Transcript

ព្រះ��រាជាណាចព្រះ��ម្ពុ�ជាជាតិ សាសនា ព្រះ��ម្ពុហា��ព្រះតិ

វិ �ទ្យា�សា� នបច្ចេច��វិ �ទ្យា� �ម្ពុ�ជា ច្ចេ�ប៉ា� តិ ម្ពុ�ង់"៖ ឆ្នាំ% &ស �'ម្ពុ(លដ្ឋា+ ន

ការអន�វិតិ/ន0�ម្ពុ1វិ �ធី3 Microsoft office Word & Excel , Python Programming ន ង់ Logic and numeric

Practice Exercise:

- Logic and numeric- Microsoft office Word & Excel

- Python Programming

ការព្រះសាវិព្រះជាវិថ្នា% �"ឆ្នាំ% &ស �'ម្ពុ(លដ្ឋា+ ន ជំ&នាន" ៣៤ម្ពុ�ខវិ �ជា9 : �តិ;មានវិ�ទ្យា�

ច្ចេរ=បច្ចេរ=ង់ ន ង់ចង់ព្រះ�ង់ច្ចេដ្ឋាយៈ: ព្រះ� ?ម្ពុន ស� តិ I1-11

1. LAY CHHIVCHUNG ID:e201403312. LAO YEANPHY ID:e201403293. LANN TONGSAN ID: e201403274. LAO IE ID: e201403285. LAY BUNKRI ID: e201403306. KRY RITHEA ID: e20140315

ណែAនា&ច្ចេដ្ឋាយៈសាព្រះសា/ ចារCសយៈ ស�ខ�ម្ពុ

ណែខ ម្ពុ ថុ�នា ឆ្នាំ% & ២០១៥

Institute of Technology of Cambodia Information Technology

ព្រះ� ?ម្ពុព្រះសាវិព្រះជាវិ ន ង់ ចង់ព្រះ�ង់

ច្ចេI1 � ហតិ�ច្ចេលខា

1. LAY CHHIVCHUNG ID: e20140331 ………………………………….

2. LAO YEANPHY ID: e20140329 ………………….………………

3. LANN TONGSAN ID: e20140327 ………………………………….

4. LAO IE ID: e20140328 ………………………………….

5. LAY BUNKRI ID: e20140330 ………………………………….

6. KRY RITHEA ID: e20140315 ………………………………….

ច្ចេដ្ឋាយៈសាព្រះសា/ ចារC ហតិ�ច្ចេលខា

អារម្ពុM�ថ្នា

នាច្ចេ�លបច��បNន%ន ង់អនាគតិ វិ �ទ្យា�សាព្រះសPប៉ានអភិ វិឌ្ឍSន0ន ង់រ T�ច&ច្ចេរ Tនល(តិលាស"ជាល&ដ្ឋាប" ទាំ&ង់ណែW%� ច្ចេអឡិ ចព្រះតិYន ច សព្វា[ វិ �ធី ព្រះប�\ន]ទ្យា(រគម្ពុនាគម្ពុន0 តារាវិ�ទ្យា� ......................។ វិ �ស\យៈទាំ&ង់ច្ចេន� ព្រះតិYវិការយ៉ា� ង់ចា&ប៉ាច"ន(វិបច្ចេច��វិ �ទ្យា�ទ្យា&ច្ចេន3ប ណែ�លជាព្រះប�\ន]ទាំ�"ទ្យាង់�aងាយៈព្រះសcលន ង់ជាឃ្លាំe &ង់Wf��ទ្យា ន%ន\យៈព្រះគប"ណែបបយ៉ា� ង់។ ទ្យានfgម្ពុនgង់ការរ T�ច&ច្ចេរ Tនរបស"វិ �ទ្យា�សាព្រះសP ភ្នា% �"ងារវិ �ទ្យា�សាព្រះសPន3ម្ពុiយៈៗព្រះតិYវិព្រះប�\ន] Computer យ៉ា� ង់ចា&ប៉ាច"ស&រាប"បញ្ចូ�(លទ្យា ន%ន\យៈ �&ច្ចេA3 រការទ្យា ន%ន\យៈន ង់Wf��ទ្យា ន%ន\យៈ របស"ខeiន។

Page | 1

Institute of Technology of Cambodia Information Technology

វិ �ទ្យា�សាព្រះសPកាន"ណែតិច្ចេជំlនច្ចេលlន ច្ចេហ3យៈព្រះបច្ចេទ្យាសមានវិ�ទ្យា�សាព្រះសPរ T�ច&ច្ចេរ Tនមានន\យៈថ្នាព្រះបច្ចេទ្យាសច្ចេនា��&��ង់ណែតិIនច្ចេmម្ពុ�នទាំ&ង់ណែW%� វិ �ទ្យា�សាព្រះសPន ង់ច្ចេស�n� ច� ណែ�លបណាP ព្រះបច្ចេទ្យាស�%�ង់ច្ចេលា�ព្រះប៉ាថ្នា% ចង់"ប៉ាន។ ច្ចេ�3ម្ពុN3ទ្យាទ្យាiលប៉ានការបច្ចេច��វិ �ទ្យា�ច្ចេជំlនច្ចេលlន ចា&ប៉ាច"ណាស"ព្រះតិYវិទ្យា ញបច្ចេច��វិ �ទ្យា��3ព្រះបច្ចេទ្យាសច្ចេជំlនច្ចេលlន ច្ចេ�3ម្ពុN3ទាំញយៈ�Wលព្រះបច្ចេយ៉ាជំន0�3វិ �ស\យៈទាំ&ង់ច្ចេនា� ច្ចេហ3យៈច្ចេ�3ម្ពុN3ច្ចេព្រះប3ព្រះប៉ាស"ឧប�រA0 ទ្យាទ្យាiលប៉ានព្រះបស ទ្យា] ភ្នា� ច្ចេយៈ3ង់ព្រះតិYវិស �'�3វាឲ្យCប៉ានចsស"ន ង់អភិ វិឌ្ឍSន0អ[3ណែ�លច្ចេយៈ3ង់ប៉ានទ្យា ញច្ចេគ ថ្ងៃថុuច្ចេន�ច្ចេយៈ3ង់ទ្យា ញច្ចេគ ណែតិថ្ងៃថុuច្ចេព្រះកាយៈច្ចេយៈ3ង់នgង់ម្ពុ នទ្យា ញច្ចេគច្ចេទ្យា=តិច្ចេទ្យា។ យ៉ា� ង់ច្ចេន�ច្ចេហ3យៈច្ចេទ្យា3បច្ចេយៈ3ង់ព្រះតិYវិការយ៉ា� ង់ចា&ប៉ាច"ព្រះប�\ន] Computer។

