Honors Biology 2006-2007
Protein Synthesis
Honors Biology 2006-2007
What do we know? § Metabolism is controlled by enzymes
enzymes are proteins
§ DNA contains the genetic information to build proteins.
§ DNA is only in the nucleus. Ribosomes are not.
§ How then can DNA be used to build proteins?
Honors Biology 2006-2007
The “Central Dogma” § Flow of genetic information in a cell
How do we move information from DNA to proteins?
transcription translation
replication
protein RNA DNA trait
DNA gets all the glory,
but proteins do all the work!
Honors Biology 2006-2007
RNA Does the Work § Traits, like eye color, are
determined by proteins that are coded in DNA.
Our cells, however, need a “secret decoder ring” to express the DNA code……….
AND, we need to get the instructions on how to make the protein from the nucleus to the ribosomes.
ENTER: Ribonucleic Acid
(RNA)
Honors Biology 2006-2007
Protein Synthesis § DNA molecules provide the
instructions for making proteins
§ BUT, RNA molecules are what build the proteins based on those instructions.
The workers for Protein Synthesis (gene expression) are RNA molecules.
Honors Biology 2006-2007
Honors Biology 2006-2007
RNA Structure § RNA structure differs from DNA
structure in 3 ways:
1. RNA is single stranded 2. RNA is composed of the sugar
Ribose 3. In RNA, a new base Uracil
replaces Thymine
Honors Biology 2006-2007
RNA Nitrogen Bases § Both RNA and DNA contain four nitrogen bases,
but instead of Thymine, RNA contains Uracil (U)
Uracil forms a base pair with Adenine, just as Thymine does in DNA.
§ RNA: U - A § DNA: T - A
Honors Biology 2006-2007
DNA vs. RNA Venn DNA RNA
Honors Biology 2006-2007
Types of RNA Molecules § 3 types of RNA molecules help to build
proteins:
1. Messenger RNA (mRNA): “the messenger” § Runs information from DNA in the
nucleus to ribsosomes.
2. Ribosomal RNA (rRNA): “the reader” § Part of ribosome and “reads” mRNA
message.
3. Transfer RNA (tRNA): “the transporter” § Brings amino acids to the ribosome to be
assembled into protein.
Honors Biology 2006-2007
The “Central Dogma”
Step 1: transcription
Step 2: translation
replication
protein RNA DNA trait
DNA gets all the glory,
but proteins do all the work!
Step 3: Folding
Genotype Phenotype
Honors Biology 2006-2007
Protein Synthesis § Step 1: Transcription
Rewriting DNA into mRNA so that the instructions can leave the nucleus
§ Step 2: Translation Translating RNA into amino acids
§ Step 3: Protein Folding Amino acid chain folds up into finished protein
Honors Biology 2006-2007
Step 1: Transcription
§ Transcription is the process within the cell nucleus where enzymes make an RNA copy of a DNA gene. The nucleotide sequence rewritten (transcripted) as
mRNA acts as a genetic message.
This message is the complete information for the building of a protein.
§ WHY??? DNA cannot leave the nucleus!
DNA RNA
Honors Biology 2006-2007
Steps of Transcription § 1. Separation of Strands
Enzyme DNA helicase opens up the DNA molecule
§ 2. Initiation Enzyme RNA Polymerase joins DNA at the beginning of a gene
§ 3. Elongation An RNA Polymerase “reads” the DNA it adds the complimentary
RNA bases
§ 3. Reformation (DNA) mRNA is complete and DNA winds back up.
§ 4. Termination mRNA is complete and leaves the nucleus to go to the ribosome.
Honors Biology 2006-2007
Transcription Example
Using the RNA base-pairing rules, DNA is easily decoded into the mRNA strand.
TACGCACATTTACGTACGCGG!DNA
AUGCGUGUAAAUGCAUGCGCC!mRNA
Honors Biology 2006-2007
Step 2: Translation
§ Translation - converting information in mRNA into the language of proteins Takes place at ribosomes in the cytoplasm.
The protein language is made up of an “alphabet” of Amino Acids.
§ Because there are 20 different amino acids and mRNA has only 4 bases, biochemists realized that a code was needed to convert the language into a protein.
RNA protein
Honors Biology 2006-2007
The Genetic Code § The Genetic Code is made up of 64 codons.
A Codon is a set of 3 nitrogen bases of mRNA that represents a certain amino acid.
§ All organisms use the same genetic code! § Example: UAC codes for the amino acid tyrosine
in the mRNA of bacteria, birch trees, and bison.
Yeah, me & bacteria go way back.
