WWWWWWWWWWWWWiiiiiiiiiiinnnnnnnnnntttttttttteeeeeeeeeeerrrrrrrrrrrrrrrrrr 22222222222222222222222222222222222220000000000000000000000111111111144444444444444
2
TThanksgiving and Christmas holy days are always accompa-nied by various rituals and traditions common and unique to each family. Every year here at the Seminary one of the
highlights of our community banquet is Christmas around the world. We delight to hear the unique ways people of every culture remember and celebrate the incarnation – God’s gift of His Son to us, with us, for us, in us!
Tradition is important. It should be biblical, personal and cul-tural. When I think of our Pentecostal tradition, I have never seen it as limited to one or two centuries. No, we claim the whole Bible (not just Acts!) and the whole of the Christian tradition (from which we draw selectively). Everyone has a tradition and tradi-tions. Th ere is no such thing as a neutral or history-less faith. We learn from those who have gone ahead of us and have passed on treasures.
Take the watch words “Wesleyan”, “Holiness”, and “Pentecostal”. Are these historical or theological descriptors? And, of course, the answer is yes.
Our Wesleyan heritage includes personal and social holiness, concern for justice and mercy, and the overriding emphasis on sanctifi cation as the love of God reigning in our hearts by faith.
Holiness describes the awesome majestic and loving nearness of the God who alone is holy. All other gods are idols. Th is God is righteous, loving and powerful toward us. He directs, motivates and empowers us to follow Christ.
As Pentecostals we live to participate in the life and mission of God. For us, there is no choice between deciding to repent, fol-lowing Christ in discipleship and sharing in His mission. It is all one choice.
Each Christmas give the gift of tradition. Th e Christian tradi-tion. Th e Wesleyan Holiness Pentecostal tradition. Pass it on in prayer, love, giving, Word, and witness.
We love you. See you in the New Year, if Jesus tarries!
Contents3 Building Steps and Stoops
As Told by Wayne Flora
4 McKinley Joins the PTS Staff
6 Faculty Happenings
8 Alumni Stories
11 Seminary Graduate …Bible21
12 Gallery of Pentecost
14 Memorial and Honor Gifts
PENTECOSTALTHEOLOGICAL SEMINARY
PO Box 3330900 Walker Street NECleveland, TN 37320
1-800-226-9126423-478-7731www.ptseminary.edujterpstra@ptseminary.edu
ON THE COVER2013 Graduation
3
Building Steps and StoopsAS TOLD BY WAYNE FLORA
FFollowing my graduation from high school, I was confi dent I was called into pastoral
ministry so I took the fi rst step on that path by enrolling at Lee Col-lege (University). Lee was my com-pass, and I did not yet know where my journey would take me. Upon completion of my undergraduate education with a major in biblical-historical studies and a minor in New Testament Greek, I realized the next logical step in my min-istry formation was to go literally “across the street” to the Church of God School of Th eology (now Pentecostal Th eological Seminary) and enroll in the M.Div. program. I focused on pastoral care and counseling classes where I was mentored by faculty members that helped carve my path toward missional ministry. Th e Seminary refi ned my character and my con-viction about the importance of personal and ministerial integrity.
My heart never stopped being drawn to pastoral ministry and on October 9, 1988, the Univer-sity Church of God was birthed in Greenville, North Carolina. At
that time there were four families consisting of eighteen individuals, most of which are still with us and deeply devoted to the life and min-istry of the church. We celebrated our 25th Anniversary this year with over 350 in attendance.
Our church motto has been “A Growing Church of Caring People” and our mission statement is “Ex-alting God, Equipping Believers, and Embracing the World.” Uni-versity Church walks out that faith expression. We have built church-es and supported missionaries in Trinidad, China, Kenya, Romania, Indonesia, and Israel. We pres-ently support fi ve missionaries, including a local Hispanic mission in our community. We have ad-opted a nearby neighborhood and built steps and stoops for families, as well as a new playground, with recreational equipment, fencing, and picnic tables. Every year we adopt foster children and pro-
vide them Christmas in addition to supporting the Carolina Preg-nancy Center, Samaritan’s Purse, and Gideon’s International. Our local Mission Board just partnered
with a nearby Christian Church to provide “backpack” foods, school supplies, and essentials for school children whose families cannot provide these for them.
Everything I know and under-stand about pastoral ministry and caring for the needs of the commu-nity and people around the world has been drawn from my days of formation and practical ministry at PTS. I have been privileged to serve in state leadership in Eastern North Carolina on the Ministerial Development Board since 1992, have been the MIP Coordinator for the last 14 years, am our state’s fi rst Church Planting Consultation Team Chairman, and am serving my 3rd term on our State Council.
I now have the privilege to “give back” as Adjunct Professor for Lee University teaching theology and pastoral ministry. Lee University is giving me a unique opportunity to mentor and be part of the forma-tion of students around the world. I am proud to have my heritage, my education, and my spiritual forma-tion shaped by the Wesleyan Pen-tecostal Holiness ministerial train-ing I have received. I am pleased that I can now point other aspiring ministers to this substantive theo-logical and ministerial training!
4
Thank You for your support!
Th e PTS campus welcomes Shaun McKinley as director of recruitment and communications. Dr. Land com-mented about Mr. McKinley joining the Seminary by saying, “We are ex-cited about Shaun joining our staff . You can see from his education and experience that he will be a valued asset to the Seminary. His qualifi ca-tions for this position are impres-sive, and his outstanding personality and dedication to God and our Pen-tecostal faith make him a good fi t for us. We look forward to working with Shaun as he brings a standard of ex-cellence to the Seminary. It is not by accident that Shaun has excelled ev-erywhere he has been; I see a special anointing upon his life. We believe God has sent him to work with us at the Seminary.”
McKinley brings to the institution a background in communications,
marketing, church relations, and re-cruitment. He most recently served as director of enrollment services of the Division of Adult Learning at Lee University, directing the school’s re-cruitment and admissions eff orts for distance learners. Prior to serving at Lee University, McKinley served at the Church of God of Prophecy In-ternational Offi ces as liaison to the General Overseer, as well as direc-tor of global communications. His career has also included positions as marketing and development di-rector for Partnership for Families, Children, and Adults in Chatta-nooga and as associate pastor at the Peerless Road Church in Cleveland, TN.
“I am honored and humbled to have been selected to lead the re-cruitment and communication ef-forts for the Seminary into the fu-ture,” said McKinley. “Th e Seminary is having a signifi cant impact around the world for God’s Kingdom and I believe this is an exciting time in its history. I look forward to sharing its story as well as increasing our
connectivity to prospective and cur-rent students, alumni, and friends.”
McKinley holds a Bachelor of Sci-ence degree from Montana State University. He will earn a Master of Business Administration degree with emphasis in marketing from Bryan College in January 2014. During his undergraduate years, he received the DECA National Mar-keting Student of the Year Award, served a marketing internship with Congressman Denny Rehberg from Montana, and received a Market-ing Internship Award of Excellence from General Motors.
Th e Pentecostal Th eological Sem-inary, which formally began classes September 1, 1975, is located in Cleveland, Tennessee. Th e Semi-nary off ers ministerial certifi cate programs, six master’s level degrees, and a doctoral program. Recently, the Seminary launched fully online degree programs, the Center for Spiritual Leadership and Lifelong Learning, the Center for Global Ed-ucation and Mission, and the Center for Latino Studies.
McKinley Joins the PTS Staff
We have now gone to this…and YOU helped make it happen!