ជា�"ណែសPង់�%�ង់នាម្ពុជាវិ�ទ្យា�សា� នបច្ចេច��វិ �ទ្យា��ម្ពុ�ជា ជាសាលាបAP� �បណាP លបច្ចេច��ច្ចេទ្យាស ណែ�លតិ&រ (វិឲ្យCស ស'ន�ស ស�ច្ចេច�ច្ចេព្រះប3ន ង់យៈល"�gង់�3ម្ពុ�ខវិ �ជា9 Computer។ ច្ចេហតិ�ច្ចេន�ច្ចេហ3យៈប៉ានជាសាព្រះសPចារCណែW%� INFORMATICS ច្ចេធី[3 Assignment ច្ចេ�3ម្ពុN3ឲ្យC�i�ខv�&ប៉ានយៈល"កាន"ណែតិចsស"�3ម្ពុ�ខវិ �ទ្យា�ច្ចេន�។ �%�ង់ច្ចេនា��i� ច្ចេយៈ3ង់ប៉ានចង់ព្រះ�ង់ជាឯ�សារម្ពុiយៈសP3អ&�3ម្ពុ�ខវិ �ជា9 INFORMATICS

ស&រាប"ទ្យា��ជាច្ចេ�3ម្ពុទ្យា�នស&រាប"�ល"ស ស�បx(នជំ&នាន"ច្ចេព្រះកាយៈច្ចេអាយៈ�i�ច្ចេគប៉ានទ្យាទ្យាiលន(វិច&ច្ចេន��gង់�3ច្ចេស=វិច្ចេyម្ពុiយៈច្ចេន� ។

ខegម្ពុសាររ iម្ពុថ្ងៃនការព្រះសាវិព្រះជាវិ

ការស �'អ&�3ម្ពុ�ខវិ �ជា9 �តិ;មានវិ�ទ្យា��ព្រះម្ពុ តិ�&ប(ង់សព្រះមាប"ស ស'ន�ស ស�ច្ចេz�%�ង់វិ �ទ្យា�សា� ន បច្ចេច��វិ �ទ្យា�� តិជាមានខegម្ពុសារជា�&�&ភិiនណែ�លម្ពុ នអាចច្ចេម្ពុ3លរ{លង់ប៉ាន អាចថ្នាជាច្ចេ�3ម្ពុទ្យា�នណែ�លស ស�ន ស តិ�ទាំ&ង់ច្ចេ�លបច��បNន%ន ង់ច្ចេ�លអនាគតិម្ពុ នអាចខ[�ប៉ាន ។ �%�ង់�ព្រះម្ពុ តិ�&ប(ង់ថ្ងៃនម្ពុ�ខវិ �ទ្យា��តិ;មាន ច្ចេយៈ3ង់ប៉ានច្ចេធី[3ការព្រះសាវិព្រះជាវិ បណែន�ម្ពុបនាf ប"�3ប៉ានបញ្ចូ�ប"ការស �'ជំ តិម្ពុiយៈឆមាស ច្ចេល3បiនច្ចេម្ពុច្ចេរ=នស&ខាន"ៗភ្នា9 ប"នgង់ការអន�វិតិ/�(ចជា៖

Microsoft Word : អាច�gង់�3ការវាយៈន ង់ច្ចេរ=បច&ឯសារប៉ានច្ចេរ=បរយៈលx យៈល"�gង់�3ការរ�'ទ្យា��ឯសារ សព្រះមាប"ជំ3វិភ្នា�ទ្យា(ច្ចេm ន ង់ការច្ចេព្រះប3ព្រះប៉ាស"�%�ង់ការ �យ៉ាល\យៈ។ ម្ពុ�}ង់ច្ចេទ្យា=តិច្ចេយៈ3ង់អាចសា~ ល"�3ធាតិ�ស&ខាន"ៗណែ�លច្ចេព្រះប3ព្រះប៉ាស"�%�ង់�ម្ពុ1វិ �ធី3 គ�Aព្រះបច្ចេយ៉ាជំន0 ន ង់ ការច្ចេព្រះប3ព្រះប៉ាស"ប៉ានច្ចេលN�នច្ចេលlនន ង់រហ\សWង់ណែ�រ។

Microsoft Excel : អាចឲ្យCយៈល"�gង់�3ការគAនាទ្យា ន%ន\យៈច្ចេW�ង់ៗឲ្យCប៉ានងាយៈន ង់រហ\ស ន ង់ការច្ចេរ=បច&ទ្យា ន%ន\យៈជាព្រះប�\ន] ន ង់ការរ�'ទ្យា��ទ្យា ន%ន\យៈច្ចេW�ង់ៗ។ ទ្យា ន%ន\យៈអាចបងា� ញតាម្ពុរយៈ:ការគAនាណែ�លច្ចេលlន ន ង់ព្រះតិgម្ពុព្រះតិYវិ ណែ�លបច្ចេព្រះម្ពុ3ឲ្យCជំ3វិភ្នា�ព្រះបចា&ថ្ងៃថុu។

Number system: អាចឲ្យCច្ចេយៈ3ង់�gង់�3រច្ចេប=បប&ណែលង់ទ្យា ន%ន\យៈ ល&ហាតិ"ន ង់ការអន�វិតិ/ផ្ទាf ល"។មា� ស�3ន�&�C(ទ្យា\រអាចសា~ ល"ន ង់បញ្ចូ�(នទ្យា ន%ន\យៈប៉ានច្ចេដ្ឋាយៈការប&ណែលង់ច្ចេ�លច្ចេន� ន ង់សារព្រះបច្ចេយ៉ាជំន0ច្ចេW�ង់ៗច្ចេទ្យា=តិ។

Python Programming: អាចឲ្យC�gង់�3រច្ចេប=បចង់ព្រះ�ង់រ (បម្ពុន/ ន ង់ការគAនាច្ចេល3មា� ស�3ន�&�C(ទ្យា\រ ណែ�លងាយៈព្រះសcលន ង់ឆ្នាំបរហ\សជាង់ការគAនាធីម្ពុ1តា។ វាមានអតិ�បរច្ចេយ៉ាជំន0សព្រះមាប"ការគAនាច្ចេW�ង់ៗ ណែ�លជំiយៈស&រ iល�ល"ខiរ�sលប៉ានម្ពុiយៈ�ព្រះម្ពុ តិធី&។

Page | 2

Institute of Technology of Cambodia Information Technology

មាតិ កាព្រះ� ?ម្ពុព្រះសាវិព្រះជាវិ ន ង់ចង់ព្រះ�ង់……………...………………………………..…………………..….1

អារម្ពុM�ថ្នា…………………………………..……………..……………..…………………..…..2

ខegម្ពុសាររ iម្ពុថ្ងៃនការព្រះសាវិព្រះជាវិ…………………..……………..……………..……………………..3

១. ច្ចេសច�/3ច្ចេW/3ម្ពុ (Introduction)…………………………………………………………………...5២. វិ �ធី3សាព្រះស/ (Methodology)…………………………………………………………….……..6

