pathol Clin Med. 48(1):51-7, 2001.

4. Terada N, et al., J Anat. 190(3):397-404, 1997.

CONFIRM Synaptophysin (SP11)Catalog Number 790-4407Type Rabbit MonoclonalControl PancreasLocalization CytoplasmicQuantity 50 tests

Normal pancreas

DescriptionAnti-Synaptophysin is useful in the detection of normal neuroendocrine cells and neuroendocrine neoplasms. Reactive neoplasms of neural type include neuroblastomas, ganglio neuroblastomas, ganglioneuromas, pheochromocytomas, chromaffin and non-chromaffin paragangliomas. The antibody also labels neuroendocrine neoplasms of epithelial type including: pituitary adenomas, islet cell neoplasms, medullary thyroid carcinomas, parathyroid adenomas, carcinoids of the bronchopulmonary and gastrointestinal tracts, neuroendocrine carcinomas of the bronchopulmonary and gastrointestinal tracts, and neuroendocrine carcinomas of the skin.

References1. Buffa R, et al., Mol and Cell Probes. 1(4): 367 381, 1987.2. Gould V, et al., Am J Pathol. 126(2): 243 257, 1987.3. Wiedenmann B, et al., Proc Natl Acad Sci USA. 83(10): 3500 3504, 1986.4. Gould V, et al., Hum Pathol. 17(10): 979 983, 1986.

5. Chejfec G, et al., Am J Surg Pathol. 11(4): 241 247, 1987.6. Kayser K, et al., Pathol Res Pract. 183(4): 412 417, 1988.7. Stefaneanu L, et al., Arch Pathol Lab Med. 112(8): 801 804, 1988.8. Wiedenmann B, et al., Am J Clin Pathol. 88(5): 560 569, 1987.

IHC_ISH | Primary Antibodies

120 Ventana Medical Systems, Inc. | 800.227.2155

Page 135: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Synaptophysin (MRQ-40)Catalog Number 760-4595Type Rabbit MonoclonalControl Pancreatic Islet CellsLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Lung small cell carcinoma

DescriptionSynaptophysin is used as an aid in the identification of neuroendocrine neoplasms within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Navone, F et al. J Cell Biol 103:2511-2527, 1986.2. Wiedenmann, B et al. Cell. 41:1017-1028, 1985.3. Kayser, K et al. Path Res Pract. 183:412-417, 1988.4. Son, EI et al. Pathol Int. 53(2):67-73, 2003.5. Conner, MG et al. Ann Diagn Pathol. 6(6):345-8, 2002.

6. Lyda, MH et al. Hum Pathol. 31(8):980-7, 2000.7. Skacel, M et al. Appl Immunohistochem Mol Morphol. 8(3):302-9, 2000.8. Morrison, CD et al. Semin Diagn Pathol. 17(3):204-15, 2000.9. Kamisawa, T et al. Pathol Res Pract. 192(9):901-8, 1996.

TAG-72 (B72.3)Catalog Number 760-2669Type Mouse MonoclonalControl Breast CarcinomaLocalization CytoplasmicQuantity 50 testsIsotype IgG1/K

Breast adenocarcinoma

DescriptionAnti-TAG-72 recognizes a high molecular weight glycoprotein called TAG-72 that is present in human adenocarcinomas and in lesser amounts, non-neoplastic tissues. It has also been found to be useful to distinguish between mesothelioma and adenocarcinoma, however, false positive reactions can occur so results must be interpreted with the utmost caution.

References1. Thor A, et al., Cancer Res. 46:3118, 1986.2. Schlom J, et al., Tumormarker Oncology. 2:3, 1987.3. Johnston WW, et al., Hum Pathol. 17:501-513, 1986.4. Lundy J, et al., Ann Aurg. 203:399-402, 1986.

5. Kline TS, et al., Cancer. 63:2253-2256, 1989.6. Chhieng DC, et al., Hum Pathol. 34(10):1016-21, 2003,7. Ordonez NG, et al., Am J Surg Pathol. 22(10):1203-14, 1998.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 121

Page 136: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

T-bet (MRQ-46)Catalog Number 760-4598Type Rabbit MonoclonalControl Tonsil, Hairy Cell LeukemiaLocalization NuclearQuantity 50 testsIsotype IgG1

Hairy cell leukemia

DescriptionT-bet is used as an aid in the differentiation of hairy cell leukemia, Hodgkin disease, and precursor B-cell lymphoblastic leukemia/lymphoblastic lymphoma within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.

References1. Szabo, SJ et al. Cell. 100(6):665-69, 2000.2. Zhang, WX et al. Genomics. 70(1):41-8, 2001.3. Johrens, K et al. Am J Surg Pathol. 31(8):1181-1185, 2007.4. Atayar, C et al. Am J Pathol. 166:127-134, 2005.

5. Dorfman, DM et al. Am J Clin Pathol. 122:292-297, 2004.6. Harashima, A et al. Leuk Res. 29(7):841-8, 2005. 7. Marafioti, T et al. Am J Pathol. 162:861-871, 2003.

TdT (Terminal Deoxynucleotidyl Transferase) (polyclonal)Catalog Number 760-2670Type Rabbit PolyclonalControl Tdt Positive Lymphomas, ThymusLocalization NuclearQuantity 50 tests

Thymus, cortical thymocytes

DescriptionAnti-Terminal Deoxynucleotidyl Transferase (TdT) antibody labels normal cortical thymocytes and primitive lymphocytes. Anti-TdT antibody detects an enzyme found in the nucleus of normal hematopoietic cells, normal cortical thymocytes and in the cytoplasm of megakaryocytes of the bone marrow. TdT expression is seen in over 90% of acute lymphoblastic lymphoma/leukemia cases with the exception of pre-B-cell ALL. TdT expression is not seen in normal mature T or B lymphocytes. Anti-TdT is positive for approximately one third of all cases of chronic myeloid leukemia, making it a good indicator of better response to chemotherapy.

References1. Elias JM, et al., TdT. A Practical Approach to Diagnosis, ASCP Press, Chicago 1990; 312-316.2. Arber DA, et al., Am.J Clin Pathol. 106(4):462-8, 1996.

3. Orazi A, et al., Mod Pathol. 7(5):582-6, 1994.4. Suzumiya J, et al., J Pathol. 182(1):86-91, 1997.

IHC_ISH | Primary Antibodies

122 Ventana Medical Systems, Inc. | 800.227.2155

Page 137: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Thymidine Phosphorylase (P-GF.44C)Catalog Number 790-4454Type Mouse MonoclonalControl Astrocytes in Normal Brain, Lymphocytes in SpleenLocalization Nuclear, CytoplasmicQuantity 50 testsIsotype IgG1

Breast carcinoma

DescriptionCONFIRM anti-Thymidine Phosphorylase (P-GF.44C) Mouse Monoclonal Primary Antibody recognizes human thymidine phosphorylase, an angiogenic factor, expressed in varying levels by macrophages, stromal cells, glial cells and some epithelial cells. Thymidine phosphorylase shows a cytoplasmic and/or nuclear location. This antibody exhibits a nuclear and/or cytoplasmic staining pattern and may be used to aid in the detection of thymidine phosphorylase in carcinoma of the breast, esophagus, stomach, colon and rectum, pancreas, head and neck, ovaries and lung.

References1. Fox SB, et al., Biochemistry. 20:3615-3621, 1981.2. Haraguchi M, et al., Biochem Pharmacol. 74:1555-1567, 2007.3. Desgranges C, et al., Biochem Biophys Acta. 654:211-218, 1981.

4. Yoshimura A, et al., Biochem Biophys Acta. 1034:107-113. 1990.5. De Bruin M, et al., Cancer Ther. 4:99-124, 2006.

Thyroglobulin (2H11+6E1)Catalog Number 760-2671Type Mouse MonoclonalControl ThyroidLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Follicular carcinoma of thyroid

DescriptionAnti-Thyroglobulin antibody reacts with human thyroglobulin as demonstrated by a single band of immunoblotting in a lysate of human thyroid tissue. The vast majority of follicular carcinomas of the thyroid will give positive immunoreactivity for thyroglobulin even though sometimes only focal. Poorly differentiated carcinomas of the thyroid are frequently thyroglobulin negative. Adenocarcinomas of other than thyroid origin do not react with this antibody.

References1. Bellet D, et al., J Clin Endocrin Metab. 56:530-533, 1983.2. Heffess CS, et al., Cancer. 95(9):1869-78, 2002.3. Bejarano PA, et al., Appl Immunohistochem Mol Morphol. 8(3): 189-94, 2000.

4. Judkins AR, et al., Hum Pathol. 30(11):1373-6, 1999.5. Hammer SP, et al., Hum Pathol. 29(12):1393-402, 1998.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 123

Page 138: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Thyroid Stimulating Hormone (TSH) (polyclonal)Catalog Number 760-2709Type Rabbit PolyclonalControl Normal PituitaryLocalization CytoplasmicQuantity 50 tests

Pituitary

DescriptionAnti-Thyroid Stimulating Hormone (TSH) is a useful marker in classification of pituitary tumors and the study of pituitary disease. It reacts with TSH-producing cells (thyrotrophs). TSH is a pituitary hormone of 28 kD, which stimulates thyroid growth and production of thyroid hormones.

References1. Batanero E, et al., Brain Behav Immun. 6(3):249-64, 1992.2. Kovalic JJ, et al., J Neurooncol. 16(3):227-32, 1993.3. Gessl A, et al., J Clin Endocrinol Metab. 79(4):1128-34, 1994.

4. Sanno N, et al., J Clin Endocrinol Metab. 80(8):2518-22, 1995.5. La Rosa S, et al., Virchows Arch. 437(3):264-9, 2000.

CONFIRM Thyroid Transcription Factor-1 (TTF-1) (8G7G3/1)Catalog Number 790-4398Type Mouse MonoclonalControl Lung Carcinoma, Lung, ThyroidLocalization NuclearQuantity 50 testsIsotype IgG1

DescriptionTTF-1 is a 38 kD nuclear protein member of the family of homeodomain transcription factors. Exclusive expression in epithelial cells of the thyroid gland and lung allows TTF-1 to be a useful antibody for the classification of tumors arising in these organs. In context with other data, TTF-1 becomes useful in the investigation of metastatic adenocarcinomas of an unknown origin. Antibody to TTF-1 demonstrates an intranuclear staining pattern, and normal thyroid gland follicle cells and lung parenchymal alveolar lining cells serve as excellent tissue internal controls.

References1. Dongfeng T, et al., Human Pathology. 34:597-604, 2003. 2. Ordonez N, American J of Surgical Pathol. 25:363-372, 2001.

IHC_ISH | Primary Antibodies

124 Ventana Medical Systems, Inc. | 800.227.2155

Page 139: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Topoisomerase IIa (JS5B4)Catalog Number 790-4371Type Rabbit MonoclonalControl Tonsil, SpleenLocalization NuclearQuantity 50 tests

Breast carcinoma

DescriptionCONFIRM anti-Topoisomerase IIα (JS5B4) Rabbit Monoclonal Primary Antibody is designed to qualitatively detect the presence of topoisomerase IIα expressing cells. During the cell cycle, topoisomerase IIα is expressed in the G1, S, G2, and M phase but is absent in the G0 (quiescent) phase. Assessment of the proportion of positive staining cells for topoisomerase IIα may aid in evaluation of the proliferative activity of normal and/or neoplastic tissue.

References1. Kreipe H, et al., AM J Pathol. 142:3-9, 1993.2. Rudolph P, et al., AM J Pathol. 147:1615-25, 1995.

3. Kreipe H, et al., AM J Pathol. 142:651-657, 1993.4. Kellner U, et al., J of Histochem and Cytochem. 45:251-264, 1997.

TRAcP (Tartrate-Resistant Acid Phosphatase) (9C5)Catalog Number 760-4275Type Mouse MonoclonalControl Hairy Cell LeukemiaLocalization CytoplasmicQuantity 50 testsIsotype IgG2b

Bone marrow

DescriptionThe histochemical identification of hairy cell leukemia via tartrate-resistant acid phosphatase assay has been a standard for over two decades. Anti-TRAcP antibody labels the cells of hairy cell leukemia (HCL) with a high degree of sensitivity and specificity. Other cells stained with this antibody are tissue macrophages and osteoclasts, which also express abundant TRAcP activity.

References1. Janckila AJ, et al., Blood. 85(10):2839-44, 1995.2. Yaziji H, et al., Am. J Clin Pathol. 104(4):397-402, 1995.3. Janckila AJ, et al., J Histochem Cytochem. 44(3):235-44, 1996.

4. Janckila AJ, et al., Hybridoma. 16(2):175-82, 1997.5. Hoyer JD, et al., Am J Clin Pathol. 108(3):308-15, 1997.6. Janckila AJ, et al., Biotech Histochem. 73(6):316-24, 1998.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 125

Page 140: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Tryptase (G3)Catalog Number 760-4276Type Mouse MonoclonalControl Mast Cell-Containing TissueLocalization CytoplasmicQuantity 50 testsIsotype IgG1

Cervix

DescriptionTryptases constitute a subfamily of trypsin-like proteinases, stored in the mast cell secretory granules and basophils. Upon cellular activation, these enzymes are released into the extracellular environment. Anti-tryptase is a good marker for mast cells, basophils, and their derivatives.

References1. Fiorucci L, et al., Cell Mol Life Sci. 61(11):1278-95, 2004.2. Li CY, et al., Leuk Res. 25(7):537-41, 2001.3. Jordan JH, et al., Hum Pathol. 32(5):545-52, 2001.

4. Gordon LK, et al., Clin Immunol. 94(1):42-50, 2000.5. Aoki M, et al., Int Arch Allergy Immunol. 130(3):216-23, 2003.

CONFIRM Tyrosinase (T311)Catalog Number 790-4365Type Mouse MonoclonalControl MelanomaLocalization CytoplasmicQuantity 50 testsIsotype IgG2a

Melanoma, with area showing normal melanoctyes

DescriptionTyrosinase is an enzyme involved in the production of melanin pigments. This enzyme catalyzes the formation of melanin within the cells and thus becomes a useful marker for the presence of melanocytes and melanosomes. As a marker of melanocytic lineage, tyrosinase is localized to melanocytes which can be found on the dermal/epidermal junction of normal skin, but is not detected in other normal cells. Expression of tyrosinase is also found in melanocytic lesions including benign nevi and the majority of primary and metastatic malignant melanomas, and not in non-melanocytic tumor types.

References1. Chen Y, et al., Proc Natl Acad Sci USA. 92:8125-8129, 1995.2. Jungbluth A, et al., Pathol Res Pract. 196:235-242, 2000.3. Clarkson K, et al., J Clin Pathol. 54:196-200, 2001.

4. Kwon B, J of Invest Dermatol. 100:134S-140S, 1993.5. Hofbauer G, et al., J Cutan Pathol. 25:204-209, 1998.

IHC_ISH | Primary Antibodies

126 Ventana Medical Systems, Inc. | 800.227.2155

Page 141: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Uroplakin III (SP73)Catalog Number 760-4533Type Rabbit MonoclonalControl BladderLocalization Membranous, CytoplasmicQuantity 50 testsIsotype IgG1

DescriptionUroplakins (UPs) are a family of transmembrane proteins (UPs Ia, Ib, II and III) that are specific differentiation products of urothelial cells. In non-neoplastic mammalian urothelium, UPs are expressed in the luminal surface plasmalemma of superficial (umbrella) cells, forming complexes of 16-nm crystalline particles. Moll, et al. reported that UPIII was detectable immunohistochemically in 29 of 55 primary (53%) and 23 of 35 metastatic (66%) urothelial carcinomas, whereas many non-urothelial carcinomas were UPIII-negative. The authors concluded that UPIII should be a valuable marker, especially for the specific identification of urothelial carcinomas in patients with metastases of unknown primary site.

References1. Angel CE, et al., Blood. 113:1257-67, 2009.2. Moll R et al., Am J Pathol. 147:1383-1397, 1995.

3. Olsburgh J, et al., J Pathol. 199: 41-49, 2003.4. Ohtsuka Y, et. al., BJU Int. 97:1322-6, 2006.

Villin (CWWB1)Catalog Number 760-4277Type Mouse MonoclonalControl Small Bowel Mucosa, Colonic MucosaLocalization Cytoplasmic, MembranousQuantity 50 testsIsotype IgG1

Colon

DescriptionVillin is a 95kD glycoprotein of microvilli associated with rootlet formation in gastrointestinal mucosal epithelium. Anti-Villin labels the brush border area in the gastrointestinal mucosal epithelium. This antibody has been useful in differentiating gastrointestinal adenocarcinoma, neuroendocrine carcinomas and ovarian adenocarcinomas from adenocarcinomas from other organs. Also labeled by this antibody are Merkel cells of the skin.

References1. Werling RW, et al., Am J Surg Path. 27(3):303-310, 2003.2. Tan J, et al., Hum Pathol. 29:390-396, 1998.3. Goldstein NS, et al., Am J Clin Pathol. 116:319-325, 2001.

4. Lau SK, et al., Hum Pathol. 33:1175-1181, 2002.5. Tamboli P, et al., Arch Pathol Lab Med. 126:1057-1063, 2002.6. Zhang PJ, et al., Arch Pathol Lab Med. 123:812-816, 1999.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 127

Page 142: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

CONFIRM Vimentin (V9)Catalog Number 790-2917Type Mouse MonoclonalControl Lymph Node, SkinLocalization CytoplasmicQuantity 50 testsIsotype IgG/K

Tonsil

DescriptionVimentin antigen is expressed in endothelial cells, fibroblasts, smooth muscle cells and lymphoid cells. A number of tumors co-express vimentin and cytokeratin, for example: thyroid carcinomas, pleomorphic adenomas of the salivary glands, ovarian carcinomas, and some renal carcinomas. Co-expression of desmin and vimentin has been reported in a number of soft tissue tumors, for example: rhabdomyosarcomas, leiomyosarcomas and alveolar soft tissue sarcomas.

References1. Sheibani K, et al., Am J Surg Pathol. 12(1): 28-34, 1988.2. Azumi N, et al., Am J Clin Pathol. 88(3): 286-296, 1987.3. Benjamin E, et al., J Pathol. 152(4): 253-263, 1987.

4. Miettinen M, et al., Arch Dermatol. 121(6): 736-741, 1985.5. Osborn M, et al., Eur J Cell Biol. 34(1): 137-143, 1984.

CONFIRM Vimentin (Vim 3B4)Catalog Number 760-2512Type Mouse MonoclonalControl Intestine, LiverLocalization CytoplasmicQuantity 50 testsIsotype IgG2a

Tonsil

DescriptionVimentin is the major and usually only intermediate filament in a variety of non muscle mesenchymal cells, including all fibroblastic cells, endothelial cells, lipocytes, Schwann cells and macrophages. The pattern of expression of intermediate filaments may be used as a device to aid in the classification of undifferentiated neoplasms. Vimentin is expressed in most malignant melanomas, either in the primary site or in metastatic foci.

References1. Weins B, Progen Biotechnik GmbH, Heidelberg, Germany, 1994.2. Azumi N, et al., Am J Clin Pathol. 88(3): 286 296, 1987.

3. True LD, J.B. Lippincott Company, Philadelphia. 1990.4. Taylor RT, et al., WB Saunders Company, Philadelphia. 1994.

IHC_ISH | Primary Antibodies

128 Ventana Medical Systems, Inc. | 800.227.2155

Page 143: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

WT1 (6F-H2)Catalog Number 760-4397Type Mouse MonoclonalControl Malignant Mesothelioma, Kidney, TesticleLocalization NuclearQuantity 50 testsIsotype IgG1/K

Mesothelioma

DescriptionWT1 is a suppressor gene located on chromosome 11p13. Wilms’ Tumor Protein (WT1) has been identified in proliferative mesothelial cells, malignant mesothelioma, ovarian cystadenocarcinoma, gonadoblastoma, nephroblastoma and desmoplastic small round cell tumor. Lung adenocarcinomas rarely stain positive with this antibody.

References1. Ordonez NG, Am J Surg Pathol. 24(4):598-606, 2000.2. Ordonez NG, Am J Surg Pathol. 22(11):1314-1327, 1998.3. Charles AK, et al., Histopathology. 30(4):312-4, 1997.4. Hussong J, et al., Mod Pathol. 10(11):1101-5, 1997.

5. Barnoud R, et al., Am J Surg Pathol. 24(6):830-6, 2000.6. Lucas DR, et al., Histopathology. 42(3):270-9, 2003.7. Jimenez RE, et al., Am J Surg Pathol. 26(3):320-7, 2002.8. Roberts F, et al., J Clin Pathol. 54(10):766-70, 2001.

