Identifying the best antibiotic-target genes in
essential biochemical pathways
Paraskevi Giachou
__________________________________________
Master Degree Project in Infection Biology, 45 credits. Spring 2018
Department of Medical Biochemistry and Microbiology (IMBIM)
Supervisor: Diarmaid Hughes
Co-Supervisors: Gerrit Brandis, Sha Cao
2
Table of Contents
Abstract ...................................................................................................................................... 3
Novel antibiotics: a solution to a post-antibiotic apocalypse ..................................................... 4
Introduction ................................................................................................................................ 5
The Non-Mevalonate (MEP) Pathway ................................................................................... 5
The Coenzyme A biosynthetic Pathway ................................................................................ 6
The Nicotinamide Adenine Dinucleotide (NAD) Biosynthetic Pathway .............................. 8
Aim of the project ...................................................................................................................... 9
Materials and Methods ............................................................................................................. 10
Strains and Growth conditions ............................................................................................. 10
Polymerase chain reaction .................................................................................................... 10
Purification of the PCR products ......................................................................................... 11
Plasmid extraction ................................................................................................................ 11
Plasmid transformation ........................................................................................................ 11
λ Red Recombineering ......................................................................................................... 11
Spot assay ............................................................................................................................. 12
Bioscreen .............................................................................................................................. 12
Minimal Inhibitory Concentration (MIC) assay................................................................... 13
MACS Flow Cytometry ....................................................................................................... 13
Sequencing ........................................................................................................................... 13
Results ...................................................................................................................................... 14
Construction of strains ......................................................................................................... 14
Spot Assay ............................................................................................................................ 15
Bioscreen .............................................................................................................................. 15
MIC Assay ............................................................................................................................ 17
Selection of ispG and ispH mutants ..................................................................................... 17
Yfp-kan cassette fusions ....................................................................................................... 18
Discussion ................................................................................................................................ 20
Acknowledgements .................................................................................................................. 22
References ................................................................................................................................ 23
Supplementary Material ........................................................................................................... 27
3
ABSTRACT
The rapid rise in the frequency of antibiotic resistance developed by many pathogens is an
urgent and concerning problem the world has to face nowadays. The discovery of novel
antibiotics is crucial to overcoming this matter and face multi-resistant microbes that could be
life threatening otherwise. In this project three essential pathways in bacteria (MEP, NAD,
CoA) were examined in order to identify the most potential antibiotic target genes. To mimic
the action of an antibiotic, strains in which expression of the genes of interest can be down
regulated (using the inducible araBAD promoter) were constructed. The constructed strains
were subsequently tested to determine if there is a correlation between gene expression and
bacterial growth. The construction of strains harboring the genes from the CoA has not been
finished yet but for the MEP pathway, genes dxs, ispG and ispH appeared to be the most
promising target genes, while the nadK gene was the only potential target of the NAD
pathway. Using Fosmidomycin, a commercially available drug targeting the MEP pathway
gene dxr, we were able to show that the constructed strains can be used to screen for novel
compounds that inhibit protein functions of genes within these pathways. Taken together, the
results of this study suggest that the products of the dxs, ispG, ispH and nadK genes of the
MEP and NAD pathway appear to be promising targets for novel antibiotics.
Key words E.coli, antibiotic resistance, MEP pathway, NAD pathway, Fosmidomycin
4
Novel antibiotics: a solution to a post-antibiotic apocalypse
Before the 20th
century bacterial infections used to be incurable and deadly. A simple
paper cut could cost someone his life, just because there was no way of fighting back the
invisible to the eye but yet vicious microbes. It all changed in 1928 when Alexander Fleming
discovered penicillin, the first true antibiotic. Ever since a flourishing antibiotic era began,
where more antimicrobial drugs that inhibit or kill bacteria were found and people started to
believe that infectious diseases have been defeated. Between 1930 and 1963 more than 20
novel classes of antibiotics were produced and reached the market but since then only two
novel ones are commercially available.
However, bacteria are versatile and antibiotic resistance did not take long to rise.
Bacteria started acquiring mechanisms that overcome the effect of the drug or mechanisms
that affect the drug itself. Infections that were once considered treatable are now resistant to
the usual drugs of choice and the appearance of multi-resistant bacteria like the Methicillin-
resistant Staphylococcus aureus (MRSA) pose a great threat to the public health. Drug–
resistant bacterial infections claim around 25,000 deaths per year in Europe and it has been
suggested that the number will continue to increase in the future if no measures are taken. The
effort to bring new antibiotics in the market has led to the production of more antimicrobial
drugs but no novel classes have been discovered.
During this study, three biochemical pathways (MEP, NAD, CoA) that are essential
for bacterial survival were examined to identify the most potential antibiotic target genes.
Each pathway has a certain number of genes and thus enzymes that are involved to carry out
the reactions. To mimic the action of an antibiotic that targets these essential enzymes, strains
were constructed for each pathway in a way that the amount of the essential proteins produced
was controllable. The construction of strains for the CoA pathway has not been finished yet
and therefore results for this pathway cannot be drawn. When the rest of the strains were
tested to produce lesser amounts of protein, bacterial growth was inhibited for the strains that
were producing less Dxs, IspG, IspH and NadK enzymes. It is therefore proposed that genes
dxs, ispG and ispH of the MEP pathway and gene nadK of the NAD pathway are attractive
target genes for future antibiotic development. Furthermore, it is shown that a combination
therapy targeting the first two enzymes of the MEP pathway (Dxs, Dxr) at the same time has a
better result than a mono-therapy.
Taken this together, the discovery of novel classes of antibiotics is possible and can
even defeat the multi-resistant pathogens that cause tens of thousands of deaths annually but
most importantly prevent the post-antibiotic apocalypse from becoming a real world
phenomenon.
