Transcript
Page 1: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  &  Introduc4on  to  Python    

Feb  19  2015  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   1  

Page 2: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Today’s  Class  

•  Brief  discussion  on  Project  1  •  Intro  to  text  analysis  problems  •  Intro  to  Python  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   2  

Page 3: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Get  Full  Credit  on  Project  1  

•  Use  sheets  for  intermediate  results,  interac4vity  •  Display  your  data  in  different  ways  (graph,  table,  etc.)  •  Follow  the  rules:  –  only  data,  parameters,  labels,  and  formulas.  

•  Use  “notes”  on  cells  for  explana4on  –   only  if  anything  out  of  the  ordinary  

•  Try  to  avoid  “hand  work”  and  use  formulas  instead!  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   3  

Page 4: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Get  Full  Credit  on  Project  1  

•  Remember  to  address  your  claim  – My  hypothesis  is  correct/incorrect  because  …  –  X%  of  the  4me,  my  hypothesis  was  correct…  

•  Be  sure  to  explain  what  obstacles  you  encountered  •  Have  a  “Discussion  and  Conclusion”  –  Reflect  on  things  like:  

•  “Is  this  data  too  unreliable  for  me  to  trust  the  conclusion?”  •  “Was  a  threshold  of  80%  really  reasonable?”  •  “Did  elimina4ng  countries  that  lacked  data  for  any  single  year  make  the  analysis  compromised  somehow?”    

•  Look  at  the  rubric!  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   4  

Page 5: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   5  

Intermediate  Results  

 Put  your  raw  data  on  its  own  sheet  and  refer  to  it  using  a  formula  when  you  do  your  analysis  on  other  sheets.  

Page 6: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   6  

Intermediate  Results  

 Use  a  new  sheet  when  the  current  sheet  already  has  a  table  with  some  meaningful  data  in  it.    Don’t  lose  that  data.  

Page 7: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   7  

Interac4vity  

Use  data  valida3on,  probably  with  a  list  (pull  down),  to  add  some  interac4ve  component.      See  ACT1-­‐4  for  an  example  using  MATCH  and  OFFSET.  

Page 8: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   8  

Presenta4on  

Try  out  different  ways  to  present  your  data.    Make  a  chart  from  your  final  results.  

 If  you’re  not  sure  what  to  do,  ask  a  TA  or  me.  

Page 9: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   9  

Address  Your  Hypothesis  

 Remember  to  relate  your  results  back  to  the  hypothesis.  

 Was  it  true?    Was  it  true  in  some  cases?    Why  might  it  have  been  false?  

Page 10: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   10  

Obstacles  and  Reflec4on  

 What  was  difficult?  What  are  the  limita4ons  of  the  analysis  you  did?    You  must  reflect  on  your  project  and  what  you  learned.  

Page 11: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   11  

Check  the  rubric  before  you  submit  

Page 12: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Text  Analysis  and  Python  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   12  

We’re  star4ng  a  new  unit  in  our  course!    

Page 13: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   13  

Define  Problem   Find  Data  

Write  a  set  of  instruc4ons  

Solu4on  

Computer  

Page 14: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   14  

Define  Problem   Find  Data  

Write  a  set  of  instruc4ons  

Solu4on  

Computer  

ACTACGTCGACTACGATCACGATCGCGCGATCACGTATTTACGATCAGCTACGATCGATCTACGATCGTAGCTGTGATCG  

Page 15: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   15  

Define  Problem   Find  Data  

Write  a  set  of  instruc4ons  

Solu4on  

Computer  

Build  a  Concordance  of  a  text  •  Loca,ons  of  words  •  Frequency  of  words  

ACTACGTCGACTACGATCACGATCGCGCGATCACGTATTTACGATCAGCTACGATCGATCTACGATCGTAGCTGTGATCG  

Page 16: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Concordances  

Alphabe4cal  index  of  all  words  in  a  text  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   16  

Word   Page  Numbers  

Apple   4,7,10,27  

Banana   77,110,130  

Carrot   50,101  

Date   9  

…   …  

Page 17: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Concordances  

•  Before  computers,  was  a  huge  pain.  •  What  texts  might  have  had  concordances?  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   17  

hlp://en.wikipedia.org/wiki/Concordance_(publishing)  