ZAP-70 (2F3.2)Catalog Number 760-4278Type Mouse MonoclonalControl Chronic Lymphocytic Leukemia, Tonsil, Lymph NodeLocalization CytoplasmicQuantity 50 testsIsotype IgG2a

Chronic lymphocytic leukemia

DescriptionZAP-70 is a 70 kD protein tyrosine kinase found in T cells and natural killer cells. Control of this protein translation is via the IgVH gene. ZAP-70 protein is expressed in leukemic cells of approximately 25% of Chronic Lymphocytic Leukemia (CLL) cases as well. ZAP-70 expression is an excellent surrogate marker for the distinction between the Ig-mutated (ZAP-70 negative) and Ig-unmutated (ZAP-70 positive) CLL subtypes and can identify patient groups with divergent clinical courses. The ZAP-70 positive Ig-unmutated CLL cases have a poorer prognosis.

References1. Wiestner A, et al., Blood. 101(12):4944-4951, 2003.2. Crespo M, et al., N Eng J Med. 348(18):1764-1775, 2003.

3. Chen L, et al., Blood. 100(13):4609-14, 2002.

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 129

Page 144: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

We have partnered with Cell Marque Corporation to provide you with an extended menu of primary antibodies for immunohistochemistry. The table below identifies all of the antibodies that are manufactured by Cell Marque.

760-2604 α-1-Antichymotrypsin (ACT)760-2605 α-1-Antitrypsin (AAT)760-2603 α-Fetoprotein (AFP)760-2601 Actin, Muscle Specific760-2833 Actin, α-Smooth Muscle760-2708 Adrenocorticotrophin (ACTH)760-4435 Annexin A1760-2607 BCA-225760-4241 bcl-6760-4242 Beta-catenin760-4450 BG8, Lewisy

760-4593 BOB.1 (SP92)760-4522 C3d760-4436 C4d760-2610 CA 125760-2611 Calcitonin760-4375 Caldesmon760-4376 Calponin-1760-4525 CD1a760-4377 CD2760-4523 CD14760-4245 CD21 760-4438 CD21760-4439 CD25760-4378 CD31760-2620 CD34760-4279 CD45760-2624 CD45R760-4596 CD56 (MRQ-42)760-2626 CD57760-4249 CD61760-4379 CD63760-2628 CD74760-4248 CD-138 (Syndecan-1)760-4437 CD163760-4380 CDX-2760-4594 CEA (CEA31)760-2632 Collagen Type IV760-4254 COX-2 (Cyclooxygenase 2)760-2637 Cytokeratin 8 760-4344 Cytokeratin 8 & 18760-4251 Cytokeratin 14 760-4281 Cytokeratin 19760-4590 DOG1 (SP31)

760-4440 E-Cadherin760-4383 Ep-CAM (Epithelial Specific Antigen)760-2642 Factor VIII Related Antigen760-4384 Factor XIIIa760-4441 Factor XIIIa 760-2702 Fascin760-2710 FSH(Follicle Stimulating Hormone)760-4255 Follicular Dendritic Cell760-4256 Galectin-3760-2643 Gastrin760-4386 GCDFP-15760-4345 GFAP (Glial Fibrillary Acidic Protein)760-2644 Glucagon760-4526 GLUT-1760-4257 Glycophorin A760-4442 Glypican-3 760-4283 Granzyme B 760-2645 Helicobacter Pylori760-4597 HGAL (MRQ-49)760-4260 HHV-8 (Human Herpes Virus Type 8)760-4350 HSA (Hepatocyte Specific Antigen)760-2650 Human Chorionic Gonadotropin (hCG)760-2804 Human Growth Hormone (hGH)760-4443 Human Placental Lactogen (hPL)760-2652 IgA760-4444 IgD760-2653 IgG760-2654 IgM760-2834 Inhibin alpha760-2655 Insulin760-4387 Ksp-Cadherin760-2802 Luteinizing Hormone (LH)760-2656 Lysozyme760-2657 Macrophage760-4263 Mammaglobin760-4527 Melanoma Associated Antigen760-4528 Melanoma Associated Antigen760-4445 Mesothelial Cell 760-4264 MLH1760-4265 MSH2760-4388 MUC2760-4389 MUC5AC760-4390 MUC6760-4529 MUM1

IHC_ISH | Primary Antibodies

130 Ventana Medical Systems, Inc. | 800.227.2155

Page 145: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

760-2658 Myelin Basic Protein760-2659 Myeloperoxidase760-2832 Myogenin760-2660 Myoglobin760-2704 Myosin, Smooth Muscle760-4446 Napsin A760-2661 Neurofilament760-4391 NGFR760-2662 NSE (Neuron Specific Enolase) 760-4447 Oct-2760-4392 Oct-4760-4453 p21WAF1

760-4268 p27kip1

760-4532 Parathyroid Hormone (PTH)760-4393 PAX-2 760-4448 PD-1760-4394 Perforin760-4591 Phosphohistone-H3 (PHH3)760-4434 PGP 9.5760-2664 Placental Alkaline Phosphotase (PLAP)760-4531 PMS2760-4395 Podoplanin760-2803 Prolactin760-4271 PSA (Prostate Specific Antigen)760-4272 PSAP (Prostatic Acid Phosphatase)760-4273 Renal Cell Carcinoma (RCC)760-4592 Smoothelin (R4A)760-2667 Somatostatin760-4274 Spectrin760-4595 Synaptophysin (MRQ-40)760-2669 TAG-72760-4598 T-bet (MRQ-46)760-2670 TDT (Terminal Deoxynucleotidyl Transferase)760-2671 Thyroglobulin760-2709 Thyroid Stimulating Hormone (TSH)760-4275 TRAcP (Tartrate-Resistant Acid Phosphatase)760-4276 Tryptase760-4533 Uroplakin III760-4277 Villin760-4397 WT1760-4278 ZAP-70

Primary Antibodies | IHC_ISH

800.227.2155 | www.ventana.com 131

Page 146: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Spring BioScience antibodies

Spring BioScience, a wholly owned subsidiary of Ventana Medical Systems, Inc., a member of the Roche Group, is driven to build essential tools for cancer researchers so that tomorrow’s patients may benefit from today’s innovations. Founded in 2001 by a team of scientists, Spring BioScience achieved early success with their line of SP clone rabbit monoclonal antibodies for immmunohistochemistry. Today, Spring BioScience serves an important role as an antibody center of excellence in Roche’s mission to deliver companion diagnostics. The Spring BioScience product offering leverages our collective medical/market intelligence to serve the cancer research community.The table below represents top research use only antibodies offered by Spring. For a complete listing and to order Spring Bioscience products, please visit www.springbio.com or call 925.474.8440.

Name Catalog #, 0.1 ml size Catalog #, 1.0 ml size Species TypeBAX M3470 M3474 Rabbit MonoclonalCalpain M3810 M3814 Rabbit MonoclonalCaveolin-1 M3430 M3434 Rabbit MonoclonalCD278/ICOS M3980 M3984 Rabbit MonoclonalCD3 M3070 M3074 Rabbit MonoclonalCD31 M3380 M3384 Rabbit MonoclonalClaudin-1 E3410 E3414 Rabbit PolyclonalDystrophin E2660 E2664 Rabbit PolyclonalF4/80 M4150 M4154 Rabbit MonoclonalGLUT-1 E13810 E13814 Mouse MonoclonalIKAROS M4080 M4084 Rabbit MonoclonalJ-chain M4050 M4054 Rabbit MonoclonalKi-67 M3060 M3064 Rabbit MonoclonalNestin M4030 M4034 Rabbit MonoclonalSLIT2 M4220 M4224 Rabbit MonoclonalSOX-2 M3760 M3764 Rabbit MonoclonalStathmin M3490 M3494 Rabbit MonoclonalSyntaxin 1A M3360 M3364 Rabbit MonoclonalVimentin M3200 M3204 Rabbit Monoclonal

IHC_ISH | Spring BioScience

132 Ventana Medical Systems, Inc. | 800.227.2155

Page 147: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The products that appear on this page are IVD (for in vitro diagnostic use).

Spring BioScience | IHC_ISH

800.227.2155 | www.ventana.com 133

Page 148: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

DISCOVERY Detection Chemistries

Blue

Red

DAB

Sensitivity

Low High

DISCOVERY detection chemistries vary in sensitivity, giving you the flexibility to choose the detection that meets your research needs. *Stained images are LMO2 on tonsil.

DABMap OmniMap HRP

RedMap

BlueMap

UltraMap HRP

UltraMap Red

UltraMap Blue

DISCOVERY Amp HQ

DISCOVERY Amp HQ

DISCOVERY Amp HQ

IHC_ISH | DISCOVERY Detection Chemistries

134 Ventana Medical Systems, Inc. | 800.227.2155

Page 149: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Multimer detection

Our innovative multimer technology consists of highly specific secondary antibodies directly joined to powerful enzymes with long-arm linkers using a patented, controlled conjugation and purification process. The biotin-free design and robust chemistry provides clean background with enhanced sensitivity and dynamic range, increasing the signal-to-noise ratio. The compact size of the molecule enables diffusion through tissues promoting access to targeted binding sites. The conjugate design preserves the highly specific activity of the enzyme.

Secondary antibody

Enzyme

Linkers Multimer moleculeThe long arm linkers attach enzymes directly to the secondary antibodies. The smaller multimer molecule minimizes steric hindrance and improves sensitivity while biotin-free chemistry eliminates endogenous biotin staining.

DISCOVERY Detection Chemistries | IHC_ISH

800.227.2155 | www.ventana.com 135

Page 150: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

UltraMap DAB anti-MsCatalog Number 760-152Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of UltraMap anti-MS HRP 760-4313

ChromoMap DAB 760-159

Hif1 apha (mouse monoclonal) on mouse xenograft using UltraMap DAB anti-Ms

DescriptionThe UltraMap DAB anti-Mouse is a biotin-free detection system that uses an HRP-multimer for the detection of an antibody raised in mouse. The brown staining is obtained by the enzymatic reaction between HRP and DAB contained in the kit. This detection kit can be used for IHC. Note: This product may also be used for ISH on the DISCOVERY ULTRA.

UltraMap DAB anti-RbCatalog Number 760-151Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of UltraMap anti-Rb HRP 760-4315

ChromoMap DAB 760-159

pERk (rabbit polyclonal) on human skin using UltraMap DAB anti-Rb

DescriptionThe UltraMap DAB anti-Rabbit is a biotin-free detection system that uses an HRP-multimer for the detection of an antibody raised in rabbit. The brown staining is obtained by the enzymatic reaction between HRP and DAB /H2O2 contained in the kit. This detection kit can be used for IHC. Note: This product may also be used for ISH on the DISCOVERY ULTRA.

UltraMap DAB anti-RatCatalog Number 760-160Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of UltraMap anti-Rat HRP 760-4456

ChromoMap DAB 760-159

F4-80 on mouse spleen using UltraMap DAB anti-Rat

DescriptionThe UltraMap DAB anti-Rat is a biotin-free detection system that uses an HRP-multimer for the detection of an antibody raised in mouse. The brown staining is obtained by the enzymatic reaction between HRP and DAB / H2O2 contained in the kit. This detection kit can be used for IHC. Note: This product may also be used for ISH on the DISCOVERY ULTRA.

IHC_ISH | DISCOVERY Detection Chemistries

136 Ventana Medical Systems, Inc. | 800.227.2155

UltraMap Multimer Detection Kits

Page 151: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

UltraMap Red anti-MsCatalog Number 760-154Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of UltraMap anti-Ms Alk- Phos 760-4312

ChromoMap Red 760-160

pKCß2 on human tonsil (mouse, clone PK-B26) with UltraMapRed anti-Ms and pHH3 (Rabbit polyclonal) withUltraMap DAB anti-Rb

DescriptionThe UltraMap Red anti-Mouse is a biotin-free detection system that uses an AP-multimer for the detection of an antibody raised in mouse. The red staining is obtained by the reaction between AP and Naphtol/Fast Red contained in the kit. This detection kit can be used for IHC and ISH.

UltraMap Red anti-RbCatalog Number 760-153Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of UltraMap anti-Rb Alk- Phos 760-4314

ChromoMap Red 760-160

p27 KIP1 (rabbit polyclonal) on human colon using UltraMap Red anti-Rb

DescriptionThe UltraMap Red anti-Rabbit is a biotin-free detection system that uses an AP-multimer for the detection of an antibody raised in rabbit. The red staining is obtained by the reaction between AP and Naphtol/Fast Red contained in the kit. This detection kit can be used forIHC and ISH.

UltraMap Blue anti-MsCatalog Number 760-156Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of UltraMap anti-Ms Alk- Phos 760-4312

ChromoMap Blue 760-161

DescriptionThe UltraMap Blue anti-Mouse is a biotin-free detection system that uses an AP-multimer for the detection of an antibody raised in mouse. The blue staining is obtained by the reaction between AP and NBT/BCIP contained in the kit. This detection kit can be used for IHC and ISH.

DISCOVERY Detection Chemistries | IHC_ISH

800.227.2155 | www.ventana.com 137

Page 152: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

UltraMap Blue anti-RbCatalog Number 760-155Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of UltraMap anti-Rb Alk- Phos 760-4314

ChromoMap Blue 760-161

VEGF anti-sense probe on mouse kidney using UltraMap Blue anti-Rb

DescriptionThe UltraMap Blue anti-Rabbit is a biotin-free detection system that uses an AP-multimer for the detection of an antibody raised in rabbit. The blue staining is obtained by the reaction between AP and NBT/BCIP contained in the kit. This detection kit can be used for IHC and ISH.

OmniMap Peroxidase Multimer detection kitsOmniMap DAB anti-Mouse (Ms)Catalog Number 760-150Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of OmniMap anti-Ms HRP 760-4310

ChromoMap DAB 760-159

Hif1 alpha (mouse monoclonal) on mouse xenograft using OmniMap DAB anti-Ms

DescriptionThe OmniMap DAB anti-Mouse is a biotin-free detection system that uses an HRP-multimer for the detection of an antibody raised in mouse. The brown staining is obtained by the enzymatic reaction between HRP and DAB / H2O2 contained in the kit. This detection kit can be used for IHC. Note: This product may also be used for ISH on the enzymatic ULTRA.

OmniMap DAB anti-Rabbit (Rb)Catalog Number 760-149Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of OmniMap anti-Rb HRP 760-4311

ChromoMap DAB 760-159

pERK (rabbit polyclonal) on human skin using OmniMap DAB anti-Rb

DescriptionThe OmniMap DAB anti-Rabbit is a biotin-free detection system that uses an HRP-multimer for the detection of an antibody raised in rabbit. The brown staining is obtained by the enzymatic reaction between HRP and DAB / H2O2 contained in the kit. This detection kit can be used for IHC. Note: This product may also be used for ISH on the DISCOVERY ULTRA.

IHC_ISH | DISCOVERY Detection Chemistries

138 Ventana Medical Systems, Inc. | 800.227.2155

Page 153: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

DISCOVERY detection kits are composed of a conjugate and a chromogen. The following lists the conjugates and compatible chromogen(s). Items can be purchased separately but must be used together to achieve desired staining results.

Conjugate Compatible chromogenOmniMap anti-Ms HRP 760-4310 ChromoMap DAB 760-159

OmniMap anti-Rb HRP 760-4311 ChromoMap DAB 760-159

OmniMap anti-Rat HRP 760-4457 ChromoMap DAB 760-159

UltraMap anti-Ms HRP 760-4313 ChromoMap DAB 760-159

UltraMap anti-Rb HRP 760-4315 ChromoMap DAB 760-159

UltraMap anti-Rat HRP 760-4456 ChromoMap DAB 760-159

UltraMap anti-Goat HRP 760-4648 ChromoMap DAB 760-159

UltraMap anti-Ms Alk-Phos 760-4312 ChromoMap Red or ChromoMap Blue 760-160 or 760-161

UltraMap anti-Rb Alk-Phos 760-4314 ChromoMap Red or ChromoMap Blue 760-160 or 760-161

UltraMap Goat anti-Rb and Goat anti-Ms Alk-Phos Cocktail* 760-4498 ChromoMap Red or ChromoMap Blue 760-160 or 760-161

OmniMap DAB anti-RatCatalog Number 760-157Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 testsComposed of OmniMap anti-Rat HRP 760-4457

ChromoMap Blue 760-159

F480 in mouse spleen using OmniMap DAB anti-Rt

DescriptionThe OmniMap ant-Rat is a biotin-free detection system that uses an HRP multimer for the detection of an antibody raised in rat. The brown staining is obtained by the enzymatic reaction between HRP and DAB / H2O2 contained in the kit. This detection can be used for IHC. Note: This product may also be used for ISH on the DISCOVERY ULTRA.

* UltraMap goat anti-Rb and goat anti-Ms Alk-Phos Cocktail contains goat anti-Rabbit IgG and Goat anti-Mouse IgG. This is an IgM free product.

DISCOVERY Detection Chemistries | IHC_ISH

800.227.2155 | www.ventana.com 139

Page 154: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Streptavidin-biotin detection

The Ventana streptavidin technology allows for the sensitive and specific detection of the cellular target. The DABMap Detection Kit incorporates conjugated streptavidin HRP technology, while RedMap and BlueMap kits incorporate conjugated streptavidin alkaline phosphatase technology. All three detection kits allow for your choice of biotinylated secondary antibody to combine with either DAB, red (Naphthol/Fast Red) or blue (NBT/BCIP) chromogen. A biotinylated goat anti-rabbit or a universal anti-rabbit and anti-mouse secondary is also available for use with these kits.

DABMap Kit (streptavidin horseradish peroxidase detection kit)Catalog Number 760-124Status For Research Use Only. Not for use in diagnostic procedures.Quantity 250 tests

pEGFR (phospho EGFR) on xenograft using DABMap

DescriptionThe DABMap kit relies on the interaction between the HRP/SA complex and a biotinylated antibody, and the subsequent reaction with DAB to produce a brown staining. This detection kit can be used for IHC and ISH.

RedMap Kit (streptavidin alkaline phosphatase detection kit)Catalog Number 760-120Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 tests

Muscle Actin using RedMap and Keratin using DAB Map on human stomach

DescriptionThe RedMap kit relies on the interaction between the AP/SA complex and a biotinylated antibody, and the subsequent reaction with Naphtol/Fast Red to produce a red staining. This detection kit can be used for IHC and ISH.

IHC_ISH | DISCOVERY Detection Chemistries

140 Ventana Medical Systems, Inc. | 800.227.2155

Page 155: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

BlueMap Kit (streptavidin alkaline phosphatase detection kit)Catalog Number 760-120Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 tests

Delta 1 anti-sense probe on chicken embryo using BlueMap Kit

DescriptionThe BlueMap kit relies on the interaction between the AP/SA complex and a biotinylated antibody, and the subsequent reaction with NBT/BCIP to produce a blue staining. This detection kit can be used for IHC and ISH.

Secondary antibodies for use with Avidin Biotin Detection kits:

DISCOVERY Biotinylated Rabbit Secondary AntibodyCatalog Number 760-4507Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 tests

Description Biotinylated goat anti-rabbit lgG in a protein block for use with detection kits.

DISCOVERY Universal Secondary AntibodyCatalog Number 760-4205Status For Research Use Only. Not for use in diagnostic procedures.Quantity 125 tests

DescriptionBiotinylated goat anti-rabbit lgG cocktailed with goat anti-mouse in a protein block for use with detection kits.

DISCOVERY Detection Chemistries | IHC_ISH

800.227.2155 | www.ventana.com 141

Page 156: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

DISCOVERY Amp HQ

DISCOVERY Amp HQ is a novel detection kit specifically intended for low-expressing gene targets or low-abundance proteins. This proprietary amplification method deposits the VENTANA HQ hapten directly at a successfully identified target site, creating a crisp, strong signal. The HQ hapten is not endogenously occurring within human, mouse, or rat tissue, thus dramatically reducing any cross-reactivity and background staining.

DISCOVERY Amp HQ KitCatalog Number 760-052Status For Research Use Only. Not for use in diagnostic procedures.Quantity 50 testsComponents Amplification HQ, PO Inhibitor, H2O2

Description

Enzyme-based target detection amplification detection kit utilizing our proprietary HQ hapten technology. The DISCOVERY Amp HQ kit, in conjunction with 1) an anti-HQ Multimer, 2) an OmniMap or UltraMap HRP Multimer, and 3) a chromogenic detection kit, enables the enhancement of the chromogenic signal in standard immunohistochemistry (IHC) and in situ hybridization (ISH) protocols.

DISCOVERY anti-HQ Alk-Phos MultimerCatalog Number 760-4521Status For Research Use Only. Not for use in diagnostic procedures.Quantity 50 tests

Description

Mouse anti-HQ Alkaline Phosphatase Multimer provides signal amplification without loss of resolution. In conjunction with 1) the DISCOVERY Amp HQ Kit, 2) an OmniMap or UltraMap HRP Multimer, and 3) a chromogenic detection kit, the DISCOVERY anti-HQ AP Multimer provides the ability to enhance the chromogenic signal in standard immunohistochemistry (IHC) and in situ hybridization (ISH) protocols.