5
EElliizzaabbeetthh GGrraacceeBBuucckknneerr
FF.F.F JJJ.. MaMaMaM y y y ExExExE cececellllllenenenenenceceecececini PPPrerereacacachihihinngng AAAwawawardrddrd
Wilmer Estraaddaa-WCarrasquuiilloInternatiooonnnanal Studenent
Leadddeeerership AAwwardPePePePentntntnteecostal MiMinistry AwardPPPPP
Derrick AllenHarmon
Pentecostal Ministry AwarPPP d
David Ray JohnsonDAmerican BibleSociety BiblicallStudies Awwaard
CChhrriissttopherTThhoommas Kaskel
AmAmAmAmAmAmAmererererericicicicicananananan BBBBBibibibibibleleleleleSoSoSoSoSoSoSoS cicicicicicicietetetetetetete y y y y y y y y BiBiBiBiBiBiBiblblblblblblblicicicicicicicalalalalalalaTeTeTeTeTTeTeTeTeTeTTeacacacacacacacacacachihihihihihihihihhingngngngngngngngngngnng AAAAAAAAAAAwawawawawawawawawawaw rdrdrdrdrdrdrdrdrr
PPPPaaaauuuullllaaaa AAAAnnnnnnnn LLLLeeeettttttttCoCoCoCoCoCoCoCoCoCoCoCoCoCoCooCoC ununununununununununununununununnnseseseseseseseseseseseseseseseseses lililililililililililililililllingngngngngngngngngngngngngnggngngng AAAAAAAAAAAAAAAAAAwawawawawawawawawawawawawawawawawawardrdrdrdrdrdrdrdrdrdrdrdrdrdrdrddrrd
CCaatthheerriinneee HHH.. PPPaaayynneeeCCCaCaCaCaCaCaCaCaCaCaCaCaarerererererererereerere MMMMMMMMMMMinininininininnninnniinisisisisisisisisisissississtrtrtrtrtrtrtrtrtrtrtrtrtrt ieieieieieieieieieieieieies s s s s ssssssss AwAwAwAwAwAwAwAwwAwwwAwAA arararararararararaararaararddddddddddddddPePePePePePePPePePePentntntntntntntntnttnntntecececececececececososososososososossoosstatatatatatatatatataatall l lll llll MiMiMiMiMiMiMiMiMiMiMM nininininininiinininn ststttstststststststsss ryryryryryryryrryryyryyyy
AwAwAwAwAwAwAwAwAwAwAwAAwwwwarararararararararararardddddddddd
GGGGeeeerrrraaaalldd EEEEE.. MMMMMcccccGGGGGGGGiiiiinnnnnnnnnnniiiissssssGGGGAlAlAlAlAlAlAlAlumumumumumummummmumnununununununus s s s s ss s s ofofofofofofoffoffffofoffofofofofoffofofofoo ttttttheheheheehheh YYYYYYYYYYYYYeaeaeaeaeaeaeaeaaaaeaarrrrrrrrrr
AA special thanks to our alumni who rep-resented PTS at 2013 camp meetings around the country.
Daniel D. Tomberlin - South GeorgiaRobert W. Barnes - AlabamaJeff rey R. McAff ee - ArizonaLarry R. Massey - MississippiToby S. Morgan - New Mexico
Daniel J. Vassell - Ontario, CANADADennis J. Whitter - Minnesota
John F. Corcoran - OhioStephen D. Hobbs - Kentucky
Shea Hughes - TexasRob Miskowski - LouisianaRay E. Hurt - West Virginia
William C. “Bill” Coble- Western North Carolina
Bobby J. Sutherland - VirginiaJ. Randolph “Randy” Turpin, Jr. - Maine
Matthew Propes - MissouriShawn and Lanette Hitt – Michigan
Lorinda Roberts – Indiana
If you would like to serve the Seminaryin this role at local camp meetings,prayer conferences, denominational
events, and ministers’ meetings,contact Joy at 423.478.7731. View their bios at www.ptseminary.edu.
6
Emmanuel College in Franklin Springs, GA recent-ly honored Dr. Cheryl Johns by presenting her the G. Earl Beatty Servant Leadership Award. Emmanuel is Dr. Johns’ alma mater. Dr. Johns said, “To be honored by your family of origin is an amazing experience!” Th is prestigious lifetime achievement award honors a career marked by outstanding servant leadership on campus, in the local church and in the commu-nity. Dr. Johns joined the faculty of PTS in 1985 and is Professor of Discipleship and Christian Formation. While being integrally involved with PTS and also serving the Bradley/Cleveland community through the ministry of the Bradley Initiative for Church and Community, she has served as co-pastor of the New Covenant Church of God, a church she and her hus-band, Jackie, planted in 1989.
McGhee, Dan Morrison, Scott A. Ellington, Chris E.W. Green, Monte Lee Rice, Daniela C. Augustine, Patrick Oden, Daniel Castelo, Johnathan E. Alvara-do, Antipas L. Harris, Wilfredo Estrada Adorno, Terry Johns, Stephen Parker, Joshua Ziefl e, Marcia
Clarke, and Rickie D. Moore. Avail-able on Amazon.Spirit-Filled Preaching In Th e 21st Century opens with Church of God General Overseer, Dr. Mark L. Wil-liams declaring, “Th e preacher’s task is daunting.” To help preachers meet the challenge, fi fteen Pente-
costal ministers explore principles and practices of dynamic preaching. Practical guide-
lines include how to prepare and preach expository sermons, plan a sermon series, preach to diverse cultures, preach for pastoral care, give an eff ective altar call, and preach with integrity. Th e book was published by and is available through Pathway Book-store.
Johns; Michael S. Stewart, President; Tracy Reynolds, Dean of the School of Christian Ministries
EMMANUEL COLLEGE HONORS DR. CHERYL JOHNS
LEE ROY MARTIN EDITS AGAIN
A Future for Holiness: Pentecostal Explorations is an attempt to stimulate conversation regarding
fresh Pentecostal approaches to the theology of holiness. Twenty Pentecostal scholars identify both opportunities and challenges for the future of holiness in Pente-costalism from the perspectives of the various academic disciplines. Th ey explore the implications of holiness for Pentecostal theology,
peacemaking, justice, global concerns, ethics, post-modernity, social responsibility, ecclesial structures, ministerial practices, Christian for-mation, intercultural engagements, immigration, civil society, political systems, personal relationships, youth work, economics, leadership, and more. Contributors include Lee Roy Martin, Narelle Melton, Robert C. Crosby, Jacqueline Grey, Faith
kk
CaSCGGGGltm
ccccococcccccccprprprpprpprprrprrprrprprprprprprppppp aaaaaacacacacaccaaaaacaccccctititititititititititititititicecececececececececessssss s s ffofffofofoffofof dd
lllilililililililillilililinenenennenennn sssss ininninininclclclclclclclududuudududude e hhohoho
7
On April 30 – May 4, 2013, Dr. Tony Richie participated in the World Day of Prayer and Action for Children council meeting in Co-imbatore, India. Th e focus of the meeting was overcoming violence against children. Dr. Richie has served on the DPAC Execu-tive Council since 2011. During the meet-ing, Richie reminded the audience that vio-lence against children is a global problem
and compassionate aid requires cooperation among all people of good will. Richie also participated in various presentations and panels which included leaders and represen-tatives from local and national governments and a variety of religious organizations. Th e World Day of Prayer and Action for Children connects people and organizations in a net-work that protects children.
FACULTY-WIDE WRITING PROJECT
During this academic year the fac-ulty is combining eff orts to write a book on the spiritual disciplines. Th e working title of the project is Knowing God in the Ordinary Practices of the Christian Life. Drs. Sang-Ehil Han and Jackie Johns are directing the project and serving as editors of the fi nal text.
Th is eff ort is the outgrowth of the faculty’s ongoing revision of the core curriculum of the Seminary’s master’s level degree programs. Approxi-mately eight years ago the faculty revised the learning outcomes of these degrees around three “meta practices” of Pentecostal min-istry: worship, community, and witness. In this process it was concluded that all stu-dents at the Seminary should be instructed in the practice of the spiritual disciplines in preparation for Spirit-fi lled ministry. Th us the purpose of this faculty project is to pro-vide an introductory text and guidebook for the prac-tice of the spiritual disciplines as viewed through the lens of Wesleyan-Pentecostal spirituality. Th e book is being designed to serve as a practical guidebook that can be used by small groups in local churches. It is believed that this will be the fi rst text written on the subject from a Wesleyan-Pentecostal perspective.
Th is is a year-long project. Faculty members are ad-dressing the various practices during selected chapel
services spread throughout the year. During the spring semester the school’s annual Minister’s Week will feature presentations of early drafts of each chap-ter of the book. Drs. Johns and Han are hopeful the book will be published in time for release during the General Assembly in July of 2014.
GREEN AND HAN CO-EDIT
Drs. Chris Green and Sang-Ehil Han are co-editing a volume on Wesleyan-Pentecostal soteriology that explores the salvation God has
worked for us in Christ through the lens of the Five-Fold Gospel. Contri-butions will be made by prominent scholars: Ken Archer will write the chapter on salvation; Sang-Ehil Han a chapter on sanctifi cation; Daniel Castelo a chapter on Spirit baptism; Chris Green the chapter on healing, and Daniela Augustine the chapter on escha-
tology. Various scholars, including Frank Macchia, Professor of Th eology at Vanguard University; and Jason Vickers, President of Wesleyan Th eological So-ciety and Associate Professor at United Th eological Seminary, will write responses to these contributions. President Steve Land will off er the conclusion. Th ese papers will be presented at the fi rst CPT (Centre for Pentecostal Th eology) Conference in September 2014. More information will be forthcoming.