Assignment for logic and numeric……………………………..……………….…..…..6 Microsoft office Word……………………………………………………………........12 Microsoft office Excel………………………………………………………….……...15 Python Programming…………………………………………………………………..22

ច្ចេសច�/3សន% ដ្ឋា+ ន (Conclusions)………………………………………………………………..27

Page | 3

Institute of Technology of Cambodia Information Technology

១. ច្ចេសច�P3ច្ចេWP3ម្ពុ

��&�C(ទ្យា\រម្ពុ�ននgង់ប៉ានម្ពុ��ល"បច��បNន% វាព្រះតិYវិវិ �វិតិ/ជាច្ចេព្រះច3ន�&ណា�"កាល ណែ�លមានជា�&ណា�"កាល�(ចខាង់ច្ចេព្រះកាម្ពុ ៖

រយៈ:ច្ចេ�លបច្ចេង់�3តិ ៖ ១៨២២ បច្ចេង់�3តិច្ចេដ្ឋាយៈ Charles Baggages មា� ស�3នគ តិច្ចេលខស&រាប"ព្វាA ជំ9�ម្ពុ1 ម្ពុ នព្រះតិgម្ពុណែតិមានសម្ពុតិ�ភ្នា��%�ង់ការគAនា វា�aអាចច្ចេធី[3ការវិ �ភ្នាគ ព្រះប�\ន]គAនា ព្រះប�\ន]បញ្ចូ�(ល ន ង់បច្ចេញ្ចូ�ញទ្យា ន%ន\យៈ រយៈ:ច្ចេ�លបច្ចេង់�3តិ ៖ ១៩៤៥ ច្ចេដ្ឋាយៈច្ចេលា� ៖ John Von Neuman គ&ន តិ�&ប(ង់បង់xស"ថ្ងៃនព្រះប�\ន]មា� ស�3ន��&�C(ទ្យា\រ�&ប(ង់បង់xស" មានសម្ពុតិ�ភ្នា��%�ង់ការគAនា ន ង់ច្ចេធី[3ការវិ �ភ្នាគច្ចេដ្ឋាយៈ�ម្ពុ1វិ �ធី3 ព្រះប�\ន]វិ �ភ្នាគទ្យា ន%ន\យៈ ព្រះប�\ន]គAនាទ្យា ន%ន\យៈ ព្រះប�\ន]Wf��ទ្យា ន%ន\យៈ ព្រះប�\ន]បញ្ចូ�(ល (Input) ន ង់ បច្ចេញ្ចូ�ញទ្យា ន%ន\យៈ (Output) រយៈ:ច្ចេ�លបច្ចេង់�3តិ ៖ ១៩៤៣ - ១៩៤៦ John William Mauchly ន ង់ J.Presper Eckert, ថ្ងៃនម្ពុហាវិ�ទ្យា�ល\យៈ University of

Pennsylvania បច្ចេង់�3តិព្រះប�\ន]មា� ស�3ន��&�C(ទ្យា\រ�&ប(ង់បង់xស"តាម្ពុគ&ន តិរបស" John Von Neuman ENIAC (Electronic Numerical Intergrator and Computer)

Speed: 5000 operations per second, multiplication in 3ms (H/W/S): 3.048m, 30T, 1000squre meters ច្ចេព្រះប3ព្រះប៉ាស"Vacuume Tubes 18000 អ&�(ល ច្ចេព្រះប3ព្រះប៉ាស"ថ្នាម្ពុ�ល 150kw

២. វិ �ធី3សាព្រះស/(Methodology)Answer of assignment for logic and numeric

( ការបំ�បែបំកលេ�ខក�ងលេ �លេ��ងៗ និ�ង ឈ្នា បំ�តក�វិ�ទ្យា� )

1. ប&ណែប�ច&នiនខាង់ច្ចេព្រះកាម្ពុ៖a) 3400K h z ច្ចេmជា Gh z, M hzន ង់ Hz

ច្ចេដ្ឋាយៈ 1Khz=10−6Ghz=10−3Mhz=103Hz

�(ចច្ចេន�3400Khz=34×10−4Ghz=3.4 Mhz=34×105Hz

b) 40000 Byteច្ចេmជា KBន ង់ MB

ច្ចេដ្ឋាយៈ 1Byte=2−10KB=10−20MB

40000 Byte =22׿

ច្ចេហ3យៈ 40000 Byte =( 52 )

4

×2−10MB= 54

214 MB

Page | 4

Institute of Technology of Cambodia Information Technology

�(ចច្ចេន�40000 Byte =( 52 )

4

KB= 54

214 MB

c) រ�ច&នiនថ្ងៃនការណែច� Hard Disk ម្ពុiយៈណែ�លមានទ្យា&ហ& 256GB ច្ចេmជាDisk Diveទ្យា&ហ& 2048MB

ច្ចេយៈ3ង់មានទ្យា&ហ& Hard Disk=256GB=28×210MB (ច្ចេព្រះព្វា� 1GB=210MB)

¿218MB

ច្ចេហ3យៈ ទ្យា&ហ&Disk Dive=2048MB=211MB

⟹ Hard DiskDisk Dive

=218MB211MB

=27=128

�(ចច្ចេន� ច្ចេយៈ3ង់អាចណែច� Hard Disk ម្ពុiយៈណែ�លមានទ្យា&ហ& 256GB ច្ចេmជាDisk Diveទ្យា&ហ& 2048MB ច&នiន 128 ។

2. ប&ណែប�ច&នiនខាង់ច្ចេព្រះកាម្ពុច្ចេmជាច្ចេ�លច្ចេW�ង់ៗ៖a. ច&នiន 511 ច្ចេ�ល 10 ច្ចេmជាច្ចេ�ល 2 ច្ចេ�ល 8 ន ង់ ច្ចេ�ល 16

ច្ចេដ្ឋាយៈ ស&Aល" ស&Aល"

⟹ (511)10=(777)8 ⟹ (511)10=(1FF)8

ស&Aល"

⟹ (511)10=(111111111)2

�(ចច្ចេន�(511 )10=(111111111)2=(777 )8=(1 FF)16

b. ច&នiន 1000110 ច្ចេ�ល 2 ច្ចេmជាច្ចេ�ល 10 ច្ចេ�ល 8 ន ង់ ច្ចេ�ល 16

ច្ចេដ្ឋាយៈ (1000110 )2=1×26+0×25+0×24+0×23+1×22+1×2+0×20

¿64+4+2=(70 )10

ច្ចេហ3យៈ (1000110 )2=(001000110 )2=(106 )8 ច្ចេព្រះព្វា� (001 )2= (1 )8 , (000 )2= (0 )8 , (110 )2=(6 )8