DISCOVERY anti-HQ HRP MultimerCatalog Number 760-4602 Status For Research Use Only. Not for use in diagnostic procedures.Quantity 50 tests

Description

Mouse anti-HQ Horseradish Peroxidase (HRP) Multimer provides signal amplification without loss of resolution. In conjunction with 1) the DISCOVERY Amp HQ kit, 2) an OmniMap or UltraMap HRP Multimer, and 3) a chromogenic detection kit, DISCOVERY anti-HQ HRP Multimer provides the ability to enhance the chromogenic signal in standard immunohistochemistry (IHC) and in situ hybridization (ISH) protocols.

IHC_ISH | DISCOVERY Detection Chemistries

142 Ventana Medical Systems, Inc. | 800.227.2155

Page 157: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Primary antibody

Tissue

OmniMap HRP

HQ HQ

HRP

HRP

HRP

1. Primary antibody binds to target antigen in tissue

Mouse anti-HQ-AP or Mouse anti-HQ-HRP

2. Peroxidase inhibitor is applied to reduce endogenous peroxidase activity

3. OmniMap anti-species multimer molecule conjugated to HRP binds to primary antibody

4. Tyramide molecule conjugated to novel, proprietary HQ hapten reacts with HRP and H2O2 at target site, covalently bonding tyramide to tissue

5. Mouse anti-HQ antibody conjugated to enzyme binds to HQ

HQ +H2O2

ENZ

ENZ

ENZEnzyme (AP or HRP)

ChromoMap substrate

ENZ

ENZ

ENZ

DISCOVERY Detection Chemistries | IHC_ISH

800.227.2155 | www.ventana.com 143

Page 158: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Quantum Dot Detection

Quantum dots bring nanotechnology and life sciences together to create novel applications in fluorescent labeling. Available in wavelengths ranging from ultra-violet to near infra-red, Qdot® Nanocrystals (Life Technologies, Corp.) allow the visualization of multiplexed biomarkers. In histochemistry, entire pathways may be profiled for biomarker expression using Quantum dot technology while preserving the correct anatomical context. Applications may be developed for immunohistochemistry assays.

VENTANA QD Map fluorescent detection kits are designed for sensitive, stable antigen localization in cytological preparations, frozen sections, or formalin-fixed, paraffin-embedded tissue sections.

QD Map 605 SA-25Catalog Number 760-4176Status For Research Use Only. Not for use in diagnostic procedures.Quantity 25 testsMay be used with QD DAPI 760-4196

QD Link 760-143

Ig Kappa (#760-2514) shown in green using QD Map 605 SA-25 and Ig Lambda (#760-2515) shown in red using QD Map 655 SA-25 on a human tonsil. Nuclei stain blue using QD DAPI counterstain.

DescriptionThe QD Map 605 SA-25 kit consists of a Quantum Dot 605/streptavidin complex used for the fluorescent detection (emission wavelength : 605 nm) of a biotinylated antibody. This kit is dedicated to IHC applications on DISCOVERY series systems.

QD Map 655 SA-25Catalog Number 760-4178Status For Research Use Only. Not for use in diagnostic procedures.Quantity 25 testsMay be used with QD DAPI 760-4196

QD Link 760-143

HER-2 shown in magenta using QD Map 65 5 SA-25 and p53 shown in blue using QD Map 605 SA-25 on human breast carcinoma

DescriptionThe QD Map 655 SA-25 kit consists of a Quantum Dot 655/streptavidin complex used for the fluorescent detection (emission wavelength : 655 nm) of a biotinylated antibody. This kit is dedicated to IHC applications on DISCOVERY series systems.

IHC_ISH | DISCOVERY Detection Chemistries

144 Ventana Medical Systems, Inc. | 800.227.2155

Page 159: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Bulk solutions

ProductCatalog Number Description Quantity

DISCOVERY EZ Prep(10x)

950-100 Concentrated solution that, when diluted ten-fold, is used for paraffin removal from tissue samples during immunohistochemistry reactions. The working solution is also used as a non-buffered diluent to dilute 2x SSC during stringency washes during in situ hybridization reactions carried out on DISCOVERY series systems. For Research Use Only. Not for use in diagnostic procedures.

2L bottle

Liquid Coverslip(High Temperature)

650-010 Ready-to-use coverslip solution used as a barrier between the aqueous reagents and the air, preventing evaporation, thereby providing a stable aqueous environment for the immunohistochemistry or in situ hybridization reactions carried out on the DISCOVERY series systems.

2L bottle

RiboWash (10x) 950-110 Used in SSC container of DISCOVERY series systems. For Research Use Only. Not for use in diagnostic procedures.

2L bottle

Reaction Buffer(10x)

950-300 Concentrated buffered solution used to rinse slides between staining steps and to provide a stable aqueous environment for the immunohistochemistry reactions carried out on the DISCOVERY series systems.

2L bottle

DISCOVERY Cell Conditioning 1 (CC1)

950-500 Ready-to-use, pre-diluted solution used as a pretreatment step in the processing of tissue samples for immunohistochemistry reactions carried out on the DISCOVERY series systems. DISCOVERY CC1 is a tris-based buffer with a slightly basic pH, which, at elevated temperatures is capable of hydrolyzing the covalent bonds formed by formalin in tissue. Removing these bonds allows renaturation of protein molecules and increases antibody accessibility. Often these changes result in significant gains in antibody binding and improved signal to noise ratios. The formulation contains an inert Nanoparticle additive which creates a more hydrophilic surface to decrease the risk of attached bubbles and non-staining events. For Research Use Only. Not for use in diagnostic procedures.

2L bottle

RiboCC 760-107 Ready-to-use, pre-diluted solution used as a pretreatment step in the processing oftissue samples for immunohistochemistry reactions carried out on the DISCOVERYseries systems. Ribo CC is a Citrate-based buffer with a slightly acidic pH, which, atelevated temperatures is capable of hydrolyzing the covalent bonds formed byformalin in tissue. Removing these bonds allows renaturation of protein moleculesand increases antibody accessibility. Often these changes result in significant gainsin antibody binding and improved signal to noise ratios. For Research Use Only. Not for use in diagnostic procedures.

1L bottle

Ancillary and Bulks

Ancillary and Bulks | IHC_ISH

800.227.2155 | www.ventana.com 145

Page 160: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Blockers

ProductCatalog Number Description Quantity

Endogenous Biotin Blocking Kit

760-050 May be used to aid in the reduction of non-specific staining caused by endogenous biotin present in cells and tissues. Blocker A specifically binds to endogenous biotin present in the tissue; Blocker B saturates the remaining binding sites of the egg white avidin in Blocker A, thus reducing the non-specific staining. For use with the DISCOVERY series systems. Components: Blocker A, Blocker B.

250 tests

Antibody Block 760-4204 High ionic strength protein blocking solution for reduction of background. For Research Use Only. Not for use in diagnostic procedures.

250 tests

S-Block 760-4212 Normal serum cocktail of goat, sheep, and donkey used to block non-specific binding of primary and/or secondary antibodies. For Research Use Only. Not for use in diagnostic procedures.

250 tests

Hybridization buffers

ProductCatalog Number Description Quantity

ChipMap Hybe 760-103 Hybridization solution for microarrays. For Research Use Only. Not for use in diagnostic procedures.

30ML bottle

RiboHybe 760-104 The RiboHybe is a stringent hybridization buffer used for the dilution of the probe and / or pre-hybridization for ISH applications on the DISCOVERY series systems. For Research Use Only. Not for use in diagnostic procedures.

30ML bottle

ChipMap Hybe 80 760-127 Hybridization solution for microarrays. For Research Use Only. Not for use in diagnostic procedures.

30ML bottle

Enzymes

ProductCatalog Number Description Quantity

Protease 1 760-2018 Ready-to-use endopeptidase (alkaline protease) of the serine protease family and cleaves antigens (proteins) in the tissue section, allowing primary antibodies to recognize and bind epitope(s). The reagent is intended for enzymatic digestion of sections of formalin-fixed, paraffin-embedded tissue. With 0.5 units/ml alkaline protease enzyme activity, Protease 1 is our strongest enzymatic pretreatment available for immunohistochemistry (IHC) or in situ hybridization (ISH). For use with the DISCOVERY series systems. Single, ready-to-use dispenser.

250 tests

Protease 2 760-2019 Ready-to-use endopeptidase (alkaline protease) of the serine protease family and cleaves antigens (proteins) in the tissue section, allowing primary antibodies to recognize and bind epitope(s). The reagent is intended for enzymatic digestion of sections of formalin-fixed, paraffin-embedded tissue. With 0.1 units/ml alkaline protease enzyme activity, Protease 2 is our intermediate-strength enzymatic pretreatment available for immunohistochemistry (IHC) or in situ hybridization (ISH). For use with DISCOVERY series systems. Single, ready-to-use dispenser.

250 tests

Protease 3 760-2020 Ready-to-use endopeptidase (alkaline protease) of the serine protease family and cleaves antigens (proteins) in the tissue section, allowing primary antibodies to recognize and bind epitope(s). The reagent is intended for enzymatic digestion of sections of formalin-fixed, paraffin-embedded tissue. With 0.02 units/ml alkaline protease enzyme activity, Protease 3 is our mildest enzymatic pretreatment available for immunohistochemistry (IHC) or in situ hybridization (ISH). For use with the DISCOVERY series systems. Single, ready-to-use dispenser.

250 tests

IHC_ISH | Ancillary and Bulks

146 Ventana Medical Systems, Inc. | 800.227.2155

Page 161: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Application kits

ProductCatalog Number Description Quantity

RiboMap Kit 760-102 The RiboMap kit has been developed for the optimization of staining with ISH applications on the DISCOVERY series systems and can be used for the dilution of probe and / or pre-hybridization. This kit contains solutions that reduce the background, enhance the signal and improve the morphology of the tissue. For Research Use Only. Not for use in diagnostic procedures.

125 Tests

ChipMap Kit 760-210 The ability to spread buffer uniformly over the entire surface of an array is key for automation of the hybridization reaction on a glass slide. The pretreatment reagent ChipMap Prep 1 prepares the surface of the array. When used in combination with the ChipMap Prep 2 kit and the specially formulated hybridization buffer ChipHybe, uniform coverage of the labeled target array surface is ensured. In addition, the combined use of these reagents provides a reduction of nonspecific binding, resulting in improved signal. Automation of the hybridization process on the DISCOVERY series of instruments reduces slide-to-slide variation, decreases time of hybridization, and increases the signal-to-noise ratio. Optimization reagents for DNA or oligo microarray applications on DISCOVERY series systems. For Research Use Only. Not for use in diagnostic procedures.

100 Tests

Composed of:

ChipMap Prep 1 760-4121 The ChipMap Prep 1 kit provides a pretreatment reagent for hybridization of a labeled target to DNA microarrays printed on glass slides using the VENTANA DISCOVERY series of instruments. For Research Use Only. Not for use in diagnostic procedures.

ChipMap Prep 2 760-4122 The ChipMap Prep 2 kit provides a pretreatment reagent for hybridization of a labeled target to DNA microarrays printed on glass slides using the VENTANA DISCOVERY series of instruments. For Research Use Only. Not for use in diagnostic procedures.

ChipMap Clean 760-4123 The ChipMap Clean kit provides a cleaning reagent for post-hybridization of a labeled target to DNA microarrays printed on glass slides using the VENTANA DISCOVERY series of instruments. For Research Use Only. Not for use in diagnostic procedures.

ChipMap Hybe 80 760-103 Hybridization solution for microarrays. For Research Use Only. Not for use in diagnostic procedures.

Antibody diluents

ProductCatalog Number Description Quantity

Antibody Dilution Buffer

ADB250 Antibody Dilution Buffer contains phosphate buffered saline and stabilizing protein and is intended to stabilize diluted antibodies when stored at 2° - 8° C; ready-to-use. For Research Use Only. Not for use in diagnostic procedures.

250ML bottle

DISCOVERY Antibody Diluent

760-108 Tris based diluent for titration and usage of antibodies. For Research Use Only. Not for use in diagnostic procedures.

100ML bottle

PSS Diluent 760-212 Tris based diluent for titration of antibodies, including phospho site specific antibodies. For Research Use Only. Not for use in diagnostic procedures.

100ML bottle

Ancillary and Bulks | IHC_ISH

800.227.2155 | www.ventana.com 147

Page 162: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

ProductCatalog Number Description Quantity

ChipMap 80 Kit 760-210 The ability to spread buffer uniformly over the entire surface of an array is key for automation of the hybridization reaction on a glass slide. The pretreatment reagent ChipMap Prep 1 prepares the surface of the array. When used in combination with the ChipMap Prep 2 kit and the specially formulated hybridization buffer ChipMap Hybe80 (with a different formamide and NaCl concentration than ChipMap Hybe), uniform coverage of the labeled target array surface is ensured. In addition, the combined use of these reagents provides a reduction of nonspecific binding, resulting in improved signal. Automation of the hybridization process on the DISCOVERY series of instruments reduces slide-to-slide variation, decreases time of hybridization, and increases the signal-to-noise ratio. Optimization reagents for DNA or oligo microarray applications on DISCOVERY series systems.

100 Tests

Composed of:

ChipMap Prep 1 760-4121 For Research Use Only. Not for use in diagnostic procedures.

ChipMap Prep 2 760-4122 The ChipMap Prep 2 kit provides a pretreatment reagent for hybridization of a labeled target to DNA microarrays printed on glass slides using the Ventana DISCOVERY series of instruments. For Research Use Only. Not for use in diagnostic procedures.

ChipMap Clean 760-4123 For Research Use Only. Not for use in diagnostic procedures.

ChipMap Hybe 80 760-103 Hybridization solution for microarrays. Different formamide and NaCl concentration than ChipHybe. For Research Use Only. Not for use in diagnostic procedures.

MoMap Kit 760-137 The MoMap Kit assists with use of mouse monoclonal antibodies on mouse tissue or xenograft tissue. The kit uses a blocking system that increases the specificity of the secondary antibody anti-mouse for the primary antibody and decreases the background usually observed. This kit works with the biotin-based detection kit (DABMap, RedMap, BlueMap) in IHC and ISH. For Research Use Only. Not for use in diagnostic procedures.

Components Solution A (biotinylated anti-mouse antibody), Solution B (Non-immune mouse immunoglobulin)

125 Tests

Universal Secondary Antibody

760-4205 Biotinylated Ig cocktail of goat anti-mouse IgG, goat anti-mouse IgM, goat anti-rabbit IgG, and protein block. For Research Use Only. Not for use in diagnostic procedures.

250 Tests

Biotinylated Rabbit Secondary Antibody

760-4507 Biotinylated goat anti-rabbit lgG in a protein block for use with detection kits. For Research Use Only. Not for use in diagnostic procedures.

250 Tests

Application kits (continued)

Amplification

ProductCatalog Number Description Quantity

Amplification HQ Kit 760-052 Enzyme-based target detection amplification detection kit utilizing our proprietary HQ hapten technology. The DISCOVERY Amp HQ kit, in conjunction with 1) an anti-HQ Multimer, 2) an OmniMap or UltraMap HRP Multimer, and 3) a chromogenic detection kit, enables the enhancement of the chromogenic signal in standard immunohistochemistry (IHC) and in situ hybridization (ISH) protocols. For Research Use Only. Not for use in diagnostic procedures.

50 Tests

Anti-HQ AP Multimer 760-4521 Mouse anti-HQ Alkaline Phosphatase Multimer provides signal amplification without loss of resolution. In conjunction with 1) the DISCOVERY Amp HQ Kit, 2) an OmniMap or UltraMap HRP Multimer, and 3) a chromogenic detection kit, the DISCOVERY anti-HQ AP Multimer provides the ability to enhance the chromogenic signal in standard immunohistochemistry (IHC) and in situ hybridization (ISH) protocols. For Research Use Only. Not for use in diagnostic procedures.

50 Tests

IHC_ISH | Ancillary and Bulks

148 Ventana Medical Systems, Inc. | 800.227.2155

Page 163: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Counterstains

ProductCatalog Number Description Quantity

Hematoxylin 760-2021 A modified Gill’s hematoxylin intended for staining cellular nuclei on slides containing cells from frozen tissue, formalin fixed and paraffine embedded tissue, or cytologic preparations. Single, ready-to-use dispenser.

250 Tests

Hematoxylin II 760-2208 A modified Mayer’s hematoxylin intended for staining cellular nuclei on slides containing cells from frozen tissue, formalin fixed and paraffine embedded tissue, or cytologic preparations. Single, ready-to-use dispenser.

250 Tests

Bluing Reagent 760-2037 Ready-to-use solution that can be applied after hematoxylin to change the hue of hematoxylin to a blue color. Single, ready-to-use dispenser.

250 Tests

ISH Red Counterstain 780-2186 ISH Red Counterstain provides pink background staining in nuclei and cytoplasm of tissue sections or cytological preparations, which is intended to aid microscopic bright field observation for chromogenic in situ hybridization (ISH) reactions. Store at room temperature.

200 Tests

Red Counterstain II 780-2218 Red Counterstain II provides pink background staining in nuclei and cytoplasm of formalin-fixed, paraffin-embedded tissue sections, which is intended to aid microscopic bright field observation for chromogenic in situ hybridization. Store at 2° - 8° C.

100 Tests

QD DAPI 760-4196 DAPI counterstain kit designed automated immunoflourescent for nuclear staining of cytological preparations, frozen sections, or formaldehyde-fixed, paraffin-embedded, tissue sections. For use with the DISCOVERY series systems. For Research Use Only. Not for use in diagnostic procedures.

125 Tests

Amplification (continued)

ProductCatalog Number Description Quantity

Anti-HQ HRP Multimer 760-4602 Mouse anti-HQ Horseradish Peroxidase (HRP) Multimer provides signal amplification without loss of resolution. In conjunction with 1) the DISCOVERY Amp HQ kit, 2) an OmniMap or UltraMap HRP Multimer, and 3) a chromogenic detection kit, DISCOVERY anti-HQ HRP Multimer provides the ability to enhance the chromogenic signal in standard immunohistochemistry (IHC) and in situ hybridization (ISH) protocols. For Research Use Only. Not for use in diagnostic procedures.

50 Tests

Amplification Kit 760-080 May be used in conjunction with VENTANA IHC detection kits to increase the signal intensity of weak staining mouse and rabbit primary antibodies. Reagents are provided pre-diluted and ready-to-use. For in vitro diagnostic use. Components: Amplifier A, Amplifier B

100 Tests

AmpMap with TSA 760-121 The AmpMap kit is a multiple steps amplification system that relies on the use of tyramide. This kit enhances the staining obtained with the biotin-based detection kits (DABMap, RedMap, BlueMap) in IHC and ISH. For use on the DISCOVERY series systems. For Research Use Only. Not for use in diagnostic procedures. Components: PO Block, SA-HRP, TSA Block, TSA DNP, TSA H2O2, Anti-DNP, Anti-Rb Biotin

50 Tests

Ancillary and Bulks | IHC_ISH

800.227.2155 | www.ventana.com 149

Page 164: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

OverviewThe Closed Loop Assay Development (CLAD) process for IHC empowers the user to optimize development protocols based on crisp morphology, signal intensity and high signal-to-noise ratio. This allows for consistent and reproducible results for both routine and complex projects. It can serve as a guideline for optimizing DISCOVERY staining protocols.

Round 1Round 1 consists of the morphology-pretreatment test using the following pretreatments: no pretreatment, pretreatment 1, standard CC1, or standard RiboCC.

Round 2Round 2 consists of signal intensity Test A and signal intensity Test B. The control is with no primary antibody with decreased multimer incubation time.

Round 3In Round 3 the user completes either signal amplification or increases signal-to-noise ratio using blockers, depending on the weak signal or the best protocol.

The CLAD Processfor IHC

IHC_ISH | The CLAD Process

150 Ventana Medical Systems, Inc. | 800.227.2155

Page 165: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

NOTE: For mouse on mouse use rabbit anti-Ms antibody (rabbit monoclonal lgG pan 12a3 Fc) to bridge between the mouse primary antibody and the anti-Rb multimer. If you need a first antibody from source different to mouse or rabbit we recommend to use a bridge antibody created in rabbit to be used with anti-Rb multimer. Round 2 and 3 can be inverted and/or run in parallel.