RICHIE PARTICIPATED IN THE WORLD DAY OF PRAYER AND ACTION FOR CHILDREN
w
A t ll tititi
KKPPDDJJ
Thi ff t i th
WWW
ww
8
77777777000000000’’’’’’SSSSSSSS
DwDwDwDwDwDwaiaiaiaiaiain n n nn n PyPyPyPyPyPyeaeaeaeaeaeatttttttttttt ((((((((((((((((((((((((((((((((((((((‘7‘7‘7‘7‘7‘7‘7‘7‘7‘7‘77‘7777‘7‘7‘7‘77‘7‘7‘77‘7‘7777776)6)6)6)666)6)6)66)6)6)6)6)6)6))6)6)66)6)6)6)666)6666)66))6))6)66666) hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhasasasasasasasasasasasasssasasssasasasasssssssasasasaaasasassasasasasas wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwworororororororoorororororororororororroorooroorrorooo kekekekekekekekekekekekekekekekekekekekekekekekkkkkekkkkkkk d dd d d d d d dd ddd d d ddd dddd ddddddd asasasasasasasasasasasasasasasasasasasasasssassaassa iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiintntntntntntntntnntntntntntntntntntntnttnnttnttnnttnnnterererererererereerreereerrrerreerrrnanananananananananananananananananananaananaanaatitititititititititittitititititittiononoononononononononononononononnnalalalalalalallalallalallalalalall cccccccccccccccccco-o-o-o-o-o-o-o-o-o-oo-o-oooo-tttttorororororororororororororororrororrrororororororrrorororrrrororrorororrrororrorororrrrorrorrdddidididididididididididididididididididdididididddidididididididididddidididididddididididididididdiddididdididididididdddidididinnanannnanananananannanananananananannananananananananaananaanannannnnannnnnan tototototototototototototototottototototototottttotoottootttttttor rr r rr r rrr rr rrr rrr r rrrrrr r r rrr fofofofofofofofofofofofofoofofofofofofofofofofofofoffofofofoffofofofofofofofffor r r rr r rrr rrr rr rrrrr r rrr r rrrrrrr rrr rrr rrrrrrrrrr ScScScScScScScScScScScScScScScScScScScScScScSScScScSScScScScSccScScScScScScSSccSSScScSSSccchhhohohohohohohohohohohohohohohohohohohohohohohohohohohhoohohohohohohohoohohhhhhhhhhohhohohh ololololololololololololololololololololololololololoolololololoolololololllolool oooooooooooooooooooooooooooooooooof f ff ff ff f f f fff f fff f f fff fff fffff f MiMiMiMiMiMiMMiMiMiMiMiMiMiMiMiMMiMiMiMMMiMiMiMiMiMiMiMiMiMiMiMMiMiMMMMMiMMMMiMMMMMMMMMMMMMM ninininininininininininininininnininininniniiniinnniiststststststtststststststststststsststtstststststssstryryryryryryryryryryryryryryryryryryryryryryryryrryryryryryryyy/M/M/M/M/M/M/M/M/M/M/M//M/M/M/M/M/M/M///M/M/M/M/MM/M/MMM/MMinininininininininininininnnininininininininininisisisisisisisisissisisissisisiisssssssstetetetettetetetetetteettetettetteeteteeeeettet riririririririririririrririirirriialalalalalalalalalalallaalalaaa DDDDDDDDDDDDDDDDeveveveveveveveevevevveveveveveleleleleleleleleleleleeleeel----------opopopopopopopopopopopopopopopopopopopoppoppopoppopopopopppoppopopopopopppopppppmemememememememememememememememememememememememememememememememememememememememmemmmmememmmemeentntntntntntntntntntntntntntntnntntntnnntntntntntntntnnnnnn ffffffffffffffffffffffffffffffffforororororoorororororororororororrororooororororororoororoor tttttttttttttttttttttttttttttttttttthhehehehehhhehehehehhehehehehehehehehehehehehehehhehehehhehehehehehehehehehhhhhehhh CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCChuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhhuhhuhuuuhuhuhuhhuhuhuuurcrcrcrcrcrcrrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrcrccrccrrcrchh h h h h h hh h h hhhhhhh hhhhhhhhh ofofofofofofofofofofofofoffofofoffofofofofffoffoffffoff GGGGGGGGGGGGGGGGGGGGGGGGGGGGGoodoooooodododoodododododoododododododododododoodddo sssssssssssssssssssssssinininininininininininininininininnnnnininininnininininininiininiii cececececececececececececcececececececececceeec 222222222222222220000000000000000000000000000000002.2.2.2.2.2.2.222.2.2.2.22
MiMiMiMichchchchaeaeaeael l l l WoWoWoWootototenenen (((((((((‘7‘7‘77‘7‘7‘7‘7‘79)9)9)9)9)9)99 ccccononon--titititititititititiitititittt nununununununununununununununnunun eseseseseseseesesesesesesesess ttttttttttttttttooooooooooooo ppapapapapappapapapappa tstststststststststorororororororor GGGGGGGGGarararararrrdedededdded n n nn SaSaSaSaS ncncnc-tututututututututututututtuararararararararararara y y y yyy y yy y yy COCOCOCOCOCOCOCOCCCCCOG G G G G G GG G ininininininininnin RRRRRRRococock k k k HiHiHiH lllllll , , SCSCSC,, whwhwhwhwhwhwhwhherererererererereeeeeeee hehehehehehehehehe hhhhhhasasas mmminininisisisteteterered dsisisisisisisisis ncncncncncncncnceeeeeee JuJuuJuJuJuJuJunnenee 11199999994.4.4
80’S
Ioan Ceuta (‘89) ministers as the General Superin-tendent for Assemblies of God Romania and Presi-dent of the Romanian Bible University.Lloyd E. Frazier (‘86) continues to do short-term rmission work, after serving with Church of GodWorld Missions in Guatemala, Panama and Haiti for over 37 years.
MaMaMaM rgaret HHene ry ((‘8‘88)8) iis woworkkinining g g asasas aaactctctiviviivitititi ieieiesss didididiiirerereerec-c-c-c-cytotototototototorrrr r r rr atatatt tttthehehehehehe WWWWeieieieinnnsnsteteeininin AAAdudd lt DDDDDayayay CCCararareeee CeCeCeCentntntntererererr iiiiin nn n nn DuDuDuDuDuuDun-n-n-n-n-nwwwwwwowowoododododododyyyy,y,y, GGGA.A.A. ThThThThThThThTheeeeeeee cccccenenenenteteter r prprp ovovovvvidididideses sssseeerererrvivivivivicececececess s s s tototototo sssssenenennenenioioioioioiorsrsrsrsrsriiiinininn ttttttheheheheheheheh mmetttttetettttetrrrrrrrrorororo AAAAAtltltllananannnnnantatatatatatatattt aarererea.a.a.a.a MMMMaarararara gigigigigiigie e ee e hahahahahasssss cocococompmpmpmpmpm leleleleleleteteteteteted d d d d dd nananananana---tititititititiiononoooooonnonalalalal cccccccccccererereeeeeeeee titititiifi fi fi fifificacacaaaatitiititionononononnon fffffffororor aaactctcttcttctctctivivivvvviviivititittitity y y yyy didididirerererecctctctctctctttorororororors s s ss frfrfrfrfrff omomomommom ttttttthehehehehehehe NNNNNNNa-a-a-a-a-a-tititititititiititititt ononononononnonnononnnnalallaalalalalalalalaalal CCCCCCCCCCCerererererererererere titititititifi fi fi fi fi fi fi fi fi fifi fificccacacacacacacacacacatitititiitititiitititiononononnonononononon CCCCCCCCCouououououououunncncncncilililllllil oooooooof f f f f f AcAcAcAcAcActitittititiiiviviviviviv tytytytytyyyy PPPPPrororororoofefefefefeffefessssssssssioioioioionananananalslslslslslss. .. . ShShShShShhShhhhhhhheeeeeeeeeeee wawawawawawawawawawawawawass s s gigigigigigigigiigigigigigiig vevevevevvevvvvevvvv nn nn n nnn nnnnnn ththththhhhhththhhhthheeeeeeeeee opopopopopopppoppopppppopopopoppopoopopopopportrtrtrtrtrtrttrrrrr ununununuuuu ititititititttitittititittyyyyyyy yy y y y totototototottototototo dddddooooo sosososososs mmmememememm ccccccccononononononono sususususususuultltltltltininininininiiing g g g g gg inininininininin aaaaaaaaaa lllllllllonononononononnnononnong-g-g-g-g-g-g-g-g-g-g-g-g-g-gg-gg teteteteteteteteteteteteteteteteerrrmrmrmrmrmrmrmrmrmrmrmrmrr cccccararararararararararaaa ee e e e e eee eeee ffffafafafafff ciciciciciciciciciciciililililllllllitytytytytytytyy iiiiiin n n n MaMaMaMaMaMaMaaaaMMariririririririririririrriietetetetetteeeeeee tatatatatt , , , , GAGAGAGAGAGAGAGAGAG ...... ShShShShShShShShe e e e aaanananand dddd d dPhPhPhPhPhPhPhPhPhPhhhPhhililililillillllil (((((((((((((‘9‘9‘9‘9‘9‘9‘9‘99999999)9)9)9)9)9)9)9)9)9)9)9)99999) aaaaaaaaaaaaaaaaaaatttttttttttttttttttttttttttttttttenennnnnnnennnnnnenndddddddddddddddd ReReReRReReReRReReReRRReR ststststststttststsstssstororororororororororo atatatatattioioioioioioioiiioioionnnnnnnnn n n ChChChChChCCCC urururururchchchchchchchchchhchchhh ooooof fff f GGoGoGoodd d d whwhwhwhwhwhwhhwherererererereee e e elllllllthththhththhhhhheyeyeyeyeyyeyeyeyeyeyeyeyy cccccccccccccco-o-o-o-o-oo-o-o-o-o-o-oo-o-teteteteteteteteteteteteteteteacacacacacaacacaacacacacacacaa h h h h hhhhhhhhhhh anananananananananananannanan aaaaaaaaaaaadudududduddudududududududulltlllltltllltltlt SSSSSSunununununundadadadadadadaaaday y y ScScScScSScScScScS hohohohohooololololl ccccclalalalalassssssss...