Page | 5

7

7

7

511 8

63 8

7 8

0

15

15

1

511 16

63 16

7 16

0

1

1

1

1

1

1

1

1

1

511 2

255 2

127 2

63 2

31 2

15 2

7 2

3 2

1 2

0

Institute of Technology of Cambodia Information Technology

ម្ពុ�}ង់ច្ចេទ្យា=តិ (1000110 )2=(01000110 )2=(46 )16

ច្ចេព្រះព្វា� (0100 )2=(4 )16 , (0110 )2=(6 )16

�(ចច្ចេន�(1000110 )2=(70 )10=(106 )8=(46 )16

c. ច&នiន B5D ច្ចេ�ល 16 ច្ចេmជាច្ចេ�ល 10 ច្ចេ�ល 2 ន ង់ ច្ចេ�ល 8ច្ចេដ្ឋាយៈ (B5D )16=B×162+5×161+D×160=11×256+5×16+13×1 ¿2816+80+13=2909

⟹ (B5D )16=(2909 )10

ម្ពុ�}ង់ច្ចេទ្យា=តិ (B )16=(1011 )2 , (5 )16=(0101 )2 , (D )16=(1101)2⟹ (B5D )16=(101101011101 )2

ច្ចេហ3យៈ (101 )2=(5 )8 , (011 )2=(3 )8 ⟹ (B5D )16=(101101011101 )2=(5535 )8

�(ចច្ចេន�(B5D )16= (2909 )10=(101101011101 )2=(5535 )8

d. ច&នiន 156 ច្ចេ�ល 8 ច្ចេmជាច្ចេ�ល 2 ច្ចេ�ល 10 ន ង់ ច្ចេ�ល 16

ច្ចេដ្ឋាយៈ (1 )8= (001 )2, (5 )8= (101 )2 , (6 )8=(110)2 ⟹ (156 )8= (001101110 )2=(1101110 )2 ច្ចេហ3យៈ (156 )8=1×82+5×8+6×80=64+40+6=(110)10 ម្ពុ�}ង់ច្ចេទ្យា=តិ (156 )8=(01101110 )2=(6 E )16

ច្ចេព្រះព្វា� (0110 )2=(6 )16 , (1110 )2=(E )16

�(ចច្ចេន�(156 )8=(1101110 )2=(110 )10=(6 E )16 e. ច&នiន 4 ABC ច្ចេ�ល 16 ច្ចេmជាច្ចេ�ល 10 ច្ចេ�ល 8 ន ង់ ច្ចេ�ល 2

ច្ចេយៈ3ង់មាន (4 ABC )16=4×163+A×162+B×161+C ×160

¿4×4096+10×256+11×16+12×1=(19132 )10

ច្ចេដ្ឋាយៈ (4 )16=(0100 )2 , ( A )16= (10 )16=(1010 )2 , (B )16=(11 )16=(1011)2 (C )16=(12 )16=(1100 )2 ⟹ (4 ABC )16= (0100101010111100 )2=(100101010111100 )2ច្ចេហ3យៈ (100 )2= (4 )8 , (101 )2=(5 )8 , (010 )2= (2 )8, (111 )2=(7 )8 ⟹ (4 ABC )16= (100101010111100 )2=( 45274 )8 �(ចច្ចេន�(4 ABC )16=(19132 )10=(45274 )8=(100101010111100 )2

3. រ�ច&នiនបង្រ្គង់~បច្ចេ�ល 2 ថ្ងៃនបណា/ ច&នiនខាង់ច្ចេព្រះកាម្ពុ៖i. ច&នiន 8 E ច្ចេ�ល 16

ច្ចេដ្ឋាយៈ (8 )16= (1000 )2, (E )16= (14 )16=(1110 )2 ⟹ (8 E )16=(10001110 )2 ប/(រ�3 0→1 ន ង់ 1→0 :

01110001

1 (01110010 )2

Page | 6

+

Institute of Technology of Cambodia Information Technology

�(ចច្ចេន�(−8 E )16=(01110010 )2ii. ច&នiន 1001010000 ច្ចេ�ល 2

ច្ចេដ្ឋាយៈ (1001010000 )2 ប/(រ�3 0→1 ន ង់ 1→0 :

0110101111

1 (0110110000 )2

�(ចច្ចេន�(−1001010000 )2= (110110000 )2iii. ច&នiន 3BC ច្ចេ�ល 16

ច្ចេដ្ឋាយៈ (3 )16= (0011)2 , (B )16=(11 )16=(1011)2 (C )16=(12 )16=(1100 )2 ⟹ (3BC )16=(001110111100 )2 ប/(រ�3 0→1 ន ង់ 1→0 :

110001000011

1 (110001000100 )2

�(ចច្ចេន�(−3 BC )16=(110001000100 )2iv. ច&នiន 654 ច្ចេ�ល 8

ច្ចេដ្ឋាយៈ (6 )8=(110 )2, (5 )8=(101 )2 , (4 )8=(100 )2⟹ (654 )16=(110101100 )2 ប/(រ�3 0→1 ន ង់ 1→0 :

001010011

1 (001010100 )2

�(ចច្ចេន�(−654 )16=(1010100 )24. រ�លទ្យា]Wល(គ តិជាតិថ្ងៃម្ពុe�%�ង់ច្ចេ�ល 2) ថ្ងៃនព្រះបមាAវិ�ធី3តិ��វិ �ទ្យា�ខាង់ច្ចេព្រះកាម្ពុ៖

(B6F 3 )16∨(1100111010101111 )2ច្ចេដ្ឋាយៈ (B )16=(11 )16=(1011)2 , (6 )16=(0110 )2 , (3 )16= (0011)2 (F )16=(15 )16=(1111)2 ⟹ (654 )16=(1011011000111111 )2 ¿

(1100111010101111 )2

(1111111101111111)2 �(ចច្ចេន� (B6F 3 )16∨(1100111010101111 )2=(1111111101111111)2

NOT ((378C )16∧(521 )10)ច្ចេដ្ឋាយៈ (3 )16= (0011)2 , (7 )16=(0111 )2 , (8 )16=(1000 )2 (C )16=(12 )16=(1100 )2

Page | 7

+

+

+

Institute of Technology of Cambodia Information Technology

⟹ (378C )16= (0011011110001100 )2

ច្ចេហ3យៈ ស&Aល"

⟹ (521 )10=(1000001001 )2=(00001000001001 )2ច្ចេយៈ3ង់ប៉ាន (378C )16=(11011110001100 )2