Round 1The morphology-pretreatment test

Enzyme: Protease 1-4 minutesNo pretreatment Standard CC1 Standard RiboCC

Standard protocol:Primary Antibody: 60 minutes diluted in antibody diluent or PSS diluent, OmniMap anti-Ms HRP Detection Kit or OmniMap anti-Rb HRP Detection Kit, 16 minutes of multimer incubation time, ChromoMap DAB Detection Kit

Round 2Signal intensity test A - to increase signalIncrease Primary Antibody concentrationIncrease Primary Antibody incubation (up to 6 hours). Use a more aggressive pretreatment (if morphology was good)

Signal intensity test BDecrease Primary Antibody concentrationDecrease Primary Antibody incubation (16-32 minutes)Use a more gentle pretreatment such as CC1 Mild (if morphology appears compromised)Use a more aggressive pretreatment (if morphology was good but signal weak)Run a control with no primary antibody

Round 3Signal amplificationUse UltraMap DAB Detection Kit, UltraMap Red Detection Kit, UltraMap Blue Detection Kit (start with 32 minutes substrate incubation for UltraMap Blue Detection Kit ONLY)

Increase signal to noise ratioUse blockers (S block, antibody block), protein block

Morphology-pretreatment test

Signal intensity

test B

Signal amplification

Increasesignal

to noise ratio

Signal with background?

Results satisfactory?Complete save protocol

Start from beginning with new first

antibody

best protocol (signal-background-morpho)

weak signal

no

high background

best protocolsignal is weak or absent

Signal intensity test A

yes

The CLAD Process | IHC_ISH

800.227.2155 | www.ventana.com 151

Page 166: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

152 Ventana Medical Systems, Inc. | 800.227.2155

Page 167: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Molecular Probes |

800.227.2155 | www.ventana.com 153

Page 168: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

INFORM HER2 Dual ISH DNA Probe Cocktail IHC ISH Catalog Number 780-4422Quantity 50 testStatus FDA approvedComponents ultraView SISH DNP Detection Kit

ultraView Red ISH DIG Detection KitHybReadyHER2 Dual ISH 3-in-1 Xenograft Slides

DescriptionVENTANA INFORM HER2 Dual ISH DNA Probe Cocktail is intended to determine HER2 gene status by enumeration of the ratio of the HER2 gene to Chromosome 17. The HER2 and Chromosome 17 probes are detected using two color chromogenic in situ hybridization (ISH) in formalin-fixed, paraffin-embedded human breast cancer tissue specimens following staining on VENTANA BenchMark XT automated slide stainer (using NexES software), by light microscopy. The INFORM HER2 Dual ISH DNA Probe Cocktail is indicated as an aid in the assessment of patients for whom Herceptin (trastuzumab) treatment is being considered.

This product should be interpreted by a qualified reader in conjunction with histological examination, relevant clinical information, and proper controls. For in vitro diagnostic use.

HER2 clusters and Chr17 60X, amplified HER2 and Chr17 60X, non-amplified

References1. Gschwind A, Fischer OM, Ullrich A. The discovery of receptor tyrosine kinases: target for cancer therapy. Nat Rev Cancer 2004;4;361-370. 2. Muleris M, et al. Assignment of v-erb-b2 avian erythroblastic leukemic viral oncogene homolog 2 (ERBB2) to human chromosome band 17121.1 by in situ hybridization. Cytogenet Cell Genet. 1997;76:34-5. 3. Coussens L, Yang-Feng TL, Liao YC, Chen E, Gray A, McGrath J, et al. Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science. 1985;230:1132-1139. 4. Slamon DJ, Godolphin W, Jones LA, et al. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science. 1989;244:707-712. 5. Slamon DJ, Clark GM, Wong SG, et al. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 1987;235:177-182.

6. Narita M, Nakao K, Ogino N, et al. Independent prognostic factors in breast cancer patients. Am J Surg 1998;175:73-75. 7. O’Reilly SM, Barnes DM, Camplejohn RS, et al. The relationship between c-erbB-2 expression, S-phase fraction, and prognosis in breast cancer. Br J Cancer. 1991;63:444-446. 8. Pegram MD, Finn RS, Arzoo K, et al. The effect of HER-2/neu overexpression on chemotherapeutic drug sensitivity in human breast and ovarian cancer cells. Oncogene. 1997;15:537-547. 9. Press MF, Pike MC, Chazin VR, et al. HER-2/neu expression in node-negative breast cancer: Direct tissue quantitation by computerized image analysis and association of overexpression with increased risk of recurrent disease. Cancer Res. 1993;53:4960-4970.

MOLECULAR PROBES

154 Ventana Medical Systems, Inc. | 800.227.2155

Page 169: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

INFORM HER2 DNA ProbeCatalog Number 760-4332Status ASR (analyte specific reagent)Size One 10 mL dispenser of INFORM HER2 DNA Probe contains approximately 10 μg/mL of the HER2 probe labeled

with DNP and formulated with human placental blocking DNA in an approximately 50% formamide-based diluent.

DescriptionINFORM HER2 DNA Probe hybridizes to the HER2 gene which is located on chromosome 17 (17q11.2-q2) and encodes the HER2 protein

INFORM Chromosome 17 ProbeCatalog Number 760-4331Status ASR (analyte specific reagent)Size One 10 mL dispenser of INFORM Chromosome 17 Probe contains approximately 2 μg/mL of the Chromosome

17 probe labeled with dinitrophenol (DNP), formulated in an approximately 50% formamide-based diluent.

DescriptionINFORM Chromosome 17 Probe is a 42 base-pair synthetic oligonucleotide that hybridizes to a repetitive DNA sequence that is located within multiple regions of the chromosome 17 centromere

Kappa DNP Probe (495-524)Catalog Number 760-1201Status ASR (analyte specific reagent)Size One container of 3 mL Kappa DNP Probe (495-524), ASR contains approximately 3.2 μg/mL of the probe diluted

in a buffer containing approximately 50% formamide.

DescriptionKappa DNP Probe (495-524), ASR is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’UGCCUCUGUUGUGUGCCUGCUGAAUAACUU 3’

Kappa DNP Probe (538-567)Catalog Number 760-1202Status ASR (analyte specific reagent)Size One container of 3 mL Kappa DNP Probe (538-567), ASR contains approximately 3.2 µg/mL of the probe

diluted in a buffer containing approximately 50% formamide.

DescriptionKappa DNP Probe (538-567), ASR is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’GCCAAAGUACAGUGGAAGGUGGAUAACGCC3’

Kappa DNP Probe (597-626)Catalog Number 760-1203Status ASR (analyte specific reagent)Size One container of 3 mL Kappa DNP Probe (597-626), ASR contains approximately 3.2 μg/mL of the probe

diluted in a buffer containing approximately 50% formamide.

DescriptionKappa DNP Probe (597-626), ASR is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’CACAGAGCAGGACAGCAAGGACAGCACCUA3’

Kappa DNP Probe (637-666)Catalog Number 760-1204Status ASR (analyte specific reagent)Size One container of 3 mL Kappa DNP Probe (637-666), ASR contains approximately 3.2 μg/mL of the probe

diluted in a buffer containing approximately 50% formamide.

DescriptionKappa DNP Probe (637-666), ASR is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’AGCACCCUGACGCUGAGCAAAGCAGACUAC3’

MOLECULAR PROBES

800.227.2155 | www.ventana.com 155

Page 170: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Lambda DNP Probe (664-693)Catalog Number 760-1205Status ASR (analyte specific reagent)Size One container of 3 mL Lambda DNP Probe (664-693), ASR contains approximately 3.2 μg/mL of the probe

diluted in a buffer containing approximately 50% formamide.

DescriptionLambda DNP Probe (664-693), ASR is designed to bind to Lambda light chain mRNA. The probe sequenced is complementary to the Lambda mRNA sequence: 5’CACAGAAGCUACAGCUGCCAGGUCACGCAU3’

Lambda DNP Probe (704-733)Catalog Number 760-1206Status ASR (analyte specific reagent)Size One container of 3 mL Lambda DNP Probe (704-733), ASR contains approximately 3.2 μg/mL of the probe

diluted in a buffer containing approximately 50% formamide.

DescriptionLambda DNP Probe (704-733), ASR is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’CCGUGGAGAAGACAGUGGCCCCUACAGAAU3’

Lambda DNP Probe (768-797)Catalog Number 760-1207Status ASR (analyte specific reagent)Size One container of 3 mL Lambda DNP Probe (768-797), ASR contains approximately 3.2 μg/mL of the probe

diluted in a buffer containing approximately 50% formamide.

DescriptionLambda DNP Probe (768-797), ASR is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’GAGACUAGAGCUGCAGGAUCCCAGGGGAGG3’

Lambda DNP Probe (826-855)Catalog Number 760-1208Status ASR (analyte specific reagent)Size One container of 3 mL Lambda DNP Probe (826-855), ASR contains approximately 3.2 μg/mL of the probe

diluted in a buffer containing approximately 50% formamide.

DescriptionLambda DNP Probe (826-855), ASR is designed to bind to Lambda light chain mRNA. The probe is complementary to the Lambda mRNA sequence: 5’GCCCUUCUCCCUGCACUCAAUAAACCCUCA3’

EBER 1 DNP ProbeCatalog Number 760-1209Status ASR (analyte specific reagent)Size One container of 4 mL EBER 1 DNP Probe, ASR contains approximately 0.8 μg/mL of the probe diluted in a

buffer containing 50% formamide.

DescriptionEBER 1 DNP Probe, ASR is designed to bind to Epstein-Barr Virus- Encoded RNA 1 (EBER 1).

U6 DNP ProbeCatalog Number 760-1210

Status ASR (analyte specific reagent)Size One container of 4 mL U6 DNP Probe, ASR contains approximately 0.05 μg/mL of the probe diluted in a buffer

containing 50% formamide.

DescriptionU6 DNP Probe, ASR is designed to bind to U6 small nuclear RNA.

MOLECULAR PROBES

156 Ventana Medical Systems, Inc. | 800.227.2155

Page 171: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

The VENTANA Customer Support Organization is always ready to assist you with your instrumentation and help you keep your lab running at optimal performance.

• Over 120 Customer Support experts across North America• More than 4100 instruments at top labs nationwide• 75% remote fix rate• 8.4 (out of 10) customer satisfaction rating• 2007, 2008, 2009 winner of Ace Annual Customer Satisfaction Award for world

class performance

1 800 227 2155

Questions?Concerns? We’ve got you covered

Ads.indd 2 6/27/11 2:09 PM

MOLECULAR PROBES

Page 172: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

158 Ventana Medical Systems, Inc. | 800.227.2155

Page 173: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

H&E |SYMPHONY fully automated H&E system 161

800.227.2155 | www.ventana.com 159

Page 174: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

160 Ventana Medical Systems, Inc. | 800.227.2155

Page 175: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

SYMPHONYhigh-definition H&E system

Optimize lean H&E process opportunities with the integration of multiple steps…from drying through coverslipping. The SYMPHONY system improves histology lab productivity through one-touch H&E slide processing. Slides are simply loaded onto the system and when the automated process is complete, stained and coverslipped slides are ready for immediate presentation to the pathologist.The SYMPHONY system integrates the best innovations in automation with the highest standard in novel reagents. SYMPHONY reduces the variables that compromise results in non-standardized H&E preparation methods, empowering you to consistently produce exceptional slides from all of your mission-critical sites.

H&E common problems The SYMPHONY solution

Manual intervention Integrated drying through coverslippingWalk-away automation, including coverslipping, ensures that finished slides are ready for immediate presentation to the pathologist.

Staining variability Reproducible results Individual and standardized slide processing with fresh reagents result in a highly reproducible slide.

Basic morphology Exceptional visual discriminationSYMPHONY reagents enable exceptional visual discrimination of micro-anatomic detail, not consistently visible with ordinary H&E methods.

Lab-to-lab variability Global standardizationEvery slide is processed in a standardized manner accommodating harmonization of protocols from sites around the world.

Reagent degradation Consistent reagent qualityFresh reagents are individually applied to each slide, eliminating the degradation in stain quality associated with the dilution and contamination of bulk reagents over time.

Sample misidentification/lost slides Individual slide identification and trackingThe SYMPHONY bar code reader tracks each slide through every stage of SYMPHONY automation, allowing instant slide status.

Extraneous tissue Cross contamination protectionEach slide is individually processed, from drying through coverslipping, minimizing the potential of tissue floating from one slide to another.

Coverslip degradation Image quality glass coverslipsHigh image-quality glass coverslips with standardized application by the SYMPHONY OPTISURE glass coverslipper ensures the visual integrity of each slide and optimal tissue preservation in archive.

SYMPHONY | H&E

800.227.2155 | www.ventana.com 161

Page 176: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

SMaLL BOwEL

Crisp visualization of brush border in rat small bowel

SPLEEN

Increased contrast in rat spleen

TONguE

Highlighting of keratohyaline granules in rat tongue papillae

Standard H&E SYMPHONY HD H&E

KIDNEY

Enhanced visualization of brush border in rat proximal convoluted tubules

H&E | SYMPHONY

162 Ventana Medical Systems, Inc. | 800.227.2155

Page 177: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Specifications

general characteristicsCapability • Provides continuous loading of up to 500 slides at a time with throughput of approximately 160-200

slides per hour. Universal Slide tray holds up to 20 individual slides and can be stacked or “nested” for pathologist review “Slide Detect” ID—slide tracking supporting multiple bar code formats

• Simultaneous processing of multiple slide trays including drying, de-paraffinization, staining and coverslipping

Reagents • All SYMPHONY solutions are sealed, pre-packaged, ready-to-use and monitored with RFID for inventory management SYMPHONY solutions can be changed “on the fly” without process interruption

DI water supply • NCCLS type II or type III DI water quality flow of greater than 22 oz/min (650 ml/min) while maintaining a dynamic pressure of greater than 18.9 psi static pressure to 30 psi

Communication • Standard category 5, RJ 45 network port, located within 14' (426 cm) of the left side of instrument Network port with TCP/IP ports 80 and 443 open

Configuration • Free standing

Certifications • CSA (C and US indicators), EMC, CE, and C-TICK compliant

Catalog number • 900-SYM3 (North America/3 stainer)

unique features• Slides are glass cover-slipped for optimum image quality• CareGiver remote support—an automated remote monitoring and diagnostics solution that enables continuous monitoring and remote

service for SYMPHONY instruments• Fresh solutions are used for each slide, resulting in consistent and reproducible results

Environmental requirementsVentilation • The facility ventilation duct should be 3" (7.62 cm) in diameter and be located between 1' and 15' (31 cm

to 457 cm) of instrument. The ventilation flow specification must be a minimum of 35 cfm and a maximum of 70 cfm

Liquid waste disposal • Location of drain must be within 15' (457 cm) of right side of instrument and not exceed 3' (91 cm) in height

Electrical specifications• Dedicated/isolated 20-amp circuit • 230 ± 10% volts nominal AC, 50/60 Hz - NEMA 6-20R standard receptacle

Physical characteristicsSpace requirements • Recommended width is greater than 98" (249 cm). This will allow doors to open 180 degrees

• Height must be greater than 86" (219 cm); (off casters, leveled, and ventilated) • Depth must be greater than 51.5" (131 cm); this is spaced 5" from wall• Instrument physical dimensions (H x W x D): 74" x 49" x 28" (188 cm x 125 cm x 72 cm)

SYMPHONY | H&E

800.227.2155 | www.ventana.com 163

Page 178: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Ordering information

Product Part number Description QuantitySYMPHONY Staining System

900-SYM3 SYMPHONY Tray KitSYMPHONY Accessory KitVENTANA Printer SystemSYMPHONY Vent Kit

900-301900-302750-005900-303

SYMPHONY Install Slide KitCable, USSBCable, Ethernet

170700022183012218400

1

SYMPHONY Cleaning Kit

900-217 Used for cleaning SYMPHONY N2+ lines. 1 kit

SYMPHONY OPTISURE Coverslips

900-221 Specialized glass coverslips applied following the staining and dehydration steps of the SYMPHONY staining process to provide enhanced optical clarity and archivability to stained tissue sections. OPTISURE coverslips have a dry mounting medium pre-applied and are packaged in cassettes that are loaded onto the SYMPHONY System.

12 casettes of 120 for 1440

SYMPHONY tray kit 900-301 Replacement trays; each tray accommodates 20 slides. 5 trays

SYMPHONY Desiccant Filter

2094800 Removes moisture from air, creating optimal humidity within the coverslipping module.

1 filter

SYMPHONY N1 900-201 Intended for staining nuclei and other basophilic cell structures purple to dark purple; used for progressive staining.

1000ml/box,3 boxes (1 pack)

SYMPHONY C 900-202 Intended for staining cytoplasmic and other non-nuclear components varying shades of red to pink providing excellent differentiation between collagen, smooth muscle, and other eosinophilic structures.

1000ml/box,6 boxes (1 pack)

SYMPHONY W 900-203 Wash solution used in rinsing steps that occur between aqueous applications during the staining process.

1000ml/box,6 boxes (1 pack)

SYMPHONY B 900-204 This solution intended to be used as a bluing reagent. When used in conjunction with SYMPHONY N1 and N2+, SYMPHONY B will change the hue of nuclear staining from purple to blue.

1000ml/box,6 boxes (1 pack)

SYMPHONY N2+ 900-213 Intended for staining nuclei and other basophilic cell structures dark purple to black; used for progressive and regressive staining.

1000ml/box,3 boxes (1 pack)

SYMPHONY Clear 900-209 Xylene-free solution used for the deparaffinization and clearing of tissue sections during the staining process.

2000ml/bottle,6 bottles

SYMPHONY D 900-210 Used for the differentiation of nuclear components stained with SYMPHONY N2+ in regressive staining protocols.

1000ml/box,6 boxes (1 pack)

H&E | SYMPHONY

164 Ventana Medical Systems, Inc. | 800.227.2155

Page 179: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Special Stains |NexES Special Stains system 167

Special stains 170Ancillary reagents 182

800.227.2155 | www.ventana.com 165

Page 180: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

SpEciAl StAiNS

166 Ventana Medical Systems, Inc. | 800.227.2155

Page 181: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

NexESSpecial Stains system

The NexES Special Stains system is the market leader in its class, enhancing performance for labs nation-wide for more than a decade. Labs everywhere trust the NexES Special Stains system to keep their staining process productive, consistent, and safe. Now, new features give you reliable results plus greater staining flexibility. This, in addition to a broad menu of complex and routine and special stains, gives you the power to create greater efficiencies.

What’s on YOUR mind?i need faster turnaround times and greater efficiency.• Deploy walk-away automation• Eliminate time wasted on manual reagent preparation

with ready-to-use reagent kits• improve workflow by freeing your most experienced

techs for value-added tasks• count on pre-programmed protocol options to get

you up and running quickly and keep you operating efficiently week after week

i need to provide consistent, high-quality stains.• choose your optimal incubation time and counter-stain

options for many stains• Select alternate temperature batch mode operation, to

improve clarity and workflow for many stains• Eliminate variability from tech to tech with quality-

controlled reagents• customize and save your best protocols from a menu

of options

i need to mitigate risk and preserve safety in my lab• Reduce technician exposure to harmful chemicals• Ensure correct results with quality-controlled

reagent kits

NexES | SpEciAl StAiNS

800.227.2155 | www.ventana.com 167

Page 182: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Specifications

General characteristicsCapability • special stains slide processing

Slide carousel • 1–20 slides

Reagent carousel • 25 reagent positions

Slides • 25 x 75 mm, 1 x 3 inches, or 26 x 76 mm Superfrost plus

Bulk solutions • 2 bulk solutions

DI water supply • NcclS type ii water or equivalent (referred to as deionized water)

Temperature control • 37°c–70°c

Modularity • 1–8 NexES Special Stains systems may be controlled from one pc

Configuration • Bench mounted with 20 liter waste bottle

Certifications • cSA and cE compliant

Catalog Number • N750-NXSS-FS

Environmental requirementsBTU output • 1700 BtU

Room temperature • 15° c to 30° c (59° F to 86° F). Note: the instrument may be unable to maintain proper reaction temperature if laboratory ambient temperature exceeds the specified maximum temperature.

Humidity • 5% to 95%, noncondensing

Location • Flat, level surface. Remove from sources of direct heat and moisture. Bulk fluid module can be placed up to three feet above or below staining module.