5
INTRODUCTION
Antibiotics are drugs that are used to prevent and treat bacterial infections by inhibiting
essential mechanisms of the microorganisms. Misuse of these drugs has led to a dramatic
increase in antibiotic resistance that poses a major threat to global health. Serious infections
such as tuberculosis and pneumonia become challenging to treat because of multi-resistant
microbial agents that limit the effectiveness of the usual drugs of choice. The severity of this
issue is supported by the following statement made by the World Health Organization
(WHO): ’’A post-antibiotic era - in which common infections and minor injuries can kill - far
from being an apocalyptic fantasy, is instead a very real possibility for the 21st century’’ (1).
The need for discovery of novel antibacterial compounds is urgent in order to minimize the
risk for public health and metabolic pathways that are essential for bacterial viability represent
ideal targets for these compounds.
The Non-Mevalonate (MEP) Pathway
Isoprenoids are a wide range of metabolites that originate from the five-carbon
precursor isopentenyl phosphate (IPP) or its isomer methylallyl diphosphate (DMAPP). They
are synthesized in all organisms and compose the largest group of natural products with a
diversity of structures and biological functions (2). In bacteria, these compounds are involved
in essential tasks such as electron transport (ubiquinone, menaquinone), cell wall and
membrane biosynthesis (bactoprenol) or the conversion of light into chemical energy
(chlorophylls, carotenoids) (3). While it was believed for a long time that IPP was synthesized
exclusively via the mevalonate pathway (MVA) in all organisms, an alternative pathway
known as MEP was identified in 1993 (4). The newly discovered MEP pathway is the only
one present in the majority of bacteria, plant plastids and the apicoplasts of apicomplexan
protozoa. It is completely absent in animals, including humans, which makes the enzymes
involved in the MEP pathway promising targets for new drug development (5).
Figure 1: The MEP pathway present in bacteria, plant plastids and the apicoplasts of apicomplexan protozoa.
Seven enzymatic steps are required for the conversion of pyruvate (Pyr) and glyceraldehyde-3-phosphate (G3P)
to the isoprenoid precursors, IPP and DMAPP (DXP: 1-deoxy-D-xylulose 5-phosphate, MEP: 2-C-methyl-D-
erythritol 4-phosphate, CDP-ME: 4-diphosphocytidyl-2-C-methyl-D-erythritol, CDP-MEP: 4-diphosphocytidyl-
2-C-methyl-D-erythritol 2-phosphate, MEcPP: 2-C-methyl-D-erythritol 2,4-cyclopyrophosphate, HMB-PP: 4-
Hydroxy-3-methyl-but-2-enyl pyrophosphate). The enzymes that catalyze each reaction are shown in red
whereas the enzymatic products in black. The enzymes that when mutated can lead to the production of DXP are
depicted in green.
6
The MEP pathway requires in total seven enzymatic steps for the production of IPP
and DMAPP (Figure 1). Considering their essentiality and the fact that these enzymes have no
homologues in mammals (6), they all are appealing drug targets. However, drug designing
can be challenging for enzymes like the IspD that contains a highly polar active site or IspE
which is an ATP-binding enzyme, both features where selectivity could be an obstacle. In
addition, IspG and IspH are both 4Fe-4S proteins and potential inhibitors targeting the Fe-S
cluster also raise concerns about selectivity among mammalian and bacterial enzymes. Dxs,
Dxr and IspF are considered the most promising targets due to the fact that they contain
potential drug binding sites and lack features that raise concerns about selectivity (7). Dxr is
the second enzyme of the pathway and the one that has been studied the most thoroughly (8).
Dxr function is inhibited by Fosmidomycin (FSM), which results in the blockage of the
isoprenoid biosynthesis in P. falciparum and some multidrug-resistant strains of bacteria (9,
10). Nonetheless, bacteria can develop a number of mechanisms to avoid this inhibition such
as alterations of the FSM transporter molecule or mutations that modify the FSM binding site
of the Dxr enzyme (11, 12). In addition, bacteria can bypass the blockage of the first or the
second step of the pathway by mutations in enzymes, normally not related to isoprenoid
biosynthesis, to produce DXP or MEP. In particular, mutations in the aceA and ribB genes
that encode for the E1 subunit of the pyruvate dehydrogenase complex (PDH) and 3,4-
dihydroxy-2-butanone 4-phosphate (DHBPS) respectively were able to rescue the otherwise
lethal inactivation of the dxs gene. This could be a result of either production of DXP by the
mutant enzymes or production of an alternative substrate that can be used by Dxr (13, 14).
Mutants that rescue a dxr inactivation were observed but the mechanism of bypassing was not
identified (13). Consequently, other MEP enzymes should also be explored rigorously to
identify the most promising drug targets in this pathway.
The Coenzyme A biosynthetic Pathway
Coenzyme A (CoA) is an essential, universally distributed cofactor that is involved in
many metabolic reactions such as synthesis and degradation of fatty acids, synthesis of
phospholipids and the citric acid cycle. The pathway is catalyzed in five enzymatic steps
(Figure 2) starting with pantothenate as a substrate (15). Even though most organisms,
including animals, rely on the uptake of exogenous pantothenate, there are some exceptions.
Some bacteria (e.g. Escherichia coli, Salmonella typhimurium), plants and fungi can
synthesize pantothenate de novo by utilizing β-alanine (17, 18). Nevertheless, Gerdes et al.
(19) showed that disrupting the pantothenate biosynthesis genes in E. coli had no effect on the
growth of the microorganism. This led to the conclusion that none of the involved genes are
essential because the bacteria can import exogenous pantothenate (19). Therefore, focus has
been on the five-step pathway that starts with pantothenate and leads to the production of
CoA due to the fact that the genes involved are essential for growth.
