1
miR-141 is A Key Regulator of Renal Cell Carcinoma Proliferation and
Metastasis by Controlling EphA2 Expression
Xuanyu Chen1, Xuegang Wang1, Anming Ruan1, Weiwei Han1, Yan Zhao2, Xing Lu2, Pei Xiao2, Hangchuan Shi1,
Rong Wang1, Li Chen1, Shaoyong Chen3, Quansheng Du4, Hongmei Yang2, and Xiaoping Zhang1
1Department of Urology, Union Hospital, Tongji Medical College, Huazhong University of Science and
Technology, Wuhan 430022, China
2Department of Pathogen Biology, Tongji Medical College, Huazhong University of Science and Technology,
Wuhan 430030, China
3Cancer Biology Program, Hematology-Oncology Division, Department of Medicine, Beth Israel Deaconess
Medical Center, Harvard Medical School, Boston, Massachusetts 02215, USA
4Department of Neurology, Institute of Molecular Medicine and Genetics, Medical College of Georgia, Georgia
Regents University, Augusta, GA 30912, USA
Corresponding Authors:
X. Zhang, Department of Urology, Union Hospital, Tongji Medical College, Huazhong University of Science
and Technology, 1277 Jiefang Avenue, Wuhan 430022, Hubei Province, China. Phone: 86-27-85351625; Email:
H. Yang, Department of Pathogen Biology, Tongji Medical College, Huazhong University of Science and
Technology, 13 Hangkong Road, Wuhan 430030, Hubei Province, China. Phone: 86-27-83691053; Email:
Running Title: miR-141 inhibits proliferation and metastasis in RCC
Key Words: miR-141, renal cell carcinoma, proliferation, metastasis, EphA2
Grant Support
This study was supported by the National Natural Science Foundation of China (NSFC) (Grant No. 30872924,
81072095 & 81372760), Program for New Century Excellent Talents in University from Department of Education
of China (NCET-08-0223), the National High Technology Research and Development Program of China (863
Program) (2012AA021101) to X. Zhang, and the NSFC (Grant No. 31070142 & 81272560) to H. Yang.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Other Notes
Our manuscript contains 4,879 words, one table and seven figures. The supplemental information is composed
of supplemental experimental procedures, two tables and five figures.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
2
Translational Relevance
Renal cell carcinoma (RCC) is a particularly aggressive and chemoresistant malignancy.
Current targeted therapies based on the discovery of the VHL/HIF/VEGF pathway have changed
the treatment landscape for patients with metastatic RCC, whereas these therapies have not lived
up to their initial promise. A central role of microRNAs (miRNAs) in the initiation and
progression of cancers has begun to emerge. Here we screened and identified that miR-141 was
the most significantly downregulated in clear cell RCC (ccRCC) tissues and cell lines, and a
promising biomarker for discriminating ccRCC and normal renal tissues. Furthermore, miR-141
overexpression effectively suppressed tumor growth, local invasion and metastatic colonization in
human RCC orthotopic xenografts by decreasing a direct functional effector EphA2. Because our
findings are based on clinical RCC samples and a good animal model, miR-141’s ability to
suppress of tumorigenesis and metastasis may prove to be clinically useful.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
3
Abstract
Purpose: Although microRNAs (miRNAs) have been revealed as crucial modulators of
tumorigenesis, our understanding of their roles in renal cell carcinoma (RCC) is limited. Here we
sought to identify human miRNAs that act as key regulators of renal carcinogenesis.
Experimental Design: We performed microarray-based miRNA profiling of clear cell RCC
(ccRCC) and adjacent normal tissues and then explored the roles of miR-141 both in vitro and in
vivo, which was the most significantly downregulated in ccRCC tissues.
Results: 74 miRNAs were dysregulated in ccRCC compared with normal tissues. miR-141 was
remarkably downregulated in 92.6% (63/68) ccRCC tissues and would serve as a promising
biomarker for discriminating ccRCC from normal tissues with an AUC of 0.93. Overexpression of
miR-141 robustly impaired ccRCC cell migratory and invasive properties and suppressed cell
proliferation by arresting cells at G0/G1 phase in vitro and in human RCC orthotopic xenografts.
Significantly, the anti-tumor activities of miR-141 were mediated by its reversal regulation of
EphA2, which then relayed a signaling transduction cascade to attenuate the functions of focal
adhesion kinase (FAK), AKT, and MMP2/9. In addition, a specific and inverse correlation
between miR-141 and EphA2 expression was obtained in human ccRCC samples. Finally,
miR-141 could be secreted from the ccRCC donor cells, and be taken up and function moderately
in the ccRCC recipient cells.
Conclusion: miR-141 serves as a potential biomarker for discriminating ccRCC from normal
tissues and a crucial suppressor of ccRCC cell proliferation and metastasis by modulating the
EphA2/p-FAK/p-AKT/MMPs signaling cascade.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
4
Introduction
Renal cell carcinoma (RCC) accounting for 3% of adult malignancies is the most lethal
urological malignancy, with about 65,150 new cases and 13,680 deaths estimated for 2013 in the
United States (1). RCC is heterogeneous and comprises several histological subtypes according to
the differences in genetics, biology and behavior. The most common and aggressive RCC subtype
is clear cell RCC (ccRCC) with the highest rates of local invasion, metastasis, mortality and
refractory to current treatments. Recently, advancements in understanding of the VHL gene
pathway in ccRCC have produced pharmaceutic outcomes based on specific molecular targets that
have changed the treatment landscape for patients with metastatic RCC (mRCC) (2).
Unfortunately, the vast majority of treated patients with mRCC eventually develop progressive
disease due to acquired resistance or other reasons. Hence, a better understanding of the
mechanisms involved in the pathogenesis of ccRCC and more effective therapeutic approaches are
urgently required.
MicroRNAs (miRNAs), a group of small non-coding RNAs of about 22 nucleotides in length,
negatively regulate gene expression, primarily through interaction with the 3’untranslated region
(3′UTR) of target mRNAs (3). miRNAs are known to contribute to multiple tumorigenic steps in
human cancers, including RCC. Recent studies have identified regulatory activities of miRNAs in
ccRCC cell growth (4-8), apoptosis (5, 6, 8, 9), migration and invasion (5-8). A predominant and
systemic alteration in miRNA expression during renal carcinogenesis has been indicated by
present studies of miRNA expression profiling (10-17). Consistently, the miR-200 family
members (miR-200s) that comprise miR-141, 200c, 200a, 200b and 429 are among the most
markedly decreased miRNAs in ccRCC. These miRNAs were previously found to be closely
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
5
associated with cell motility by modulating epithelial-mesenchymal transition (EMT), the
formation of cancer stem cells, sensitivity to chemotherapeutic agents, and apoptosis (9, 18-23).
However, how miR-200s function in ccRCC pathogenesis remains largely unknown. Growing
evidences reveal that extracellular miRNAs are chemically stable and can be detected in a broad
range of clinical samples and hence, have diagnostic and prognostic values (24-26). Furthermore,
certain secreted miRNAs from living cells (for example, miR-146a and miR-223), are transferable
and can affect surrounding and remote cells by regulating target mRNAs and proteins, implying
functions of miRNAs in intercellular communication (27-29). Given their small size and
substantial effects in a wide range of pathologies, miRNAs can be potentially utilized in ccRCC
therapy.
Here, we monitored miRNA expression profiles of ccRCC and identified miR-141 as one of
the most significantly downregulated miRNAs in ccRCC tissues and cells and a critical suppressor
of ccRCC cell growth and metastasis both in vitro and in vivo. We further demonstrated that the
attenuation of miR-141 in RCC is associated with the amplification of EphA2 and additional
downstream pathways. Moreover, our results based on clinical RCC samples showed that
miR-141 might be a potential biomarker for discriminating between ccRCC and normal tissues.
Finally, we found that miR-141 can be secreted from the ccRCC donor cells, and be taken up and
function moderately in the ccRCC recipient cells.
Materials and Methods
Human samples
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
6
Surgical specimens (paired normal and cancerous tissues) were obtained from 78 patients with
kidney tumors in Department of Urology, Union Hospital, Tongji Medical College (Wuhan,
China), freshly frozen in liquid nitrogen and stored at -80°C for RNA and protein extraction.
Informed consent was obtained from patients and the study was approved by the Institutional
Review Board of Huazhong University of Science and Technology. Relevant clinical and
pathological information based on patient records was collected and listed in the Supplementary
Table S1.
miRNA microarray
The miRNA expression profiling was conducted using the commercially available G4471A
Human miRNA Microarray (Agilent Technologies, Palo Alto, CA), which consists of 961 probes
for 851 human miRNAs, based on Sanger miRBase release 12.0. The arrays were washed and
scanned with a laser confocal scanner (G2565BA, Agilent Technologies, Palo Alto, CA) according
to the manufacturer’s instructions. The intensities of fluorescence were calculated by Feature
extraction software (Agilent Technologies). Differentially expressed miRNAs were identified by
arbitrarily setting the threshold at a fold change of 2.0 or above combined with p < 0.05
(ANOVA ).