Electrical specificationsVoltage • 120 VAc ± 10%

Current • 8 amps

Frequency • 60 Hz

Staining module • SM #850-000

Bulk Fluid module • BFM #850-001

Physical characteristics Staining module (SM) Bulk fluid module (BFM) Size (W x D x H) • 16" x 20" x 13.5"

• (40.5 cm x 51 cm x 34 cm)• 13.5" x 14.5" x 13.5" • (34 cm x 37 cm x 34 cm)

Weight • 40 lbs. (18 kg) • 30 lbs. (13.6 kg)

Clearances • top 15" (38.1 cm)• Sides 4" (10.2 cm)• Rear 6" (15.2 cm)

SpEciAl StAiNS | NexES

168 Ventana Medical Systems, Inc. | 800.227.2155

Page 183: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Ordering information

Product Part number DescriptionNexES Special Stains N750-NXSS-FS NexES Special Stains full system — 110v, 60Hz. For US and canada only.Full system control module

MonitorHp printerStaining moduleBulk fluidics moduleAccessory kitpower strip

750-002750-006750-005850-000850-001750-Acc753-000

E-bar ii bar code slide label systemslide labeling system kit packReagent trayWaste container with sealed capWaster container with vapor trap and open capGraduated carboy (20l)

16328001418702182690012008001200802

1196700

NexES Special Stains N750-NXSS-M NexES Special Stains module — 110v, 60Hz. For US and canada only.Add-on module(s) Staining module

Bulk fluidics moduleAccessory kitpower strip

850-700850-001750-Acc753-000

Reagent tray — special stainsWaste container with vapor trapAnd open capGraduated carboy (20l)

18269001200802

1196700

Heavy metal extraction system

860-104 Heavy metal extraction system

Vapor extraction filter 860-101 Vapor extraction filter

Waste container with sealed cap

1200800 Waste container with sealed cap

Reagent tray 1826900 Reagent tray

E-Bar ii bar code slide 1632800 E-Bar electronic bar code labelling and printing system - printer 110v/60Hz.label system cable, parallel interface

power cord (us/can)power cord (intl)printer ribbon, e-barHead cleaning pen

13471001490500149010016329001490000

insert sheet, quick setupinsert sheet, ordering informationE-bar mylar shield (5 shields/pkg)power supplyE-bar label kit

14904001490300182900014902001418702

labels 1358501 1 rolls of 500 labels.

E-Bar label kit 1418702 5 rolls of 500 labels and 5 mylar shields. printer ribbon not included.

E-Bar mylar shields 1829000 5 shields/package.

NexES | SpEciAl StAiNS

800.227.2155 | www.ventana.com 169

Page 184: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Special StainsStains for mucins

PAS Staining KitCatalog Number 860-014Type pAS with HematoxylinControl liverComponents/Storage periodic Acid

NeutralizerHematoxylin counterstainSchiff’s Reagent (3 vials)

2º-30º c2º-30º c2º-30º c2º-8º c

Quantity 75 testsNote: Open only one Schiff’s Reagent vial at a time. Each vial is stable for ONE month after opening.

DescriptionpAS Staining Kit is used to demonstrate the presence of glycogen in tissue. pAS-positive reticular fibers, basement membrane, fungus and neutral mucopolysaccharides are also detected. pAS Staining Kit may also be used to aid in distinguishing a pAS-positive, secreting adenocarcinoma from undifferentiated pAS-negative squamous cell carcinoma. pAS Staining Kit uses periodic Acid to oxidize glycols to aldehydes. Schiff’s Reagent forms a colorless dialdehyde compound that is transformed to the colored final staining of glycol-containing cellular components. pAS staining in tissue sections and digestion with diastase is useful as an aid in the diagnosis of glycogen storage disease. the pAS Staining Kit stains glycogen bright magenta, with cell nuclei staining light purple.

Protocol(s)Name Application timepAS / HpAS H-Dark (optional)

Standard pAS protocol with Hematoxylin counterstainStains basement membrane darker

36 min40 min

Diastase KitCatalog Number 860-004Type Diastase for pASControl liverComponents/Storage Diastase 2º-8º cQuantity 75 tests

Note: this is not a stand-alone reagent; it must be used in conjunction with pAS Staining Kit.

DescriptionDiastase is an enzyme which selectively digests (breaks down) glycogen. it is used to remove glycogen from tissue. this produces “negative pAS” staining of the glycogen. Any remaining pAS staining after diastase digestion must be due to non-glycogen protein-bound neutral polysaccharides, such as mucin or fungus. Diastase for pAS is an accessory reagent that is used with the pAS Staining Kit to A) identify glycogen with certainty, by its removal and/or B) eliminate it from the tissue section when it is interfering with the identification of other pAS-positive tissue structures. Because the glycogen is removed, the magenta staining is absent, but the nuclei still stain light purple with the Hematoxylin counterstain.

Protocol(s)Name Application timepAS / D-lgpAS / D-ShpAS / D Xlng

long diastase clearance (16 min)Short diastase clearance (8 min)Extra long diastase clearance (32 min)

60 min52 min72 min

SpEciAl StAiNS | Special Stains

170 Ventana Medical Systems, Inc. | 800.227.2155

Page 185: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Light Green for PASCatalog Number 860-010Type pAS/light GreenControl liverComponents/Storage light Green counterstain 15º-30º cQuantity 75 tests

Note: this is not a stand-alone reagent; it must be used in conjunction with pAS Staining Kit.

Descriptionlight Green for pAS is an accessory reagent that is used with the pAS Staining Kit. in conjunction with the pAS Staining Kit, fungal elements stain magenta against a light green background.

Protocol(s)Name Application timepAS / lGpAS / H ltGrn

pAS with light Green counterstainpAS with Hematoxylin and light Green counterstains

36 min40 min

Alcian Blue for PASCatalog Number 860-003Type pAS/Alcian BlueControl colonComponents/Storage Alcian Blue Stain 15º-30º cQuantity 75 tests

Note: this is not a stand-alone reagent; it must be used in conjunction with pAS Staining Kit.

DescriptionAlcian Blue for pAS is an accessory reagent that is used with the pAS Staining Kit. in conjunction with the pAS Staining Kit, Acid mucin stains bright blue, while neutral polysaccharides stain bright magenta.

Protocol(s)Name Application timepAS / ABpAS / H AlcBlupAS/lt. H Alc Bw

pAS — Alcian Blue stainingpAS — Alcian Blue staining with Hematoxylin counterstainpAS — Alcian Blue with lt Hematoxylin counterstain

44 min48 min44 min

Special Stains | SpEciAl StAiNS

800.227.2155 | www.ventana.com 171

Page 186: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Alcian Blue Staining KitCatalog Number 860-002Control colonComponents/Storage Alcian Blue Stain

NFR counterstain15º-30º c15º-30º c

Quantity 75 tests

DescriptionAlcian Blue Staining Kit demonstrates weakly acidic mucopolysaccharides. At pH 2.5, Alcian Blue stains sulfated mucins, usually epithelial in origin (and usually pAS-negative), with some occurrences in connective tissue, e.g. in subcutaneous tissue in thyroid deficiency, (myxedema) and in myxomas. it also stains carboxylated sialomucins, found in the mucins of submaxillary glands, small intestine and upper colon, and sulfated and carboxylated acid mucopolysaccharides. Some examples of components that stain positive with alcian blue are goblet cells, hyaluronic acid (found in umbilical cord and connective tissue in dermis), salivary glands, and gastric lining cells. Alcian Blue (pH 2.5) may be helpful in detecting genetic disorders of acid mucosubstance metabolism and collagen diseases where various acid mucosubstances are increased. the presence of acid mucosubstances tends to decline with advancing age.

Protocol(s)Name Application timeAB (2.5)AB Dark

Standard Alcian Blue protocolAlcian Blue with darker counterstain

32 min32 min

Mucicarmine Staining KitCatalog Number 860-011Control BowelComponents/Storage iron Hematoxylin A

iron Hematoxylin Btartrazine counterstainMucicarmine Stain

2º-30º c2º-30º c2º-30º c2º-8º c

Quantity 75 tests

DescriptionMucicarmine Staining Kit is used to detect acid mucopolysaccharides (mucin). Mucin is a secretion of acid mucopolysaccharides and other substances produced by a variety of epithelial and connective tissue cells. in certain inflammatory processes and certain intestinal carcinomas, epithelial cells secrete excess mucin. Mucicarmine Staining Kit detects mucins of epithelial origin. Fibroblastic or connective tissue mucins may stain poorly. the purpose of this stain is primarily to determine the site of a primary tumor or to distinguish undifferentiated mucin-negative squamous cell lesions from mucin-positive adenocarcinomas. As is the case with current manual stains, mucicarmine stain may not be appropriate for detection of metastatic cancers of the stomach. the stain may also be used as an aid in the identification of cryptococcus neoformans, a pathogenic fungus containing mucin in its capsule. carmine and aluminum mordant combine to stain the epithelial mucin a deep rose to red color. Although the mechanism is not completely understood, it is believed that the aluminum forms a chelate complex with carmine by dye-lake formation, to produce a net positive charge. the complex then attaches to the acid groups of the mucin. tartrazine counterstain is applied to provide a contrasting yellow background. Mucin stains deep rose. cell nuclei stain black. Other tissue elements stain yellow from the counterstain. the capsule of cryptococcus neoformans stains dark red.

Protocol(s)Name Application timeMuciMuci DarkMuci lt cS

Standard Mucicarmine protocolDarker Mucicarmine stainMucicarmine with lighter counterstain

35 min52 min36 min

SpEciAl StAiNS | Special Stains

172 Ventana Medical Systems, Inc. | 800.227.2155

Page 187: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Stains for connective tissue:Elastic, Jones, Jones light Green, trichrome ii Blue, trichrome iii Blue, trichrome iii Green, Reticulum ii

Elastic Staining KitCatalog Number 860-005Type Elastic (Modified Hart’s)Control Kidney, lung, SkinComponents/Storage Elastic clarifier

DecolorizerOxidizerElastic tissue StainVan Gieson Solution

15º-30º c15º-30º c15º-30º c15º-30º c15º-30º c

Quantity 75 tests

DescriptionElastic Staining Kit demonstrates elastic fibers in tissue sections. Elastic Staining Kit is a modification of Hart’s method for elastic fibers. A resorcin-fuchsin solution is used to stain elastic fibers dark blue or purple to black. collagen appears pink to red. Van Gieson’s Solution is applied to provide contrasting yellow background tissue. this stain is useful in demonstrating atrophy of elastic tissue in cases of emphysema, and the thinning and loss of elastic fibers in arteriosclerosis and other vascular diseases. in normal aorta, a majority of the tissue is elastic and stains dark blue to purple. in kidney, the renal arteries will stain dark blue to purple, while the cortex will stain pink to red. in lung, the pulmonary artery and bronchial walls contain elastin and will stain dark blue to purple. Under high power, the alveoli also demonstrate an intricate meshwork of elastic fibers. the Elastic Staining Kit stains elastic fibers in tissue dark blue-purple against a yellow background. collagen in the tissue appears pink to red.

Protocol(s)Name Application timeElastic Standard Elastic protocol 40 min

Jones H&E Staining KitCatalog Number 860-019Type Jones H&E (Hematoxylin and Eosin counterstains)Control KidneyComponents/Storage Jones toner

Jones FixerJones HematoxylinJones EosinJones periodic AcidJones Silver AJones Silver B

2º-30º c2º-30º c2º-30º c2º-30º c2º-8º c2º-8º c2º-8º c

Quantity 40 tests

DescriptionJones Staining Kit demonstrates capillary basement membrane and is a modification of Jones Methanamine Silver procedure. Methanamine in this stain is used to demonstrate the carbohydrate component of basement membrane. periodic acid is used to oxidize carbohydrates to aldehyde groups. Jones Silver A, a silver nitrate solution, provides the silver ions. Jones Silver B provides the alkaline conditions that reduce the silver ions to metallic silver. toner reagent contains gold chloride to form a more stable gold complex and remove the yellow tones from the tissue. Fixer, with thiosulfate, stops the reaction and removes any unreduced silver from the section. the purpose of this stain is primarily to distinguish pathological abnormalities in kidney diseases. Hematoxylin and Eosin counterstains are applied to provide contrasting background. the Jones Staining Kit stains basement membrane black against a light pink background. Basement membranes appear as black ink drawn lines and these fine lines should be seen in the glomeruli of the kidney.

Protocol(s)Name Application timeJones 1Jones 2Jones 3

Renal biopsies4µm larger pieces of tissue2-3µm larger pieces of tissue

67 min71 min75 min

Special Stains | SpEciAl StAiNS

800.227.2155 | www.ventana.com 173

Page 188: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Jones Light Green Staining KitCatalog Number 860-020Type Jones (Hematoxylin and light Green counterstains)Control KidneyComponents/Storage Jones toner

Jones FixerJones HematoxylinJones light GreenJones periodic AcidJones Silver AJones Silver B

2º-30º c2º-30º c2º-30º c2º-30º c2º-8º c2º-8º c2º-8º c

Quantity 40 tests

DescriptionJones light Green Kit demonstrates capillary basement membrane in formalin-fixed paraffin embedded tissue. Jones light Green Kit is a modification of Jones Methanamine Silver procedure. Methanamine in this stain is used to demonstrate the carbohydrate component of basement membrane. periodic acid is used to oxidize carbohydrates to aldehyde groups. Jones Silver A, a silver nitrate solution, provides the silver ions. Jones Silver B provides the alkaline conditions that reduce the silver ions to metallic silver. toner reagent contains gold chloride to form a more stable gold complex and remove the yellow tones from the tissue. Fixer, with thiosulfate, stops the reaction and removes any unreduced silver from the section. the purpose of this stain is primarily to distinguish pathological abnormalities in kidney diseases. Hematoxylin and light Green counterstain are applied to provide contrasting background. the Jones light Green Kit stains basement membrane black against a light green background. Basement membrane appear as black ink drawn lines and these fine lines should be seen in the glomeruli of the kidney.

Protocol(s)Name Application timeJones lG 1Jones lG 2Jones lG 3

Renal biopsies4µm larger pieces of tissue2-3µm larger pieces of tissue

67 min71 min75 min

Trichrome II Blue Staining KitCatalog Number 860-013Control liver, Kidney, Skin, colonComponents/Storage Bouins Solution

Hematoxylin AHematoxylin Btrichrome Redtrichrome Mordanttrichrome Blue iitrichrome clarifier

15º-30º c15º-30º c15º-30º c15º-30º c15º-30º c15º-30º c15º-30º c

Quantity 75 tests

Descriptiontrichrome ii Staining Kit is used to study connective tissue, muscle and collagen fibers in tissue. trichrome ii Staining Kit is a modification of Masson’s trichrome Stain. Bouin’s Solution is applied to tissue sections to intensify the final coloration. cytoplasm and muscle are stained with trichrome Red, containing Biebrich Scarlet and acid fuchsin. Nuclei are stained with iron hematoxylin. After application of trichrome Mordant, the collagen is stained with trichrome Blue, which contains aniline blue. trichrome clarifier, an acetic acid solution, is applied to create a more delicate and transparent shade of color in the tissue section.

Protocol(s)Name Application timetrictric w/o BN

On-instrument Bouin’s treatment prior to stainingOff-instrument Bourin’s treatment prior to staining

56 min24 min

SpEciAl StAiNS | Special Stains

174 Ventana Medical Systems, Inc. | 800.227.2155

Page 189: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Trichrome III Blue Staining KitCatalog Number 860-022Type trichrome Blue (Modified Masson’s)Control liver, Kidney, Skin, colonComponents/Storage Bouin’s Solution

Bouin’s Solution 2trichrome iii Hematoxylin Atrichrome iii Hematoxylin Btrichrome iii Enhancertrichrome iii Redtrichrome iii Red 2trichrome iii Mordanttrichrome iii Bluetrichrome iii Blue 2

2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c

Quantity 75 tests

Descriptiontrichrome iii Blue Staining Kit is used to study connective tissue, muscle and collagen fibers. trichrome iii Blue Staining Kit is a modification of Masson’s trichrome Stain. Bouin’s Solution is applied to tissue sections to intensify the final coloration. cytoplasm and muscle are stained with trichrome Red, containing Biebrich scarlet and acid fuchsin. Nuclei are stained with iron hematoxylin. After application of trichrome iii Mordant, the collagen is stained with trichrome iii Blue, which contains aniline blue. the trichrome iii Blue Staining Kit stains collagen blue, muscle and erythrocytes red, and cell nuclei blue-black

Protocol(s)Name Fixation Application timetri iii Blu1tri iii Blu2tri iii Blu3tri iii Blu4tri iii Blu5tri iii Blu6tri iii Blu7tri iii Blu8tri iii Blu9

NBFNBFNBFNBFNBFBouin’sBouin’sBouin’sBouin’s

4µm liver, muscle and gastric sections2-4µm kidney sections with increased tubular staining2-4µm kidney sections with increased basement membraneincreased collagen and muscle staining2µm liver and gastric sections2-4µm liver, muscle and gastric sections2µm kidney with increased basement membrane2-4µm kidney with increased tubular stainingincreased muscle and collagen staining

92 min95 min95 min99 min88 min58 min51 min43 min48 min

Trichrome III Green Staining KitCatalog Number 860-023Type trichrome Green (Modified Masson’s)Control liver, Kidney, Skin, colonComponents/Storage Bouin’s Solution

Bouin’s Solution 2trichrome iii Hematoxylin Atrichrome iii Hematoxylin Btrichrome iii Enhancertrichrome iii Redtrichrome iii Red 2trichrome iii Mordanttrichrome iii Greentrichrome iii Green 2

2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c

Quantity 75 tests

Descriptiontrichrome iii Green Staining Kit is used to study connective tissue, muscle and collagen fibers. trichrome iii Green Staining Kit is a modification of Masson’s trichrome Stain. Bouin’s Solution is applied to tissue sections to intensify the final coloration. cytoplasm and muscle are stained with trichrome Red, containing Biebrich scarlet and acid fuchsin. Nuclei are stained with iron hematoxylin. After application of trichrome iii Mordant, the collagen is stained with trichrome iii Green, which contains fast green FcF. the trichrome iii Green Staining Kit stains collagen green, muscle and erythrocytes red, and cell nuclei blue to black.

Protocol(s)Name Fixation Application timetri iii GRN1tri iii GRN2tri iii GRN3tri iii GRN4tri iii GRN5tri iii GRN6tri iii GRN7tri iii GRN8tri iii GRN9

NBFNBFNBFNBFBouin’sBouin’sBouin’sBouin’sBouin’s

2-4µm liver sections and 4µm muscle sections4µm kidney sections2µm kidney sectionsincreased collagen and muscle staining2-4µm liver sections and 4µm muscle sections2µm kidney sections4µm kidney sectionsincreased collagen and muscle stainingincreased collagen and muscle staining

94 min98 min85 min90 min52 min48 min48 min52 min52 min

Special Stains | SpEciAl StAiNS

800.227.2155 | www.ventana.com 175

Page 190: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Reticulum II Staining KitCatalog Number 860-024Type Reticulum (Modified Gordon and Sweets)Control liver, SpleenComponents/Storage Oxidizer

DecolorizerSensitizerReticulum ii ReducertonerFixer iiNFR counterstainReticulum ii Silver A

2º-30º c2º-30º c2º-30º c2º-30º c2º-30º c2º-30º c2º-30º c2º-8º c

Quantity 75 tests

DescriptionReticulum ii Staining Kit is used to demonstrate reticular fibers. the purpose of this stain is primarily to aid in the differential diagnosis of certain tumor types. in certain tumors, reticulum is located in a characteristic position in relation to the actual tumor cells. Reticulum stains can be used to show disease states in organs such as the liver, spleen and kidney by demonstrating reticular patterns not normal to the organ. in normal liver, the fibers are well-defined strands, but in necrotic or cirrhotic liver, the fibers have discontinuous patterns. Reticulum ii Staining Kit is a modification of Gordon and Sweets Stain. Oxidizer, with potassium permanganate, oxidizes the tissue to enhance staining of reticular fibers. Decolorizer, with oxalic acid, removes excess potassium permanganate. Sensitizer, with ferric ammonium sulfate, is added to form a metal-organic compound. the metal-organic compound is replaced by the silver in Reticulum ii Silver A. Reducer is applied to develop the deposited silver into visible silver. toner reagent contains gold chloride for better contrast and clarity. Fixer, with thiosulfate, stops the reaction and removes any unreacted silver from the section. Nuclear Fast Red counterstain is applied to provide contrasting background. the Reticulum ii Staining Kit stains reticular fibers black against a pink to red background.

Protocol(s)Name Application timeRetic ii 1Retii 1 NFRDkRetii1 NoNFRReticii 2Retii2 NFRDkRetii2 NoNFRRetic ii 3Netii2 NFRDkRetii2 NoNRF

liver, spleen, 4µm sectionsliver, spleen, 4µm sections, darker counterstainliver, spleen, 4µm sections, no counterstainSpleenSpleen with darker counterstainSpleen with no counterstainBone marrow, needle biopsies, thin sectionsBone marrow, needle biopsies, thin sections, darkerBone marrow, needle biopsies, thin sections, no counterstain

67 min67 min67 min71 min71 min71 min75 min75 min75 min

SpEciAl StAiNS | Special Stains

176 Ventana Medical Systems, Inc. | 800.227.2155

Page 191: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Stains for microorganisms:AFB iii, Alcian Yellow, Steiner, GMS

AFB III Staining KitCatalog Number 860-027Type Acid-Fast Bacillus (Modified Ziehl-Neelson)Control tissue positive for acid-fast bacteriaComponents/Storage AFB Stain

AFB Decolorizer iiAFB iii Blue

15º-30º c15º-30º c15º-30º c

Quantity 75 tests

DescriptionAFB iii Staining Kit is used to selectively demonstrate Mycobacterium and other acid fast organisms and components in tissue. AFB iii Staining Kit is a modification of the Ziehl-Neelsen stain. A carbol fuchsin solution is used to stain acid fast organisms and components red. Aniline blue counterstain is applied to provide contrasting blue background.

