Download ppt - M Huch et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11826

Transcript
Page 1: M Huch et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11826

M Huch et al. Nature 000, 1-4 (2013) doi:10.1038/nature11826

Liver damage induces Lgr51+ bipotential liver progenitors.

Recommended

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51
Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51 Documents
GI Motility online (May 2006) | doi:10.1038/gimo6
GI Motility online (May 2006) | doi:10.1038/gimo6 Documents
Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental
Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental Documents
DOI: 10.1038/NPHYS3211 Supplementary Information for
DOI: 10.1038/NPHYS3211 Supplementary Information for Documents
GI Motility online (May 2006) | doi:10.1038/gimo12
GI Motility online (May 2006) | doi:10.1038/gimo12 Documents
17 September 2009 doi:10.1038/nature08355 LETTERS
17 September 2009 doi:10.1038/nature08355 LETTERS Documents
DOI: 10.1038/NGEO2405 Moist convection in hydrogen
DOI: 10.1038/NGEO2405 Moist convection in hydrogen Documents
GI Motility online (May 2006) | doi:10.1038/gimo31
GI Motility online (May 2006) | doi:10.1038/gimo31 Documents
Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385
Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385 Documents
DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization
DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization Documents
Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7
Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7 Documents
Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling
Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling Documents
Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS
Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS Documents
DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |
DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – | Documents
DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor
DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor Documents
Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015
Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015 Documents
Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility
Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility Documents
doi:10.1038/nature05150 LETTERS
doi:10.1038/nature05150 LETTERS Documents