Cell culture, infection, transfection and preparation of conditioned media (CM)
Human RCC cell lines 786-O and A498 were obtained from the American Type Culture
Collection (ATCC, Manassas, VA). The RCC cell line SN12-PM6 was supplied by Dr. I.J. Fidler
(MD Anderson Cancer Center, Houston, TX). All cells were cultured in Dulbecco’s modified
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
7
Eagle’s media plus 10% fetal bovine serum (FBS) with 1% penicillin-streptomycin at 37°C in 5%
CO2. Lentiviruses containing vector pGCSIL-GFP and pGCSIL-GFP-miR-141 were constructed
by GENECHEM (Shanghai, China) and used to infect 786-O or SN12-PM6 cells at a multiplicity
of infection (MOI) of 10 or 50, respectively, according to the manufacturer’s instructions.
miR-141 inhibitor (Inh-miR-141) and its negative control (Inh-NC) were designed and
synthesized by RiboBio (Guangzhou, China). Short interfering RNA (siRNA) against EphA2
(si-EphA2) and negative control (si-NC) with non-specific sequences was synthesized by
Genepharma (Shanghai, China). Sequence of EphA2 siRNA is as following:
5’-UGACAUGCCGAUCUACAUGdTdT-3’ (sense), 5’-CAUGUAGAUCGGCAUGUCAdTdT-3’
(antisense) (30). Cells were seeded in media without antibiotics approximately 24 hours before
transfections. Oligonucleotide transfection of a final concentration of 50 or 100 nM was
performed with Lipofectamine 2000 reagents (Invitrogen, Carlsbad, CA) according to the
manufacturer’s protocol. Cells were used for experiments after siRNA transfection for 48 hours.
To prepare CM, cells infected with lentiviruses were cultured in fresh complete media. After
incubation for 0, 24, 48, 72 hours, respectively, media were collected and centrifuged at 2,000g for
15 minutes at 4°C to remove living cells and centrifuged again at 12,000g for 35 minutes at 4°C to
thoroughly remove cellular debris (27). Then the CM were transferred to an RNase/DNase-free
1.5 ml tube and used for RNA extraction. In addition, the media from miR-141 or miR-NC cells
after incubation for 48 hours were used to culture miR-NC cells for another 48 hours.
RNA extraction, quantitative real-time PCR (qRT-PCR) and semiquantitative
reverse-transcription PCR (RT-PCR)
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
8
Total RNA of tissues and cells was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA).
Total RNA in CM was isolated by using TRI Reagent BD (Molecular Research Centre, Cincinnati,
OH) according to the manufacturer’s protocol with modification. In brief, 0.2 ml of CM was
added to 0.75 ml of TRI Reagent BD supplemented with 20 µl of acetic acid (5 mol/L). 25 fmol of
synthetic C.elegans miRNA cel-miR-39 (Qiagen, Hilden, Germany) was spiked-in as a normaliser
before chloroform extraction, and then the RNA was precipitated in isopropanol overnight at
-20°C. Finally the pellet was dissolved in 15 µl of DEPC-treated water. Reverse transcription of
miRNA and mRNA was done using RevertAid™ First Strand cDNA Synthesis Kit (Fermentas,
Vilnius, Lithuania) and a reverse transcript primer from RiboBio (Guangzhou, China). qRT-PCR
analysis was performed with the Platinum SYBR Green qPCR Supermix UDG kit (Invitrogen,
Carlsbad, CA) using synthesized primers from RiboBio (Guangzhou, China) or
Sangon biotech (Shanghai, China). Mature miRNAs and mRNAs were measured in accordance
with the manufacturer's instructions (LightCycler® 480Ⅱ, Roche, Mannheim, Germany). RT-PCR
for EphA2 was performed with 2 x Taq PCR MasterMix (Tiangen Biotech, Beijing, China)
according to the manufacturer’s protocol. The primers were listed in the Supplemental
Experimental Procedures. Samples were normalized to RNU6B (U6) or GAPDH. Relative
expression was calculated using the power formula: 2-△Ct (△Ct=CtmiR-141-CtU6).
Cell viability, drug sensitivity, cell cycle, migratory and invasion assays
Cell viability was assessed at 24, 48, 72 and 96 hours upon treatments by the
3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) method (Sigma, USA) as
previously described (31). For drug sensitivity assay, cells were treated with various
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
9
concentrations of cisplatin (DDP), 5-fluorouracil (5-FU) and tumor necrosis factor-related
apoptosis-inducing ligand (TRAIL) for 24 or 48 hours, then measured by above MTT assay.
Fluorescence -activated cell-sorting (FACS) (BD, USA) analysis was done using propidium iodide
(PI) stains for cell-cycle analysis according to the manufacturer's protocol. The 24-well transwell
plate with 8 µm pore polycarbonate membrane inserts (Corning, New York, USA) was used to
analyze the migration and invasive potential of cells according to manufacturer's protocol. For
invasion assay, the membrane was coated with the matrigel (200 ng/ml) (BD Biosciences, Bedford,
MA). After 24 hours of incubation, cells invading into the lower surface of the membrane insert
were fixed in 100% methanol, stained with 0.05% crystal violet, and quantified by counting in 10
random fields. To evaluate the effects of secreted miR-141 on cell migration and invasion, cells
overexpressing miR-141 or miR-NC were cultured in the lower chambers for 24 hours and then
control (miR-NC) cells were placed in the upper chamber for another 24 hours.
Xenograft orthotopic implantations
For in vivo studies, 1 x 106 SN12-PM6 cells stably expressing miR-141 or miR-NC were
injected into the left kidney of male BALB/c nude mice at 4-5 weeks of age as previously
described (32). The green fluorescence intensity of the xenografts was monitored periodically
using the Lumazone FA 2048 system (Roper Scientific, USA). 6 weeks and 8-9 weeks after the
implantation of the xenografts, animals were euthanized and xenografts were harvested, and
assessed for tumor weight, local invasion and distant metastasis. Renal tumors from xenografts
were flash frozen in liquid nitrogen and stored at -80°C for RNA extraction. Formalin-fixed,
paraffin-embedded RCC xenografts were assessed by hematoxylin and eosin (HE) staining and
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
10
evaluated for EphA2 expression. All experiments were approved by the Animal Care and Use
Committee of Tongji Medical College of Huazhong University of Science and Technology.
Luciferase assays
Wild-type and mutant EphA2 3’UTR reporter and control construct were purchased from
GENECHEM (Shanghai, China). Tumor cells overexpressing miR-141 and miR-NC cultured in
48-well plates were cotransfected with 1.5 ug of firefly luciferase reporter and 0.35 ng Renilla
luciferase reporter with Lipofectamine 2000 reagents (Invitrogen, Carlsbad, CA). 24 hours
posttransfection, firefly luciferase activities were measured using the Dual Luciferase Assay
(Promega, Madison, WI) and the results were normalized with Renilla luciferase according to the
manufacturer’s protocol.
Statistical analysis
Results are expressed as mean±SEM from at least three independent experiments. Using the
GraphPad Prism statistical program, data were analyzed using Student’s t- test unless otherwise
specified (Mann–Whitney test, ROC, Pearson’s correlation, etc.). The 2-tailed P values <0.05 were
considered significant.
Supplemental information
The supplemental information includes supplemental methods, two tables, and five figures.
Results
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
11
Loss of miR-141 expression in ccRCC tissues and cells
Using a microarray platform which contains 851 human miRNAs to study miRNA profiles in
paired primary tumor and adjacent normal tissues (NTs) from 5 patients with the mean
tumor size of 4.7 cm (range, 2.3-6.0 cm), we identified 74 miRNAs dysregulated in ccRCCs
compared with NTs (fold change>2.0 and p < 0.05), among which 44 were significantly
downregulated and the other 30 were upregulated (Supplementary Table S2). Notably, four
members (miR-141, 200b, 200c and 429) of miR-200s were all markedly reduced in ccRCC
tissues. Our miRNA expression pattern was similar with previous studies identified by microarray,
qRT-PCR or deep-sequencing, which covered less miRNAs (10-14, 17). Based on these findings,
we reasoned that miR-200s may contribute to the development of ccRCC. Among these
differentially expressed miRNAs in ccRCC, miR-141 was one of the most remarkably
downregulated miRNAs (104-fold) and its roles in RCC have not been fully documented yet
(10-14, 17). Thus, we chose miR-141 as a representative to substantiate the functions of miR-200s
in ccRCC.