Page 18: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Concordances  

•  Before  computers,  was  a  huge  pain.  •  What  texts  might  have  had  concordances?  – The  Bible  – The  Quran  – The  Vedas  – Shakespeare  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   18  

hlp://en.wikipedia.org/wiki/Concordance_(publishing)  

Page 19: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Concordances  

•  Before  computers,  was  a  huge  pain.  •  What  texts  might  have  had  concordances?  – The  Bible  – The  Quran  – The  Vedas  – Shakespeare  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   19  

Not  a  “New”  Problem:  First  Bible  Concordance  completed  in  1230  

hlp://en.wikipedia.org/wiki/Concordance_(publishing)  

Page 20: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Concordances  

•  How  long  would  the  King  James  Bible  take  us?  – 783,137  words  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   20  

hlp://agards-­‐bible-­‐4meline.com/q10_bible-­‐facts.html  

Page 21: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Concordances  

•  How  long  would  the  King  James  Bible  take  us?  – 783,137  words    

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   21  

hlp://agards-­‐bible-­‐4meline.com/q10_bible-­‐facts.html  

800,000  *  (3  min.  to  look  up  word  and  put  page  #)  =  2,400,000  minutes  =  40,000  hours  =  1,667  days  =  4.5  years  

Page 22: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Concordances  

•  How  long  would  the  King  James  Bible  take  us?  – 783,137  words  

 Takes  70  hours  to  read  the  King  James  Bible  aloud    

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   22  

hlp://agards-­‐bible-­‐4meline.com/q10_bible-­‐facts.html  

800,000  *  (3  min.  to  look  up  word  and  put  page  #)  =  2,400,000  minutes  =  40,000  hours  =  1,667  days  =  4.5  years  

Page 23: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Strong’s  Concordance  

•  Concordance  of  the  King  James  Bible  •  Published  in  1890  by  James  Strong  

Wikipedia  

hlp://www.chris4anbook.com/reader/?item_no=563788  CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   23  

Page 24: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

From  Concordance  to  Word  Frequency  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   24  

Suppose  our  text  has  1000  words  total.  

Word   Page  Numbers  

#  of  Occurrences  

Word  Frequency  

Apple   4,7,10,27   4   4/1000  

Banana   77,110,130   3   3/1000  

Carrot   50,101   2   2/1000  

Date   9   1   1/1000  

…   …   …   …  

Page 25: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Google  Ngrams  

•  Google  (verb)  “Google  n-­‐grams”  •  ngram:  a  set  of  n  words  – “hello”  is  a  1-­‐gram  – “hello  there”  is  a  2-­‐gram  

•  Click  on  “About  Google  Books  Ngram  Viewer”  for  more  informa4on    

•  Ques4on:  what  is  the  data  source  here?    CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   25  

Page 26: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   26  

Define  Problem   Find  Data  

Write  a  set  of  instruc4ons  

Solu4on  

Computer  

Build  a  Concordance  of  a  text  •  Loca,ons  of  words  •  Frequency  of  words  •  Word  frequencies  across  4me  

ACTACGTCGACTACGATCACGATCGCGCGATCACGTATTTACGATCAGCTACGATCGATCTACGATCGTAGCTGTGATCG  

Page 27: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

The  Wizard  of  OZ  

•  About  40  Books,  wrilen  by  7  different  authors  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   27  

Lyman  Frank  Baum   Ruth  Plumly  Thompson  

hlp://www.ssc.wisc.edu/~zzeng/soc357/OZ.pdf  

#1   #14   #15   #16   #33  

…   …  

Page 28: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

The  Wizard  of  OZ  

•  About  40  Books,  wrilen  by  7  different  authors  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   28  

Lyman  Frank  Baum  (1856-­‐1919)  

Ruth  Plumly  Thompson  

hlp://www.ssc.wisc.edu/~zzeng/soc357/OZ.pdf  

#1   #14   #15   #16   #33  

…   …  

Published  in  1921  

Page 29: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

The  Wizard  of  OZ  

•  About  40  Books,  wrilen  by  7  different  authors  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   29  

Lyman  Frank  Baum  (1856-­‐1919)  

Ruth  Plumly  Thompson  

hlp://www.ssc.wisc.edu/~zzeng/soc357/OZ.pdf  

#1   #14   #15   #16   #33  

…   …  

Published  in  1921  

Page 30: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

The  Federalist  Papers  •  85  ar4cles  wrilen  in  1787  to  promote  the  ra4fica4on  of  the  US  Cons4tu4on  