The pantothenate kinase (PanK or CoaA) catalyzes the first ATP-dependent step of
the pathway and converts pantothenate to 4-phosphopantothenate (20, 21). PanK of E. coli
(Type I) shares homology with other PanK proteins identified in bacteria such as
Haemophilus influenzae, Mycobacterium tuberculosis and Streptococcus pneumoniae and has
a different structure from the eukaryotic enzyme (19, 22). However, there are bacteria e.g.
Staphylococcus aureus that produce another type of PanK (Type II) that differs from the Type
7
I and is more similar to a eukaryotic one (19). A third type of PanK (Type III) has recently
been identified in Bacillus subtilis and subsequently in other bacteria missing PanK I or PanK
II. The main difference with the other two is its low affinity for ATP (23). PanK is the
enzyme of the CoA pathway that research on antimicrobial targets has been focused on due to
the diversity in structures and properties, as well as the fact that it catalyzes the committing
and rate-limiting step of the pathway (24). Even though inhibitors have been identified in
vitro, especially for the M. tuberculosis PanK Type I, none of them is able to inhibit the cell
growth in in vivo studies conducted so far and therefore it was concluded that PanK has a
poor vulnerability (25). In most bacteria, including E. coli, the second and third steps of the
pathway are carried out by a bifunctional enzyme, PPCS/PPCDC, encoded by the coaBC gene
(previously known as dfp) (26). However, in humans two distinct enzymes are responsible for
these two enzymatic reactions. The human PPCDC shares homology with the bacterial one
while the PPCS is less conserved between prokaryotes and eukaryotes (27). Some inhibitors
have been identified for the PPCS domain but there are no reports about the effect on bacterial
growth so far (28). PPAT, the enzyme that catalyzes the fourth step of the pathway to form
dephospho-coA, is encoded by the coaD gene (29). In mammals, the PPAT enzyme is fused
with the dephospho-CoA kinase that catalyzes the last step of the pathway, forming the
bifunctional enzyme coA synthase (30). However, the prokaryotic PPAT differs significantly
from the eukaryotic PPAT domain and that is the reason this enzyme is considered a potential
target for antibacterial drugs (27). Cycloalkyl pyrimidines were identified as inhibitors against
PPAT by AstraZeneca and the results were quite promising. The inhibitors were able to
suppress the growth of Gram-positive bacteria in vivo and even in animal models when tested
in vitro, which shows the importance of this enzyme as a drug target. However, the
optimization of these compounds regarding pharmacokinetics and toxicity was not feasible
and therefore it did not proceed to the phase of clinical testing (31). The fifth and last step of
the pathway, the phosphorylation of dephospho-coA, is catalyzed by dephospho-coA kinase
(DPCK), which is encoded by the coaE gene (32). This enzyme shows high sequence
similarity to the eukaryotic DPCK domain of the coA synthase and consequently studies are
not focused on it as it does not appear to be an attractive drug target (27).
Figure 2: The universal Coenzyme A biosynthetic pathway in bacteria. Five enzymatic steps are required for the
conversion of pantothenate to Coenzyme A. PanK is the enzyme catalyzing the first step and dephospho-coA
kinase (DPCK) the last step of the pathway. Bacteria can either synthesize pantothenate de novo or utilize
mechanisms for the uptake of exogenous pantothenate. In any case, the coenzyme A biosynthetic pathway from
pantothenate remains the same. The enzymes that catalyze each step are depicted in red whereas the enzymatic
products in black.
8
The Nicotinamide Adenine Dinucleotide (NAD) Biosynthetic Pathway
The nicotinamide adenine dinucleotides (NAD, NADH, NADP and NADPH) are
important coenzymes that carry out redox reactions in all living cells. NAD and NADP act as
oxidizing agents, accepting electrons from other molecules while NADH and NADPH act as
reducing agents, donating electrons (33). Apart from redox reactions, nicotinamide adenine
dinucleotides are implicated in ADP ribosylation of proteins and can also act as a cosubstrate
for non-redox enzymes such as bacterial DNA ligases (34, 35). NAD can be synthesized de
novo by simple components or through salvage pathways dependent on the recycling of
normal cellular catabolism metabolites. Almost all living organisms can synthesize NAD de
novo with some notable differences between eukaryotes and prokaryotes. The initial step in
the NAD pathway is the production of quinolinic acid (QA) from an amino acid. In animals
and some bacteria, tryptophan is used as a substrate whereas most bacteria synthesize QA
from aspartic acid (36, 37). The prokaryotic NAD biosynthesis is a six step enzymatic process
(Figure 3) and starts with aspartic acid which is oxidized by the L-aspartate oxidase (NadB).
The first three genes of the pathway (nadA, nadB, nadC) have been shown to be non-essential
for the growth bacteria whereas inactivation of each of the last three genes of the pathway
(nadD, nadE, nadK) led to no bacterial growth (38). This observation, coupled with the fact
that these essential genes are present in almost all bacterial genomes, make them an attractive
antibacterial drug target (39).
Figure 3: The NAD pathway starting with aspartic acid in bacteria. Five enzymatic steps are required for the
conversation of L-aspartic acid to NAD. One additional phosphorylation step is needed for the production of
NADP. The non-essential enzymes of the pathway are depicted in green whereas the three essential ones are
depicted in red. The enzymatic products are shown in black.