Protocol(s)Name Application timeAFB iii 1AFB iii 2

3-5µm sections, light blue counterstain3-5µm sections, dark blue counterstain

42 min42 min

Alcian Yellow Staining KitCatalog Number 860-017Control Gastric tissue positive for H. pyloriComponents/Storage Alcian Yellow toluidine Blue

Alcian Yellow SensitizerAlcian Yellow OxidizerAlcian Yellow StainAlcian Yellow clarifier

2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c

Quantity 75 testsNote: Open only one Alcian Yellow clarifier vial at a time. Each vial is stable for ONE month after opening.

DescriptionHelicobacter pylori is a gram negative bacterium that has been shown to be the causative organism in some gastric and duodenal ulcers. it is the most common cause of antral gastritis and has been linked to the development of the distal gastric carcinoma and low grade gastric lymphoma. Helicobacter pylori has been shown to survive in the acid environment of the stomach and is able to destroy the neutral mucin that the surface epithelial cells secrete. identification in a gastric biopsy and prompt treatment with antibiotics can lead to a speedy recovery for the patient. Alcian Yellow Staining Kit stains the Helicobacter pylori blue, the background blue, and the mucin yellow.

Protocol(s)Name Application timeAlc. YellowAl.Yell.DarkAl.YEll.XDk (Optional)

5µm sections3-4µm sections, darker Alcian YellowStains H. pylori organisms darker (mucin may be greener)

43 min43 min50 min

Special Stains | SpEciAl StAiNS

800.227.2155 | www.ventana.com 177

Page 192: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Steiner Staining KitCatalog Number 860-018Control tissue positive for H. pylori, cat Scratch, legionella, SpirochetesComponents/Storage Steiner Diffuser

Seiner EnhancerSteiner ReducerSteiner SilverSteiner Diluent

2º-8º c2º-8º c2º-8º c2º-8º c2º-8º c

Quantity 40 tests

DescriptionSteiner Staining Kit is used to aid in the identification of causative organisms of infection such as spirochetes, legionella pneumophilia, Helicobacter pylori and other bacteria. Organisms will stain dark brown to black. Background will stain golden yellow to amber. Other tissue elements stain golden yellow to amber; nuclei will stain amber to dark brown.

Protocol(s)Name Application timeSteiner 1Steiner 2Steiner 3Steiner 4

H. pylori and cat Scratch fever (includes cleaning)Darker stain; Spirochetes and legionnella (includes cleaning)Spirochetes and legionenella darker stain (includes cleaning)Darkest stain, H. pylori, cat Scratch, Spirochetes, and legionnella (includes cleaning)

72 min72 min72 min65 min

Steiner Cleaning KitCatalog Number 860-025Components/Storage Steiner clean

probe cleaning Solutionambientambient

Quantity 10 runsNote: Steiner cleaning Kit should be ordered with the Steiner Staining Kit. this is a no-cost accessory and is a critical component in proper functioning of the NexES Special Stains automated slide stainer

DescriptionSteiner cleaning Kit is an accessory required for use with the Steiner Staining Kit. the Steiner cleaning Kit is an alcohol solution that is used to prevent and remove buildup of Gum Mastic residue from the NexES Special Stains automated slide stainer that is deposited during the Steiner assay.

SpEciAl StAiNS | Special Stains

178 Ventana Medical Systems, Inc. | 800.227.2155

Page 193: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

GMS II Staining KitCatalog Number 860-028Type Gomori’s Methanmine Silver (Modified)Control tissue positive for fungi or pneumocystis cariniiComponents/Storage Oxidizer

NeutralizertonerFixerlight Green counterstainGMSii Silver AGMSii Silver B (2 vials)

2º-30º c2º-30º c2º-30º c2º-30º c2º-30º c2º-8º c2º-8º c

Quantity 75 tests

DescriptionGMS ii Staining Kit selectively demonstrates polysaccharides in the cell walls of fungi and other opportunistic organisms, such as pneumocystis carinii. GMS Staining Kit is a modification of Gomori’s Methenamine Silver procedure. tissue, fungal and microbial cell wall polysaccharides are oxidized to aldehyde groups by GMS Oxidizer. chromic acid suppresses weaker background staining of collagen fibers and basement membranes. Neutralizer removes excess chromic acid. GMS Silver A, a silver nitrate reagent, provides the silver ions. GMS Silver B provides the alkaline conditions that reduce the silver ions to metallic silver. toner reagent contains gold chloride to form a more stable gold complex and remove the yellow tones from the tissue. Fixer, with thiosulfate, stops the reaction and removes any unreduced silver from the section. the purpose of this stain is primarily to distinguish pathogenic fungi, such as Aspergillus and Blastomyces, and other opportunistic organisms, such as pneumocystis carinii in tissue sections. light Green counterstain is applied to provide contrasting background. the GMS Staining Kit stains fungus black against a light green background. Aspergillus hyphae appear as black filaments. pneumocystis carinii organisms appear as clusters of helmet-shaped black spots.

Protocol(s)Name Application timeGMS ii StandardGMS ii Dark

Standard protocol pcStandard protocol Fungus

75 min 80 min

Special Stains | SpEciAl StAiNS

800.227.2155 | www.ventana.com 179

Page 194: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Other special stainsGiemsa Staining KitCatalog Number 860-006Control Bone MarrowComponents/Storage Giemsa Stain 15º-30º cQuantity 75 tests

DescriptionGiemsa Staining Kit differentiates leukocytes in bone marrow and other hematopoietic tissue (lymph nodes). the stain can also be used to demonstrate some microorganisms, such as H. pylori. A buffered thiazine-eosinate solution is used to stain cells differentially with a characteristic blue or pink color. the Giemsa Staining Kit stains leukocytes purple, erythrocytes pink and mast cells and many other cell types characteristically blue. Nuclei stain red to purple. the pathogenic gram-negative spiral bacteria, H. pylori, stains blue.

Protocol(s)Name Application timeGiemsa Standard Giemsa protocol 20 min

Iron Staining KitCatalog Number 860-009Control liverComponents/Storage iron Reagent A

iron Reagent BNuclear Fast Red counterstain

15º-30º c15º-30º c15º-30º c

Quantity 75 tests

Descriptioniron Staining Kit detects the presence of ferric iron in tissue. the iron is separated from protein by hydrochloric acid. the free ferric iron reacts with the potassium ferrocyanide to form an insoluble bright blue ferric ferrocyanide, or prussian blue. A Nuclear Fast Red counterstain is applied to provide a pink to red contrasting background. iron pigment stains bright blue. Heavy deposits of iron appear dark blue. cytoplasm stains pink and nuclei stain pink to red.

Protocol(s)Name Application timeFEFE-NFR-DKFE-NFR-Drkst (Optional)

Standard protocoliron, darker counteratiniron, very dark counterstain

31 min31 min40 min

SpEciAl StAiNS | Special Stains

180 Ventana Medical Systems, Inc. | 800.227.2155

Page 195: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Congo Red Staining KitCatalog Number 860-026Control tissue positive for AmyloidComponents/Storage congo Red Stain

Glycine Buffercongo Red Hematoxylin

2º-8º c2º-8º c2º-8º c

Quantity 40 tests

Descriptioncongo Red Staining Kit is used to selectively demonstrate Amyloid in tissue sections. the staining reaction is based on the application of congo red which stains the patterns of atypical proteins (amyloid). the b-pleated sheets of amyloid are suitable in size and shape to accommodate the congo red molecules, which are held in the lattice work of the b-pleated sheets. Birefringence is an intrinsic property of the amyloid fibril congo red complex. congo red may also stain unexpected structures such as: keratin, elastic and dense collagen fibers. Without both the red staining of congo red and the apple green birefrengence under polarization a definite identification cannot be made. the hematoxylin is applied as a contrasting blue nuclear stain. the congo Red Staining Kit stains amyloid a bright pink to red and nuclei blue. Amyloid may appear as circular or ribbon-like pink staining deposits throughout the tissue. it has a particular predilection for deposition in blood vessel walls and basement membranes. Nuclear staining may vary from light to dark blue depending on the tissue section and thickness (6-10 microns).

Protocol(s)Name Application timecongo Red Standard congo Red protocol 63 min

Special Stains | SpEciAl StAiNS

800.227.2155 | www.ventana.com 181

Page 196: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Ancillary ReagentsProduct Part number Description QuantitySpecial Stains Wash (10x)

860-015 Special Stains Wash is used to dilute the special stains reagents that are dispensed onto the slide and to wash the slides in between reagent application on the NexES Special Stains automated slide stainer. it is used at a 1X concentration and therefore requires a 1:10 dilution prior to use. the quality of the water used to prepare the Special Stains Wash Solution is critical to obtaining proper staining results. De-ionized water is recommended for its preparation.

2l bottle

liquid coverslip (low temperature)

250-009 liquid coverslip is applied atop aqueous reagents by the NexES Special Stains automated slide stainer to prevent reagent evaporation and ensure complete slide coverage.

2l bottle

Special Stains cleaning Kit

860-016 the Special Stains cleaning Kit is used to neutralize and clean the reagent aspiration and dispense mechanism of the NexES Special Stains system and prevent reagent carry-over. it is recommended to perform a cleaning runat the end of each workday and after each trichrome iii Blue or trichrome iiiGreen run.*1 kit for 50 cleaning cycles. (Standard cleaning cycle) components: cleaning Solution A, cleaning Solution B, cleaning Solution c

50 cleaning cycles*

Sections

AFB Alcian Blue Alcian Yellow Congo Red

3-5µm 4µm 3-5µm 6-10µm

Elastic Giemsa GMS Iron

4µm 4µm 4µm 4µm

Jones and Jones LG Mucicarmine PAS/Diastase PAS/Alcian Blue

2-4µm 4µm 4µm 4µm

PAS Reticulum Steiner Trichrome

4µm 2-5µm sections< 4µm may cause light or broken fibers

5µm for tissue section< 5µm may cause light and pale staining2-3µm for biopsies (kidney/liver)

Water Quality

Type I Type II Type III

conductivity at 25º c (microohms/cm) 0.1 1.0 10

Resistivity at 25º c (megaohms-cm) 10 1.0 0.1

Silicate (mg/l Si02) 0.05 0.1 1.0

pH — — 5.0-8.0

Bacteria growth (cfu/ml) 10 (preferably bacteria free) 1000 n/a

particulate matter 0.22 mm filter n/a n/a

Organics activated carbon n/a n/a

SpEciAl StAiNS | Ancillary Reagents

182 Ventana Medical Systems, Inc. | 800.227.2155

Page 197: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Digital Pathology |iScan Coreo Au slide scanner 185

800.227.2155 | www.ventana.com 183

Page 198: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

184 Ventana Medical Systems, Inc. | 800.227.2155

Page 199: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

iScan Coreo Auslide scanner

The iScan Coreo Au slide scanner provides high quality brightfield slide scanning with exceptional image quality for case review, sharing, and telepathology. Paired with our VENTANA Virtuoso software, iScan Coreo Au provides users with a complete digital pathology solution. Image acquisition through customized reporting increases operational efficiencies and productivity in the lab.

What’s on YOUR mind?

I need to create a digital image archive.• Access virtual image archives for case sharing

and collaboration• Reduce slide handling errors• Improve slide availability, portability

I need an easier way to review frozen sections.• Use the “Live Mode” feature as a live microscope to view

tissue sections• Enable the pathologist to render a review outside of the

surgery suite with remote viewing• Reduce turnaround time

powered by

I need a solution that is easy to adopt and implement into my lab.• Benchtop scanner can hold up to 160 slides with a

small footprint• Choose from multiple acquisition options to suit your lab’s

financial considerations• Enjoy world-class training and support from our industry-

leading customer support organization• Implement and acclimate quickly with easy IT integration

iScan Coreo Au | DIgITAL PAThoLogy

800.227.2155 | www.ventana.com 185

Page 200: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Specifications

General characteristics

Computer • Intel based PC, dual core, dual Xeon processor• Storage: 160 SATA / 12 gB, CD/DVD Burner• Connectivity: gIgABIT Ethernet ports

Computer Monitor • Resolution: flat panel high resolution monitor (1920x1200)• Size: 24 inch

Input format • 1 in x 3 in (25 mm x 75 mm) microscope slides

Slide capacity • 1 to 160 slides using 8 standard Sakura baskets in an integrated rack

Automated turret • Turret with support for four microscope objectives

Objectives • olympus 4X (0.1 NA), 10X (0.3 NA), 20X (0.5 NA), and 40X (0.75 NA)

Scanning resolution • 2.5 μm/pixel @ 4X, 1 μm/pixel @ 10X, 0.46 μm/pixel @ 20X, 0.23 μm/pixel @ 40X

Bar code capability • 1D and 2D bar code reading capability

Light source • Integrated LED

Configuration • Free standing

Light scan • Automated bar code reading, tissue identification, auto focus, scanning, and image compression

Manual scan • User configurable scan area for single or batched slides in manual mode

LCD • 5.5" diagonal full color display 320 x 240 resolution

Scan viewing • 24-bit true color

Slide storage format • Customizable to: JPEg 2000, BIF, and TIFF

Unique features

• only whole slide scanner with an automated turret with four objectives, allowing optical brightfield scanning at 4X, 10X, 20X, and 40X within one batch

• Performs volume scanning with up to 15 z-stacks• Live Mode application supports remote microscopy; the iScan Coreo Au can be used as a live, digital microscope to remotely view frozen

sections at 1X-40X magnifications and multiple planes• Walk-away automation with 160 slide capacity

Environmental requirements

BTU/Hour Output • 400 BTU/hr idle, 1000 BTU/hr running

Room Temperature • 20ºC to 32ºC (68ºF to 90ºF)

Humidity • 10% to 90%, non-condensing

Electrical specifications

Voltage • 110-220 VAC

Output capacity • 400 Watts (includes lightsource)

Frequency • 50/60 hz

Safety certifications

Compliance • CE, UL

Physical characteristics

Size (W x D x H) • 44.00" x 33.10" x 62.40" (111.76 cm x 84.07 cm x 158.50 cm), • 13.5" x 14.5" x 13.5" (34 cm x 37 cm x 34 cm)

* VENTANA products are for in vitro diagnostic use for specific applications, and are intended for research use only for other applications.

DIgITAL PAThoLogy | iScan Coreo Au

186 Ventana Medical Systems, Inc. | 800.227.2155

Page 201: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

IVD Companion Diagnostics Services |Translational Diagnostics 189

IVD COMPANION DIAGNOSTICS SERVICES

800.227.2155 | www.ventana.com 187

Page 202: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Ventana Translational Diagnostics

We’re there through every step of your development journey.Only Ventana TDx offers you proven expertise in all four key components required to successfully integrate IVD systems on automated instrument platforms:• Biomarker assay development• Operational execution• Regulatory and clinical experience• Commercialization expertiseOur operational processes integrate design control, GMP manufacturing, and a strong supply chain. We offer exceptional ongoing service from dedicated lab, marketing, sales, and reimbursement support organizations.

Innovative thinking, hard work and commitment have brought you within reach of the answers you need. Through our Translational Diagnostics Group (TDx), we help you overcome the challenges that remain on the road to drug approval.

BIOMARkER ASSAyDEVElOPMENT

REGulATORy ANDClINICAl ExPERIENCE

OPERATIONAlExECuTION

COMMERCIAlIzATIONExPERTISE

IVD COMPANION DIAGNOSTICS SERVICES | Ventana Translational Diagnostics

188 Ventana Medical Systems, Inc. | 800.227.2155

Page 203: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Drug development (clinical trials)Phase 1 >Safety

Phase 2 >Treatment effects

Phase 3 >Confirmation of clinical benefit

Diagnostic milestoneStage 1 >Prototypeassaydevelopment

6-8 weeks

Stage 2a >PMA readyIVD productdevelopment

8-12 months

Stage 2b >Performretroanalysis of PII samples

6-7 months

Phase 3 >Conduct diagnostic clinical trial with PMA ready IVD diagnostic trial parallels theraputic trial

2-3 years

Prepare and submit PMA filing with FDA. Co-filing with NDA for simultaneous on label approval of PMA

We’ll take you anywhere you want to go.• We have a robust global install base in North America,

Europe, Australia, and Japan, with rapid expansion into Asia (including China) and latin America

• Direct global operations in 59 countries• Active in 150 countries

We offer you the advantage of strength in numbers.• 7,000+ instruments installed in anatomic, reference,

pharma research, and clinical research labs around the world

• 10+ years experience working with top 25 biopharmaceutical companies and CROs

• 350 assays active today• 58 plus-country network of regulatory associations to

ensure a smooth progression through clinical validation, clinical trials, and submission

Ventana Translational Diagnostics | IVD COMPANION DIAGNOSTICS SERVICES

800.227.2155 | www.ventana.com 189

Page 204: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

190 Ventana Medical Systems, Inc. | 800.227.2155

Page 205: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Support |Commercial education 193

VENTANA customer support 196Support and maintenance agreements 198

Field operations 201Customer Care 203

800.227.2155 | www.ventana.com 191

Page 206: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

192 Ventana Medical Systems, Inc. | 800.227.2155

Page 207: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Commercial Educationtechnical education

The curricula consist of an optimal mix of theory and hands-on experience. Courses are presented in small, intimate classes, creating a relaxed learning environment. The Operator courses are basic training in the operation and maintenance of VENTANA automated staining platforms. The Fundamentals of Immunohistochemistry course is focused on the practical application of comprehensive theoretical principles of immunohistochemistry.

InstructorsEach course is lead by highly qualified technical professionals. Accredited pathologists and histologists are available to answer any questions regarding course content and/or applications.

ValueBasic theory and principles are combined with hands-on IHC and ISH staining. Antibody dilutions and titrations are covered, along with detection chemistries. Participants engage in extensive microscopic slide review, troubleshooting and sharing experiences.

Course fee includes: airfare, hotel accommodations, meals, and transportation to and from hotel. Please ask your Ventana representative for additional details.

Our ongoing commitment is to provide a comprehensive solution in the area of world-class customer support and training through technical education initiatives. Training programs are held at our training center, located at our headquarters in Tucson, Arizona. We look forward to welcoming you to one of our training courses.

Commercial Education | SUPPORT

800.227.2155 | www.ventana.com 193

Page 208: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Training courses

Product Part Number DescriptionDISCOVERY ULTRA Operator 06386547001 Basic training course in the operation and maintenance of the

DISCOVERY ULTRA automated slide staining system.. Topics of instruction include: overview of instrument components and hardware, in-depth training on instrument software, in-depth training of slide bar code software, product overview and applications including antibodies, detection chemistries and ancillary products, antibody dilutions and titrations, hands-on IHC and ISH staining, research applications, microscopic slide review, and troubleshooting. Length: 4.5 days

DISCOVERY XT Operator 06386474001 Basic training course in the operation and maintenance of the DISCOVERY XT automated slide staining system.. Topics of instruction include: overview of instrument components and hardware, in-depth training on instrument software, in-depth training of slide bar code software, product overview and applications including antibodies, detection chemistries and ancillary products, antibody dilutions and titrations, hands-on IHC and ISH staining, research applications, microscopic slide review and troubleshooting. Length 4.5 days.

Fundamentals of Immunohistochemistry 06386482001 Comprehensive basic course in immunohistochemistry (IHC) for beginners. Daily morning lectures are followed by hands-on afternoon workshops that emphasize the learning objectives. Topics of instruction include: concepts of basic immunology, basic properties of antibodies and their production, tissue and slide preparation, theory of IHC, antibody dilutions and titrations, detection chemistries, hands-on IHC staining, diagnostic applications, microscopic slide review and troubleshooting. Length: 5 days.

SYMPHONY Operator 06386504001 The SYMPHONY Key Operator training program provides in-depth instruction on all aspects of the SYMPHONY system. Topics of instruction include: instrument operation, software operation, theory and practice of the H&E stain, protocol optimization, inventory management, primary user troubleshooting, remote diagnostics troubleshooting (Caregiver remote support), change management and Train the Trainer. The course is tailored to meet the specific needs of each laboratory (protocol and workflow optimization). Length 2 days.