•  In  1944,  Douglass  Adair  guessed  authorship  – Alexander  Hamilton  (51)  –  James  Madison  (26)  –  John  Jay  (5)  –  3  were  a  collabora4on  

•  Corroborated  in  1964  by  a  computer  analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   30  

Wikipedia  

hlp://pages.cs.wisc.edu/~gfung/federalist.pdf  

Page 31: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   31  

Define  Problem   Find  Data  

Write  a  set  of  instruc4ons  

Solu4on  

Computer  

Build  a  Concordance  of  a  text  •  Loca,ons  of  words  •  Frequency  of  words  •  Word  frequencies  across  4me  

•  Determine  authorship  ACTACGTCGACTACGATCACGATCGCGCGATCACGTATTTACGATCAGCTACGATCGATCTACGATCGTAGCTGTGATCG  

Page 32: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   32  

Define  Problem   Find  Data  

Write  a  set  of  instruc4ons  

Solu4on  

Computer  

Build  a  Concordance  of  a  text  •  Loca,ons  of  words  •  Frequency  of  words  •  Word  frequencies  across  4me  

•  Determine  authorship  •  Count  labels  to  determine  

liberal  media  bias  

ACTACGTCGACTACGATCACGATCGCGCGATCACGTATTTACGATCAGCTACGATCGATCTACGATCGTAGCTGTGATCG  

Page 33: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

How  are  we  going  to  analyze  texts?  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   33  

firehow.com  

Excel  

Numerical  Data  

Page 34: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

How  are  we  going  to  analyze  texts?  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   34  

firehow.com  

Excel  

Numerical  Data  

Textual  Data  

Page 35: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

How  are  we  going  to  analyze  texts?  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   35  

Makita  Cordless  Chain  Saw,  $270  

Textual  Data  

Page 36: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

How  are  we  going  to  analyze  texts?  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   36  

Textual  Data  

9poundhammer.blogspot.com  

Python:  A  Programming  Language  Free!  

Page 37: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Textual  Analysis  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   37  

Define  Problem   Find  Data  

Write  a  set  of  instruc4ons  

Solu4on  

Python  

Build  a  Concordance  of  a  text  •  Loca,ons  of  words  •  Frequency  of  words  •  Word  frequencies  across  4me  

•  Determine  authorship  •  Count  labels  to  determine  

liberal  media  bias  

ACTACGTCGACTACGATCACGATCGCGCGATCACGTATTTACGATCAGCTACGATCGATCTACGATCGTAGCTGTGATCG  

Page 38: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

“Python”  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   38  

Page 39: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

“Python”  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   39  

•  A  language  for  giving  the  computer  instruc4ons.  It  has  syntax  and  seman4cs.  

Page 40: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

“Python”  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   40  

•  A  language  for  giving  the  computer  instruc4ons.  It  has  syntax  and  seman4cs.  

•  Might  say  “write  a  Python  program”,  meaning  “write  instruc4ons  in  the  Python  language”  

Page 41: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

“Python”  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   41  

•  A  language  for  giving  the  computer  instruc4ons.  It  has  syntax  and  seman4cs.  

•  Might  say  “write  a  Python  program”,  meaning  “write  instruc4ons  in  the  Python  language”  

•  There  is  an  interpreter  (e.g.,  IDLE)  that  takes  Python  instruc4ons  and  executes  them  with  the  CPU,  etc.  

Page 42: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Install  •  Let’s  install  Python  2.7.9    •  www.python.org/downloads/  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   42  

Page 43: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Install  

•  Lets  open  IDLE  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   43  

Page 44: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  •  Expressions  are  inputs  that  Python  evaluates  –  Expressions  return  an  output  –  Like  using  a  calculator  

Type  the  expressions  below    a{er  ‘>>>’  and  hit  Enter  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   44  

1.   Expressions  2.  Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

Page 45: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  •  Expressions  are  inputs  that  Python  evaluates  –  Expressions  return  an  output  –  Like  using  a  calculator  

Type  the  expressions  below    a{er  ‘>>>’  and  hit  Enter  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   45  

1.   Expressions  2.  Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 4+2 6 >>> 4-2 2 >>> 4*2 8 >>> 4/2 2

Page 46: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Assignments  do  not  have  an  output,  they  are  stored  in  memory.  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   46  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

Page 47: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Assignments  do  not  have  an  output,  they  are  stored  in  memory.  – We’ve  done  this  kind  of  thing  in  Excel  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   47  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

We  have  assigned  the  number  1  to  cell  A1.  