¿

(521 )10=(00001000001001 )2

(00101001111010 )2 ⟹NOT ( (378C )16∧(521 )10 )=(11010110000101 )2

�(ចច្ចេន� NOT ( (378C )16∧(521 )10 )=(11010110000101 )2 (9D 5 )16 XOR (3706 )8

ច្ចេដ្ឋាយៈ (9 )16=(1001 )2, (D )16=(13 )16= (1101)2 , (5 )16=(0101 )2⟹ (9D5 )16=(100111010101 )2 ច្ចេហ3យៈ (3 )8=(011)2 , (7 )8=(111 )2 , (0 )8=(000 )2 , (6 )8=(110)2⟹ (3706 )16=(011111000110 )2 ច្ចេយៈ3ង់ប៉ាន: (9D 5 )16=(100111010101 )2XOR

(3706 )16= (011111000110 )2

(111000010011)2

�(ចច្ចេន� (9D 5 )16 XOR (3706 )8=(111000010011)2

5. a). រ�ព្រះបច្ចេភិទ្យាថ្ងៃនចតិ�ច្ចេកាA ប&រាប": ព្រះបច្ចេលឡិ(ព្រះកាម្ពុម្ពុiយៈមានព្រះជំ ?ង់ a ន ង់ b តាម្ពុល��ខA� NOT(a≠b¿⟹a=b

Page | 8

1

0

0

1

0

0

0

0

0

1

521 2

260 2

130 2

65 2

32 2

16 2

8 2

4 2

2 2

1 2

0

Institute of Technology of Cambodia Information Technology

ច្ចេហ3យៈតាម្ពុល��ខA� (មានម្ពុ�&ណែ�ង់ម្ពុiយៈ) AND (NOT(a≠b))

មានន\យៈថ្នា ព្រះបច្ចេលឡិ(ព្រះកាម្ពុច្ចេនា� មានព្រះជំ ?ង់ច្ចេស13�% គ a=b ន ង់មានម្ពុ�&ណែ�ង់១ នា&ឲ្យCច្ចេយៈ3ង់ទាំញប៉ានថ្នា: ព្រះបច្ចេលឡិ(ព្រះកាម្ពុច្ចេន�គ ជាចតិ�ច្ចេកាAណែ�ង់�(ចច្ចេន� ព្រះបច្ចេភិទ្យាថ្ងៃនចតិ�ច្ចេកាAច្ចេន�គ ជា ចតិ�ច្ចេកាAណែ�ង់b). �&Aតិ"ល��ខA� ណែ�លនា&ឲ្យC�តិ"ម្ពុ នច្ចេព្រះប3ឆ\ព្រះតិ៖ ប&រាប": ប�រសច្ចេនា�ច្ចេព្រះប3ឆ\ព្រះតិច្ចេzច្ចេ�លណែ�លច្ចេម្ពុឃច្ចេភិe�ង់ ន ង់ ច្ចេ�ល�តិ"�1 នរថុយៈន/ �(ចច្ចេន� ល��ខA� ណែ�លនា&ឲ្យC�តិ"ម្ពុ នច្ចេព្រះប3ឆ\ព្រះតិគ

ច្ចេzច្ចេ�លច្ចេម្ពុឃម្ពុ នច្ចេភិe�ង់ ន ង់ ច្ចេ�ល�តិ"�1 នរថុយៈន/ ច្ចេzច្ចេ�លច្ចេម្ពុឃច្ចេភិe�ង់ ន ង់ ច្ចេ�ល�តិ"មានរថុយៈន/ ច្ចេzច្ចេ�លច្ចេម្ពុឃម្ពុ នច្ចេភិe�ង់ ឬ ច្ចេ�ល�តិ"មានរថុយៈន/

Answer of Assignment for Ms. Word

I. Computer Basics and Word Processing

1. What is this?

It is a Network Adapter.

2. What is this?

It is a Network Card.

Page | 9

Institute of Technology of Cambodia Information Technology

3. What is this?

It is a Central Processing Unit (CPU)

4. What is this?

They are Input devices for gaming (Joystick and Racing wheels).

5. What is a program?

Program is a specific set of ordered operations for a computer to perform.

6. What is a file?

File is a combination of data that represent documents or any information.

7. What is a Microsoft Word?

Microsoft Word is a program using for report and other documents that is fulfill of convenient and quality meaning that it provide the way to decorate and prepare the data in any document as what we want.

8. What is the Algorithm?Algorithm is the ways to solve problems step by step and continuously until we are able to find the answer.

9. What is the Hardware?

Hardware is an electric tool which joins on the reaction of computer and we can touch it by your hand.

10. What is the Software?

Software is a soft part, combination of programs that order hardware to run any work and give the result that user want.

II. Draw a line from the word to the correct definition

1 Personal Computer Aa word processing program that you can use to type, save, and print documents

2 Spell Check BThe line or arrow that you control by moving the mouse.

3 Operating System CEarphones and a microphone that you wear on your head.

4 Cursor DSymbols or pictures that you can click on to perform an action. Each program has its own i con.

5 Headset E The tools you can use tell the computer what to Page | 10

Institute of Technology of Cambodia Information Technology

do. For example you can open programs and fills by clicking or double clicking.

6 Mouse FThe most important program in your computer. This program is like the “manager” of all of the other programs.

7 Screen Saver GA computer that is made to use the Windows operating system. There are two basic kinds of computer PCs and Macs.

8 Icon HA design on the screen that turns on if you don’t use your computer for a few minutes.

9 Laptop IOrganizes information into rows and columns and often uses math and numbers.

10 Spreadsheet JWhen you’re using Microsoft Word, you can click on this button to look for spelling and grammar mistakes.

1. Operating System F c

2. Cursor B c

3. Spell Check J c

4. Laptop G c

5. Headset C c

6. Icon D c

7. Mouse E c

8. Screen Saver H c

9. Spreadsheet I c

10. Personal Computer A c

III. Microsoft Word 2013 Screen

Page | 11

4

89

710

6

532

1

Institute of Technology of Cambodia Information Technology

1. File button

2. Quick Access Toolbar

3. Title bar

4. Minimize bar

5. Restore Down bar

6. Text Boundaries

7. Scroll bar

8. Zoom bar

9. Status Toolbar

10. Rulers bar

Answer of Assignment for Ms. Excel

Exercise 1: Using Excel’s AND, OR and NOT Function

A

1 The Data

2 15

3 9

4 8

Page | 12

Institute of Technology of Cambodia Information Technology

A. Write an AND formula to determine if A2>A3 and A2<A4 is true or false statement.

If A2>A3 and A2<A4 is false statement

B. Write an OR formula to determine if A2>A3 and A2<A4 is true or false statement.

If A2>A3 and A2<A4 is true statement

C. Write a formula that expresses that A2+A3=24 is a false statement.

We use NOT formula to determine A2+A3=24 is a false statement

Exercise 2: Using Excel’s IF Function

A

1 The Data

2 50

A. Write an IF statement so that if the number in cell A2 is less than 100 the formula displays the text “Within budget”, otherwise the formula displays the text “Over budget”.