NadD is the first essential enzyme of the pathway that catalyzes the conversion of
nicotinic acid mononucleotide (NaMN) to nicotinic acid adenine dinucleotide (NaAD), the
first shared intermediate product between most de novo and salvage pathways. Enzymes of
this family have been studied in pathogenic and model bacteria and it has been found that the
enzyme is catalyzing the reaction much faster by using NaMN as a substrate instead of
nicotinamide mononucleotide (NMN) which is also a NAD precursor (40, 41, 42). On the
other hand, the human enzyme that shares similar functions (hsNMNAT) has the same
substrate preference for NaMN and NMN (43). Furthermore, the 3D structures of human and
bacterial NadD show significant differences in their active site conformation, which opens a
window for using discriminating NadD inhibitors (44). Even though there are no known drugs
that inhibit NadD, some inhibitors that are able to act on both Gram-positive and Gram-
negative bacteria with a weak selectivity for the human enzymes have been identified.
9
However, the binding affinity of these inhibitors is not optimal but the results validate the
importance of NadD as a drug target (45). The second essential enzyme, NAD synthetase
(NadE), is responsible for the conversion of NaAD to NAD. The action of the enzyme can be
ammonia-dependent (most bacteria e.g. E. coli, B. subtilis) or glutamine-dependent
(eukaryotes and some prokaryotes e.g. M. tuberculosis) (46, 47, 48, 49). Both types of
enzymes contain a highly conserved C-terminal synthetase domain while the M. tuberculosis
synthetase shares 23% sequence similarity with the equivalent human enzyme (50). Based on
these observations studies focused on targeting NadE have been carried out and inhibitors
have been identified. Nevertheless, some of the inhibitors showed no correlation between
enzymatic inhibition and effect on bacterial growth whereas others had biochemical properties
not suitable for further drug development (51, 52, 53). The production of NADP is carried out
by the third enzyme of the pathway, NAD kinase, that phosphorylates NAD by using ATP or
in some cases a poly(P) polymer as a phosphodonor (54, 55). The activity of the NAD kinases
was known for a long time but their genes were identified recently, leading to the discovery of
NadK orthologs in all living organisms including humans (56, 57). Ever since, this enzyme
has received a lot of attention due to its importance in the NADP metabolism and the fact that
differences between the human and the prokaryotic NadK have been observed (57). Studies
have led to the identification of some NAD homologues that can specifically inhibit the
bacterial NadK but further improvement of these inhibitors is needed in order to achieve a
concordance between in vitro enzymatic activity and antibacterial effect (58, 59).
AIM OF THE PROJECT
Construct strains that mimic the action of antibiotics targeting the enzymes of the
three essential biochemical pathways (MEP, NAD, CoA) that were chosen for this
study.
Identify the most potential antibiotic target genes of these three pathways.
Test the antibiotic Fosmidomycin against all the constructed strains of the MEP
pathway to observe if targeting Dxr and another enzyme of the pathway has a better
outcome than a mono-therapy.
10
MATERIALS AND METHODS
Strains and Growth conditions
All strains are derived from E. coli K12 MG1655. Bacteria were routinely grown in LB broth
or on LB agar (LA) at 37°C (30°C for strains that carry the pSIM5-Tet plasmid) with shaking
at 200rpm for liquid cultures under normal atmospheric conditions. When required, arabinose
(ara) was added to a final concentration of 0.1% unless otherwise specified. Antibiotics were
added to the cultures at the following concentrations: Tetracycline: 15 mg/L;
Chloramphenicol: 30 mg/L and Kanamycin: 50 mg/L.
Polymerase chain reaction
PCR was used to amplify genetic regions that were inserted in the E. coli genome by the λ red
recombineering method, regions that were sent for sequencing and also to verify the
insertion/deletion of a gene. Phusion High-Fidelity 2X PCR Master Mix with HF Buffer (New
England Biolabs) was used for the amplification of the genes that were used for λ red
recombination whereas Taq 2X PCR MasterMix (Thermo Scientific) was used for sequencing
and verification of insertion/deletion. The PCR reactions and the cycling scheme were
performed as listed in the following table by using an S1000TM
Thermal Cycler ( Bio-Rad
Laboratories, California) (Tables 1 and 2). The primers that were used for the amplification of
the genes are listed in the supplementary table. Correct amplification was checked using a 1%
agarose gel.
PCR Reaction (25 μl)
Phusion/TaqMasterMix 12.5 μl
H2O 9.5 μl
Forward primer
(10pmol/μl)
1 μl
Reverse primer
(10pmol/μl)
1 μl
DNA 1 μl
Table 1: Components used for the PCR reactions and the respective volumes.
PCR Cycling Scheme Steps Phusion MasterMix Taq MasterMix
1. Initial denaturation 98°C for 5 min 95°C for 5 min
2. Denaturation 98°C for 30 sec 95°C for 30 sec
3. Annealing 55°C for 30 sec 55°C for 30 sec
4. Extension 72°C for 1 min/kb 72°C for 1 min/kb
5. Repeat Steps 2,3,4 for 34 times Steps 2,3,4 for 34 times
6. Final extension 72°C for 5 min 72°C for 5 min
7. Hold 4°C for ∞ 4°C for ∞
8. END END END
Table 2: The PCR cycling scheme that was used according to the type of polymerase in the MasterMix.
11
Purification of the PCR products
The PCR products were purified in order to be used for lambda red recombineering and sent
for sequencing. The purification was performed according to the instructions of the QIAquick
PCR Purification Kit from Qiagen.
Plasmid extraction
For the plasmid extraction a 2 ml overnight culture of the E. coli strain CH6997 carrying the
pSIM5-tet plasmid was used. The pelleted bacterial cells were collected after centrifugation of
the culture and the plasmid purification was performed based on the instructions of the
QIAprep Spin Miniprep kit (Qiagen).