Page 48: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Assignments  do  not  have  an  output,  they  are  stored  in  memory.  – We’ve  done  this  kind  of  thing  in  Spreadsheets  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   48  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

We  have  assigned  the  number  1  to  cell  A1.  

Let’s  rename  cell  A1  to  x.  

Page 49: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Assignments  do  not  have  an  output,  they  are  stored  in  memory.  – We’ve  done  this  kind  of  thing  in  Spreadsheets  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   49  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

Let’s  rename  cell  A1  to  x.  

>>> x = 1

Page 50: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Assignments  do  not  have  an  output,  they  are  stored  in  memory.  – We’ve  done  this  kind  of  thing  in  Spreadsheets  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   50  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> x = 1

variable   expression  =  

Memory  

Variable  Name   Value  

x   1  

Page 51: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Assignments  do  not  have  an  output,  they  are  stored  in  memory.  – We’ve  done  this  kind  of  thing  in  Spreadsheets  

– We  can  now  use  x  in  expressions!  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   51  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> x = 1

Memory  

Variable  Name   Value  

x   1  

>>> x+1 2 >>> (x+2)*3 9

Page 52: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  You  can  name  your  variables  anything  

•  Well,  almost  anything  – No  spaces,  operators,  punctua4on,  number  in  the  first  posi4on  

•  Variables  usually  start  with  a  lowercase  leler  and,  if  useful,  describe  something  about  the  value.  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   52  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> steve = 100 >>> myNumber = 12345 >>> noninteger = 4.75

Page 53: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Choices  

•  Why  are  those  the  rules  for  names?    •  Someone  thought  about  it  and  made  a  choice  •  Usually  based  on  years  of  experience  •  Many  choices  seem  crazy...  – Un4l  one  day  you  see  they’re  obviously  correct  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   53  

Page 54: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Try  this:  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   54  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 3/2

Page 55: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Try  this:  •  There  are  two  types  of  numbers  in  Python.    The  type()func4on  is  useful.  

     

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   55  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 3/2

>>> type(3/2) <type 'int'> >>> type(1.5) <type 'float'>

Page 56: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Try  this:  •  There  are  two  types  of  numbers  in  Python.    The  type()func4on  is  useful.  

 •  Floats  are  numbers  that                                      display  with  decimal                                      points.      

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   56  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 3/2

>>> type(3/2) <type 'int'> >>> type(1.5) <type 'float'>

>>> 3.0/2.0 1.5

Page 57: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Try  this:  •  There  are  two  types  of  numbers  in  Python.    The  type()func4on  is  useful.  

 •  Floats  are  decimals.      

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   57  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 3/2

>>> type(3/2) <type 'int'> >>> type(1.5) <type 'float'>

>>> 3.0/2.0 1.5

General  Rule:  Expressions  for  a  par4cular  type  will  output  that  same  type!  

Page 58: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Strings  are  sequences  of  characters,  surrounded  by  single  quotes.    

     •  The  +  operator  concatenates  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   58  

1.   Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 'hi' 'hi' >>> myString = 'hi there' >>> myString 'hi there'

Page 59: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Strings  are  sequences  of  characters,  surrounded  by  single  quotes.    

     •  The  +  operator  concatenates  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   59  

1.   Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 'hi' 'hi' >>> myString = 'hi there' >>> myString 'hi there'

General  Rule:  Expressions  for  a  par4cular  type  will  output  that  same  type!  

Page 60: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Strings  are  sequences  of  characters,  surrounded  by  single  quotes.    

     •  The  +  operator  concatenates  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   60  

1.   Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> 'hi' 'hi' >>> myString = 'hi there' >>> myString 'hi there'

>>> endString = ' class!' >>> myString + endString 'hi there class!' >>> newString = myString + endString >>> newString 'hi there class!'

Page 61: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Lists  are  an  ordered  collec4on  of  items  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   61  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> [5,10,15] [5, 10, 15] >>> myList = [5,10,15] >>> myList [5, 10, 15] >>> stringList = ['hi','there','class'] >>> stringList ['hi', 'there', 'class']

Page 62: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  •  Lists  are  an  ordered  collec4on  of  items  

   •  Individual  items  are  elements  •  The  +  operator  concatenates  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   62  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> [5,10,15] [5, 10, 15] >>> myList = [5,10,15] >>> myList [5, 10, 15] >>> stringList = ['hi','there','class'] >>> stringList ['hi', 'there', 'class']

>>> myList + stringList [5, 10, 15, 'hi', 'there', 'class']

Page 63: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  To  get  an  element  from  a  list,  use  the  expression                                                      where  i  is  the    index.  O{en  spoken:  “myList  sub  i”  

•  List  indices  start  at  0!  