Next, we validated the clinical significance of miR-141 by analyzing its expression in 68 pairs
of ccRCCs and NTs by qRT-PCR. In accordance with microarray results, qRT-PCR showed that
miR-141 was significantly downregulated in 92.6% (63/68) ccRCCs (p<0.0001) (Fig. 1A and B).
Receiver operating characteristics (ROC) analysis revealed that miR-141 might serve as a useful
biomarker for discriminating ccRCC from normal tissues with an area under the ROC curve (AUC)
of 0.93 (95% CI, 0.881 to 0.981) (Fig. 1C). At a threshold of 0.00005 for its relative expression,
the sensitivity was 86.76% and the specificity was 97.06%. As demonstrated, miR-141 expression
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
12
was not associated with tumor stage, grade or size, while its expression gradually decreased during
tumor progression (Supplementary Fig. S1A-C). Notably, miR-141 was barely expressed in
ccRCC cell lines, including 786-O, SN12-PM6 and A-498 cells (Fig. 1D).
We then addressed whether miR-141 could be a potential marker to differentiate malignant
tumors from benign tumors. The levels of miR-141 in 2 chromophobe RCCs (chRCCs), 1 sarcoma
RCC, 7 renal angiomyolipomas (AMLs) and their NTs were analyzed by qRT-PCR. Unexpectedly
and significantly, miR-141 was also markedly decreased in these tumors, although there was no
difference between ccRCCs and AMLs (Fig. 1B and Supplementary Fig. S1D). The results imply
that miR-141 contributes to the development of tumors originated from kidney independent of
specific subtypes.
Overexpression of miR-141 attenuates ccRCC cell proliferation and motility
To explore the biological significance of miR-141, we stably overexpressed miR-141 in two
ccRCC cell lines 786-O and SN12-PM6 with lentiviruses carrying miR-141 and its control
(miR-NC) (Supplementary Fig. S2A and B). The efficacy of infection was tested by qRT-PCR
(Supplementary Fig. S2C and D). miR-141 expression was elevated up to 400- and 2400-fold in
786-O and SN12-PM6 cells, respectively. An increase in the control miR-16 expression was not
observed, suggesting that lentiviruses specifically increased miR-141 expression. There were no
marked cellular morphologic changes in the miR-141-overexpressed cells (Supplementary Fig.
S2A and B), however, the cellular proliferation (MTT and FACS) analyses showed that
overexpression of miR-141 suppressed ccRCC cell proliferation (p<0.05) (Fig. 2A), caused cell
cycle arrest at G0/G1 phase and decreased the S phase population (Fig. 2B and Supplementary Fig.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
13
S3A). More importantly, overexpression of miR-141 markedly impaired ccRCC cell migration
and invasiveness compared to miR-NC (p<0.001) (Fig. 2C and Supplementary Fig. S3B).
Additionally, miR-141 overexpression did not directly induce apoptosis in the two tested ccRCC
cell lines, with no pronounced alterations in the responsiveness to DDP, 5-FU and TRAIL (data
not shown). These findings indicate that miR-141 acts as a tumor-suppressor in RCC by inhibiting
cell proliferation and motility.
Extracelluar miR-141 modulates cell motility of recipient cells
Mounting evidence indicate certain miRNAs released from the donor tumor cells can be taken
up by the recipient tumor cells to function in cell-cell communications during cancer progression
(29). To determine whether miR-141 had similar features in the ccRCC cell lines, we first
prepared conditioned media (CM) from miR-141-overexpressed 786-O and SN12-PM6 cells, as
well as control cells (miR-NC). The levels of miR-141 in the CM from miR-141 and miR-NC
cells were measured at several time points. Similar to previous reports (27, 28), extracelluar
miR-141 in CM of miR-141 cells was significantly higher than that of miR-NC cells (Fig. 2D). As
a control, extracelluar miR-16 expression remained unchanged (Fig. 2D). In addition, the ratios of
extracelluar/intracellular miR-141 in the 786-O and SN12-PM6 cells were less than 2.2% and
0.01%, respectively (Supplementary Fig. S2E and F). To test whether extracelluar miR-141 was
taken up in the recipient ccRCC cells, CM from miR-141 or miR-NC cells were used to culture
miR-NC cells. As shown in Fig. 2E, levels of intracellular miR-141 in the miR-NC cells was
increased for about 10 or 7-fold after adding CM of the miR-141 cells. We next assessed whether
extracelluar miR-141 can make an impact on cell motility using transwell assay. The data showed
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
14
that co-culture with CM of the miR-141 cells decreased migration and invasion of the recipient
miR-NC cells (Fig. 2F and Supplementary Fig. S3C). However, CM of miR-141 cells did not
impact cell proliferation and cell cycle of miR-NC cells (data not shown). The above data
demonstrated that miR-141 can be excreted into extracellular environment and plays active
biological functions in the recipient cells. However, the level of extracelluar miR-141 was
markedly lower than its intracellular counterpart in the parental cells, suggesting that more
predominant miRNA activities reside intracellularly. Accordingly, we next focused on the
functions of intracellular miR-141.
miR-141 suppresses tumorigenesis and metastasis in human RCC orthotopic xenografts
To identify antitumorigenic roles of miR-141 in RCC in vivo, SN12-PM6 cells overexpressing
miR-141 versus miR-NC were injected into the left kidney of nude mice and then tumor growth
and metastasis were evaluated. Our previous results have demonstrated that the renal orthotopic
xenografts can develop primary renal tumors and give rise to metastases in multiple organs (32).
Tumor growth was surveilled by detecting GFP expression using the automated fluorescence
imaging system. As shown in Fig. 3A, fluorescence imaging showed a significant reduction of
tumor growth in miR-141-overexpressed cells at as early as 3nd week. Meanwhile, no difference
of tumor incidence was observed between miR-141 and miR-NC tumors (Table 1). Over a period
of 6 weeks and 8-9 weeks postimplantation, there was a more significant decrease in tumor weight
and size upon expression of miR-141 (p<0.05) (Table 1 and Fig. 3B). More specifically, tumors
with miR-141 overexpression were commonly encapsulated and confined to kidney parenchyma,
whereas tumors of control cells presented more aggressive growth (Fig. 3B and C). In addition, no
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
15
macroscopic metastases were found in tumors with miR-141 overexpression. In contrast, miR-NC
tumors extensively infiltrated the kidney fascia, especially at 8th-9th week after implantation
(Table 1 and Fig. 3B). Compared with miR-141 tumors, the miR-NC tumors were prone to local
invasion and metastasis. As shown in Fig. 3D, the miR-NC tumors metastasized to various sites,
including lung, liver, lymph nodes, cecum, musculus diaphragm and peritoneum ((Table 1 and Fig.
3D). These data further demonstrated that miR-141 functions as a critical tumor-suppressor in
RCCs by suppressing tumorigenesis, local invasion and metastatic colonization.
EphA2 is a novel direct target of miR-141
Our aforementioned work demonstrated that miR-141 plays a critical role in modulating
migration and invasion in ccRCC cells, which promoted us to identify specific miR-141 targets
with potential relevance in the regulation of metastasis. Recent work on miR-141 mostly focused
on the association with the process of EMT by downregulating ZEB2, TGFβ2 and upregulating
E-cadherin in different cancers (18-21). Several reports also showed miR-141 regulated Notch
signaling pathway by targeting JAG1 (33, 34). Consistent with previous observations, 786-O and
SN12-PM6 cells with overexpression of miR-141 showed decreased levels of ZEB2, TGFβ2,
JAG1, HES1 and increased E-cadherin expression (Supplementary Fig. S4). However, the
alterations just based on EMT cannot fully recapitulate its profound effects on tumor progression.
Next, we used different miRNA target-predicting algorithms such as TargetScan, Pictar, miRanda,
miRDB and miRwalk to identify potential effector (s) of miR-141 and found conserved miR-141
sites at the 3’UTR of EphA2. As EphA2 has been reported to be highly expressed in RCC cells
and tissues and associated with advanced stage disease and poor prognosis (35, 36), we reasoned
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
16
that the loss of miR-141 might be an important factor of RCC malignancy by upregulating EphA2
expression.
To prove the above hypothesis, we examined the correlation between miR-141 and EphA2
expression in both in vitro and in vivo studies. As shown in Fig. 4A and B, enforced miR-141
expression led to a decrease in EphA2 mRNA and protein expression in both 786-O and
SN12-PM6 cells. Consistently, evaluation of primary tumors in the renal orthotopic xenografts
models showed an inversed correlation between miR-141 expression and EphA2 mRNA and
protein levels (Fig. 4C and D).