SUPPORT | Commercial Education

194 Ventana Medical Systems, Inc. | 800.227.2155

Page 209: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Commercial Education | SUPPORT

800.227.2155 | www.ventana.com 195

Page 210: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

VENTANA Customer Supportorganization

Every VENTANA instrument includes peace of mind. You receive a vast scope of services when you invest in our instrumentation. When you bring a VENTANA instrument into your lab, a team of world-class customer support experts comes with it.

What’s on YOUR mind? Where can I turn if I need assistance with my VENTANA instrument any time, day or night? • 24 hours a day, 7 days a week, 365 days a year, the

Ventana Customer Support Organization (CSO) is ready to help you deliver optimum performance at your lab

What if I need on-site assistance with a VENTANA instrument? • With over 120 Field Support experts strategically

positioned across North America, we can quickly address your concerns in person

Is the CSO team qualified to meet my lab’s specific needs?• With more than 4100 instruments supported at top labs

across the country and a 75% remote fix rate, the CSO keeps your lab running smoothly and efficiently – with minimal down time

How do I know Ventana really cares about customer satisfaction?• Our CSO has won the Ace Annual Customer Satisfaction

Award for World Class Performance in 2007, 2008, and 2009

• An 8.4 (out of 10) customer satisfaction rating is testimony of our dedication and stellar support

• We continuously monitor and address performance with our customers using quarterly surveys and on-going complaint analysis

SUPPORT | VENTANA Customer Support

196 Ventana Medical Systems, Inc. | 800.227.2155

Page 211: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Our goal: your satisfaction

Consistent, optimal performance of your instrumentation is a must—and our top priority. Your satisfaction is critical to us, because we share your desire to improve and personalize cancer diagnostics and patient care.

Customer Support Center

• Over 50 Call Center Specialists at your service 24/7, 365 days a year• Instrument, reagent, and software support

Customer Care

• Anytime ordering by phone, fax or email• Standing order management• Rapid response to your questions and concerns

Support sales

• 7 out of 10 instruments installed are covered by a support agreement specifically developed to meet the lab’s needs• Dedicated Support Sales Specialist to assist in creating a support agreement that’s right for you

Field based applications and engineering support

• Over 120 support professionals for prompt, personal response• Installations• Reagent and instrument support• Ready to answer questions on protocols and instrument settings

Applications support lab

Staffed with our top technical minds, the support lab is dedicated to meeting your needs. Because we are located on campus at our corporate headquarters in Tucson, we can rapidly turnaround requests, ensuring the workflow of your lab is never interrupted.

The professionals in our lab do their utmost to support the professionals in yours, with value and efficiency in the vast services they provide:

• Protocol optimization on your tissue• Cutting-edge new product demonstrations and evaluations• Assistance for questions on 3rd party antibodies and probes

VENTANA Customer Support | SUPPORT

800.227.2155 | www.ventana.com 197

Page 212: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Support and maintenance agreementsAvailable on NexES Special Stains automated slide stainer and DISCOVERY biomarker platform.

Product Part number DescriptionPremier agreement 750-933 Unlimited on-site service support by a VENTANA Field Service

Engineer (FSE). All requests for repair service will be dispatched with a 24-hour priority dispatch. Costs for all repair and preventative maintenance parts are included; customer will not be charged shipping costs (excluding shipments to Canada). Recommended preventative maintenance (PM) services will be performed by an FSE based on customer’s annual slide volume. One performance maintenance service will be performed by an FSE annually during the term of the agreement. Unlimited applications troubleshooting and support are available from a DISCOVERY Product Specialist (DPS) and include: instrument relocation assistance, antibody work-up, protocol development, and on-site training. Installation of all operational modifications and hardware/software upgrades by an FSE during the next scheduled service visit. Term: variable.

Standard agreement 750-932 Unlimited on-site service support by a VENTANA Field Service Engineer (FSE). All requests for repair service will be dispatched with a 48-hour priority dispatch. Costs for all repair and preventative maintenance parts are included; customer will not be charged shipping costs (excluding shipments to Canada). One annual preventative maintenance (PM) service will be performed by an FSE. All PM service is dispatched as a non-priority for completion within 30 days of request. Unlimited on-site applications troubleshooting by a VENTANA DISCOVERY Product Specialist (DPS). Five days of applications support are available from a DPS and include: instrument relocation assistance, antibody work-up, protocol development, and on-site operator training. Agreement includes the installation of all operational modifications by an FSE during the next scheduled service visit. Term: variable.

SUPPORT | VENTANA Customer Support

198 Ventana Medical Systems, Inc. | 800.227.2155

Page 213: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

SYMPHONY support and maintenance agreementsAvailable on SYMPHONY staining systems.

Product Part Number DescriptionSYMPHONY premier agreement 750-939 Unlimited on-site service support by a VENTANA Field Service

Engineer (FSE) is available 24 hours a day, seven days a week. All requests for repair service will be dispatched with a 24-hour recovery guarantee (for customers located within 100 miles of FSE). Costs for all repair and Preventative Maintenance (PM) parts are included; customer will not be charged shipping costs (except for shipments made to Canada). Unlimited telephone support from our Technical Consultation Center is available 24 hours a day, seven days a week. Recommended PM service will be conducted based on customer’s annual slide volume. One Performance Maintenance service will be performed by an FSE annually during the term of the agreement. All hardware/software upgrades and modifications are included. Remote diagnostics and monitoring included. Term: variable.

SYMPHONY standard agreement 750-938 Unlimited on-site service support by a VENTANA Field Service Engineer (FSE) is available Monday through Friday 8 a.m. to 8 p.m. local time. All requests for repair service will be dispatched with a 36-hour recovery guarantee (for customers located within 100 miles of FSE). Costs for all repair and Preventative Maintenance (PM) parts are included. customer will not be charged shipping costs for repair/PM parts (except for shipments made to Canada). Unlimited telephone support from our Technical Consultation Center is available 24 hours a day, seven days a week. Recommended PM service will be conducted based on customer’s annual slide volume. Remote diagnostics included. Term: variable

VENTANA Customer Support | SUPPORT

800.227.2155 | www.ventana.com 199

Page 214: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

200 Ventana Medical Systems, Inc. | 800.227.2155

Page 215: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Field OperationsTo improve each customer’s experience, we have the largest customer support network in the market. Field Service Engineers and DISCOVERY Product Specialists are available in key locations to meet all customer needs.DISCOVERY Product Specialists• To ensure our customers receive exceptional support,

every DISCOVERY Product Specialist has a strong background in histology, immunohistochemistry and in situ hybridization.

• Each has been specifically trained on VENTANA DISCOVERY systems.

• These specialists are qualified to perform installations, assist with experimental design, protocol development, troubleshooting and on site training.

Qualification • As a combined team, our Customer Support

Organization ensures that your support requirements are met in a timely and effective manner.

• From your initial request of installation, on-site training, applications support, repair, or maintenance activities our support organization is in position — ready to respond to your needs.

• We are committed to delivering an exceptional customer experience in the most effective and efficient way.

Field Operations | SUPPORT

800.227.2155 | www.ventana.com 201

Page 216: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

202 Ventana Medical Systems, Inc. | 800.227.2155

Page 217: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Customer CareOur mission is to provide world-class customer service to each of our customers. Ventana is proud to be your vendor of choice and it is our desire to continue to earn your trust through the actions we take every day with professional, friendly service, order accuracy, and same-day order processing. We strive to deliver exemplary customer care, which is evident in our timely and accurate order processing system. We are proud to offer same day order processing for all of our customers—ensuring orders placed before 3 p.m. MST will ship that same day.

Standards • Customer Care processes nearly 6,000 orders every

month with 99.9% accuracy. Our goal is to ensure that your order is accurate and on-time, every time.

• Customers choose Ventana because of our commitment to service excellence in order fulfillment.

• Our courteous Customer Care Executives are ready to help you with all of your order needs.

• Orders placed before 3 p.m. MST (Mountain Standard Time) will ship the same day.

• Note: Tucson is located in a portion of Arizona that does not observe Daylight Savings Time so please adjust for this when calling.

Order by email • [email protected] (24 hrs/day)

Order by telephone• (800) 227-2155 (M-F 6 a.m. - 5 p.m. MST)

Order by fax• (520) 229-4207 (24 hrs/day)• Attn: Sales Order Administration

Customer Care | SUPPORT

800.227.2155 | www.ventana.com 203

Page 218: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

SUPPORT | Customer Care

204 Ventana Medical Systems, Inc. | 800.227.2155

Page 219: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Appendix |General terms and conditions 206

Index 207

APPENDIX

800.227.2155 | www.ventana.com 205

Page 220: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

General Terms and Conditions

The following General Terms and Conditions apply in addition to the terms and conditions set forth on the face page of the Agreement and the Software License Agreement where applicable.

1. PAymenT Terms. All prices are firm unless otherwise agreed to in writing. Unless prohibited by law, Customer is responsible for all applicable sales, use, excise, value added or similar other taxes or fees imposed upon this transaction by any federal, state or local governmental authority, unless Customer provides Ventana with a valid tax exemption certificate. Payment terms shall be net 30 days from date of invoice. Ventana reserves the right to require C.O.D. payment terms from any Customer whose account is overdue for a period of more than 60 days or who has an unsatisfactory credit or payment record. Ventana may also refuse to sell to any Customer until overdue accounts are paid in full. Credits for pricing discrepancies must be issued within 90 days of invoice date. No credits will be issued after 90 days. Ventana may increase Customer’s prices up to five percent (5%) upon each anniversary of the effective date of the Agreement. “Products” includes without limitation, software, systems, instruments, documentation, reagents and consumables sold or transferred to Customer by Ventana.

2. Delivery AnD shiPmenT. Shipment of all Products shall be FOB Ventana’s point of distribution. All shipping and handling costs shall be paid by Customer and if prepaid by Ventana the amount thereof shall be reimbursed to Ventana. Ventana shall use reasonable efforts to deliver Products or provide services in accordance with the requested delivery date but will not be liable in any way for any failure to meet any such date. Tucson based training slots must be completed within 120 days (4 months) from the date of installation or the slot may be forfeited.

3. insPeCTion. Customer shall be responsible for inspecting all Products. Unless Customer provides Ventana written notice of rejection of any Product within 30 days of delivery or installation of system or instrument, the Products shall be deemed to have been irrevocably accepted. Ventana shall, in its sole discretion, remedy or replace rejected or defective Products of which it has been timely notified.

4. WArrAnTy. Ventana warrants and represents that when used per instructions, the Products will perform in accordance with the relevant Product specification for a period of 12 months from the date of delivery or installation of system or instrument. Reagents are warranted until their respective expiry dates. Ventana reserves the right to change the design or specifications of the Products at any time. Ventana will provide Customer prior notice of any change in design or specification that materially affects Product performance. Ventana further warrants that the Products do not infringe the patent rights of third parties. In the event of a court order of patent infringement results in an interruption in the Customer’s continued use of the Products, Ventana shall, at its option, either (a) provide for the Customer at Ventana’s expense the right to continue using the affected products; or (b) modify or replace the affected products so that the products become non-infringing, but only if the modification or replacement does not negatively affect the performance of the products or their use by the Customer. THE FOREGOING WARRANTY IS IN LIEU OF ALL OTHER WARRANTIES. VENTANA DISCLAIMS ALL WARRANTIES, EXPRESSED OR IMPLIED, INCLUDING ALL WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Ventana will have no liability for any claim of infringement to the extent that it

is based on materials or modifications made by Customer or a third party at the request of Customer. This Section 4 states the entire liability of Ventana and the exclusive remedy of Customer with respect to any alleged infringement. Ventana’s warranty obligations are contingent upon Customer: (i) notifying Ventana of a warranty claim within ten (10) days after having knowledge of same; (ii) providing sufficient detail of the facts associated with a warranty claim in writing so as to allow Ventana to reasonably reproduce any alleged defects in the Products, or demonstrate to Ventana such defect.

5. limiTATion of liAbiliTy. IN NO EVENT SHALL VENTANA BE LIABLE FOR ANY LOST REVENUES, LOST PROFITS, PROPERTY DAMAGE, SPECIAL OR CONSEQUENTIAL DAMAGES OR ECONOMIC LOSS OR PROPERTY DAMAGE INCURRED BY THE CUSTOMER IN CONNECTION WITH THE SALE OR FURNISHING, PERFORMANCE OR USE OF THE PRODUCTS OR GOODS OR THE SERVICES PROVIDED BY VENTANA.

6. DefAulT. Any of the following shall constitute a default under this Agreement: (a) failure of Customer to make payments when due hereunder; b) failure of Customer to fully comply with and perform any obligations hereunder which failure remains uncured for thirty (30) days after written notice; (c) making of assignment for the benefit of creditors by Customer; (d) institution of bankruptcy, reorganization, liquidation, or receivership proceedings by or against Customer and (e) impairment of the credit of Customer.

7. remeDies. In the event of default, Ventana shall have the right to: (a) terminate this Agreement; (b) declare the then remaining unpaid balance, if any, of the committed dollars and all other agreed charges, taxes and assessments due and payable under this Agreement and/or adjust prices to reflect actual volumes; (c) retake possession of the Products (and Customer authorizes and empowers Ventana to enter upon the premises wherever the Products may be found); or (d) pursue any other remedy provided by law. In addition, Ventana shall have all of the rights and remedies of a secured party under the Arizona Uniform Commercial Code, without liability to Ventana. Customer agrees to pay all costs of collection, including without limitation, court costs, reasonable attorneys’ fees, fees for repossession, repair, storage and sale of the Products.

8. ConfiDenTiAliTy. Each party agrees that it will keep in confidence all information and documentation disclosed by the other party which relates to any confidential information or trade secrets, including without limitation, proprietary processes of manufacture, know-how, methods of carrying on business or which is designated by a party as confidential (“Confidential Information”) and that it will not directly or indirectly use, copy or disclose to any third party any Confidential Information it receives from the other party. Confidential Information shall not include any information which is (i) known by the receiving party at the time of disclosure by the other party, free of any obligation to keep it confidential (ii) publicly available or hereafter becomes publicly available through authorized disclosure; or (iii) rightfully obtained by the receiving party from a third party who has the right to disclose such information, or (iv) independently developed by the receiving party. This Agreement and ideas and expressions contained in the Software, as well any information provided by Ventana in connection with the Software and Ventana’s pricing shall be considered Confidential Information.

9. AssiGnmenT. Customer may not assign or transfer this Agreement without Ventana’s prior written consent.

10. GoverninG lAW. This Agreement shall be governed by and construed in accordance with the laws of the State of Arizona, excluding choice of law provisions.

11. enTire AGreemenT. This Agreement constitutes the entire agreement of the parties and supersedes any other agreements or understandings concerning the subject matter hereof, written or oral. No amendment of this Agreement shall be effective unless in writing and signed by both parties. No failure or delay by any party hereto in exercising any right or remedy hereunder or under applicable law will operate as a waiver thereof or a waiver or release of that right.

12. forCe mAjeure No liability shall result from delay in performance or nonperformance, directly or indirectly caused by circumstances beyond the control of the party affected, including, but not limited to: Act of God, acts of terrorism, fire, explosion, flood, war, act of or authorized by any Government, accident, labor trouble or shortage, inability to obtain material, equipment, or transportation. Quantities so affected may be eliminated from the Agreement without liability, but the Agreement shall remain otherwise unaffected. Ventana shall have no obligation to purchase for Customer the Products to enable it to perform this Agreement.

13. CounTerPArTs. This Agreement may be executed in any number of counterparts. Customer and Ventana agree that a facsimile or electronic copy of this Agreement bearing authorized signatures shall be taken as an original.

14. TiTle AnD risk of loss. Unless otherwise agreed in writing, Ventana shall retain title to the Products until the terms of the Agreement and all obligations of Customer are fulfilled. Risk of damage or loss of Products shall pass to Customer when they leave Ventana’s point of distribution. Loss or damage to the Products after risk of loss has passed shall not relieve Customer of its obligations including the obligation to make full payment hereunder.

15. ComPliAnCe WiTh lAWs. The parties intend that this Agreement comply at all times with all existing and future applicable laws, including state and federal anti-kickback laws, the Medicare & Medicaid Regulations, the restrictions on Customer by virtue of its tax-exempt status and the federal law relating to physician referrals. If at any time either party reasonably believes, upon advice of counsel. that there is a substantial risk that as a result of this Agreement, either party does not comply with applicable law such party shall so notify the other party and then the parties shall exercise best efforts to reform this Agreement in such a manner so that it complies with applicable law. If the parties have not been able to resolve these legal issues referred, then the party(s) who initiated the notice may terminate this Agreement upon at least 30 days written notice to the other party.

16. reseArCh use only AnD evAluATion ProDuCTs. Products intended for Research Use Only are not intended to be used for diagnostic or clinical purposes. Research Use expressly excludes any and all diagnostic or clinical uses, including without limitation, use in the diagnosis of disease or other conditions, or in the cure, mitigation, treatment or prevention of disease in humans. Customer warrants and represents that it shall not use Research Use Only Products for diagnostic or clinical purposes. In addition, Ventana may from time to time provide a reasonable and limited number of evaluation products to Customer at no charge in order for Customer to assess the appropriate use and functionality of such products in Customer’s business. In each such case, Customer warrants that it will (i) comply with all applicable laws with respect to Customer’s billing of third parties for use of any such evaluation products and (ii) report the no-cost status of such products to any third party payor that requires such notice.

APPENDIX | General Terms and Conditions

206 ventana medical systems, inc. | 800.227.2155

Page 221: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

indexsymbols0CH1E5 [clone] 801A4 [clone] 201A9-1 [clone] 871E2 [clone] 1151G12 [clone] 742B11 & PD7/26 [clone] 432f2 [clone] 462F3.2 [clone] 1292F11 [clone] 1032G9 [clone] 372GV6 [clone] 322H11+6E1 [clone] 1233C6 [clone] 644A4 [clone] 1084B5 [clone] 77, 784C4.9 [clone] 1184C9 [clone] 395B7 [clone] 646F-H2 [clone] 1298G7G3/1 [clone] 1249.7 [clone] 51, 529C4 [clone] 719C5 [clone] 12513B10 [clone] 7914 [clone] 2430-9 [clone] 8631A5 [clone] 8934βE12+4A4 [clone] 2234βE12 [clone] 22, 5535betaH11 [clone] 5836 [clone] 6344 [clone] 9555k-2 [clone] 6998 [clone] 109121SLE [clone] 27123C3 [clone] 45124 [clone] 23

Aa-1-Antichymotrypsin (ACT) (polyclonal) 18a-1-Antitrypsin (AAT) (polyclonal) 18A53-B/A2.26 [clone] 61a-1-Fetoprotein (AFP) (polyclonal) 19A103 [clone] 90AAT. See a-1-Antitrypsin (AAT) (polyclonal)AC-1A1 [clone] 68ACT. See a-1-Antichymotrypsin (ACT) (polyclonal)ACTH. See Adrenocorticotropin (ACTH)

(polyclonal)Actin, a-Smooth Muscle (1A4) 20Actin, Muscle (HUC1-1) 19Actin, Muscle Specific (HHF35) 20Adrenocorticotropin (ACTH) (polyclonal) 21

AE1/AE3 & PCK26 [clone] 57AE1 [clone] 56AE3 [clone] 56AFB III Staining Kit 177AFP. See a-1-Fetoprotein (AFP) (polyclonal)Alcian Blue for PAS 171Alcian Blue Staining Kit 172Alcian Yellow Staining Kit 177CONFIRM ALK1 (ALK01) 21ALK01 [clone] 21Amplification 148-149Amplification HQ Kit 148Amplification Kit 149AmpMap with TSA 149Annexin A1 (MRQ-3) 22Antibody Block 146Antibody diluents 147Antibody Dilution Buffer 147Anti-HQ AP Multimer 148Anti-HQ HRP Multimer 149Application kits 147-148

bB22.1 & B23.1 [clone] 59B72.3 [clone] 121B-A38 [clone] 49Basal Cell Cocktail (34βE12+4A4) 22BCA-225 (Cu-18) 23CONFIRM bcl-2 (124) 23bcl-6 (GI191E/A8) 24Ber-EP4 [clone] 66Ber-H2 [clone] 39Beta-catenin (14) 24BG8, Lewisy (F3) 25Biotinylated Rabbit Secondary Antibody 148Blockers 146BlueMap Kit 141Bluing Reagent 149BOB.1 (SP92) 25Bp-53-11 [clone] 107Bulk solutions 145

CC3d (polyclonal) 26C4d (polyclonal) 26C5/D5 [clone] 93CA 19-9 (121SLE) 27CA 125 (OC125) 27Calcitonin 28Caldesmon (E89) 28Calponin-1 (EP798Y) 29CONFIRM Calretinin (SP65) 30CAM 5.2 [clone] 55Carcinoembryonic Antigen (CEA) (TF3H8-1) 30CD1a (EP3622) 31CD2 (MRQ-11) 31CONFIRM CD3 (2GV6) 32CONFIRM CD4 (SP35) 32

