Transcript
Page 1: K.A. Seifert - Algae, Protists & Fungi Plenary

… The plague is on the walls of the house with ingrained streaks, greenish or reddish … and the dust that they scrape off they shall pour out in an unclean place outside the city.

Leviticus 14

Page 2: K.A. Seifert - Algae, Protists & Fungi Plenary

microbial culturing (conventional & d2e)

DNA detection (pyrosequencing)

field biology (in a house)

comprehensive DNA barcode databases

Page 3: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 4: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 5: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 6: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 7: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 8: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 9: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 10: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 11: K.A. Seifert - Algae, Protists & Fungi Plenary

Penicillium italicum Kent Loeffler / Kathie Hodge

Cornell Mushroom Blog

Page 12: K.A. Seifert - Algae, Protists & Fungi Plenary

Stachybotrys

Page 13: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 14: K.A. Seifert - Algae, Protists & Fungi Plenary

Classical indoor moulds in the Eumycota

Eurotiomycetes

• Penicillium and Aspergillus

Dothideomycetes

• Alternaria

• Cladosporium

Sordariomycetes

• Fusarium

• Stachybotrys

Wallemiomycetes

• Wallemia

Common mycobiota: 100-200 species

Page 15: K.A. Seifert - Algae, Protists & Fungi Plenary

Wallemia sebi

Page 16: K.A. Seifert - Algae, Protists & Fungi Plenary

• What is the indoor fungal diversity on a world scale?

• What is the correlation in the profile of species detected by different methods?

• Are we talking about unculturable or uncultured organisms?

• What is the biological significance of the species detected?

IM-BOL Global house dust survey

Page 17: K.A. Seifert - Algae, Protists & Fungi Plenary

Next generation DNA sequencing

• Millions of sequences directly from a sample – Culture independent

• In fungi, usually ITS +/- 28S • Many platforms and technologies

– 454 pyrosequencing – Illumina sequencing – Ion Torrent

5.8S 25-28S

ITS1 ITS2 IGS

18S

IGS

5.88S 2255-

ITSS1 ITSS2

Page 18: K.A. Seifert - Algae, Protists & Fungi Plenary

Global dust survey: Pyrosequencing results

Amend et al., 2010. Proc. Nat. Acad. Sci. 107, 13748-13753.

ITS (1 and 2) LSU

Sequence Length Mean

397 bp

445 bp

Total Reads 288,361 (204,000)

282,883 (183,000)

• 7,032 OTUs • 56% represented once

Page 19: K.A. Seifert - Algae, Protists & Fungi Plenary

Hoekstra et al. 1994. In Health implications of fungi in indoor environments. ed. Samson et al. pp. 169-177.

Page 20: K.A. Seifert - Algae, Protists & Fungi Plenary

Classical isolation study - Netherlands

454 pyrosequencing study – Northern hemisphere

Dothideomycetes

Sord

ario

myc

etes

Leot

iom

ycet

es

Tremellomycetes

Wal

lem

iom

ycet

es

Eurotiomycetes

? Data reformatted from:

Hoekstra et al. 1994. In Health implications of fungi in indoor environments. ed. Samson et al. pp. 169-177.

Amend et al., 2010. Proc. Nat. Acad. Sci. 107, 13748-13753.

dyy –– ortNN

Page 21: K.A. Seifert - Algae, Protists & Fungi Plenary

454 sequences … Cladosporium

Reference alignment from TreeBase: Schubert et al. 2009. Persoonia, 22: 111-122.

Full alignment

Alignment minus 170 bases

Page 22: K.A. Seifert - Algae, Protists & Fungi Plenary

454 sequences… Alternaria

Reference alignment from: Pryor, B. M., and Gilbertson, R. L. 2000. Mycological Research 104: 1312-1321.

Page 23: K.A. Seifert - Algae, Protists & Fungi Plenary

454 sequences … Epicoccum

In house ITS data plus GenBank data

Page 24: K.A. Seifert - Algae, Protists & Fungi Plenary

FX2FH6V03C9FN4 – ID = Dikarya ATCCCTACCTGATCCGAGGTCAACCGTAGAAATGGGGGTTTCTGGAGGCGGGCGGCGCCGAACCTGGAAAGCTGGAGAATTTACTACGCTTGAGGTTCAACACCACCGCCGAGGCCTTTAGGGAGCGTCCGCGACAGGGACGGCACCCAATACCAAGCAGGGCTTGAAGGTTGATAATGACGCTCGAACAGGCATGCTCCCCGGAATACCAGGGAGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAG

… a problem with unidentified sequences

Page 25: K.A. Seifert - Algae, Protists & Fungi Plenary

Dilution to Extinction (d2e)

Page 26: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 27: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 28: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 29: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 30: K.A. Seifert - Algae, Protists & Fungi Plenary

‘High throughput’ isolation from global dust samples

Page 31: K.A. Seifert - Algae, Protists & Fungi Plenary

Cryptocoryneum rilstonei

Page 32: K.A. Seifert - Algae, Protists & Fungi Plenary

Triadelphia uniseptata

Page 33: K.A. Seifert - Algae, Protists & Fungi Plenary

Bartheletia paradoxa

Page 34: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 35: K.A. Seifert - Algae, Protists & Fungi Plenary

600 unique DNA sequences 53 unassigned to taxonomic order (<10%)

Keith’s house. Pyro-fungi.LCA analysis

Page 36: K.A. Seifert - Algae, Protists & Fungi Plenary

Keith’s house. Pyro-fungi.

Page 37: K.A. Seifert - Algae, Protists & Fungi Plenary

Fusarium sambucinum dry rot of potato (teleomorph: Gibberella pulicaris)

Page 38: K.A. Seifert - Algae, Protists & Fungi Plenary

Fusarium oxysporum wilt of basil

Page 39: K.A. Seifert - Algae, Protists & Fungi Plenary

Keith’s house. Pyro-fungi.

Page 40: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 41: K.A. Seifert - Algae, Protists & Fungi Plenary

Friday Afternoon Mycologist / Kathie Hodge / Kent Loeffler

Cornell Mushroom Blog

Page 42: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 43: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 44: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 45: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 46: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 47: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 48: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 49: K.A. Seifert - Algae, Protists & Fungi Plenary

Conifer endophytes

600 unique sequences 53 unassigned to taxonomic order (<10%)

Keith’s house. Pyro-fungi.

Page 50: K.A. Seifert - Algae, Protists & Fungi Plenary

www.cbs.knaw.nl/indoor

• now includes classical isolations only

• d2e isolations to be added

• to be linked with MoBEDAC

Page 51: K.A. Seifert - Algae, Protists & Fungi Plenary

IM-Bol conclusions

• Vast increase in indoor fungal species diversity on the global scale

• Enhanced importance of the class Dothideomycetes – especially Epicoccum, Phoma and Alternaria

• Confirmed importance of the class Eurotiomycetes – especially Penicillium and Aspergillus

• Confirmed significance of the genus Wallemia – undoubtedly several species rather than one

Page 52: K.A. Seifert - Algae, Protists & Fungi Plenary

Concluding thoughts • Identifications in environmental DNA studies

– Very sensitive to data gaps and taxonomic imprecision – Especially Last Common Ancestor analysis – Results can vary day by day!

• Dilution to extinction – Very labour intensive – Isolates common as well as rare, unusual fungi – Including species not detected by pyrosequencing

• Determining biological significance requires multifaceted approach – Living growing moulds vs transients or dead cells – Are all fungi really detected by 454 sequencing?

Page 53: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 54: K.A. Seifert - Algae, Protists & Fungi Plenary

microbial culturing (conventional & d2e)

DNA detection (pyrosequencing)

field biology (in a house)

comprehensive DNA barcode databases

Page 55: K.A. Seifert - Algae, Protists & Fungi Plenary

pyrosequencing

culturing

direct observation

Page 56: K.A. Seifert - Algae, Protists & Fungi Plenary

pyrosequencing

culturing

direct observation

alternative culturing

Page 57: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 58: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 59: K.A. Seifert - Algae, Protists & Fungi Plenary
Page 60: K.A. Seifert - Algae, Protists & Fungi Plenary

Keith A. Seifert, Joey Tanney, Kalima Mwange, Hai Nguyen, Ed Whitfield

Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Canada

Robert A. Samson, Martin Meijer, Vincent Robert CBS Fungal Biodiversity Centre, Utrecht, the Netherlands

Thomas D. Bruns, Anthony Amend Plant & Microbial Biology, University of California at Berkeley, USA

IM-BOL: The Indoor Mycota Barcode of Life Real moulds and virtual moulds in your house

Keith Seifert [email protected]

Thanks to

Alfred P. Sloan Foundation

Genome Canada, NSERC, Canadian Network for DNA Barcoding, Consortium for the Barcode of Life

ECORC colleagues: Tom Graefenhan, Wen Chen, Chris Lewis,

André Lévesque


Recommended