To further validate EphA2 as a direct target of miR-141, a 208 bp fragment from the EphA2
3’UTR containing the putative miR-141 target sites was cloned into a luciferase reporter construct.
As shown in Fig. 4E, the miR-141 binding site in EphA2 mRNA is a broadly conserved element
among vertebrates and locates in the vicinity of 753 to 759 bp of the EphA2 3’UTR.
Dual-luciferase reporter assays were performed in 786-O and SN12-PM6 cells with
overexpression of miR-141 versus miR-NC to assess the functions of this potential miR-141 target
site. Significantly, miR-141 overexpression substantially repressed activity of the reporter that
carried the wild-type but not mutant 3’UTR of EphA2 (Fig. 4F), suggesting the regulation is
mediated in sequence-specific manner and the tested region is a bona fide miR-141 targeting site.
miR-141-repressed tumor proliferation and aggressive behavior is mediated by EphA2
The above findings indicate that EphA2 is a candidate effector to mediate biological functions
of miR-141. We next examined whether knockdown of EphA2 could recapitulate the inhibitory
effects of miR-141 on ccRCC cell proliferation and progression. 786-O and SN12-PM6 cells were
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
17
transfected with si-EphA2 versus si-NC. RT-PCR and WB analysis confirmed the EphA2 siRNA
markedly and specifically decreased EphA2 expression (Fig. 5A and B). Significantly, knockdown
of EphA2 in ccRCC cells attenuated cell growth, induced G0/G1 cell-cycle arrest, and suppressed
cell migration and invasion (Fig. 5C-E), similarly to the phenotypic alterations upon miR-141
overexpression. To further determine whether EphA2 is the direct and functional mediator of
miR-141-repressed cell migration and invasion, we performed a rescue experiment by
co-transfecting with EphA2 siRNA (versus the negative control) and miR-141 inhibitor (versus the
negative control) into 786-O and SN12-PM6 cells. Transient transfection of miR-141 inhibitor led
to downregulation of miR-141 and upregulation of EphA2 as determined by qRT-PCR and WB
(Fig. 5F). Importantly, the enhancement in ccRCC cell migration and invasion induced by
miR-141 inhibitor was effectively reversed by EphA2 attenuation (Fig. 5G and Supplementary Fig.
S3D). Collectively, these findings indicate that EphA2 is an essential functional effector of
miR-141 in ccRCC.
EphA2 protein is frequently upregulated in ccRCC tissues
We then further investigate based on clinical samples whether miR-141 is involved in the
pathogenesis of human ccRCC through EphA2. The expression of EphA2 mRNA and protein
from 20 pairs of ccRCC and their NTs were analyzed by qRT-PCR, WB and IHC, respectively.
These 20 pairs of samples have showed a statistically significant decrease in miR-141 in the
ccRCC tissues (Fig. 1A). Unexpectedly, no remarkable difference of EphA2 mRNA was observed
between ccRCC and NTs (Fig. 6A). Anyhow, Pearson’s correlation analysis showed a good
reverse correlation between levels of miR-141 and EphA2 mRNA in ccRCC tissues (R2=0.3661,
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
18
p=0.0047) (Fig. 6B). Specifically, lower miR-141 levels were associated with higher EphA2
mRNA expression, and vice versa (Fig. 6C). Notably, compared to normal tissues, meaningful
overexpression of EphA2 protein was observed in 17 of 20 and decreased expression of EphA2
was showed in 1 of 20 ccRCC cases by WB analysis (Fig. 6D). A similar result was obtained in
IHC analysis (Supplementary Fig. S5), further supporting that the increased level of EphA2 is, at
least in part, attributed to loss of miR-141 in ccRCC. Collectively, these findings clearly
substantiate that EphA2 is a direct and functional target of miR-141.
miR-141-EphA2 modulates FAK and AKT phosphorylation
Next, we extended the studies on the miR141-EphA2 module to further downstream, based
on reported EphA2 signaling to the FAK and AKT pathways (28, 35-37). For this purpose, we
monitored whether p-FAK and p-AKT were the downstream effectors of the miR-141-EphA2
module. Expectedly, overexpression of miR-141 adequately led to compromised p-FAK and
p-AKT in 786-O and SN12-PM6 cells (Fig. 7A). Suppression of EphA2 also resulted in an
attenuation of p-FAK and p-AKT (Fig. 7B). Moreover, the rescue experiment showed that
upregulation of EphA2 expression following miR-141 inhibition led to increased phosphorylation
of FAK and AKT, while knockdown of EphA2 rescued the stimulatory effects of miR-141
inhibitor on p-FAK and p-AKT (Fig. 7C). These results suggest that miR-141 may act as a
tumor-suppressor through negatively regulating the EphA2/p-FAK/p-AKT pathway.
It has been reported that FAK and AKT promote cancer cell migration and invasion by
elevating MMP-2/9 expression, which have been implicated in the aggressiveness of RCC (37, 38).
Accordingly, we further pursued whether miR-141-EphA2 mediated tumorigenesis and
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
19
progression in ccRCC was correlated with MMP-2/9. WB analysis showed that stable
overexpression of miR-141 or EphA2 knockdown in 786-O and SN12-PM6 cells led to a marked
reduction of MMP-2 (Fig. 7A and 7B). However, a significant downregulation of MMP-9 was
only observed in SN12-PM6 cells but not in 786-O cells. Together, these data imply that
miR-141-EphA2 may contribute to ccRCC metastasis through that p-FAK/p-AKT/MMPs cascade.
Discussion
Identification of additional and essential molecular determinant(s) is imminent to designate
alternative strategies to overcome resistance in RCC therapy. Recent advances have established
dysregulation of miRNAs as a common event in cancers. Others and our groups have identified
that global downregulation of miRNA expression is a rising feature in ccRCC (10-14, 16, 17).
Among these miRNAs, four members (miR-141, 200c, 200b and 429) of miR-200s were all
markedly reduced in ccRCC tissues. However, how miR-200s functions in ccRCC pathogenesis
are still not well understood. Despite of our globe miRNA screen in the small sample size (N=5),
miR-141 has been reported to be one of the most significantly down-regulated in ccRCC tissues
and cells (10-14, 16, 17). Thus, we chose miR-141 as a representative to study the roles of
miR-200s. We demonstrated that miR-141 serves as a potential biomarker for discriminating
ccRCC from normal tissues and a crucial suppressor of ccRCC cell proliferation and metastasis by
modulating the EphA2/p-FAK/p-AKT/MMPs signaling cascade. This is the first in vivo study on
the functional characterization and mechanistic investigation of miR-141 in RCC.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
20
Our findings indicated that miR-141 can be a potential biomarker in RCC diagnosis. Similar to
Jung’s reports (11, 15), our study showed that miR-141 measurement yielded 92.6% accuracy in
discriminating ccRCC tissues from normal kidney tissues. In consistence with previous studies (15,
39), no significant correlation was identified between miR-141 expression and RCC tumor stage,
grade, or size. Recent reports have also showed the ability of miRNAs to distinguish between
RCC subtypes with an accuracy of about 90%, including ccRCC, papillary RCC (pRCC), chRCC
and the closely related benign tumor oncocytoma (40, 41). Here, miR-141 expression was equally
decreased in malignant (ccRCC, chRCC and sarcoma RCC) and benign renal tumors (AML).
Considering that these results come from the relatively small number of clinical samples and
SYBR Green dye-based assays, the clinical significance of miR-141 remains to be investigated by
TaqMan Assay with higher specificity in a large cohort of RCC patients. Another limitation of
present study is that benign renal lesion oncocytomas, which is histologically quite similar to
chRCC, have not been included in our study. The comparison among oncocytomas, AML, chRCC
and ccRCC may further determine the role of miR-141 as a potential biomarker.
It has been well documented that a reciprocal repression between ZEB1/2 and miR-200s
induces EMT, which confers invasive properties to tumors (18-21). However, the effects of
miR-141 on ZEB1/2 mediated EMT are less efficient compared with other miR-200s members
(18-21, 23), indicating the additional biological functions of miR-141 in malignancy. Consistently,
our in vitro data suggested that miR-141 overexpression dramatically attenuated ccRCC cell
migration and invasiveness, suppressed cell proliferation and induced cell cycle arrest at the G0/G1
phase. Moreover, our in vivo studies based on orthotopic xenograft model of human RCC cells
indicated that suppression of miR-141 led to a pronounced increase in renal tumor weight, local
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
21
invasion and metastasis rate. These data suggest that miR-141 is involved in RCC proliferation
and progression. However, similar correlation was not obtained in clinical ccRCC cohort (15, 39,
42). The inconsistency may be due to limited samples, improvement of early-diagnosis of clinical
RCC and genetic intratumor heterogeneity (variable levels of miR-141 expression within different
regions of one tumor sample) (39).