Honors Biology 2006-2007
DNA Replication vs. RNA Transcription
Honors Biology 2006-2007
AUGCGUGUAAAUGCAUGCGCC!mRNA
mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG!DNA
AUGCGUGUAAAUGCAUGCGCC!mRNA
codon
Codons are “read” by the ribosome three bases at a time
Honors Biology 2006-2007
More on Codons § Codons do not just code for amino acids. Some codons
provide instructions for the assembling of proteins.
Stop Codon: (UAA), (UAG), and (UGA) are all stop codons indicating that protein production ends.
Start Codon: (AUG) is a codon that indicates where protein production must start. This codon also codes for an amino acid (Methionine)
Honors Biology 2006-2007
The Code
§ For ALL life! strongest support for a
common origin for all life
§ Code is redundant several codons for each
amino acid
§ Start codon AUG methionine
§ Stop codons UGA, UAA, UAG
Honors Biology 2006-2007
How do amino acids get to the ribosome?
§ tRNA transports all the amino acids to the ribosome. Each tRNA molecule attaches to only one type
of amino acid because of it’s structure. This is done through base pairing.
§ tRNA carries only the amino acid that it’s Anticodon specifies.
Honors Biology 2006-2007
tRNA Structure § “clover leaf” structure § Anticodon - three bases
on tRNA that pair with codon of mRNA on “clover leaf” end amino acid on �
opposite end
Honors Biology 2006-2007
Honors Biology 2006-2007
Ribosomes Structure § Made up of rRNA § P site
holds tRNA carrying growing polypeptide chain
§ A site holds tRNA carrying next amino acid to be
added to chain
§ E site (exit site) discharged tRNA �
leaves ribosome �from exit site
Honors Biology 2006-2007
Steps of Translation 1. Ribosome reads mRNA
codons AUG codes start
2. tRNA brings correct amino acids
3. tRNA matches anticodon to codon
4. Amino Acids assembled into polypeptide chain Peptide bonds!
5. Protein synthesis is terminated by stop codon.
Honors Biology 2006-2007
Honors Biology 2006-2007
Translation Example
Use the Genetic Code chart and mRNA codons to figure out each amino acid in the sequence.
TACGCACATTTACGTACGCGG!DNA
AUGCGUGUAAAUGCAUGCGCC!mRNA
Met Arg Val Asn Ala Cys Ala!protein
Honors Biology 2006-2007
Genetic Code Chart
Honors Biology 2006-2007
Step 3: Protein Folding
§ Amino acid chains become active Proteins when they are freed from the ribosome and twist and curl into complex 3-D shapes.
Each protein chain forms the same shape every
time it is produced.
§ These proteins become enzymes, cells, and tissue structures.
protein trait
Honors Biology 2006-2007
mRNA
From gene to protein
DNA transcription
nucleus cytoplasm
mRNA leaves nucleus through nuclear pores
proteins synthesized by ribosomes using instructions on mRNA
aa
aa
aa
aa
aa
aa
aa
aa
ribosome
protein translation
Honors Biology 2006-2007
The Big Picture
Honors Biology 2006-2007
Honors Biology 2006-2007
Gene Mutations
Honors Biology 2006-2007
Reading Codons § Codons are “read” by the ribosome three bases
at a time WHYDIDTHEREDBATEATTHEFATRAT!WHYDIDTHEREDBATEATTHEFATRAT!§ But, what happens if there is a change in the
DNA base sequence?
WHYDIDTHEREDCATEATTHEFATRAT!
WHYDIDTHEREDBATATTHEFATRAT!
WHYDIDTHEREDBATEATATHEFATRAT!
Honors Biology 2006-2007
Gene Mutations § A mutation is a permanent change in the DNA sequence of
a gene. Mutations in a gene's DNA sequence can alter the amino acid
sequence of the protein encoded by the gene.
§ How does this happen? Error during DNA replication
Error during transcription
Exposure to chemical, UV Radiation, carcinogen, etc.
Honors Biology 2006-2007
When do mutations affect the next
generation?
Point Mutations § Single base change § 3 Outcomes
1. Silent mutation – no amino acid change
2. missense – Changes the amino acid
3. nonsense – changes to a stop codon
Honors Biology 2006-2007
Point mutation leads to Sickle cell anemia What does the mutation cause?
Missense!
Honors Biology 2006-2007
Frameshift Mutations § Shifts reading frame
changes everything “downstream”
§ 2 Kinds Frameshift Insertion
§ adding base(s)
Frameshift Deletion § losing base(s)
§ Outcomes: nonsense or missense
Honors Biology 2006-2007
Cystic Fibrosis
Honors Biology 2006-2007
Is there any value in mutations?