Plasmid transformation
pSIM5-tet plasmids were inserted in the strains that had the desirable genes under the control
of the arabinose promoter but also contained the same genes in the original positions. For the
insertion of the plasmids overnight cultures of the strains were used. The cultures were
centrifuged for 5 min to collect the cells, the supernatant was then discarded and the cells
were resuspended in 1ml of water followed by another 5 min centrifugation. The supernatant
was discarded again and the procedure of washing was repeated for 4 more times. After the
last discarder, the cells were resuspended in the water that was left in the tube. In a clean 1.5
ml microcentrifuge tube 50 μl of the recipient cells were added along with 5 μl of the purified
plasmid. The mixture was then transferred in electroporation cuvettes and electroporation
occurred by using a Gene PulserTM
(Bio-Rad Laboratories, California) according to the
following protocol : 1.8KV, 25μF and 200Ω. The cells were then resuspended in 1 ml LB and
recovered at 30°C for at least an hour. After recovery, 100μl of the cells were plated on LA
plates containing 15 mg/ml tetracycline and incubated overnight at 30°C.
λ Red Recombineering
Recombineering was used to construct the strains by inserting the gene of interest behind the
araBAD promoter and deleting it from the original position. The same technique was used for
the yellow fluorescent protein (yfp)- kanamycin (kan) cassette fusions.
Day 1
An overnight culture of the recipient strain, carrying the pSIM5-tet plasmid with the λ red
genes essential for the recombination, was started in 2 ml LB containing 15 mg/L tetracycline.
The culture was grown overnight shaking at 30°C.
Day 2
The overnight culture was diluted (1:100) in 50 mL LB containing 15 mg/L
tetracycline.
12
The culture was incubated in a 30°C shaking water bath for around 2,5 hours to a
culture density of approximately OD600 = 0,2 - 0,3 measured by a spectrophotometer.
The culture was transferred to a 43°C shaking water bath for 15 minutes to induce the
production of the λ red proteins and transferred to ice water-bath for an additional 15
minutes.
The electrocompetent cells were subsequently collected by centrifugation at 4500 x g
for 8 min at 4°C, using a Heraeus Labofuge 16R (Thermo Scientific, Germany).
The pellet was resuspended in 15 ml of ice-cold H2O and washed three times in total
by repetitive steps of centrifugation and resuspension.
After the last washing, the pellet was resuspended in 150μl of ice-cold H2O.
50 μl of the cell suspension was mixed with 5 μl of purified PCR product (for DIRex:
5 µL of each PCR product) and transferred into an electroporation cuvette. A Gene
PulserTM
( Bio-Rad Laboratories, California) was used for the electroporation
according to the following protocol : 1.8KV, 25μF and 200Ω.
After electroporation, the cells were recovered in 1 mL LB and incubated overnight at
37°C. In case of sucrose counter-selection, cells were recovered in 15 ml of Salt-free
LB shaking at 37°C.
Day 3
100 μl of the overnight cultures were plated on the appropriate selective media. The
plates were incubated overnight at 37°C.
Spot assay
Cultures in LB containing 0.5% glucose were started for the constructed strains (strains
having the gene of interest behind the araBAD promoter and carrying the deletion of the gene
in the original position) and incubated overnight at 37°C shaking. The overnight cultures were
washed with 0.9% NaCl and a 10-fold serial dilution was performed by serially adding 100 μl
of cells in 900 μl of 0.9% NaCl. Square plates with different arabinose concentrations (0.1%,
0.01%, 0.001%, 0.0001%) and plates containing 0.5% glucose were used for the assay. For
each dilution a spot of 5 μl was added onto the plates. The plates were incubated overnight at
37°C.
Bioscreen
Cultures in LB containing 0.5% glucose were started for the constructed strains (strains
having the gene of interest behind the araBAD promoter and carrying the deletion of the gene
in the original position) and incubated overnight at 37°C shaking. The overnight cultures were
washed with 0.9% NaCl and diluted 10 fold. 100 well “honeycomb” plates and media
containing arabinose and 0.5% glucose were used for the assay. Each well was filled with 300
μl of media and 1 μl of the diluted cultures. The instrument used for the measurements was
BioscreenC (Oy Growth Curves Ab Ltd ), and the run was set for 18 hours.
13
Minimal Inhibitory Concentration (MIC) assay
A MIC assay for all the constructed strains was also performed against the antibiotic
Fosmidomycin. 96-well Microtiter plate and media containing arabinose and 0.5% glucose
were used for the test. Overnight cultures of the strains were washed with 0.9% NaCl and 50
μl were tranferred to 5 ml of 0.9% NaCl. The diluted cultures were measured by using a
SensititreTM
Nephelometer (ThermoFisher Scientific) and culture or 0.9% NaCl were added
until obtaining the desired bacterial concentration of 1x108 CFU/ml. The diluted cultures were
further diluted 2 fold in selective media (final bacterial cells: 1x106
CFU). The antibiotic
concentrations used for the assay were 128: 64: 32: 16: 8: 4: 2: 1: 0 μg/ml. 100 μl of the
diluted antibiotic (256 μg/ml) were transferred in column 1 and a series dilution of the
compound was performed until column 11. 50 μl of media containing cells were filled from
column 2 to 11 and 100 μl of media containing cells in column 12. The final volume in each
well was 100 μl. The plates were incubated for ~ 20 hours at 37°C without shaking.
MACS Flow Cytometry
Flow cytometry was used to measure the fluorescence levels in the constructed strains
harboring the yfp-kan cassette. Overnight cultures were started for the constructed strains in
selective media and subsequently 1μl of each overnight culture was mixed with 200μl of LB
in a 96-well Microtiter plate. Fluorescence levels were determined by using magnetic-
activated cell sorting (MACSQuant VYB, Miltenyi Biotec). For each sample the average
fluorescence of 20.000 single cells was determined. All values are averages ± standard
deviation of three independent cultures.