Most importantly, our results established EphA2 as a direct functional effector of miR-141 in
RCC. EphA2, a member of the erythropoietin-producing hepatocellular (Eph) tyrosine kinases
receptor family, is an emerging target for cancer therapeutics (43). High EphA2 expression has
been correlated with cancer progression and metastasis in many cancers, including RCC (35, 36).
Downregulation of EphA2 expression with various approaches has been shown to inhibit
malignant behavior in vitro and in vivo (43). Up to now, knowledge of functional roles and
regulatory mechanism of EphA2 in RCC is still missing. Here we showed that EphA2 protein was
significantly upregulated in the vast majority of clinical ccRCC tissues and EphA2 mRNA
expression was inversely correlated with miR-141 levels in ccRCC tissues and cells. The
restoration of miR-141 in ccRCC cells markedly downregulated EphA2 expression through direct
interaction with the 3′UTR of EphA2 mRNA, and vice versa. Our results also indicated that
EphA2 knockdown suppressed RCC cell growth by inducing G0/G1 cell-cycle arrest, migration
and invasion, which phenocopied the effects of miR-141 overexpression in vitro. Knockdown of
EphA2 rescued the promoting effects of miR-141 inhibitor on RCC cell migration and invasion.
These data clearly demonstrated that EphA2 contributes to cell growth and migration in RCC and
is a direct and functional target of miR-141.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
22
Two prominent oncogenic pathways, FAK and AKT, have been associated with EphA2
overexpression (30, 44-46). FAK pathway has been reported to be inversely correlated with
miR-200a expression in ovarian tumors, the seed sequence of which is the same as that of the
miR-141 (23). In our study, either EphA2 knockdown or miR-141 overexpression suppressed the
phosphorylation of FAK and AKT in ccRCC cells. In contrast, inhibition of miR-141 led to
increased phosphorylation of FAK and AKT. Additional downstream mediators of FAK/AKT such
as MMPs (MMP-2/9) that have been implicated in the aggressiveness of RCC (37, 38) are known
to contribute to FAK/AKT-mediated cell proliferation and progression (47-50), which is further
supported by our study on the functional activities of miR-141 and EphA2. However, further
investigation of EphA2/p-FAK/p-AKT/MMP pathway regulation in RCC is mandatory.
In conclusion, our identification of the remarkable alterations of miR-141 in RCC and its
specific functional mediators may provide novel mechanism (s) in tumor progression and
additional diagnostic and/or therapeutic target(s). The specification of the
miR-141-EphA2-FAK/Akt-MMP (2/9) pathway also has fundamental importance in basic
research.
Acknowledgment
The authors thank Dr. I.J. Fidler (MD Anderson Cancer Center, Houston, TX) for providing
the SN12-PM6 cell line.
References
1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63:11-30.
2. Rini BI, Campbell SC, Escudier B. Renal cell carcinoma. Lancet. 2009;373:1119-32.
3. Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R, et al. Regulation by let-7 and lin-4
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
23
miRNAs results in target mRNA degradation. Cell. 2005;122:553-63.
4. Mikhaylova O, Stratton Y, Hall D, Kellner E, Ehmer B, Drew Angela F, et al. VHL-Regulated
MiR-204 Suppresses Tumor Growth through Inhibition of LC3B-Mediated Autophagy in Renal Clear
Cell Carcinoma. Cancer Cell. 2012;21:532-46.
5. Majid S, Saini S, Dar AA, Hirata H, Shahryari V, Tanaka Y, et al. MicroRNA-205 Inhibits
Src-Mediated Oncogenic Pathways in Renal Cancer. Cancer Research. 2011;71:2611-21.
6. Saini S, Yamamura S, Majid S, Shahryari V, Hirata H, Tanaka Y, et al. MicroRNA-708 Induces
Apoptosis and Suppresses Tumorigenicity in Renal Cancer Cells. Cancer Research. 2011;71:6208-19.
7. Doberstein K, Steinmeyer N, Hartmetz AK, Eberhardt W, Mittelbronn M, Harter PN, et al.
MicroRNA-145 targets the metalloprotease ADAM17 and is suppressed in renal cell carcinoma
patients. Neoplasia. 2013;15:218-30.
8. Hirata H, Hinoda Y, Ueno K, Nakajima K, Ishii N, Dahiya R. MicroRNA-1826 directly targets
beta-catenin (CTNNB1) and MEK1 (MAP2K1) in VHL-inactivated renal cancer. Carcinogenesis.
2012;33:501-8.
9. Schickel R, Park SM, Murmann AE, Peter ME. miR-200c regulates induction of apoptosis
through CD95 by targeting FAP-1. Mol Cell. 2010;38:908-15.
10. Nakada C, Matsuura K, Tsukamoto Y, Tanigawa M, Yoshimoto T, Narimatsu T, et al.
Genome-wide microRNA expression profiling in renal cell carcinoma: significant down-regulation of
miR-141 and miR-200c. J Pathol. 2008;216:418-27.
11. Jung M, Mollenkopf HJ, Grimm C, Wagner I, Albrecht M, Waller T, et al. MicroRNA profiling of
clear cell renal cell cancer identifies a robust signature to define renal malignancy. J Cell Mol Med.
2009;13:3918-28.
12. Yi Z, Fu Y, Zhao S, Zhang X, Ma C. Differential expression of miRNA patterns in renal cell
carcinoma and nontumorous tissues. J Cancer Res Clin Oncol. 2010;136:855-62.
13. Juan D, Alexe G, Antes T, Liu H, Madabhushi A, Delisi C, et al. Identification of a microRNA
panel for clear-cell kidney cancer. Urology. 2010;75:835-41.
14. Weng L, Wu X, Gao H, Mu B, Li X, Wang JH, et al. MicroRNA profiling of clear cell renal cell
carcinoma by whole-genome small RNA deep sequencing of paired frozen and formalin-fixed,
paraffin-embedded tissue specimens. J Pathol. 2010;222:41-51.
15. Wotschofsky Z, Busch J, Jung M, Kempkensteffen C, Weikert S, Schaser KD, et al. Diagnostic
and prognostic potential of differentially expressed miRNAs between metastatic and non-metastatic
renal cell carcinoma at the time of nephrectomy. Clin Chim Acta. 2013;416:5-10.
16. Duns G, van den Berg A, van Dijk MC, van Duivenbode I, Giezen C, Kluiver J, et al. The entire
miR-200 seed family is strongly deregulated in clear cell renal cell cancer compared to the proximal
tubular epithelial cells of the kidney. Genes Chromosomes Cancer. 2013;52:165-73.
17. Hidaka H, Seki N, Yoshino H, Yamasaki T, Yamada Y, Nohata N, et al. Tumor suppressive
microRNA-1285 regulates novel molecular targets: aberrant expression and functional significance in
renal cell carcinoma. Oncotarget. 2012;3:44-57.
18. Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, et al. The miR-200 family and
miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol.
2008;10:593-601.
19. Burk U, Schubert J, Wellner U, Schmalhofer O, Vincan E, Spaderna S, et al. A reciprocal
repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer
cells. EMBO Rep. 2008;9:582-9.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
24
20. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, et al. A double-negative
feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal
transition. Cancer Res. 2008;68:7846-54.
21. Korpal M, Lee ES, Hu G, Kang Y. The miR-200 family inhibits epithelial-mesenchymal transition
and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2.
J Biol Chem. 2008;283:14910-4.
22. Shimono Y, Zabala M, Cho RW, Lobo N, Dalerba P, Qian D, et al. Downregulation of
miRNA-200c links breast cancer stem cells with normal stem cells. Cell. 2009;138:592-603.
23. Mateescu B, Batista L, Cardon M, Gruosso T, de Feraudy Y, Mariani O, et al. miR-141 and
miR-200a act on ovarian tumorigenesis by controlling oxidative stress response. Nature Medicine.
2011;17:1627-35.
24. Mitchell PS, Parkin RK, Kroh EM, Fritz BR, Wyman SK, Pogosova-Agadjanyan EL, et al.
Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A.
2008;105:10513-8.
25. Chen X, Ba Y, Ma L, Cai X, Yin Y, Wang K, et al. Characterization of microRNAs in serum: a
novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res. 2008;18:997-1006.
26. Weber JA, Baxter DH, Zhang S, Huang DY, Huang KH, Lee MJ, et al. The microRNA spectrum
in 12 body fluids. Clin Chem. 2010;56:1733-41.
27. Kosaka N, Iguchi H, Yoshioka Y, Takeshita F, Matsuki Y, Ochiya T. Secretory mechanisms and
intercellular transfer of microRNAs in living cells. J Biol Chem. 2010;285:17442-52.
28. Vickers KC, Palmisano BT, Shoucri BM, Shamburek RD, Remaley AT. MicroRNAs are
transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol.