LaLaLaLanenenene LLLLavavavavenenenendededederrr (((((((((((((((((‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8‘8888‘87)7)7)7)7)7)7)7)7)7)7)7)7)7)7)7)7 iiiiiiiiiiiis ss s ss s ssss s sesesesesesesesesees rvrvrvrvrvrvrvrvrvrvrvrvrvininininininininininining g g g g g g asasasasassasssss SSSSSSSSSSSeneneneneneneneenioioiioioioiiii r r r r r PaPaPaPaPaPaPastststststs orororor ooooof f ffrrrthththththhththththththhththe e e e e e eee e LiLiLiLiLiLiLiLiLLiLiLiiL ghghghghghghghghghghghghghghththththththththththhthhtthououououououououououououoo seseseseseseseseseseee CCCCCCCCCCCCChuhuhhhuhuhuhuhuhuhuhuhuhuhurcrcrcrcrcrcrcrrcrcrcrrch h h hhh hh h hhhh ofofofofofoffofofofofof GGGGGGGGGGGGododododdododood iiiiiin n n nn PlPlPlPlPlPlPlPlPlaiiaiaiaiaiaia nfinfinfinfinfinfinfin eeeeeeldldldl ,,,, CTCCTCT...
BBeBeBBeBeBeBeBennn nnn McMcMcMcMcMcGlGlGlGlGlGlllamamamamaama erererery y y y ((‘(‘‘(‘(‘( 84848484848484)))))) hhhahhahasss seseservrvrv ddeddeded aaasss aaa MiMiMiM ssssiioioionsnsns RRRRepepep-rresentative for Chhururchch oof f God Worlldd MiMissions since202020020202..
M.M Lane Morris (’87) hah s s rerececentntlly been named the Associate Dean for Undergraduate Programs and Student Aff airs at the University of Tennessee-Knox-ville. He earned his Ph.D. from the University of Ten-nessee in 1992, M.Div. from PTS in 1987, and his B.S. from Lee University in 1981. He has been employed since 1992 at UT as a faculty member, professor, andin several leadership positions.
Don Munn (‘85) is lead pastor foRestoration Church of God in Alpharetta, GA where he has led thechurch through a major reloca-tion and four building programs.He is a member of the speak-ining g teteamam fforor GGrereatat TTururnanaroround (B WWilki MMii i t i )(B(Brurucece WWililkikinsnsonon MMininisistrtrieies)s)and has spoken at conferences, m r’s memeetetini gsg , and has taught several pastotorsrs’’ cococonfnffnfererererenenenenc-c-c-c-c-eses iin n HoHondndururasas aandnd EEcucuadadoror.
R. C. Hugh NNelelsosonn ((’8’89)9) iiss seservrviniing g g asas ssenenioior r papaststoror oof f ChChururchchch ooof f f GoGoGod d ddof East FlFlatatbubushsh iin n n BrBrBrooooooklklklynynyn,,, NYNYNY, , , as district ovovverererseseseererer, , , asasas NNNY Y Y COCOCOG G G ststatate e exexececututivive e cococounununcicicil l l mememembmbmbererer, , , asas NNY Y chchapaplalainincycy ccoooordrdininatatoror, , ,anand d asas NNY Y mimininiststryry oof f cacarere ccoooor-r-didinator. He is aalslso Brrooo kdale UnUni-i-
vvveversrsitity y HHospiti al trustee and board membeer r fofor r JCJCAPAP. HeHeH mmini isters as pastoral covering for “S“Set the Cap-tit ves Free” Outreach Center in Baltimore, MD.
My prayer is that God will continue to bless PTS and its ministry outreach to the world.
—Lloyd Frazier
R
or l-e
mininisistter’s
MMMMtttttttttttttttttttttttwwwww
9
Darrell Rose (’80) reminisces that he was among the very fi rst students at the Church of God Grad-uate School when classes were held at the Monu-ment Building on Ocoee St. He began his studies after a tour in the Philippines as the Director of the Clarkview Servicemen’s Center in Angeles City, 50 miles north of Manila. He now pastors the Oak Grove Church of God, Ooltewah, TN, and serves as Founder and President of Nationwatch International Ministries, Cleveland, TN.
90’S
Mickey Jett (’90) completed two more degrees after graduation, a Master of Science in Counseling from Columbus State University in 2002 and a D. Min. from Erskine Th eological Seminary in 2010.
Neil Lawrence (’91), along with his wife, Jennifer, and son, Joshua, continue in ministry as missionaries to Zambia. Th eir team, Eagles’ Wings Gospel Minis-try, recently held its 166th gospel meeting in Eldoret where over 100 people were saved. Eagles’ Wings was helping a pastor and graduate of Discipleship College start a mission church. Neil and Jennifer share, “An amazing thing happened on Sunday morning follow-ing the Saturday gospel meeting. Five people testifi ed that they were saved at their homes while listening to us preach. Th ey hadn’t even come to the meeting! Th e church is already starting to grow.”
Lionel Th omas (‘91) has pastored the Byblos Full Gospel Church of God in Crossmoore, Chatsworth, Durban, South Africa from 1997 to present.
Butch Varner (‘94) recently published Life Changing Leadership on Amazon Kindle. Varner shares, “It is a quick reference guide to leadership that is transfor-mative. Anyone can lead, teach, direct, and parent, however truly exceptional leaders lead in a manner that is transformative.” Th is guide and system aspires to enhance individual leadership on four relational tiers: with self; with subordinates, peers, and superi-ors; with spouses; and with children.
2000’S
David Bennett (’07) is the direc-tor of Academic Services for the School of Adult and Graduate Studies at Bryan College, Dayton TN.
Th is has been a life-changing experiencefor me here at the Seminary.
—Linda Avila
D
10
Don Brock (‘01) is founder and chairman of Synergy Ministries, Inc. You can fi nd out more about Syn-ergy Ministries at www.synergyministries.net.
Vanessa Dimoulas (’03) works as an advanced regis-tered nurse practitioner at the Cleveland Clinic. She completed her doctorate in nursing practice at Cha-tham University in Pittsburgh, PA. She is involved in medial missions and looks forward to using her edu-cation and expertise in future trips.
Sarah Levine (‘00) continues to work at Peniel Drug/Alcohol Treatment Center as the admissions super-visor.
Benson (’99, DMin ‘04) and Cathy (’08) Vaughan are en-joying perfect Fall weather in Kniebis, Germany where they are beginning their 15th year at European Th eologi-cal Seminary. Classes have started and they recently had the opportunity to attend the German Minister’s Confer-ence, where Benson led wor-ship.
Dennis Whitter (’09) pastors Life Church in Bloom-ington, MN.
Chris Wilson (’01) continues in ministry as an Army chaplain.
2010’S
Marvin Amos (‘13) is a case manager/therapistat Smoky Mountain Children’s Home, Sevierville, TN.
Melvin Colón (’13) serves as associate pastor of care at the Park West Church of God, and as pastor of the Spanish ministry of Park West Church of God.
Milton Gordon (D.Min. ’13)co-pastors the Waverly Church of God of Prophecy with his wife, Karen, in Wa-verly, TN.
Clive McBean (‘13) pastors the Newark Praise Temple Church of God in Newark, NJ.
STAY CONNECTED!
“Like” us @ Pentecostal Th eological Seminary Alumni and Friends
• www.ptseminary.edu• Update your contact information• Join the email list
• Email [email protected]• Fax: 423-478-7952• Call: 423-478-7707
My experience at PTS has been
transformational.—Catherine
Payne
PTS has given me the opportunity to gain skills in ministry and helped to clarify my personal vision of ministry.