=if (A 2<100 ,within budget ,Over budget)

B. Write an IF statement so that if the number in cell A2 is 100 then the formula sums the range B5:B15.Otherwise, the formula returns a blank(empty text)

=if ¿)

Exercise 3: More Practice with IF Function

A If score is Then return

1 Scores Greater than 89 A

2 45 From 80 to 89 B

3 90 From 70 to 79 C

4 78 From 60 to 69 D

Less than 60 E

A. Write an IF statement to assign a letter grade to the score in cell A2.

=IF(A2>89,"A",IF(A2>79,"B",IF(A2>69,"C",IF(A2>59,"D",IF(A2<=59,"F")))))

B. Write an IF statement to assign a letter grade to the score in cell A3.

Page | 13

Institute of Technology of Cambodia Information Technology

=IF(A3>89,"A",IF(A3>79,"B",IF(A3>69,"C",IF(A3>59,"D",IF(A3<=59,"F")))))

C. Write an IF statement to assign a letter grade to the score in cell A4.

=IF(A4>89,"A",IF(A4>79,"B",IF(A4>69,"C",IF(A4>59,"D",IF(A4<=59,"F")))))

Exercise 4: Building & Using a Nested IF Statement

A B

1 cost/gallon for the first 500 gallons $23

2 cost/gallon for next 500 gallons $20

3 cost/gallon for gallons>1,000 $15

4

5 16006 4837 2001

Write two formulas using nested IF statement to calculate the cost of the quantities of olive oil listed in Cell A6 (483 gallons) and Cell A7 (2,001 gallons) above.

An Excel nested IF function can be written with this syntax: =IF(condition-to-test,IF(condition-to-test, value-if-condition-true, value-if-condition-false), value-if-condition-true, value-if-condition-false)

For example, one formula to find the cost for 1,600 gallons is:=IF(A5<=500,A5*$B$1,IF(A5<=1000,(500*$B$1)+(A5-500)*$B$2,(500*$B$1)+ (500*$B$2)+(A5-1000)*$B$3))

A. Write a formula to find the cost of 483 gallons.

=IF(A6<=500,A6*$B$1,IF(A6<=1000,(500*$B$1)+(A6-500)*$B$2,(500*$B$1)+

(500*$B$2)+(A6-1000)*$B$3))

B. Write a formula to find the cost of 2,001 gallons.

=IF(A7<=500,A7*$B$1,IF(A7<=1000,(500*$B$1)+(A7-500)*$B$2,(500*$B$1)+ (500*$B$2)+(A7-1000)*$B$3))

Exercise 5: The IF, the MIN, and the SUMPRODUCT Function

Page | 14

Institute of Technology of Cambodia Information Technology

The price schedule for olive oil is the same but the data layout has changed, as illustrated below. In this view, the costs for each of the quantities (Cells G6 through I6) have already been calculated. The answers are in Cells G12:I12

B C D E F G H I

6 1600 483 2001

7 Gallons gallons gallons

8 Price Schedule gals/price level gals/price level gals/price level

9 First 500 gallons at $23.00 500 483 500

10 next 500 gallons at $20.00 500 0 500

11 any additional gallons at $15.00 600 0 1001

12 Cost $30,500.00 $11,109.00 $36,515.00

Write formulas that use the MIN function, the IF function (nested), and the SUMPRODUCT function to calculate the quantities of olive oil listed in Cells H6 (483 gallons) and I6(2,001 gallons), above.

The syntax of Excel’s MIN function is: =MIN(number1,number2, ...)One way to write Excel’s nested IF function is: =IF(condition-to-test, IF(condition-to-test, value-if-condition-true, value-if-condition-false), value-condition-true, value-if-condition-false).

Excel’s SUMPRODUCT function multiplies corresponding components in the given ranges and returns the sum of those products. One way to write Excel’s SUMPRODUCT function is: =SUMPRODUCT(range1, range2) where ranges 1 and 2 hold components you want to multiply and then add. (Both ranges must be the same length.)

B C D E F G

6 1600

7 gallons

8 Price Schedule gals/price level

9 First 500 gallons at $23.00 500

10 next 500 gallons at $20.00 500

11 any additional gallons at $15.00 600

12 cost $30,500.00

For example, formulas to calculate the cost of 1,600 gallons are located below in Cells G9, G10, G11 and G12

B C D E F G

6 1600

Page | 15

Institute of Technology of Cambodia Information Technology

7 Gallons

8 Price Schedule gals/price level

9 First 500 gallons at $23.00 =MIN(G6,$C$9)10 next 500 gallons at $20.00

=MAX(IF(G$6<$C$9+$C$10,G$6-$C$9,$C$10),0)

11 any additional gallons at $15.00

=IF(G$6>1000,G$6-1000,0)

12

cost =SUMPRODUCT($E$9:$E$11,G9:G11)

A. Write the four formulas to calculate the cost of 483 gallons.

=MIN(H6,$C$9)

=MAX(IF(H$6<$C$9+$C$10,H$6-$C$9,$C$10),0)=IF(H$6>1000,H$6-1000,0)=SUMPRODUCT($E$9:$E$11,H9:H11)

B. Write the four formulas to calculate the cost of 2,001 gallons.

=MIN(I6,$C$9

=MAX(IF(I$6<$C$9+$C$10,I$6-$C$9,$C$10),0)=IF(I$6>1000,I$6-1000,0)=SUMPRODUCT($E$9:$E$11,I9:I11)

Exercise 6: Calculate Employee Retirement & Health Plan

A company contributes to each eligible employee’s retirement plan at the rate of 4% of the employee’s annual salary. However, to be eligible for this benefit, an employee must have full-time status with two or more years of employment. A calculation for the retirement contribution requires a test of two conditions: Full-time status and number of years of employment. A graphical view of

the conditions to test might look like this illustration:

Page | 16

Yes

Yes

No

No

No retirement benifit Benefit=salary*4%

>=2yrs employmt?

Full time

Start

Institute of Technology of Cambodia Information Technology

There are three retirement contribution possibilities to account for:- An employee works full time AND has been employed two or more years. The retirement

benefit applies.- An employee works full time but has NOT been employed two or more years. The

retirement benefit does not apply.- An employee does NOT work full time. The retirement benefit does not apply.

You can account for these three possibilities in a single formula. Write your formula using logical functions. There’s more than one way to write this formula. For example, you might use both the IF and AND statement or you could express the same thing with a nested IF statement.