Sequencing
Sequencing was performed by Macrogen (The Netherlands) using purified PCR products.
14
RESULTS
Construction of strains
Since the essential genes of the three pathways (MEP, NAD, CoA) are considered to be
potential antibiotic targets, strains that mimic the action of an antibiotic were constructed. For
this, potential target genes were moved behind the inducible araBAD promoter in order to
assess if there is a correlation between the amount of the respective proteins and the bacterial
growth.
Strains for all the essential genes of the three pathways were constructed by λ red
recombineering (Figure 4). Insertion of the gene of interest behind the araBAD promoter was
performed with sucrose counter-selection whereas the deletion of the gene from the original
position was achieved with the DIRex method (60, 61). Seven strains were constructed for the
MEP pathway (strains: dxsara
, dxrara
, ispDara
, ispEara
, ispFara
, ispGara
, ispHara
) and three strains
for the NAD pathway (strains: nadDara
, nadEara
, nadKara
). During the project, it was
discovered that the ispEara
strain had a mutation that led to constitutive expression of the
araBAD promoter and for this reason the strain was excluded from the results. Strains that
harbor the gene of interest behind the araBAD promoter have been constructed for the CoA
pathway (strains: coaAwt+ara
, coaDwt+ara
, coaEwt+ara
) but the deletion of the original gene has to
be performed. The strain for the second gene of the CoA pathway (coaBC) has not been
constructed yet.
Figure 4: Construction of the strains for the essential genes of the three pathways exemplified with the dxs gene.
The gene of interest is first inserted behind the araBAD promoter by λ red recombineering with sucrose counter-
selection (A, B). In another step, the gene of interest is deleted from the original position by using the DIRex
method (C).
15
Spot Assay
The constructed strains of the MEP and NAD pathways were tested with the spot assay to
observe if the different expression levels of the gene of interest have an effect on bacterial
growth. A wild-type E. coli strain (strain CH1464) was used as a control. For the MEP
pathway, a reduction in the expression levels of the dxr, ispD and ispF genes had no visible
effect on bacterial growth compared to the wild type and the strains could still grow in all the
media used for the assay. However, the colonies were getting smaller as the arabinose
concentration was decreasing which shows that they could not grow as fast as in the media
containing the highest arabinose concentration. The other three genes exhibited an impact on
the bacterial growth. Gene dxs showed a correlation between the arabinose concentration and
the bacterial growth which was more clear on the plates containing 0.001%, 0.0001%
arabinose and 0.5% glucose where there were no colonies of the diluted cultures.
Surprisingly, the two last genes of the MEP pathway, ispG and ispH were the ones that
showed the most significant reduction in bacterial growth as the levels of arabinose and
consequently the levels of gene expression were decreasing. The effect of the ispG became
obvious on the plate containing 0.01% arabinose whereas the effect of the ispH was visible
even on the plate with the highest arabinose concentration, 0.1%. Both strains gave almost no
growth on the plate containing 0.5% glucose (Figure 5, Supplementary Figure 1).
For the NAD pathway, nadD and nadE did not show any effect on bacterial growth when
tested on the different arabinose and glucose concentrations compared to the wild type strain.
These strains could efficiently grow in all media and the size of the colonies in the lowest
arabinose concentration was the same as in the highest. Nevertheless, low levels of expression
of the last gene of the pathway, nadK, led to a poor bacterial growth, which was more
apparent on the plate with the lowest arabinose concentration (0.0001%) and on the plate
containing glucose.
Figure 5: a) Results of the spot assay for the dxrara
strain. The strain was not affected by the decreasing
concentrations of arabinose and could still grow even in the lowest concentration of arabinose and in media with
glucose. The size of the colonies thought was getting smaller as the arabinose concentration was decreasing. b)
Results of the spot assay for the ispHara
strain. There was a gradual decrease in bacterial growth and a strong
effect in media containing 0.0001% ara and 0.5% glu.
Bioscreen
a) b)
16
The Bioscreen was used as an alternative method to verify the results of the Spot assay by
measuring the bacterial growth over time.
The results for the MEP pathway match the ones from the Spot assay, as the dxrara
, ispDara
and
ispFara
strains did not show significant changes in growth. The bacteria were growing equally
good in all media even though a reduction in growth was observed in media containing
glucose. This correlates perfectly with the spot assay findings in which the strains could grow
in glucose but much slower compared to the higher arabinose concentrations. However, dxsara
,
ispGara
and ispHara
strains were the ones that had a distinguishable reduction in growth as the
arabinose concentration was decreasing. It was more obvious for the ispHara
strain that gave
no bacterial growth in media containing less than 0.01% arabinose (Figure 6).
The NAD pathway results were different from the Spot assay as the strain nadKara
did not
seem to be affected by the concentration of arabinose and the bacterial growth remained at the
same levels even though a reduction in media containing glucose was observed. Nevertheless,
the other two strains, nadDara
and nadEara
, showed no significant changes in growth as
expected from the Spot assay and the bacterial growth remained the same over time in all the
media used for this assay (data not shown).
Figure 6: a) The bioscreen results for the dxrara
strain which showed that the strain could grow at the
same levels in all the different concentrations of arabinose b) The results for the ispHara
strain indicated
that the strain could grow in media with the highest concentration of arabinose and less efficiently in
a)
b)
17
media containing 0.01% arabinose. However, no growth was observed in the other three media (0.001%
ara, 0.0001% ara, 0.5% glu).