•  What  does                                                            do?  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   63  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> myList[i]

>>> myList[0] 5 >>> myList[1] 10 >>> myList[2] 15

>>> myList[1] = 4

Page 64: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  To  get  a  range  of  elements  from  a  list,  use  the  expression                                                      where  i  is  the  start  index  (inclusive)  and  j  is  the  end  index  (exclusive).  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   64  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> myList[i:j]

>>> myList [5, 4, 15] >>> myList[0:2] [5, 4] >>> myList[1:3] [4, 15] >>> newList = [2,5,29,1,9,59,3] >>> newList [2, 5, 29, 1, 9, 59, 3] >>> newList[2:6] [29, 1, 9, 59]

Page 65: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Indexing  and  ranges  also  work  on  Strings.  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   65  

1.  Expressions  2.  Assignments  

a)  Variables  3.   Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

>>> myString 'hi there' >>> myString[0] 'h' >>> myString[5] 'e' >>> myString[6] 'r' >>> myString[0:6] 'hi the'

Page 66: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Introduc4on  to  Python  

•  Remember  what  assignments  do  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   66  

1.  Expressions  2.   Assignments  

a)  Variables  3.  Types  

a)  Integers  b)  Floats  c)  Strings  d)  Lists  

Memory  

Variable  Name   Value  

x 1

amountOfEggs 100

myNumber 12345

noninteger 4.75

myString 'hi there'

endString ' class!'

myList [5,4,15]

stringList ['hi','there','class']

newList [2,5,29,1,9,59,3]

Page 67: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

Class  Review  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   67  

Python  So  Far  (to  be  updated/refined!)  1.  Expressions  •  Evaluate  input  and  returns  some  output  (calculator)  

2.  Variable  Assignments:  <variable>  =  <expression>  •  Store  the  value  of  the  expression  in  the  variable  

instead  of  outpu�ng  the  value.  •  There  is  always  an  equals  sign  in  an  assignment  •  Variables  can  be  named  many  things  •  List  assignments:  <listvar>[<index>]  =  <expression>  

3.  Types  •  Integers  vs.  Floats  (Decimals)  •  Strings  in  single  quotes  •  Lists  are  sets  of  other  types  •  We  can  index  into  Strings  &  Lists  

•  Indexed  star3ng  at  0!  

General  Rule:  Expressions  for  a  par4cular  type  will  output  that  same  type!  

Page 68: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

A  brief  review  of  things  you  didn’t  know  you’d  learned  

•  In  a  spreadsheet,  there  are  many  types  of  data  

•  Numbers  (start  with  +/-­‐  or  a  digit)  •  Strings  (nondigit-­‐start,  or  start  with  ‘  )  •  Formulas  (start  with  =  )  •  Ranges  (B2,  B2:B4,  B2:D5)  •  Errors  (#N/A)  •  Blanks  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   68  

Page 69: Textual(Analysis(&(Introduc4on( to(Python((cs.brown.edu › courses › cs0931 › 2014-spring › 2-text_analysis › ...Textual(Analysis(CSCI0931(A(Intro.(to(Comp.(for(the(Humani4es(and(Social(Sciences(

What  shows  up  in  a  cell  •  If  a  formula  evaluates  to  a  number  or  string,  that  number  or  string  

•  If  it  evaluates  to  a  range,  the  value  in  the  first  cell  of  that  range  ...some4mes  –  If  you  write  =A1:A6,  you  get  A1  –  If  you  write  =OFFSET(A1:A6,  0,  0),  Gsheets  fills  in  adjacent  cells;  excel  just  fills  in  one  cell  

•  If  evalua4on  leads  to  an  error,  then  #N/A  •  Mostly,  we  never  no4ce  any  of  this  •  In  Python,  the  rules  have  greater  consistency,  and  because  results  aren’t  instantly  visible,  knowing  the  rules  malers  more  

CSCI  0931  -­‐  Intro.  to  Comp.  for  the  Humani4es  and  Social  Sciences   69  


Recommended