B C D E F G H

8 NameEmployment

status

Health Plan

SalaryHireDate

# YearsEmployed

RetirementContribution

9 Gopnik Part time Family $45,000 Jan-98 510 Mahfouz Full time Family $120,000 May-89 1311 Bryson Full time Individual $145,000 Mar-01 212 Peters Full time Individual $100,000 Nov-00 213 Deviles Full time Individual $115,000 Jul-97 514 Talento Part time Family $55,000 Aug-95 715 Yang Full time Other plan $95,000 Apr-99 416 Marks Part time Family $15,000 May-01 117 Heller Full time Family $124,000 Oct-00 2

A. Write the formula to calculate the Retirement Contribution for Gopnik. You should be able to copy this formula down the column to get valid values for employees Mahfouz through Heller.

B H

8 NameRetirement

Contribution

9 Gopnik=IF(AND(G9>=2,C9=" Part time"),E9*0%,IF(AND(G9>=2,C9="Full time"),E9*4%, IF(AND(G9<2,C9="Full time"),E9*0%,IF(AND(G9<2,C9="Part time "),E9*0%))))

10Mahfou

z

=IF(AND(G10>=2,C10="Part time"),E10*0%,IF(AND(G10>=2,C10="Full time"),E10*4%, IF(AND(G10<2,C10="Full time"),E10*0%,IF(AND(G10<2,C10="Part time"),E10*0%))))

Page | 17

Institute of Technology of Cambodia Information Technology

11 Bryson=IF(AND(G11>=2,C11="Part time"),E11*0%,IF(AND(G11>=2,C11="Full

time"),E11*4%, IF(AND(G11<2,C11="Full time"),E11*0%,IF(AND(G11<2,C11="Part time"),E11*0%))))

12 Peters=IF(AND(G12>=2,C12="Part time"),E12*0%,IF(AND(G12>=2,C12="Full

time"),E12*4%, IF(AND(G12<2,C12="Full time"),E12*0%,IF(AND(G12<2,C12="Part time"),E12*0%))))

13 Deviles=IF(AND(G13>=2,C13="Part time"),E13*0%,IF(AND(G13>=2,C13="Full

time"),E13*4%, IF(AND(G13<2,C13="Full time"),E13*0%,IF(AND(G13<2,C13="Part time"),E13*0%))))

14 Talento=IF(AND(G14>=2,C14="Part time"),E14*0%,IF(AND(G14>=2,C14="Full

time"),E14*4%, IF(AND(G14<2,C14="Full time"),E14*0%,IF(AND(G14<2,C14="Part time"),E14*0%))))

15 Yang=IF(AND(G15>=2,C15="Part time"),E15*0%,IF(AND(G15>=2,C15="Full

time"),E15*4%, IF(AND(G15<2,C15="Full time"),E15*0%,IF(AND(G15<2,C15="Part time"),E15*0%))))

16 Marks=IF(AND(G16>=2,C16="Part time"),E16*0%,IF(AND(G16>=2,C16="Full

time"),E16*4%, IF(AND(G16<2,C16="Full time"),E16*0%,IF(AND(G16<2,C16="Part time"),E16*0%))))

17 Heller=IF(AND(G17>=2,C17="Part time"),E17*0%,IF(AND(G17>=2,C17="Full

time"),E17*4%, IF(AND(G17<2,C17="Full time"),E17*0%,IF(AND(G17<2,C17="Part time"),E17*0%))))

The company supplies two health plan options:- Up to $10K of annual coverage for employees who choose the family plan.- Up to $8K of annual coverage for employees who choose the individual plan.

These benefits do not apply if the employee or employee-and-family is already covered by some other health plan. A calculation for health insurance requires a test of three conditions: Individual, Family, and Already Covered. A graphical view of the conditions to test might look like this illustration that follows.

Page | 18

Yes

Yes

No

No

No retirement benifit Benefit=salary*4%

>=2yrs employmt?

Full time

Start

Institute of Technology of Cambodia Information Technology

B C D E F G H I

8 NameEmployment

status

Health Plan

SalaryHireDate

# YearsEmployed

RetirementContribution

Health Plan Cost

9 Gopnik Part time Family $45,000 Jan-98 5 $0 $10

10 Mahfouz Full time Family $120,000May-

8913 $4,800 $4,810

11 Bryson Full time Individual $145,000 Mar-01 2 $5,600  $5,60812 Peters Full time Individual $100,000 Nov-00 2 $4,000  $4,00813 Deviles Full time Individual $115,000 Jul-97 5 $4,600  $4,60814 Talento Part time Family $55,000 Aug-95 7 $0 $10

15 Yang Full timeOther plan

$95,000 Apr-99 4 $3,800  $3,800

16 Marks Part time Family $15,000May-

011 $0  $10

17 Heller Full time Family $124,000 Oct-00 2 $4,960 $4,970

B. Write the formula to calculate the Health Plan Cost for Gopnik. You should be able to copy this formula down the column to get valid values for employees Mahfouz through Heller.

B I

8 Name Health Plan Cost

9 Gopnik =IF(D9="Family",H9+10,IF(D9="Individual",H9+8,IF(D9="Other plan",H9+0)))

10Mahfou

z=IF(D10="Family",H10+10,IF(D10="Individual",H10+8,IF(D10="Other plan",H10+0)))

11 Bryson =IF(D11="Family",H11+10,IF(D11="Individual",H11+8,IF(D11="Other plan",H11+0)))

12 Peters =IF(D12="Family",H12+10,IF(D12="Individual",H12+8,IF(D12="Other plan",H12+0)))

13 Deviles =IF(D13="Family",H13+10,IF(D13="Individual",H13+8,IF(D13="Other plan",H13+0)))

14 Talento =IF(D13="Family",H13+10,IF(D13="Individual",H13+8,IF(D13="Other plan",H13+0)))

15 Yang IF(D15="Family",H15+10,IF(D15="Individual",H15+8,IF(D15="Other plan",H15+0)))

16 Marks =IF(D16="Family",H16+10,IF(D16="Individual",H16+8,IF(D16="Other plan",H16+0)))

17 Heller =IF(D17="Family",H17+10,IF(D17="Individual",H17+8,IF(D17="Other plan",H17+0)))

Assignment for Python Programming

Ex1. The following names, that are acceptable as variable names , have: i. Value ii. Value -1 vi. V

Ex2. The following assignments expressions correct according to Python syntax are:i. Value = “ACGT”

ii. Value = Value + 3

Page | 19

Institute of Technology of Cambodia Information Technology

iii. a + value = 6iv. Value = a = 6v. Value = a*b + 5

vi. Value = “TA”*5vii. Value = “value” + 5

viii. 2*value = 6 Ex3. We code the following algebraic expression into an assignment expression in Python like

the picture bellowing:

i. 5x3+7 x2+88 x−6

ii. 6 x4−z( 7 y+6

2 ( x+3 )−2)+ (9− y )3

Ex4. Find the results of the following expression using Python.