MIC Assay
A MIC assay was performed for the dxr
ara strain against the antibiotic Fosmidomycin that is
known to inhibit the Dxr protein and has a MIC of about 128 mg/L on a wild-type E. coli
strain. When tested against the dxrara
strain there was a clear correlation between the arabinose
concentrations and the MIC values, verifying Dxr as the original target of FSM. As the
arabinose concentration was declining, the MIC was decreasing as well reaching a MIC of 8
mg/L in media containing 0.0001% arabinose and 0.5% glucose.
To test if there were synergistic effects with other genes of the pathway, the rest of the MEP
pathway strains were tested against the antibiotic in various concentrations of arabinose and
in glucose. No changes in MIC were observed for the strains ispDara
and ispFara
which had a
MIC of >128 mg/L in all the different media, indicating that low levels of the respective
proteins do not affect the action of the antibiotic. On the other hand, a reduction in the MIC
was observed when the strain dxsara
was tested against FSM, starting with a MIC of 128 mg/L
and reaching 4 mg/L in the lowest arabinose concentration. This suggests that when the levels
of the Dxs protein are decreasing, the FSM MIC is decreasing as well, demonstrating that
there could be synergistic effects between FSM and an antibiotic that could target Dxs.
Results for strains ispGara
and ispHara
can’t be drawn by the MIC assay as these strains can’t
grow in antibiotic-free media with low concentrations of arabinose and glucose (Table 3).
Media
MIC (mg/L) for strains:
dxs dxr ispD ispF ispG ispH
0.1% ara > 128 > 128 > 128 > 128 > 128 >128
0.01% ara > 128 32 > 128 > 128 128 -
0.001% ara 16 16 > 128 > 128 - -
0.0001% ara 4 8 > 128 > 128 - -
0.5% glucose 4 8 > 128 > 128 - -
Table 3: Results of the susceptibility test for the strains of the MEP pathway against the antibiotic
Fosmidomycin.
Selection of ispG and ispH mutants
Since ispG and ispH appeared to be the most potential antibiotic target genes of the MEP
pathway, as concluded from the spot assay and bioscreen results, mutant selection was
performed to determine the mechanism of resistance.
18
Mutants were selected on LA plates containing 0.5% glucose, as these two strains were not
able to grow in this media. 7 and 12 mutants were selected for the ispG and ispH strains
respectively and sent for sequencing of the ara operon. The sequencing results showed that all
mutants harbored mutations in the araC gene, which encodes for the regulatory protein of the
operon (Table 4). Most mutations are repeated, like the amino acid change L10Q (6x), P11L
(2x), S14L (2x), V20M (2x) and L156I (2x). Most of the mutation found in this project, have
been shown to modify the structure of the N-terminal domain of the regulatory araC protein
leading to a constitutive gene expression even in the absence of arabinose from the media
(62). The fact that all the mutations were found in the araC gene implies that there is no
easier bypass mechanism such as amplification of the ispG or ispH genes to overcome the
depletion of the proteins.
Strain Nucleotide change Amino acid change
ispG 1 C41T S14L
ispG 2 G35A G12E
ispG 3 C41T S14L
ispG 3 C455A A152E
ispG 5 G58A V20M
ispG 6 C32T P11L
ispG 7 T29A L10Q
ispH 1 T56C L19P
ispH 2 T26A L9Q
ispH 3 T29A L10Q
ispH 4 C32T P11L
ispH 5 T29A L10Q
ispH 6 A53C H18P
ispH 7 T29A L10Q
ispH 8 G58A V20M
ispH 9 C466A L156I
ispH 10 T29A L10Q
ispH 11 C466A L156I
ispH 12 T29A L10Q
Table 4: Sequencing results for the selected ispG and ispH mutants.
Yfp-kan cassette fusions
In order to verify that the araBAD promoter functions equally well in all the strains
constructed for the MEP and NAD pathways, a yfp-kan cassette was inserted behind the
araBAD promoter and the gene of interest (Figure 7). The strains containing the yfp-kan
fusions were tested in all media combinations and the levels of fluorescence were measured
by Magnetic-activated cell sorting (MACS).
Based on the results obtained from this assay, the fluorescence levels corresponding to the
activity of the araBAD promoter were comparable in all the strains (Table 5). There was a
reduction in the levels as the arabinose concentration was decreasing whereas in media
containing glucose the fluorescence levels were around zero. Both observations indicate that
the promoter and its activity depend on arabinose and the concentration of it in the media.
Furthermore, all the strains gave similar and comparable fluorescence levels, validating the
results of the spot assay and the bioscreen. In particular ispG and ispH genes that were found
to be promising antibiotic target genes, were amongst the strains with the highest fluorescence
levels. This means that the results of the spot assay and the bioscreen were only influenced by
19
the concentration of arabinose used and not by malfunction of the promoter. Even though
some strains, like nadEara
,dxrara
and especially ispDara
, did not give as high fluorescence as
the others, which could be interpreted as lower gene expression, it did not affect the assays as
the strains could still grow in all media combinations.
Figure 7: Construction of strains containing the yfp-kan cassette exemplified with strain dxs
ara . The cassette
was inserted behind the araBAD promoter and the gene of interest in each case by λ Red Recombineering.
Media dxs dxr ispD ispF ispG ispH nadD nadE nadK
0,1% ara 162,74 124,73 15,74 396,03 260,59 296,74 335,15 102,79 188,53
0,01% ara 107,44 95,54 11,18 300,96 187,60 235,17 222,88 78,14 130,94
0,001% ara 67,74 57,91 5,91 176,23 100,35 137,90 137,06 47,43 76,23
0,0001% ara 8,80 8,58 0,52 20,77 12,12 16,10 16,01 4,94 8,40
0,5% glu 0,75 1,53 -0,35 0,30 0,09 0,80 0,56 -0,31 -0,27
Table 5: The fluorescence levels for all the constructed strains of the yfp-kan fusions measured in arbitrary units
(AU). The strains were tested in different concentrations of arabinose and in glucose and the fluorescence was
measured by MACS.