2011;13:423-33.
29. Turchinovich A, Weiz L, Burwinkel B. Extracellular miRNAs: the mystery of their origin and
function. Trends Biochem Sci. 2012;37:460-5.
30. Duxbury MS, Ito H, Zinner MJ, Ashley SW, Whang EE. EphA2: a determinant of malignant
cellular behavior and a potential therapeutic target in pancreatic adenocarcinoma. Oncogene.
2004;23:1448-56.
31. Zhang X, Jin TG, Yang H, DeWolf WC, Khosravi-Far R, Olumi AF. Persistent c-FLIP(L)
expression is necessary and sufficient to maintain resistance to tumor necrosis factor-related
apoptosis-inducing ligand-mediated apoptosis in prostate cancer. Cancer Res. 2004;64:7086-91.
32. Zhang L, Zhang X, Barrisford GW, Olumi AF. Lexatumumab (TRAIL-receptor 2 mAb) induces
expression of DR5 and promotes apoptosis in primary and metastatic renal cell carcinoma in a mouse
orthotopic model. Cancer Lett. 2007;251:146-57.
33. Vallejo DM, Caparros E, Dominguez M. Targeting Notch signalling by the conserved miR-8/200
microRNA family in development and cancer cells. EMBO J. 2011;30:756-69.
34. Brabletz S, Bajdak K, Meidhof S, Burk U, Niedermann G, Firat E, et al. The ZEB1/miR-200
feedback loop controls Notch signalling in cancer cells. EMBO J. 2011;30:770-82.
35. Tatsumi T, Herrem CJ, Olson WC, Finke JH, Bukowski RM, Kinch MS, et al. Disease stage
variation in CD4+ and CD8+ T-cell reactivity to the receptor tyrosine kinase EphA2 in patients with
renal cell carcinoma. Cancer Res. 2003;63:4481-9.
36. Herrem CJ, Tatsumi T, Olson KS, Shirai K, Finke JH, Bukowski RM, et al. Expression of EphA2
is prognostic of disease-free interval and overall survival in surgically treated patients with renal cell
carcinoma. Clin Cancer Res. 2005;11:226-31.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
25
37. Kallakury BV, Karikehalli S, Haholu A, Sheehan CE, Azumi N, Ross JS. Increased expression of
matrix metalloproteinases 2 and 9 and tissue inhibitors of metalloproteinases 1 and 2 correlate with
poor prognostic variables in renal cell carcinoma. Clin Cancer Res. 2001;7:3113-9.
38. Cho NH, Shim HS, Rha SY, Kang SH, Hong SH, Choi YD, et al. Increased expression of matrix
metalloproteinase 9 correlates with poor prognostic variables in renal cell carcinoma. Eur Urol.
2003;44:560-6.
39. Berkers J, Govaere O, Wolter P, Beuselinck B, Schoffski P, van Kempen LC, et al. A Possible
Role for MicroRNA-141 Down-Regulation in Sunitinib Resistant Metastatic Clear Cell Renal Cell
Carcinoma Through Induction of Epithelial-to-Mesenchymal Transition and Hypoxia Resistance. J
Urol. 2012.
40. Fridman E, Dotan Z, Barshack I, David MB, Dov A, Tabak S, et al. Accurate molecular
classification of renal tumors using microRNA expression. J Mol Diagn. 2010;12:687-96.
41. Youssef YM, White NM, Grigull J, Krizova A, Samy C, Mejia-Guerrero S, et al. Accurate
molecular classification of kidney cancer subtypes using microRNA signature. Eur Urol.
2011;59:721-30.
42. White NM, Khella HW, Grigull J, Adzovic S, Youssef YM, Honey RJ, et al. miRNA profiling in
metastatic renal cell carcinoma reveals a tumour-suppressor effect for miR-215. Br J Cancer.
2011;105:1741-9.
43. Tandon M, Vemula SV, Mittal SK. Emerging strategies for EphA2 receptor targeting for cancer
therapeutics. Expert Opin Ther Targets. 2011;15:31-51.
44. Miao H, Burnett E, Kinch M, Simon E, Wang B. Activation of EphA2 kinase suppresses integrin
function and causes focal-adhesion-kinase dephosphorylation. Nat Cell Biol. 2000;2:62-9.
45. Miao H, Li DQ, Mukherjee A, Guo H, Petty A, Cutter J, et al. EphA2 mediates ligand-dependent
inhibition and ligand-independent promotion of cell migration and invasion via a reciprocal regulatory
loop with Akt. Cancer Cell. 2009;16:9-20.
46. Cui XD, Lee MJ, Kim JH, Hao PP, Liu L, Yu GR, et al. Activation of mammalian target of
rapamycin complex 1 (mTORC1) and Raf/Pyk2 by growth factor-mediated Eph receptor 2 (EphA2) is
required for cholangiocarcinoma growth and metastasis. Hepatology. 2013;57:2248-60.
47. Canel M, Secades P, Garzon-Arango M, Allonca E, Suarez C, Serrels A, et al. Involvement of
focal adhesion kinase in cellular invasion of head and neck squamous cell carcinomas via regulation of
MMP-2 expression. Br J Cancer. 2008;98:1274-84.
48. Sein TT, Thant AA, Hiraiwa Y, Amin AR, Sohara Y, Liu Y, et al. A role for FAK in the
Concanavalin A-dependent secretion of matrix metalloproteinase-2 and -9. Oncogene.
2000;19:5539-42.
49. Chen JS, Huang XH, Wang Q, Huang JQ, Zhang LJ, Chen XL, et al. Sonic hedgehog signaling
pathway induces cell migration and invasion through focal adhesion kinase/AKT signaling-mediated
activation of matrix metalloproteinase (MMP)-2 and MMP-9 in liver cancer. Carcinogenesis.
2013;34:10-9.
50. Chen LX, He YJ, Zhao SZ, Wu JG, Wang JT, Zhu LM, et al. Inhibition of tumor growth and
vasculogenic mimicry by curcumin through down-regulation of the EphA2/PI3K/MMP pathway in a
murine choroidal melanoma model. Cancer Biol Ther. 2011;11:229-35.
Legends
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
26
Table 1. Incidence of renal tumor, tumor weight, invasion and metastasis in orthotopic
xenografts after 6 and 8-9 weeks.
Figure 1. miR-141 is frequently attenuated in kidney tumor tissues and ccRCC cell lines.
A, relative miR-141 expression was determined by qRT-PCR in paired normal and ccRCC tissues
and analyzed with Mann–Whitney test. Each dot represents one sample.
B, relative miR-141 expression levels in kidney tumors are presented as fold change=2(△Ct normal-△Ct
tumor) of tumor versus matched normal tissues. The 0.5-fold-change threshold was defined as
differentially expressed. The relative miR-141 expression levels in ccRCC samples were
summarized in the table.
C, receiver operator characteristic (ROC) analysis of the cohort (A) to assess the specificity and
sensitivity of miR-141 to differentiate between ccRCC and normal tissues.
D, qRT-PCR analysis of miR-141 expression levels in pools of normal and ccRCC tissues, and
ccRCC cell lines. miR-141 level of normal tissues was set as 1. Data were normalized to U6 and
represented as mean±SEM.
Figure 2. miR-141 acts as a tumor-suppressor in RCC.
A-C, overexpression of miR-141 inhibits ccRCC cell proliferation, migration and invasion, and
induces cell-cycle arrest at G0/G1 in vitro. 786-O and SN12-PM6 cells infected with miR-141
expression or control lentiviruses were monitored for cell proliferation (A), cell-cycle (B) and
transwell migration and invasion (C).
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
27
D-F, released miR-141 from the donor tumor cells functions in the recipient tumor cells. D,
time-course expression of miR-141 and miR-16 in the CM from ccRCC cells stably
overexpressing miR-141 versus miR-NC. miR-16 expression was used as a control for exported
miRNA. Samples were measured by qRT-PCR and data were normalized to cel-miR-39. E,
expression of miR-141 and miR-16 in the ccRCC cells stably expressing miR-NC. Cells were
cultured with the CM of miR-141 or miR-NC cells for 48 hours, followed by assessing miR-141
and miR-16 expression using qRT-PCR. Data were normalized to U6. F, migration and invasion of
ccRCC cells stably expressing miR-NC were analyzed by transwell assay upon pretreatment with
the CM of miR-141 versus miR-NC cells. The results were derived from at least three independent
experiments and analyzed with Student’s t-test. Data are represented as mean±SEM. *, p<0.05; **,
p<0.01; ***, p<0.001.
Figure 3. Overexpression of miR-141 attenuates the tumor growth, migratory and invasive
properties of SN12-PM6 cells in vivo.