—Milton Gordonn-erthi
vadhrr
n-er re h i-----
veeeeeeeeedddddd ddd
hee eeer-r-
BB
j
y
DD
11
MMinistry by PTS alumni takes many forms. Zdenĕk Sýkora (MDiv, 2009) substantially contributed to Bible21 which is a contem-
porary translation of the Hebrew, Aramaic and Greek Scriptures into the modern-day Czech language. Avoiding literalism on the one hand and a free para-phrase on the other, it strives to communicate clearly, yet faithfully both the meaning and the literary style of biblical writings. A team of Evangelical and Pente-costal translators and linguists led by Alexandr Flek worked on this version for 15 years. Since 2009 when it was fi rst published, Bible21 has become widely popular among Czech churches and the general pub-lic.
For the past 400 years, there have only been two Czech translations of the Bible available. In 2009, three new translations were published:
• “Bible21”: a translation in the common Czech language.
• “Czech Study Version”: a literal, word-for-word translation
• Th e Czech version of the “Jerusalem Bible”: a Catholic Bible translated from French
Upon its release in 2009, Bible21 became the bestseller of the Czech book market.
Zdenĕk worked on the New Testament with textual criticism comparison and proposal of many changes in transla-tion. Bible 21 has received acclaim from both the religious and secu-lar worlds. Jiří Unger, President of the European Evangelical Alliance commented, “Th e 21st Century Translation makes daily Bible reading a refreshing experience for a wide range of
Christians including myself. It is also a convenient missional translation, accessible in its form, yet un-compromising in its content.” Bible21 has had un-precedented media attention in the Czech Republic throughout the past couple of years. In what some call the “most atheist nation on earth”, both national and local media started to talk positively about the Bible like never before. Zdenĕk shares, “It gave me great pleasure to be able to work on this project that has had an eternal impact upon my country. I could not have been eff ective in my role if I had not been the benefi ciary of outstanding instruction at PTS.”
His wife Basia Sýkorová, also, graduated from the seminary in 2007 with a Master of Arts in Counsel-ing. Upon graduation, Zdenĕk and Basia returned to Prague to minister, and they have recently moved to Poland where they continue to minister in their community and local church. Basia counsels while Zdenĕk teaches and preaches. Zdenĕk is working on his doctoral degree. Th ey have a son, Daniel.
Seminary GraduateIntegrally Involvedin Bible21
12
More than twenty years ago, Pentecostal Th eo-logical Seminary devel-
oped a program to raise scholar-ship funds to assist students with tuition to ease the fi nancial bur-den of ministerial training. Th e Gallery of Pentecost honors min-isters and laity while at the same time providing a focal point for the raising of scholarship funds. Th e family and friends of each per-son who is inducted into the Gal-lery of Pentecost donate to create a scholarship endowment (Hall of Prophets – $25,000, Ministe-rial Hall of Honor - $10,000, Laity Hall of the Faithful - $10,000). We earn interest from the endowment funds and that interest is directly assigned to student scholarships. Nearly every student enrolled at PTS benefi ts from this program. Most students could not attend the Seminary if it were not for these endowments.
Bob and Jeanette Cary were inducted into the Hall of Proph-ets in the Cross Memorial Chapel on October 31, 2013. Th e scholar-ship fund in their name was initi-ated by their family and friends to honor their fi fty plus years of pas-toral and missions ministry in the Church of God. Th e Carys are so deeply loved that attendees came from churches in Florida where they had pastored so they could have the opportunity to express their appreciation and honor. Th ey continue to serve as Mis-sionary Evangelists for Church of God World Missions. Dr. Tim Hill, Director of COGWM, said, “Bob and Jeanette are the epitome of men and women with missionary callings. Th eir labor on the fi eld and subsequently in fund-raising has kept missionaries at their task and has been a blessing to multi-plied thousands.”
Billy J. Rayburn was inducted into the Hall of the Prophets on the PTS campus May 30, 2013. Th is induction was initiated by Rayburn’s family, in honor of his 80th birthday. Stepson Tony Lane said of Rayburn, “His love for peo-ple groups, particularly the Roma-nian community, represented in the United States, has embraced and propelled many in ministry in the Church of God. Th is endow-ment will permit others to follow in his footsteps and legacy as we continue to enlarge our borders in the harvest.”
Dr. Horace S. Ward was induct-ed into the Hall of the Prophets at his home in Yukon, OK, September 10, 2013, by Bishop Charles Fisch-er, on behalf of President Land and the Seminary Board of Directors.
Cary, Rayburn, Ward, Burell, and Kay Inducted Into the Gallery of Pentecost
• Is reserved for nominated can-didates who have reached the age of 65 and have contributed a major portion of his or her life to full time and signifi cant min-istry in the Church of God.
13
Dr. Arvel Burell was inducted into the Hall of Faithful during Commencement exercises on June 1, 2013. Dr. Burell received this honor for 13 years of meritorious service on the Pentecostal Th eo-logical Seminary Board of Direc-tors. “Th e Church of God denomi-nation has been an integral part of my life... I have a heart and mind fi lled with many treasured memo-ries of my life-long involvement in dedicated, committed and faithful service to God and to my church. For more than 90 years, God has given me a full and rewarding life. My God, my family, my friends, my church and my business suc-cesses are more than any one man can expect... I have been highly favored and highly blessed. I am most grateful,” said Burell.
In a private ceremony with the Seminary board members and ad-ministration, W. Nathan Kay was inducted into the Hall of the Faith-ful on May 31, 2013. Th e endow-ment was initiated by his wife of more than 52 years, Mrs. Emma Joyce Kay. Nathan Kay’s merits in-clude fi fty years of faithful service to the Church of God, including twelve years as clerk at South Met-ro Ministries, Sharpsburg, GA, serving through the years as choir leader, Sunday school teacher, and spiritual mentor. He also helped establish the Forest Park Church of God. His heart was called to support missionaries in the fi eld as well as his home church.
For more information regard-ing the establishment of a Hall of the Prophets, Ministerial Hallof Honor, or Laity Hall of the
Faithful endowment at PTS, ppleleaasase e contact Joy Terpstra at t (4(42323) )) 478-7731 or e-mail jtjttererppstrra@a@[email protected]. Th Th e e Semiminananaryryryyis proud to hehelplpp ppreservrvee ththessesse e eewonderrfuull stststororiies anndd mememomooriririesesessofofof ttthehehe ccconontrt ibuttioion n ofof lliives tttooo thththhe e e eeChChhChurururchchch aaandndnd mmminininisistrtryy.
PTPTPTPTPTSSSSS alalalalalsososososo hhhhhasasasas aaa lllononong g g trtrtrradadadaditititititioioioioiooon n n n n n nnnofofofofofofof rrrrrrrecececececececeieieieieieieivivivivivivivingngngngngngng hhhhhhonononononorororor aaaandndndnd mmmmmemememememmmmmo-o-o-o-o-o-o-o-ririririririririalalalalalalalaal ggggggggggifififififififififtstststststsststs... . . . ... Th Th Th Th Th Th ThThTh eseseseseesesese e e e ee ee mamamamamamay y y y yy bebebebebe iiiiinn nn n nn hohohohohohohoonononononononononor r r r r r rrrororororororororor mmmmmmmmmemememememememememororororororororory y y y y y y y y ofofofofofofofofoff aaaaaaaaa fffffffffamamamamamamamamamilililililililily y y yy y y y y mememememememmemembmbmbmbmbmbmbmbbbererererererererererrororororororororororror aaaaaaaaaaa ffffffffffffririririririririririr eneneneneneneneneneneend.d.d.d.d.d.d.d.d.d. ThThThThThThThThThTheeeeeeeeeseseseseseseseseese ggggggggggififififififififififtstststststststststs aaaaaaaaaarererererererererere pppppppppplalalalalalalalalalacecececececececececec d d dddd d dddinininininininininininn aaaaaaaaaaaa nnnnnnnnnnnnamamamamamamamamamamammededededededededededed eeeeeeeeeendndndndndndndndndndndndowowowowowowowowowowo mememememememememementntntntntntntntntnt fffffffffffunununununununununund dd d dd d d d d ifififififififififif ssssssssssooooo o o o o odededededededededededesisisisisisisisiisisigngngngngngngngngngngngnatatatatatatatatatatatatedededededededededededd......... IfIfIfIfIfIfIfIfIfIfIfIf ttttttttttttheheheheheheheheheheheherererererererererere iiiiiiiiiiis s sss s s sss nononononononononon ddddddddddesesesesesesesessesesigigigigigigigigigignananananananananana--------titititititititititiionononononononononononn ooooooooooooffffffffffff aaaaaaaaaa papapapapapapapapapapap rtrtrtrttrtrtrtrtrtrttrticicicicicicicicicicululululululululululularararararararararar eeeeeeeeeendndndndndndndndndndndowowowowowowowowowowo memememememememememem ntntntntntntntntntnt,,,,,,,,tititititititititionononoononononononnn oooooooooooff f f f ff f f aa a a a aa aa pappapapapapapapapapartrtrtrtrtrtrtrtrtrtr icicicicicicicicicci ulululululululululu arararararararararr eeeeeeeeendndndndndndndndndndndowowowowowowowowowowmemememememememememem ntntntnntntntnttnt,, , , ,, ,,, ,wewewewewewewewewew ddddddddddepepepepepepepepepeppososososososososoosositititititititititititt aaaaaaaaaalllllllllllllllllllllll mmmmmmmmmmmonononononononononononetetetetetetetetetetettararararararararararary y y y y y y yy y y memememememememememomomomomomomomomomo--------ririririririririalalalalalalalalall aaaaaaaaandndndndndndndndndnd hhhhhhhhhhononononononononononoororororororororor gggggggggifififififififfififtststststststtststs iiiiiiiiiin n n nn n n n n n ththththththththththhe ee eeee eee gegegegegegegegegeneneneneneneneneneerarararararararararal ll l l l ll l llPePePePePePePePentntntntntntntntececececececececcecosososososososososostatatatatatatatataaallllllllll Th Th ThThTh Th Th Th ThTh ThTheoeoeoeoeoeoeoeoeolololololololololologigigigigigigigigigicacacacacacacacacal l ll l l ll l SeSeSeSeSeSeSeSeSemimimimimimimimminananananananananaryryryryryryryryryEnEnEnEnEnEnEndododododododowmwmwmwmwmwmwmwmwmenenenenenenenene t.t.t.t.t.t.t.t.