Ex5. We have code below:

Page | 20

Institute of Technology of Cambodia Information Technology

So the output of the given code above is

Ex6. Write an algorithm that read 3 integers as input and prints out their sum, product and average.

When prints out:

Page | 21

Institute of Technology of Cambodia Information Technology

Ex7. We can convert the following sentences into logical expressions (conditions) using Python like the picture bellowing :

i. a is smaller than 3 or larger than 15ii. a is equal to b and c

iii. a is not equal to 3

Ex9. We have code:

So the output of the given code above is:

Page | 22

Institute of Technology of Cambodia Information Technology

Ex10. Write an algorithm that reads an integer x and calculates and prints the value of the following mathematical function.

f ( x )={5

( x−1 )2, x<1

2 , x=15

( x−1 )3, x>1

Ex11. Write an algorithm that reads three numbers and prints out the smallest of the three.

The example when we run:

Ex12. You are given the following DNA sequence: AAACGCTGTCAATACAATCTTYCTAGATATTCGGATTTGAATTTTGCAAAA

a. Can you convert the previous sequence in lower case?We can convert the previous sequence in lower case by using formula like following picture:

Page | 23

Institute of Technology of Cambodia Information Technology

b. How can you replace all A’s with T’s?We can replace all A’s with T’s by using formula like following picture:

លេ�ចក���និ�ដ្ឋា! និតាម្ពុរយៈ:ការស �'ព្រះសាវិព្រះជាវិខាង់ច្ចេល3 វាជាការអន�វិតិ/ម្ពុiយៈណែ�លជំiយៈសព្រះម្ពុបសព្រះម្ពុcលទ្យា ន%ន\យៈណែ�លច្ចេយៈ3ង់ប៉ានស �'រ iចម្ពុ�

ច្ចេហ3យៈ ម្ពុ�រ{លg�ជាថុ13ម្ពុPង់ច្ចេទ្យា=តិ ន ង់ជំiយៈប&ច្ចេ�ញបណែន�ម្ពុន(វិចច្ចេនាe �ខ[�ខាតិណែW%��តិ;មានវិ�ទ្យា�ណែ�លច្ចេយៈ3ង់ប៉ានស �'រ iចម្ពុ�។ ច្ចេយៈ3ង់អាច�gង់ចsស"ជាង់ម្ពុ�ន�3 ធាតិ�ស&ខាន"ៗម្ពុiយៈច&នiនច្ចេz�%�ង់ច្ចេព្រះគlង់មា� ស�3ន�&�C(ទ្យា\រ ការច្ចេរ=បច& ន ង់ការវាយៈឯសារតាម្ពុល��A:ស/ង់"ដ្ឋាសព្រះមាប"តិព្រះម្ពុYវិការទ្យា(ច្ចេm ន ង់តិព្រះម្ពុYវិការ�%�ង់ការ �យ៉ាល\យៈ។ ម្ពុ�}ង់ច្ចេទ្យា=តិច្ចេយៈ3ង់ប៉ានយៈល"�3រច្ចេប=បគAនាទ្យា ន%ន\យៈច្ចេW�ង់ៗណែ�លមានល��A:ងាយៈព្រះសcលន ង់ព្រះតិgម្ពុព្រះតិYវិWង់ណែ�រ។ ច្ចេល3ស�3ច្ចេន�ច្ចេmច្ចេទ្យា=តិច្ចេយៈ3ង់អាច�gង់�3ការប&ណែលង់ទ្យា ន%ន\យៈ�%�ង់មា� ស�3ន�&�C(ទ្យា\រ (ការប&ណែលង់ច្ចេ�លន ង់ការចង់ព្រះ�ង់រ (បម្ពុន/សព្រះមាប"ការគAនាទ្យា ន%ន\យៈច្ចេW�ង់ៗតាម្ពុរយៈ:ការច្ចេព្រះប3ព្រះប៉ាស" Python Programming ន ង់ច&ច្ចេន��gង់ណែW%��តិ;មានវិ�ទ្យា�ច្ចេW�ង់ៗច្ចេទ្យា=តិ )។

Page | 24

Institute of Technology of Cambodia Information Technology

ម្ពុ�}ង់វិ �ញច្ចេទ្យា=តិ ការស �'ព្រះសាវិព្រះជាវិច្ចេន�ជំiយៈឲ្យCស ស�ន ស �តិប៉ានណែស[ង់យៈល"�3�ង់[�ខាតិថ្ងៃនការស �'�នeង់ម្ពុ� ច្ចេហ3យៈអាចមានជាចម្ពុuល" ច្ចេល3�ជាស&នiរសព្រះមាប"ច្ចេចាទ្យាសiរ�% ច្ចេmវិ�ញច្ចេmម្ពុ� ឬសiរច្ចេmព្រះគYបច្ចេព្រះង់=ន, សាព្រះសាP ចារC ណែ�លបច្ចេង់�3តិជាគ&ន តិយៈល"�gង់បណែន�ម្ពុ�ល"ន ស �តិច្ចេz�%�ង់ថ្នា% �"។

ប��ណែនPច&ច្ចេព្វា�ជំ&នាញទាំ&ង់ច្ចេន� ច្ចេយៈ3ង់ព្រះតិYវិណែតិភ្នា9 ប"ជាម្ពុiយៈការអន�វិតិ/ន0ជាព្រះបចា&Wង់ណែ�រច្ចេ�3ម្ពុN3ឲ្យCវាស� តិច្ចេzជាប"�% ជាម្ពុiយៈនgង់ជំ&នាញបច្ចេច��ច្ចេទ្យាសណែ�លច្ចេយៈ3ង់ប៉ានស �'។ �i�ច្ចេយៈ3ង់ជាស ស�ន ស �តិគ តិថ្នា ច្ចេព្រះ��3ជំ&នាញណែ�លប៉ានស �'ម្ពុ�ច្ចេន� អាចមានល��A:ងាយៈព្រះសcល ន ង់មានព្រះបស ទ្យា]ភ្នា�ប៉ាន ល��ព្រះតាណែតិW'រភ្នា9 ប"នgង់បច្ចេច��វិ �ទ្យា��តិ;មានវិ�ទ្យា�Wង់ណែ�រ។ ជាច�ង់ច្ចេព្រះកាយៈច្ចេន� ច្ចេយៈ3ង់ខv�&ស(ម្ពុណែថុeង់អ&Aរគ�A�ល" ច្ចេលា�ព្រះគYណែ�លបងា� តិ"បងា� ញន(វិជំ&នាញ�តិ;មានវិ�ទ្យា�ជាច្ចេព្រះច3នម្ពុ��ល"�i�ច្ចេយៈ3ង់៕

Page | 25