A, representative fluorescence images with primary tumors in the left kidney of nude mice after
orthotopic injections of SN12-PM6 cells stably overexpressing miR-141 or miR-NC for three
weeks.
B, macroscopic appearance of the tumor xenograft (arrows) in nude mice from the 6th-week and
8th-9th-week group. L, left kidney; R, right kidney.
C, HE staining of the tumor xenograft. N, normal renal tissues; T, primary renal tumors. Original
magnification was ×100.
D, SN12-PM6 cells stably overexpressing miR-NC metastasized to multiple organs (arrows).
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
28
Figure 4. miR-141 downregulates EphA2 expression through specifically targeting its
3’UTR.
A and B, the mRNA (A) and protein (B) levels of EphA2 were examined by qRT-PCR and WB in
786-O and SN12-PM6 cells stably overexpressing miR-141 versus the control (miR-NC),
respectively. mRNA data were normalized to GAPDH and β-actin was used as loading control in
WB.
C, the expression of miR-141 and EphA2 mRNA was assessed by qRT-PCR in renal tumor
xenografts. Data were normalized to U6 and GAPDH, respectively.
D, analysis of EphA2 protein expression in orthotopic renal tumors by IHC. Original
magnification was ×400.
E, sequence alignment of the EphA2 3’UTR with wild-type (WT) versus mutant (mut) potential
miR-141 targeting sites.
F, luciferase reporter assays showing decreased reporter activity after transfection of wild-type
EphA2 3’UTR reporter construct in the 786-O and SN12-PM6 cells overexpressing miR-141. The
EphA2 3’UTR mutant and control constructs had no effect on reporter activity. A renilla luciferase
construct was co-transfected into cells as internal control. The normalized luciferase activity of
control construct in each experiment was set as 1. Data are represented as mean±SEM. *, p<0.05;
***, p<0.001.
Figure 5. Knockdown of EphA2 in ccRCC cells significantly inhibits cell growth, induced
G0/G1 cell-cycle arrest, and suppressed cell migration and invasion.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
29
A and B, the levels of EphA2 mRNA (A) and protein (B) in 786-O and SN12-PM6 cells were
assessed by RT-PCR and WB, respectively. Cells were transfected with 100 nM EphA2 siRNA
versus non-specific control for 48 hours before detection. GAPDH and β-actin served as internal
controls for mRNA and protein loading, respectively.
C-E, cell proliferation (C), cell-cycle (D), transwell migration and invasion (E) assays of 786-O
and SN12-PM6 cells were performed after transfection with EphA2 siRNA (si-EphA2) versus
control (si-NC) for 48 hours.
F, after co-transfection with 50 nM siRNA duplexes (siRNA against EphA2 or negative control)
and 50 nM miRNA inhibitors (miR-141 or negative control), the levels of miR-141 and EphA2
mRNA were analyzed by qRT-PCR analysis (top) and the levels of EphA2 protein were measured
by WB (bottom) in both 786-O and SN12-PM6 cells.
G, cell migration and invasion in 786-O and SN12-PM6 cells were analyzed by transwell assays.
Cells were co-transfected with 50 nM siRNA duplexes (siRNA against EphA2 or negative control)
and 50 nM miRNA inhibitors (miR-141 or negative control). Data are represented as mean±SEM.
*, p<0.05; **, p<0.01; ***, p<0.001.
Figure 6. miR-141 expression is reversely correlated with expression of EphA2 mRNA and
EphA2 protein is frequently upregulated in clinical ccRCC tissues.
A, EphA2 mRNA expression was examined by qRT-PCR in 20 pairs of normal and ccRCC tissues
and analyzed with Mann–Whitney test. Each dot represents a sample. GAPDH served as internal
control.
B, correlation between levels of miR-141 and EphA2 mRNA in ccRCC tissues. Data was analyzed
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
30
with Pearson’s correlation analysis.
C, ccRCC tissues were divided into two groups according to their miR-141 expression. ccRCC
tissues with lower miR-141 expression displayed higher EphA2 level, and vice versa.
D, the expression of EphA2 protein was determined by WB in 20 pairs of normal (N) and ccRCC
(T) tissues. An increase in EphA2 protein was detected in 17 of 20 RCC cases, with the exception
of 3 pairs of ccRCCs (Italics).
Figure 7. Ectopic miR-141 expression and knockdown of EphA2 suppress activated focal
adhesion kinase (FAK) and AKT (p-FAK and p-AKT) and MMP2/9 expression.
A, WB showing decreased levels of p-FAK, p-AKT, MMP2/9 in miR-141-overexpressed 786-O
and SN12-PM6 cells, as compared to the miR-NC counterparts.
B, WB for FAK/p-FAK, AKT/p-AKT, MMP2/9 protein expression in 786-O and SN12-PM6 cells
following transfection with EphA2 siRNA (si-EphA2) versus control (si-NC).
C, the protein levels of FAK/p-FAK, AKT/p-AKT were determined by WB after co-transfection
with miR-141 inhibitor (versus control) and EphA2 siRNA (versus control) in 786-O and
SN12-PM6 cells. β-actin served as an internal control.
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224
1
Table 1. Incidence of renal tumor, tumor weight, invasion and metastasis in orthotopic xenografts after 6 and 8-9 weeks.
Group No. of mice Tumor incidence (%)a Tumor weight (mg) (mean ± SEM)b Beyond renal fascia rate (%)a Metastasis rate (%)a
6th week 8th-9th week 6th week 8th-9th week 6th week 8th-9th week 6th week 8th-9th week
miR-NC 10 5/5 (100) 5/5 (100) 124.7 ± 29.6 368.6 ± 131.1 2/5 (40) 4/5 (80) 2/5 (40) 3/5 (60)
miR-141 10 5/5 (100) 5/5 (100) 38.7 ± 8.1 52.9 ± 6.2 0/5 (0) 0/5 (0) 0/5 (0) 0/5 (0)
P value NSc 0.023 0.043 0.011 0.033
Note: a P values were determined by Fisher’s exact test. b Tumor weight was calculated by subtracting the weight of the right kidney (normal) from the weight of the left kidney (implanted with tumor). If the
tumor xenograft weight was small and the left kidney was just slightly heavier than the right, the weight of the tumor was recorded as zero. c Not significant.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
A C D
-10
-5p<0.0001
expr
essi
onT )
60
80
100
Sensitivity 86.76%Specificity 97.06%
y(%
)
1.0
1.2
expr
essi
on
25
-20
-15
Rel
ativ
e m
iR-1
41
log(
2-ΔC
T
0
20
40
60
AUC=0.93 (0.881 to 0.981)
Sens
itiv
ity
0 00
0.01
0.02
0.8
Rel
ativ
e m
iR-1
41 e
(2-ΔΔ
CT )
Normal ccRCC-25
(n=68) (n=68)
R
0 20 40 60 80 1000
100 - Specificity(%)
4B
Normal
ccRCC
786-O
SN12-P
M6
A-498
0.00R
-2
0
2
essi
on)
8
-6
-4
ativ
e m
iR-1
41 e
xpre
log 2
( Fol
d ch
ange
)
-12
-10
-8Relative miR-141 expression in ccRCC N (%)
Lower (≤ 0.5) 63 (92.6)No change (0.5~2) 4 (5.9)Higher (≥ 2) 1 (1.5)
Rel
at
Figure 1.