• Is reserved for laypersons whose service to Jesus Christ andthe Church of God has been meritorious.
Th is scholarship was initiated by graduates of West Coast Chris-tian College. Brother Fischer is a long-time friend of the Wards and a former student of WCCC where Brother Ward was President. He is the administrative bishop of the California/Nevada Church of God
State Offi ce as well as a member of the Seminary Board. Bishop Fisch-er said of Ward, “Th e infl uence of Dr. Horace S. Ward continues to be seen all around the world in the lives and ministries of the students he impacted.”
Bob Cary,Ishmael Charles,
Jeanette Cary
BB bbbb CCCCCCCC
14
2013 Memorial and Honor Gifts2013 Memorial and Honor Gifts
In memoriamClarence J. Abbott Chair of Biblical Studies
Dr. & Mrs. Fred AbbottDr. Donna F. Mills
W.W. Ball ScholarshipDr. William A. Ball
Sandra BishopDr. & Mrs. Rickie D. Moore
Ora Belle BuxtonRev. & Mrs. Ken DavisMrs. Lora M. Langford
C. W. & Myrtle Collins ScholarshipMr. & Mrs. Darrell W. Collins, Sr.
James A. Cross ScholarshipMr. Norman J. Cross
Lewis A. Daughenbaugh ScholarshipPennsylvania Church of God State Offi ce
Martha DouglasRev. & Mrs. Ken Davis
Robert E. Fisher Chair of Spiritual RenewalMrs. Mary Fisher
Clifford HuffRev. & Mrs. Ken Davis
James & Ernestine Johns ScholarshipDrs. Jackie & Cheryl Johns
W. Nathan Kay ScholarshipRev. & Mrs. Ken DavisMrs. Lora M. Langford
Jack & Mary Land ScholarshipDr. and Mrs. Steve LandMrs. Lora M. LangfordMs. Charline Swetzig
Daniel & Flara Livingston ScholarshipMrs. Anna DavisRev. & Mrs. Ken DavisMr. & Mrs. Larry Evans
Maggie Nolie O’Quinn ScholarshipMrs. Linda T. Brown
Roberto Amparo Rivera ScholarshipMs. Gladys García
Arlie C. StarnMr. Paul V. Starn
Mack P. StewartMr. & Mrs. Dan R. BatemanMr. Michael G. Breaux
Mr. & Mrs. Carl E. ChaneyMr. & Mrs. James Paul McTyre Sr.Mr. & Mrs. Bill SaundersMrs. Norman Simmons
Stewart-Long ScholarshipCh, Lt. Col. & Mrs. Paul C. Stewart (Ret)
Rene’ Triplett-Pyeatt ScholarshipDr. & Mrs. Bennie S. Triplett
Arthur and Ruby Turner ScholarshipRev. & Mrs. Ken DavisMr. David E. Turner
In honorAntonio Bonilla Scholarship
East Central Spanish Church of God State Offi ce
Arvel Burell ScholarshipMr. & Mrs. Herbert C. BuieMr. & Mrs. William A. BurellDr. & Mrs. Paul L. WalkerMr. & Mrs. Dan ColeMr. & Mrs. John CowartRev. & Mrs. Ken DavisMr. & Mrs. Jim Hamilton, Jr.Mr. & Mrs. Dale HughesMr. & Mrs. James M. RogersMr. & Mrs. J. Hosea SmithMr. Stan WhitmireDr. & Mrs. Bennie S. TriplettMr. & Mrs. James Westberry, Sr.Mr. & Mrs. H. W. Youngblood
Bob & Jeanette Cary ScholarshipAlpha Agape Ministries, Inc., Waymon W. Thomas, Jr.Alton Church of GodRev. Lucille Barfi eldMr. & Mrs. Paul M. BishopMs. Ruby W. BrowningMr. & Mrs. Ernest H. CaryMr. & Mrs. Ernest Cary, Jr.Ms. Glenda M. CaryMr. & Mrs. Michael CaryMrs. Virginia CaryMr. Edmond CuppMiss Justine CuppRev. & Mrs. Ken DavisDeeper Life Christian MinistriesRev. Wayne DeHartRev. Eugene Rickey DillMr. & Mrs. Vernon P. FerrellRev. & Mrs. Timothy Futch
Grand Bay Church of GodMs. Jean B. HancockMr. & Mrs. Douglas J. HaneyMr. & Mrs. Jearel G. HeltonRev. & Mrs. Dewey HuffstutlerJefferson Avenue Church of God Rev. Gregory A. TomlinsonJapan Church of God Rev. Kazumoto YatsuzukaMr. & Mrs. Ronald JusticeRev. Charles David KingMr. & Mrs. Noah L. KingMr. Lloyd G. KoesterMs. Betty R. LanierRev. & Mrs. C. L. LeonardMr. & Mrs. Leonard T. CochranMrs. Virginia P. LilleyMr. & Mrs. George W. MaddenMr. & Mrs. Richard G. MarquetteMr. & Mrs. Bobby Ray MaxberryMr. & Mrs. George Edgar McLeanMrs. Yvonne MohammedRev. & Mrs. Max M. MorrisRev. David Munguia ZeladaDr. & Mrs. Gene D. RiceRidge Community Church of God Rev. Steven Dwight ThompsonRev. & Mrs. Julian B. RobinsonRevs. Ray H. & Kathy SandersMr. & Mrs. Herman ShawDr. & Mrs. Bill F. SheeksRev. & Mrs. Randall L. SmithRev. & Mrs. Kirby H. ThompsonMr. & Mrs. George C. WarrenWinchester Church of God Drs. Darrell W. & Pauline WallerMr. & Mrs. Daniel E. WintersWorld Outreach Worship Center Rev. Russell Evenson
J. Frank & Kohatha Culpepper ScholarshipMs. Sandra J. Jones
R. Hollis Gause ScholarshipDr. & Mrs. Sang-ehil HanRev. Richard J. HicksChristine Harris ScholarshipBay Harbour Church of God Rev. Rickey Harris
Daniel L. & Nell C. Hughes Scholarship Mr. & Mrs. D. L. Hughes
Steven Jack Land’s birthday Mrs. Lora M. Langford Dr. & Mrs. Lee Roy Martin Dr. & Mrs. Oliver McMahan
January 1 - October 31, 2013
15
AlAllalann MaMaththurura a ScScScScSchhhohohohoooholalalaaaarsrsrsrsrsrsshihihihihihih pppppSoSoSoSoSoSoSoSoSSSS utututututuuthhhhhhh MeMeMeMeMetrtrtrtro o o o MiMiMiMinininniistststststririririr eseeseseseses