CONFIRM CD5 (SP19) 33CD7 (SP94) 33CONFIRM CD8 (SP57) 34CD10 (SP67) 34CD14 (EPR3653) 35CONFIRM CD15 (MMA) 35CD19 (SP110) 36CONFIRM CD20 (L26) 36CD21 (2G9) 37CD21 (EP3093) 37CD22 (SP104) 38CONFIRM CD23 (SP23) 38CD25 (4C9) 39CONFIRM CD30 (Ber-H2) 39CD31 (JC70) 40CONFIRM CD34 (QBEnd/10) 40CD34 (QBEnd/10) 41CD43 (L60) 41CD44 (SP37) 42CONFIRM CD45 (LCA) (RP2/18) 42CD45 (LCA) (2B11 & PD7/26) 43CD45R (MB1) 43CONFIRM CD45RO (UCHL-1) 44CONFIRM CD56 (123C3) 45CD56 (MRQ-42) 44CD57 (NK-1) 45CD61 (2f2) 46CD63 (NKI/C3) 46CONFIRM CD68 (KP-1) 47CD74 (LN2) 47CONFIRM CD79a (SP18) 48CONFIRM CD99 (O13) 48CD117. See PATHWAY c-KIT (9.7)CD138 (Syndecan-1) (B-A38) 49CD163 (MRQ-26) 49CDX-2 (EPR2764Y) 50CEA. See Carcinoembryonic Antigen (CEA)

(TF3H8-1)CEA31 [clone] 50CEA (CEA31) 50ChipMap 80 Kit 148ChipMap Hybe 146ChipMap Hybe 80 146ChipMap Kit 147Chromogranin A (LK2H10) 51ChromoMap Blue 139ChromoMap DAB 139ChromoMap Red 139INFORM Chromosome 17 Probe 155CIV22 [clone] 53PATHWAY c-KIT (9.7) 51, 52CLAD Process for IHC 150–151CONFIRM Total c-MET (SP44) 53CNA.42 [clone] 70Collagen Type IV (CIV22) 53Congo Red Staining Kit 181Counterstains 149COX-2 (Cyclooxygenase 2) (SP21) 54Cu-18 [clone] 23Customer Care 203CWWB1 [clone] 127Cyclin D1 (SP4-R) 54

Index | APPENDIX

800.227.2155 | www.ventana.com 207

Page 222: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Cyclooxygenase 2. See COX-2 (Cyclooxygenase 2) (SP21)

CONFIRM Cytokeratin (34βE12) 55CONFIRM Cytokeratin (AE1) 56CONFIRM Cytokeratin (AE3) 56Cytokeratin (CAM 5.2) 55Cytokeratin (Pan) (AE1/AE3 & PCK26) 57Cytokeratin 5/6 (D5/16B4) 57CONFIRM Cytokeratin 7 (SP52) 58Cytokeratin 8 (35betaH11) 58Cytokeratin 8 & 18 (B22.1 & B23.1) 59Cytokeratin 10 (SP99) 59Cytokeratin 14 (LL002) 60Cytokeratin 17 (SP95) 60Cytokeratin 19 (A53-B/A2.26) 61CONFIRM Cytokeratin 20 (SP33) 61

DD2-40 [clone] 114D5/16B4 [clone] 57DABMap Kit 140DCS-60.2 [clone] 106DE-R-11 [clone] 62CONFIRM Desmin (DE-R-11) 62Detection chemistries 134–141, 144Diastase Kit 170DISCOVERY 3DISCOVERY Amp HQ 142DISCOVERY Amp HQ Kit 142DISCOVERY Antibody Diluent 147DISCOVERY anti-HQ Alk-Phos Multimer 142DISCOVERY anti-HQ HRP Multimer 142DISCOVERY Biotinylated Rabbit Secondary

Antibody 141DISCOVERY Cell Conditioning 1 145DISCOVERY EZ Prep 145DISCOVERY series Support and Maintenance

AgreementsPremier Agreement 198Standard Agreement 198

DISCOVERY ULTRA independent slide staining system 7–9

DISCOVERY ULTRA operator training course 194

DISCOVERY Universal Secondary Antibody 141DISCOVERY XT automated slide staining system

11–13DISCOVERY XT operator training course 194DO-7 [clone] 108DOG1 (SP31) 62

eE27 [clone] 105E29 [clone] 65E89 [clone] 28

E-Bar II Barcode Slide Label System 13, 169E-Bar Label Kit 13, 169E-Bar Mylar Shields 13, 169E-Bar Printer Ribbon 13, 169Labels 13, 169

EBER 1 DNP Probe 156E-cadherin (36) 63E-cadherin (EP700Y) 63CONFIRM EGFR (Epidermal Growth Factor

Receptor) (3C6) 64CONFIRM EGFR (Epidermal Growth Factor

Receptor) (5B7) 64Elastic Staining Kit 173CONFIRM EMA (Epithelial Membrane Antigen)

(E29) 65Endogenous Biotin Blocking Kit 146Enzymes 146EP1582Y [clone] 72EP3093 [clone] 37EP3372 [clone] 69EP3622 [clone] 31EP672Y [clone] 72EP700Y [clone] 63EP798Y [clone] 29Ep-CAM (Epithelial Specific Antigen) (Ber-EP4)

66Epidermal Growth Factor Receptor.

See CONFIRM EGFR (Epidermal Growth Factor Receptor) (3C6); See CONFIRM EGFR (Epidermal Growth Factor Receptor) (5B7)

Epithelial Membrane Antigen. See CONFIRM EMA (Epithelial Membrane Antigen) (E29)

Epithelial Related Antigen (MOC-31) 65EPR2764Y [clone] 50EPR3653 [clone] 35EPR3864 [clone] 67EPR3947 [clone] 114ER. See CONFIRM Estrogen Receptor (ER) (SP1)ERG (EPR3864) 67ER-PR8 [clone] 116CONFIRM Estrogen Receptor (ER) (SP1) 67

fF3 [clone] 25F5D [clone] 100Factor VIII Related Antigen (polyclonal) 68Factor XIIIa (AC-1A1) 68Factor XIIIa (EP3372) 69Fascin (55k-2) 69Field Operations 201Follicle Stimulating Hormone. See FSH (Follicle

Stimulating Hormone) (polyclonal)Follicular Dendritic Cell (CNA.42) 70FSH (Follicle Stimulating Hormone)

(polyclonal) 70Fundamentals of Immunohistochemistry

training course 194

GG3 [clone] 126G11 [clone] 83G168-728 [clone] 93G219-1129 [clone] 94Galectin-3 (9C4) 71GA-R2 & HIR2 [clone] 74Gastrin (polyclonal) 71GC33 [clone] 75GCDFP-15 (EP1582Y) 72GFAP (Glial Fibrillary Acidic Protein) (EP672Y)

72GI191E/A8 [clone] 24Giemsa Staining Kit 180Glial Fibrillary Acidic Protein. See GRAP (Glial

Fibrillary Acidic Protein) (EP672Y)Glucagon (polyclonal) 73GLUT-1 (polyclonal) 73Glycophorin A (GA-R2 & HIR2) 74Glypican-3 (1G12) 74Glypican 3 (GC33) 75GMS II Staining Kit 179Goat anti-Ms Alk-Phos Cocktail 139Granzyme B (polyclonal) 75

hH23 [clone] 95HAM-56 [clones] 89HBME-1 [clone] 92hCG. See Human Chorionic Gonadotropin (hCG)

(polyclonal)Helicobacter pylori (polyclonal) 76Hematoxylin 149Hematoxylin II 149Hepatocyte Specific Antigen. See HSA

(Hepatocyte Specific Antigen) (0CH1E5)INFORM HER2 DNA Probe 155INFORM HER2 Dual ISH DNA Probe Cocktail

154PATHWAY HER-2/neu (4B5) 77, 78HGAL (MRQ-49) 79hGH. See Human Growth Hormone (hGH)

(polyclonal)HHF35 [clone] 20HHV-8 (Human Herpes Virus Type 8) (13B10) 79HMB45 [clone] 92hPL. See Human Placental Lactogen (hPL)

(polyclonal)HSA (Hepatocyte Specific Antigen) (0CH1E5)

80HUC1-1 [clone] 19Human Chorionic Gonadotropin (hCG)

(polyclonal) 80Human Growth Hormone (hGH) (polyclonal) 81Human Herpes Virus Type 8. See HHV-8 (Human

Herpes Virus Type 8) (13B10)

APPENDIX | Index

208 ventana medical systems, inc. | 800.227.2155

Page 223: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Human Placental Lactogen (hPL) (polyclonal) 81

Hybridization buffers 146

iIgA (Immunoglobulin A) (polyclonal) 82IgD (polyclonal) 82CONFIRM IGF-1 Receptor (G11) 83IgG (Immunoglobulin G) (polyclonal) 83IgM (Immunoglobulin M) (polyclonal) 84Immunoglobulin A. See IgA (Immunoglobulin A)

(polyclonal)Immunoglobulin G. See IgG (Immunoglobulin G)

(polyclonal)Immunoglobulin M. See IgM (Immunoglobulin M)

(polyclonal)Inhibin, alpha (R1) 84Insulin (polyclonal) 85Iron Staining Kit 180iScan Coreo Au Slide Scanner 185–186

Specifications 186ISH Red Counterstain 149

jJC70 [clone] 40Jones H&E Staining Kit 173Jones Light Green Staining Kit 174JS5B4 [clone] 125

kCONFIRM Kappa (polyclonal) 85Kappa DNP Probe (495-524) 155Kappa DNP Probe (538-567) 155Kappa DNP Probe (597-626) 155Kappa DNP Probe (637-666) 155KBA.62 [clone] 91CONFIRM Ki-67 (30-9) 86KP-1 [clone] 47Ksp-Cadherin (MRQ-33) 86

lL26 [clone] 36L60 [clone] 41CONFIRM Lambda (polyclonal) 87Lambda DNP Probe (664-693) 156Lambda DNP Probe (704-733) 156Lambda DNP Probe (768-797) 156Lambda DNP Probe (826-855) 156LCA. See CONFIRM CD45 (LCA) (RP2/18);

See CD45 (LCA) (2B11 & PD7/26)LH. See Luteinizing Hormone (LH) (polyclonal)Light Green for PAS 171

Liquid Coverslip (High Temperature) 145Liquid Coverslip (Low Temperature) 182LK2H10 [clone] 51LL002 [clone] 60CONFIRM LMO2 (1A9-1) 87LN2 [clone] 47Luteinizing Hormone (LH) (polyclonal) 88Lysozyme (polyclonal) 88

mM1 [clone] 94Macrophage (HAM-56) 89Mammaglobin (31A5) 89CONFIRM MART-1/melan A (A103) 90MB1 [clone] 43Melanoma Associated Antigen (KBA.62) 91Melanoma Associated Antigen (PNL2) 91CONFIRM Melanosome (HMB45) 92Mesothelial Cell (HBME-1) 92CONFIRM MITF (C5/D5) 93MLH1 (G168-728) 93MLH-1 (M1) 94MMA [clone] 35MOC-31 [clone] 65MoMap Kit 148MOPC21 [clone] 102MRQ-2 [clone] 105MRQ-3 [clone] 22MRQ-10 [clone] 106MRQ-11 [clone] 31MRQ-18 [clone] 96MRQ-19 [clone] 97MRQ-20 [clone] 98MRQ-21 [clone] 104MRQ-22 [clone] 111MRQ-23 [clone] 112MRQ-26 [clone] 49MRQ-31 [clone] 109MRQ-33 [clone] 86MRQ-40 [clone] 121MRQ-42 [clone] 44MRQ-43 [clone] 99MRQ-46 [clone] 122MRQ-49 [clone] 79MSH2 (G219-1129) 94CONFIRM MSH6 (44) 95MUC1 (H23) 95MUC2 (MRQ-18) 96MUC5AC (MRQ-19) 97MUC6 (MRQ-20) 98Mucicarmine Staining Kit 172Mucopolysaccharides. See Stains for MucinsMUM1 (MRQ-43) 99Myelin Basic Protein (polyclonal) 99Myeloperoxidase (polyclonal) 100Myogenin (F5D) 100Myoglobin (polyclonal) 101Myosin, Smooth Muscle (SMMS-1) 101

nNapsin A (polyclonal) 102NB10 [clone] 113Negative Control Mouse Ig (MOPC21) 102CONFIRM Negative Control Rabbit Ig 102Neurofilament (2F11) 103Neuron Specific Enolase. See NSE (Neuron

Specific Enolase (E27)NexES Special Stainer 167

Specifications 168NexES Special Stains Support and Maintenance

AgreementsPremier Agreement 198Standard Agreement 198

NGFR (MRQ-21) 104NK-1 [clone] 45NKI/C3 [clone] 46NSE (Neuron Specific Enolase) (E27) 105

oO13 [clone] 48OC125 [clone] 27Oct-2 (MRQ-2) 105Oct-4 (MRQ-10) 106OmniMap anti-Ms HRP 139OmniMap anti-Rat HRP 139OmniMap anti-Rb HRP 139OmniMap DAB anti-Mouse (Ms) 138OmniMap DAB anti-Rabbit (Rb) 138OmniMap DAB anti-Rat 139

Pp21WAF1 (DCS-60.2) 106p27kip1 (SX53G8) 107CONFIRM p53 (DO-7) 108p53 (Bp-53-11) 107p63 (4A4) 108p120 (98) 109Parathyroid Hormone (PTH) (MRQ-31) 109PASE/4LJ [clone] 117PAS Staining Kit 170PAX-2 (polyclonal) 110CONFIRM PAX5 (SP34) 110PD-1 (MRQ-22) 111Perforin (MRQ-23) 112P-GF.44C [clone] 123PGP 9.5 (polyclonal) 112PHH3 [clone] 113Phosphohistone-H3 (PHH3) 113Placental Alkaline Phosphatase (PLAP)

(NB10) 113PLAP. See Placental Alkaline Phosphatase (PLAP)

(NB10)PMS2 (EPR3947) 114PN-15 [clone] 117

Index | APPENDIX

800.227.2155 | www.ventana.com 209

Page 224: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

PNL2 [clone] 91Podoplanin (D2-40) 114Primary Antibodies 18-131CONFIRM Progesterone Receptor

(PR) (1E2) 115Prolactin (polyclonal) 115Prostate Specific Antigen. See CONFIRM

(Prostate Specific Antigen) (polyclonal); See PSA (Prostate Specific Antigen) (ER-PR8)

Prostatic Acid Phosphatase. See PSAP (Prostatic Acid Phosphatase) (PASE/4LJ)

Protease 1 146Protease 2 146Protease 3 146CONFIRM PSA (Prostate Specific Antigen)

(polyclonal) 116PSA (Prostate Specific Antigen) (ER-PR8) 116PSAP (Prostatic Acid Phosphatase)

(PASE/4LJ) 117PSS Diluent 147PTH. See Parathyroid Hormone (PTH) (MRQ-31)

QQBEnd/10 [clone] 40, 41QD DAPI 149QD Map 605 SA-25 144QD Map 655 SA-25 144Quantum Dot Detection 144

rR1 [clone] 84R4A 119RBC2/3D5 [clone] 120RCC. See Renal Cell Carcinoma (RCC) (PN-15)Reaction Buffer 145Red Counterstain II 149RedMap Kit 140Renal Cell Carcinoma (RCC) (PN-15) 117Reticulum II Staining Kit 176RiboCC 145RiboHybe 146RiboMap Kit 147RiboWash 145RP2/18 [clone] 42

sCONFIRM S100 (4C4.9) 118CONFIRM S100 (polyclonal) 118S-Block 146Secondary antibodies 141SMMS-1 [clone] 101Smoothelin (R4A) 119Somatostatin (polyclonal) 119SP1 [clone] 67

SP4-R [clone] 54SP11 [clone] 120SP18 [clone] 48SP19 [clone] 33SP21 [clone] 54SP23 [clone] 38SP31 [clone] 62SP33 [clone] 61SP34 [clone] 110SP35 [clone] 32SP37 [clone] 42SP44 [clone] 53SP52 [clone] 58SP57 [clone] 34SP65 [clone] 30SP67 [clone] 34SP73 [clone] 127SP92 [clone] 25SP94 [clone] 33SP95 [clone] 60SP99 [clone] 59SP104 [clone] 38Special Stains 168–182Special Stains Cleaning Kit 182Special Stains Wash (10x) 182Specifications 163Spectrin (RBC2/3D5) 120Stains for connective tissue 173Stains for Microrganisms 177Stains for Mucins 170Steiner Cleaning Kit 178Steiner Staining Kit 178Streptavidin-biotin detection 140SX53G8 [clone] 107SYMPHONY B 164SYMPHONY C 164SYMPHONY Cleaning Kit 164SYMPHONY Clear 164SYMPHONY D 164SYMPHONY Desiccant Filter 164SYMPHONY H&E operator training course 194SYMPHONY high definition H&E system

161-164SYMPHONY N1 164SYMPHONY N2+ 164SYMPHONY OPTISURE Coverslips 164SYMPHONY Support and Maintenance

AgreementsSYMPHONY Premier 199SYMPHONY Standard 199

SYMPHONY Tray Kit 164SYMPHONY W 164CONFIRM Synaptophysin (SP11) 120Synaptophysin (MRQ-40) 121Syndecan-1. See CD138 (Syndecan-1) (B-A38)

TT311 [clone] 126TAG-72 (B72.3) 121Tartrate-Resistant Acid Phosphatase. See TRAcP

(Tartrate-Resistant Acid Phosphatase) (9C5)

T-bet (MRQ-46) 122TdT (Terminal Deoxynucleotidyl Transferase)

(polyclonal) 122Terminal Deoxynucleotidyl Transferase. See TdT

(Terminal Deoxynucleotidyl Transferase) (polyclonal)

TF3H8-1 [clone] 30CONFIRM Thymidine Phosphorylase (P-GF.44C)

123Thyroglobulin (2H11+6E1) 123Thyroid Stimulating Hormone (TSH) (polyclonal)

124CONFIRM Thyroid Transcription Factor-1 (TTF-

1) (8G7G3/1) 124CONFIRM Topoisomerase IIa (JS5B4) 125TRAcP (Tartrate-Resistant Acid Phosphatase)

(9C5) 125Trichrome II Blue Staining Kit 174Trichrome III Blue Staining Kit 175Trichrome III Green Staining Kit 175Tryptase (G3) 126TSH. See Thyroid Stimulating Hormone (TSH)

(polyclonal)TTF-1. See CONFIRM Thyroid Transcription

Factor-1 (TTF-1) (8G7G3/1)CONFIRM Tyrosinase (T311) 126

uU6 DNP Probe 156UCHL-1 [clone] 44UltraMap anti-Goat Hrp 139UltraMap anti-Ms Alk- Phos 139UltraMap anti-Ms Hrp 139UltraMap anti-Rat Hrp 139UltraMap anti-Rb Alk- Phos 139UltraMap anti-Rb Hrp 139UltraMap Blue anti-Ms 137UltraMap Blue anti-Rb 138UltraMap DAB anti-Ms 136UltraMap DAB anti-Rat 136UltraMap DAB anti-Rb 136UltraMap Goat anti-Rb 139UltraMap Multimer Detection Kits 136UltraMap Red anti-Ms 137UltraMap Red anti-Rb 137Universal Secondary Antibody 148Uroplakin III (SP73) 127

APPENDIX | Index

210 ventana medical systems, inc. | 800.227.2155

Page 225: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

vV9 [clone] 128Villin (CWWB1) 127Vim 3B4 [clone] 128CONFIRM Vimentin (V9) 128CONFIRM Vimentin (Vim 3B4) 128

WWT1 (6F-H2) 129

ZZAP-70 (2F3.2) 129

Index | APPENDIX

800.227.2155 | www.ventana.com 211

Page 226: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research
Page 227: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research
Page 228: USA 2012 Product Catalog research applications · Research Applications 2012 Product Catalog research applications. Advanced product portfolio ... to deliver the most advanced research

Ventana Medical Systems, Inc.1910 E. Innovation Park DriveTucson, Arizona 85755USA+1 (520) 887 2155(800) 227 2155

www.ventana.com

© 2012 Ventana Medical Systems, Inc.

VENTANA, the VENTANA logo, BENCHMARK, ChipMap, CONFIRM, INFORM, NEXES, Optisure, PATHWAY, RiboMap, iScan, SYMPHONY, ultraView, VANTAGE, VIAS and VIRTUOSO are trademarks of Roche.All other trademarks are the properties of their respective owners.N2448 1211A

Ventana Medical System

s, Inc. 2012 Product Catalog | R

esearch Applications

2012 Product Catalog research applications


Recommended