-14
ccRC
C
chR
CC
Sarc
oma
AM
L
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
786-O
1.0
1.5 miR-NCmiR-141
nm
SN12-PM6
1.0
1.5 miR-NCmiR-141
0nm
786-O
40
60
80 miR-NCmiR-141
bers
/fiel
d
CA
24 48 72 960.0
0.5 **
Hours
A49
0n
24 48 72 960.0
0.5
**
*
Hours
A49
0
Migration Invasion0
20
40
*** ***Cel
l num
b
60
80miR-NCmiR-141*
786-O
age
B SN12-PM6
100
150 miR-NCmiR-141
ers/
fiel
d
60
80miR-NCmiR-141
SN12-PM6
**ag
e
G0/G1 S G2/M0
20
40 *
Per
cent
a
Migration Invasion0
50*** ***C
ell n
umb
G0/G1 S G2/M0
20
40 **
Per
cent
a
0
Figure 2.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
786-O
9
12
15 miR-NCmiR-141 ***
expr
essi
on)
SN12-PM6
6
8
10miR-NCmiR-141
**
**
expr
essi
on)
D E
16
20 miR-NC CMmiR-141 CM
*expr
essi
on
0 24 48 720
3
6
9
**
**
Hours
Rel
ativ
e m
iR-1
41
(2-ΔΔ
CT
0 24 48 720
2
4
6
*
Hours
Rel
ativ
e m
iR-1
41
(2-ΔΔ
CT
786 O miR NC SN12 PM6 miR NC0
4
8
12
**
Rel
ativ
e m
iR-1
41 e
(2-ΔΔ
CT )
786-O
1 2
1.5 miR-NCmiR-141es
sion
SN12-PM6
1 2
1.5 miR-NCmiR-141es
sion
1 5
2.0 miR-NC CMmiR-141 CM
ress
ion
786-O miR-NC SN12-PM6 miR-NC
0.3
0.6
0.9
1.2
Rel
ativ
e m
iR-1
6 ex
pre
(2-ΔΔ
CT
)
0.3
0.6
0.9
1.2
elat
ive
miR
-16
expr
e (2
-ΔΔ
CT
)0.5
1.0
1.5
Rel
ativ
e m
iR-1
6 ex
pr (2
-ΔΔ
CT )
0 24 48 720.0Hours
R
0 24 48 720.0Hours
R
F 786-O miR-NC80 miR-NC CM
SN12-PM6 miR-NC100 miR NC CM
786-O miR-NC SN12-PM6 miR-NC0.0R
20
40
60
miR-141 CM
*
*
ll n
umbe
rs/fi
eld
40
60
80
100 miR-NC CMmiR-141 CM
*
*
ll n
umbe
rs/fi
eld
Migration Invasion0
20
Ce
Migration Invasion0
20Cel
Figure 2.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
A6th week
miR
-NC
R-N
C
B
8th-9th week
miR
-141
NC
miR
miR
-Nm
iR-1
41
miR
-141
m
DC
3nd week
DC
T
miR
-NC
Lung Liver Lymph nodes
R-1
41
Figure 3.PeritoneumCecum Diaphragm
TNm
iR
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
EphA21.2 miR-NC
iR 141ΔC
T )A C
4000 miR-NC
miR-141
1.5 miR-NC
EphA2
0.6
0.9miR-141
*
***e ex
pres
sion
(2-ΔΔ
2000
2500
3000
3500
miR-NCmiR-141
***
***
lati
ve e
xpre
ssio
n (2
-ΔΔ
CT )
0.6
0.9
1.2
miR-NCmiR-141
***
lati
ve e
xpre
ssio
n (2
-ΔΔ
CT )
786-O SN12-PM60.0
0.3
Rel
ativ
e
6 weeks 8-9weeks012
2000
Rel
6 weeks 8-9weeks0.0
0.3 ***Rel
DmiR-NC miR-141
EphA2
β-actin
BmiR-NC miR-141
miR-NC miR-141 miR-NC miR-141
786-O SN12-PM6 6th week 8th-9th week
E 786-O1.5
ControlWTit
y
SN12-PM61.5 Control
WTy
F
0.5
1.0
mut
*
elat
ive
repo
rter
act
ivi
0.5
1.0
WTmut
*
elat
ive
repo
rter
act
ivit
EphA2 3'UTR (739-761) WT 5' … AAGUUUCUAUUCUGUCAGUGUUA …
miR-141 3' GGUAGAAAU- GGUCUGUCACAAU
EphA2 3'UTR mut 5' … AAGUUUCUAUUCUGUAUUAUGGA…
. .
. .
. .
. .
. .
. .
miR-NC miR-1410.0
Re
miR-NC miR-1410.0
Re
Figure 4.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
si-NC si-EphA2 si-NC si-EphA2
D 786-O80
SN12-PM680
A
EphA2
GAPDH
p p
786-O SN12-PM6 20
40
60
si-NCsi-EphA2*
*
Perc
enta
ge
20
40
60
si-NCsi-EphA2
*
*
Perc
enta
ge
EphA2
si-NC si-EphA2si-NC si-EphA2B
786-O60 si-NC
si EphA2
SN12-PM6100 si-NC
i h
G0/G1 S G2/M0
G0/G1 S G2/M0
E
β-actin
786-O SN12-PM620
40
si-EphA2
******C
ell n
umbe
rs/fi
eld
20
40
60
80 si-EphA2
****
Cel
l num
bers
/fiel
d
CMigration Invasion
0Migration Invasion
0C 786-O
1.0
1.5 si-NCsi-EphA2
*A49
0nm
SN12-PM6
1.0
1.5 si-NCsi-EphA2
A49
0nm si
-NC
si-N
C
24 48 72 960.0
0.5*
*
Hours
A
24 48 72 960.0
0.5*
*
Hours
A
si-E
phA
2
si-E
phA
2
Figure 5.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
2.5 Inh-NC+si-NCInh-NC+si-EphA2
ΔC
T ) 2.0 Inh-NC+si-NCInh-NC+si-EphA2
ΔC
T )
F 786-O SN12-PM6
0 5
1.0
1.5
2.0 Inh-miR-141+si-NCInh-miR-141+si-EphA2
*** ***
**
*
ive
expr
essi
on (2
-ΔΔ
0.5
1.0
1.5Inh-miR-141+si-NCInh-miR-141+si-EphA2
**
**
ive
expr
essi
on (2
-ΔΔ
miR-141 EphA20.0
0.5 ***
Rel
ati
miR-141 EphA20.0
*** ***
Rel
ati
EphA2
β-actin
EphA2
β-actinβ actin β actinInh-NC+si-NC
Inh-miR-141+si-NC
Inh-miR-141+si-EphA2
Inh-NC+si-EphA2
100 I h NC+ i NC
786-O
150 Inh NC+si NC
SN12-PM6G
Inh-NC+si-NC
Inh-miR-141+si-NC
Inh-miR-141+si-EphA2
Inh-NC+si-EphA2
40
60
80
100 Inh-NC+si-NCInh-NC+si-EphA2Inh-miR-141+si-NCInh-miR-141+si-EphA2
*
*
umbe
rs/fi
eld
60
90
120
150 Inh-NC+si-NCInh-NC+si-EphA2Inh-miR-141+si-NCInh-miR-141+si-EphA2 *
*
umbe
rs/fi
eld
Migration Invasion0
20
40
***
Cel
l nu
Migration Invasion0
30 * *
Cel
l n
Figure 5.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
-3-2
p=0.4903
n
A B C
-3
-2 p=0.0185
n
0R2 = 0.3661
0 0047
9-8-7-6-5-43
ativ
e Ep
hA2
expr
essi
onlo
g(2-Δ
CT )
-8
-7
-6
-5
-4
3
ativ
e Ep
hA2
expr
essi
olo
g(2-Δ
CT )
-10
-5
p = 0.0047
Eph
A2
(log
2)
Normal ccRCC-11-10
-9
(n=20) (n=20)
Rel
a
Lower miR-141 Higher miR-141-10
-9
(n=10) (n=10)
Rel
a
-20 -18 -16 -14 -12-15
miR-141 (log2)
D
Figure 6.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
miR-NC miR-141 si-NC si-EphA2A BmiR-NC miR-141 si-NC si-EphA2
p-FAK
FAK
p-AKT
p
p-FAK
FAK
p-AKT
p
AKT
MMP-9
MMP-2
β-actin
AKT
MMP-9
MMP-2
β-actin
SN12-PM6786-O
β-actin
CInh-NC+si-NC
Inh-miR-141+si-NC
Inh-miR-141+si-EphA2
Inh-NC+si-EphA2
β-actin
SN12-PM6786-O
Inh-NC+si-NC
Inh-miR-141+si-NC
Inh-miR-141+si-EphA2
Inh-NC+si-EphA2
p-AKT
AKT
p-FAK
FAK
p-AKT
AKT
p-FAK
FAK
AKT
β-actin
AKT
β-actin
786-O SN12-PM6
Figure 7.
Research.
on Septem
ber 24, 2020. © 2014 A
merican A
ssociation for Cancer
clincancerres.aacrjournals.org D
ownloaded from
Author m
anuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Author M
anuscript Published O
nlineFirst on M
arch 19, 2014; DO
I: 10.1158/1078-0432.CC
R-13-3224
Published OnlineFirst March 19, 2014.Clin Cancer Res Xuanyu Chen, Xuegang Wang, Anming Ruan, et al. Proliferation and Metastasis by Controlling EphA2 ExpressionmiR-141 is A Key Regulator of Renal Cell Carcinoma
Updated version
10.1158/1078-0432.CCR-13-3224doi:
Access the most recent version of this article at:
Material
Supplementary
http://clincancerres.aacrjournals.org/content/suppl/2014/03/19/1078-0432.CCR-13-3224.DC1
Access the most recent supplemental material at:
Manuscript
Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://clincancerres.aacrjournals.org/content/early/2014/03/19/1078-0432.CCR-13-3224To request permission to re-use all or part of this article, use this link
Research. on September 24, 2020. © 2014 American Association for Cancerclincancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on March 19, 2014; DOI: 10.1158/1078-0432.CCR-13-3224