BiBilllly y J.J. RRaya burn ScScScScScS hohohoholalalalarsrsrsrsshihihihh ppppMrMrMrMrr. . . AuAuAuAurrereel l A.A.A AAAntntntntntimimmimmmieieieeMrMrMrMrMrM . . & & & & MrMrM s.s. BBBruruucececec EE. AaAaroronnReReReReRev.v.v.vv LLLarry JJ. AnAndedded rsrsononReReRReRev.v. & Mrss. DaDavividd H. Beae tttyyMrMrMM . & & Mrs. SShahawnw BegleyDr. & & Mrs. Kenneth R. BellBethhany Romanian Church ofof Godd Rev. Simon AvramBethel Romanian Rev. Johnn TTipipeiMrMr. && MrMrs. Bill BeBeglgley, Jr.MrMr. && MrMrs. Youdisteer BiBindndaaRev. Constantitinn LuLupapancncuMr. & MrMrss. Aururelel BBuiaRevv. & MMrrs. Ioan J. BuiaRevv. Lemuel BuiaMr. & & Mrrs.s Chad CagleMrs. DDebe bib e CagleMr. & MrMrs. JJustin CagleEmanuel Peentecostal Romanian Church of God Rev. Lazzar GogChurchh of GGod, Inc.Chururcch ooff God Romanian Territorial Offi ceDrDr. Flororinel T. CimpeanMr. && Mrs. Teofi l ciobanasiuReev. & Mrs. James E. CosseyReRev. & Mrs. John CrankKKen & Debbie DavisRRev. Paul MoldovanRRev. & Mrs. Moisa DihelDDiscover Your Mission, Inc.MMs. Martha R. DismukesEEkklesia Bible Institute
Rev Florin Cimpean Rev. Florin CCimimpepeananElElE imim Chrhrisistitian CChhurchh
RRRevev.. && MrMrs. Ovidiu G. PiscueElElElimimim RRomomanian Church of Godd
RRRevevev.. GhGhGheorgghe StrimmbubuRReReRev.v.v. GGGavavavriril l FaFazezecacassMrMrMrMr. . . & & & MrMrMrs.s.s. DDDarararrererennn FoFoFostststerererMrMrMrM . . . & & & MrMrMrs.s.s. MMMarararcececelll D.D.D. GGGafafafenenencucucuGeGeGeGeGenenenenenesisisisis s s sss RoRoRoRomamamamamanininininianananana MMMMMisisisisissisisisisiononononon
RRRRevevevv... FlFlFlFlorororororo ininininn CCCCCCimimimimimmpepepepepep anananananReReReReReR v.v.v.v.v &&&&& MMMMMrsrsrsrss... DaDaDaDaDaninininininielelellelel GGGGGGrererererer cucucuccucuReReReReR v.v.v.v RRRRonononono alalalaldddddd A.A.A.AA.. HHHHHHarararararrmamamaammaannnnnReReReReReRev.v.v.vvv. &&&&&& MMMMMMrsrsrsrsrsrs.... WaWaWaWaWaWaynynynynynyneeeeee W.W.W.W.WW. HHHHHeieieiieieillllllReReReReReR v.v.v.v.vv &&&&& MMMMMrsrsrsr ... KeKKeKennnnnnetetetetthhhhh L.LL.L.L. HHHHHililililillllllReReReReRev.vvv.v.v. FFFFFF. . . . SaSaSaSanfnfnfnforororordddd HoHoHoHopkpkpkpkininininsssssInInInInInteteteteternrnrnrnrnrnatatataatatioioiooioionanananal l l ll FeFeFeFeFFF llllllllowowowowshshshshipipipip CCCChuhuhuhurcrcrcrchhhh ofofofof GGGGodododod
RRRRevevevev.... D.D.D.DDD NNNNNNieiieieieieimimimimimmReReReRevv.v.v. RRRRodododododneneneneney y y y JeJeJeJeffffffffororororordsdsdsdsdsReReReRev.v.v.v. &&& MMMMrsrsrs.. JaJaJamemememessss D.D.DD. JJJJenenenenkikikkinsnssnMrMrMMrMrs.s.ss DDDDDororoo otototthyhyhyhy JJJenenennininingngngs s s RoRoRobbebebersrsrssononon
Mr. & Mrs. L. MaM rvrvinin JJohohnsnsononnJoliet Church of God Rev. Douglas M. GoldenMrs. Evelyn KnightMrMr. && MrMrs. Joshua K. LaneMss. MeMeaagan LaneRev. & Mrs. Tonyy laneMrMr. && MrMrs.s. CClilifffforordd RR. LLogoganMaMarranatha Romanian Church ofof GGodo Rev. Moses GaodeRev. Stephan Jacobs MatasarMuntean Soups Mr. George MunteanNorth Cleveland Church of God Rev. Mitch MaloneyMr. & Mrs. Garry F. ParnellPhiladelphia Romanian
Rev. Ion BorceaRev. & Mrs. Claudius C. PrattDr. & Mrs. M. Dwain PyeattRev. & Mrs. Billy Joe RayburnRev. Brian K. RayburnRev. & Mrs. Hurbert Leon RayburnMr. & Mrs. Roger RiddleRev. & Mrs. Julian B. RobinsonRomanian Bethel Church of Godd Rev. Ioan MuresanRevs. Ray H. & Kathy SanandededersrsrsSouth Cleveland Churrchchh ooof f f GoGoGodd Rev. Chris MooddyyRev. & Mrs. Donald LLeeeeee SStotot vavavallllllMr. Herbert E. SwaffffoororddRev. Ion Gleorge BBoorrlolovav nnRev. & Mrs. Larry JJ. TTimmemeermrmrmannanannDr. & Mrs. Bennie S.S.S TTriplletetttttMr. & Mrs. Ellis LL. TuTuckerWestmore Churcrchh of GoddWestmore Churchh of Godd
RReve . Kelvin EE. PaPaP gegeMrMr. & & Mrs. Richaardrd O. WhWhititeeMr. & MrMrss. HHara old WoWoododssMs. Shelellyly DD. . Ziegler
Marshall E. Roberson’s birththdadayyDrDD . & MrMrs.s DDalalee HuHughghesesesMrMrs.s. DDororotothyhy JJenennininngs RoRobeb rsononMrMr. . & & Mrs. Bill Winters
Asbury Sellers Schoolalalarsrshih pReReRevvv. CCCedededriirickckck AAAlblblburururyyyMsMMs. MaM riilyn n ElElE izabeth AllAlfordBeBeeacaa onon Aveenunue e ChC urrchchch oooof f GoGoodddReReRev.v.v. AAAugugugusustetete GGGeoe rgesess BBBBonononnno apapaparararteteteteteReReReR v.v.v. RRRobobobererert tt E.E.E. BBBrorookoko ininnsssCaCaaaCapipipipitotototollll ChChChC ururururchchch oooooofff f f GoGoGoGG ddMsMsMssM .. DoDoDoDD roroorothththt y y y y CCCrCrC awwawwfofofofofordrdrd CCCCCarrararmimimimichchchc aeaeaellElElElElmmmm StStStStrerereetetet CCChuhuhurcrcrcr hh h ofofofofof GGGGGodododododMrMrMrM . . . anannand d dd MrMrMrs.s.s. SSSSamama ueueueuel ll BeBeBeBeltltltltrerer EEEspspspspiriri ititttitososososooooo anananana totototoo
ReReReReRRev.v.v.v.v. aaaaaaaandndndndndnddn MMMMMrsrrss. . ClClClCCleeveveveieieiononon FFFFerererergugugugusososon,n,n, SSSr.r.r.rReReRev.v.v.v aaand Mrs. Alphphononsoso FFluluelellilingngReRev. Ernest FoFordrd, Jr.Mr. and Mrrss. Calalvivin D. FranknklilinnRev. JJosose RaRammon GuzmzmannReRevv. andd MMrs. Keennnnetethh LL. Hill
MMrr. Leon G.G. InmnmanRev. Huberertt JoonnesMr. anandd MrMrss. Jim L. McGaheeMrs.s. SSaardis Cruz PerezRev. Rudolph PlanterReverend D. L. PoitierRev. & Mrs. Clarence ReynoldsRev. Joseph Fritz SimonRev. Mary Evelyn SimsRev. Theophilus StuartRev. Susie C. Torrence
Wallace & Dorothy Sibley ScholarshipRev. James BostonRev. Rosa E. CascoRevs. Kenneth L. & Janice HillCPT Marlene Lucas
Paul C. Stewart SchoholalarsshihipRev. Macack k P.P. SStettewawa trt, Jr.
Paul & Carmeelilitata WWalalkekerChChChChaiaiair r r fofofor r r PrPrPrreaeaeachchchinininggg & & & PaPaPaststororala Caree
MrMrMrMr. . . . JoJoJoJohnhnhnhn TTTT... . ClClClClowowowowowererererer,,,, IIIIIIIIIIIMrMrMrMrMr. .. . & & & & & MrMrMrMrMrs.s.s.s.s. JJJJJJamamamamamameseseseseses AAAAA. . ... CoCoCoCoCoststststieieieieMsMsMsMsMsMsMs....... A.A.A.A.A.A.A.A BBBBBBBB...... DeDeDeDeDeDeDeetetetetetetete sssssssMrMrMrMrMrMrMrMMrMr..... .. . . & & & &&& & && MrMrMrMrMrMrMrMMrMrs.s.s.s.s.s.s.s.s. CCCCCCCCCChahahahahahahahahharlrlrlrlrlrlrlrlrlesesesesesesesesees MMMMMMMM...... DyDyDyDyDyDyDyDykekekekekekekessssssssMrMrMrMrMrMrMrMrMr. ..... . . & & & & & & & & && MrMrMrMrMrMrMrMrMrMrMrs.s.s.s.s.s.s.s.s.ss PPPPPPPPP...... HeHeHeHeHeHeHeHeHeggggggggggggggggggg erererererererererMrMrMrMrMrMrMrMrMrMrMrs.s.s.s.s.s.s.s.s.s.s PPPPPPPPPPPegegegegegegegegegegegggygygygygygygygygygygygy LLLLLLLLLLeFeFeFeFeFeFeFeFeFeFe evevevevevevevevevevrererererererererereLoLoLoLoLoLoLoLoLoLoLoL guguguguguguguguguguggue ee eee e eee e LaLaLaLaLaLaLaLaLaLaLaL w w w w w w www ww FiFiFiFiFiFiFiFiFiFiFiF rmrmrmrmrmrmrmrmrmrmrMrMrMrMrMrMrMrMrMrM ... ..... & & & & & & && & & && MrMrMrMrMrMrMrMrMrMrMrM s.s.s.s.s.s.s.s.s.s.s.s JJJJJJJJJJJohohohohohohohohohohohn n n n n n nnn n FrFrFrFFrFrFrFrFrFrFrFranananananananananannancicicicicicicicicicicc sssssssssss MaMaMaMaMaMaMaMaMaMaMaMansnsnsnsnsnsnsnsnsnsn eleleleleleleleleele llllllllMoMoMoMoMoMoMoMoMoMoMounununununununununntt tt t tt ttt t PaPaPaPaPaPaPaPaPaPaPaararararararararararararannnn n nnn n n nn ChChChChChChChChChChChChhurururururururururuururu chchchchchchchchchccchch oooooooooof f f f f f ffff GoGoGGoGoGoGoGoGoGoGodddddddddd ––––––––– NoNoNoNoNoNoNoNoNoNoNortrtrtrtrtrtrtrtrtrthhhhhhhhhhReReReReReReReeReReRev.v.v.v.v.v.v.v.vv.v.v MMMMMMMMMMMMararararararrarararararkk kk k kkkkk k L.L.LL.L.L.L.L.L.LL.L. WWWWWWWWWWWalalalalalalalalallala kekekekekekekekekekekekerrrrrrrrrrrrMrMrMrMrMrMrMrMrMr.. .. . . . & & & & & & & & & & MrMrMrMrMrMrMrMrMrMrrs.s.s.s.s.s.s.s.s. LLLLLLLLLLLawawawawawawawawawawa rerererererererereerencncncncncncncnccncncce e e e e e e e ee e B.B.B.B.B.B.B.B.B.B. OOOOOOOOOOOwewewewewewewewewewewensnsnsnsnsnsnsnsnssnsns,,,,,,,,, JrJrJrJrJrJrJrJrJrJrJr.........MrMrMrMrMrMrMr. . . . .. & & & & & & & && MrMrMrMrMrMrMrMrMrMrM s.s.s.s.s.s.ss.s.s. LLLLLLLLLLinininininininininin RRRRRRRRRRogogogogogogogogogogererererererererersssssssssDrDrDrDrDrDrDrDr. . . .... & & & & & & && MrMrMrMrMrMrMrMrrrs.s.s.s.s.s.s.s.s JJJJJJJJJJohohohohohohohohohhn n nn n n n nn W.W.W.W.W.W.W.WW.WW RRRRRRRRRosososososososossssssssssMsMsMsMsMsMsM ...... ReReReReReReeReenenenenenenenenenee e e ee eee B.B.B.B.B.B.B.B. RRRRRRRRuxuxuxuxuxuxuxuxSeSeSeSeSeSeSelblblbblblblby y y y y y y BiBiBiBiBiBiBiBiblblblblbbblblble e e e e e eee GrGrGrGGrGrGrGrGrououououououououpppppppppMsMsMsMsMsMsMs.... RhRhRhRhRhRhhhanananananana dadadadadaadaa SSSSSSS...... SmSmSmSmSmSmSmititititititithhhhhhhMrMrMrMrMrMr. . .. & & & & && && MrMrMrMrMrMMrMrs.s.sss.s.s.s. CCCCCCCC..... A.A.A.A.A.A.A SSSSSSSStutututututututuararararararararttttttt
Horaracece SS. . WaWardrd,, JrJ . ScScScScScScSchohohohohohohoholalalalalalarsrsrsrsrshihihhihihihihihippppppppCaCaCaCaCaCalililiiliiifofofofofofornrnrnrnrnrnniaiaiaiaiaa-N-N-N-N-NN-Nevevevevevevevevadadadadadadaddada a aa a a a a ChChChChChChChC urururururururrchchchchchchhchcc ooooooofff f ff fff GoGoGoGoGoGoGoGoGoGoooooooddddddddddddddddd StStSttStStStStStStSSSSSS atatatatatatataaate ee e e e e e OfOfOfOfOfOfOfOfOOO fi fi fi fi fi fi fificceccecececececeeccecc
CCCCCChahahahahahah rlrlrlrlrlrlesesesessseses &&&&&&&& AAAAAAlilililililicececececece FFFFFFFFisisisisisiiischchchchchcherererererrrrrrrrrrrMMrMrMMrMrMrMr.. .. & & && && & & MrMrMrMrMrMrM s.s.s.ss.s. WWWWWWWWayayayayayayayaynneneneneneneneee EEEEEEasasasasasthththththamamamamamMrMrMrMrM .. ... & & && & MrMrMrMMrMrM ss.s.s.s.s..s. AAAAAAAvevevevevevv ryryryryryyyyyry FFFFFFininininnninngggggegegegegegeggegeggegeg rrrrrrrrrrMsMsMsMsMsMssM ..... DeDeDeDeDeDenininininn sesesesee LLLLLLLLLLLLL...... KKKKKKKKKKeKeKeKKKetctctct hahahahhaammmmmmmmMMrMrMrMrMrM s.s.s.s.s. LLLLLororoororororororororororaa aa a a a a a a aaa MMMMMMMMM.M.M.M. LLLLLanananananaana gffffffgfgfgfororororororororrrrrrddddddddddddddDrDrDrDrDD .... .. & & & &&& & & & && &&& & MMMMMMMrMrMrMrMrMrMM s.ss.s. DDDDDavavavava ididididd RRRRRRRRRoeoeoeoeeeeeoeeoeoebububububububububububububbuckckckckckkkckcccMsMsMsMsMsMsMMsMsMsMssMM ... DaDaDaDaDarlrlrlrlrlynynynynynneeeeeeeee ee SwSwSwSwSwSwwSwSwSwSweneneneenenenennenenensosososososs nnnnnnnnTrTrTrTrT acacacacy,y,y,y,yy JJJJJoyoyoyoyoyoyoyoyoylililitatataa,,, KaKaKaKaKaKKKaririiiiris,s,ss,s,s KKKKKKatatatttttatatathhhhhhhhheheheheriiiiiiiriririririnenenen &&&&&&&&&&&&& MMMMMMMMMMMMMMMMMatataatatatatatatatatataa thththththththhthththhththiaiaiaiaiaiaiaiaiaiaiaiaiaiaiaaas ss s s ss s s s s s s sTeTeTeTeTeTerrprprpstststtttrarara
Memorial and honor gifts have been made by donors to the Seminary in honor of, or in memory of friends and loved ones. At times, these gifts are designated to endowed funds that are named in honor or in memory of the individual(s) to celebrate a special occasion or initiate a scholarship fund. Gifts may also be made in memory of friends and loved ones in lieu of fl owers.
P.O. Box 2250Cleveland, TN37320-2250
Non-Profi t Org.US Postage
PA I DPermit No. 231
Cleveland, TN
PTS OnlineAccredited Degree Programs
Entirely Online
900 Walker Street • Cleveland, TN 37311 • 800.226.9126 • [email protected]
www.ptseminary.edu
50% ScholarshipNew and Re-admission Students
January J-Term and Spring Semester
Certifi cate ProgramQualifying process for Seminaryfor those with no college degree
mmmmsss
Increasingly
Increasingly
Accessible
Accessible