20
DISCUSSION
Living in a time where antibiotic resistance becomes more and more frequent, the
discovery of new antibiotics is the key to dealing with this problem and even targeting multi-
resistant pathogens that cannot be treated by the usual drugs of choice. Addressing this
serious issue, the present study was focused on finding new promising antibiotic targets
involved in three essential pathways in bacteria, the MEP, the NAD and the CoA pathways.
The strains constructed in this study were designed to mimic the effects of a potential
antibiotic on a specific target protein. As antibiotics bind to their targets they inhibit the
protein’s function leading to a reduction in effective protein concentration. To mimic this
effect, we cloned potential target genes behind the inducible araBAD promoter and removed
the gene from its original chromosomal location. Thus, protein levels could be down
regulated as a result of decreased arabinose concentration in the media. Since the construction
of strains for the CoA pathway had not been completed, only the MEP and NAD were
explored as potential target pathways. Two methods (Spot assay, Bioscreen) were examined
in order to identify the one that gives more clear results and will be used to test the strains in
different arabinose concentrations. The Bioscreen showed no effect in growth for the strains
of the NAD pathway whereas there was some effect for some strains of the MEP pathway,
which was visible at the end of the assay as all strains had almost the same growth rate at the
beginning. This resemblance in the growth rates between all strains might be a result of liquid
nature of the LB which supplies the cells with nutrients for a longer period of time compared
to the solid media (LA) used in the Spot assay. The Spot assay gave more clear results
concerning the plating efficiency and the size of the bacterial colonies on the plate and for this
reason it was selected as the most appropriate method to test the strains. Growth of all strains
was affected when expression levels of the proteins were reduced. In most cases the effect
was not bactericidal (equal number of colonies on the plates containing various concentrations
of arabinose) but the size of the colonies became smaller as expression levels were reduced
(Fig. 5a, supplementary Fig. 1). However, low levels of Dxs, IspG, IspH and NadK proteins
additionally reduced the number of colony forming units by up to six orders of magnitude in
low concentrations of arabinose and in glucose (Fig. 5b, supplementary Fig. 1). Dxs has been
suggested to be the rate-limiting step of the pathway in Synechococcus leopoliensis (63) and
IspG in M. tuberculosis (64) indicating that both enzymes have low reaction rates. Both
findings suggest that the protein depletion, resulting from the low arabinose concentrations,
has the strongest effect on proteins that catalyze slow reaction of a pathway.
Overall, the effect on bacterial growth was the strongest for IspG and IspH proteins,
making those two the most potential antibiotic target genes in this study. Nevertheless,
previous studies have not been focused on IspG and IspH due to the lack of protein crystal
structures from relevant pathogenic organisms (65). Furthermore, both belong to the family of
iron-sulfur proteins that are highly distributed in the nature and which raises concerns with
regard to selectivity (66). Even though ispG and ispH are considered the most promising, this
does not exclude the potentiality of the rest of the tested genes. Fosmidomycin, a
commercially available antibiotic, acts as an alternative substrate for the Dxr enzyme and is
active against a wide range of bacteria that belong to the Enterobacteriaceae family (67). The
findings in this study showed that low levels of the Dxr enzyme in the bacterial cell did not
reduce the number of colony forming units within the culture but still had a significant effect
on the bacterial growth (reduction in colony size). This indicates that not only genes that
21
demonstrate antibacterial effects but instead display a lower growth rate could also be
considered as potential target genes. In addition, this observation further strengthens the
choice of dxs, ispG, ispH and nadK as the most promising target genes of the two pathways
since it can be assumed that a much lower dose of a potential antibiotic should be needed to
observe the same antibacterial effect like in the case of FSM. A lower dose would increase the
window between effective antibacterial concentration and toxicity effects of the drug and
therefore be beneficial for treatments.
Another question that was explored during this study was if the constructed strains
could be used to test for synergistic effects between antibiotics that target different enzymes
within the pathway. An example for such an effect is the combinatory use of Trimethoprim
and Sulfamethoxazole that target two enzymes in the folate synthesis pathway (68). To assess
this, a Fosmidomycin MIC assay in the presence of different arabinose concentrations was
performed for each strain. The basic idea behind this test is that Fosmidomycin directly
targets Dxr and reduced arabinose concentrations mimics a drug targeting another protein.
The expectation was that the FSM MIC should be independent from the arabinose
concentration for proteins that display no synergistic effect with Dxr inhibition and a
reduction in FSM MIC in lower arabinose concentrations would be an indication for
synergistic effects. The results validated Dxr as a target for FSM as when the expression of
the dxr gene was decreasing, the FSM MIC was going down as well showing that there is a
clear correlation between the levels of the Dxr protein and the effectiveness of the antibiotic
(Table 3). When FSM was tested against strains ispDara
and ispFara
there was no change in the
MIC compared to the one of a wild-type E. coli strain, indicating that that there is no
synergistic effect between targeting Dxr and these two proteins. Conclusions for strains
ispGara
and ispHara
cannot be drawn by this assay because the strains did not grow in low
levels of arabinose (due lack of IspG and IspH production). Surprisingly, there was one strain
(dxsara
) that gave lower FSM MIC values as the arabinose concentration was decreasing,
starting with a wild-type E. coli MIC of 128 mg/L and reaching a MIC of 4 mg/L in media
with the lowest arabinose concentration. Dxs is the first essential enzyme of the MEP
pathway, converting pyruvate and G3P to 1-deoxy-D-xylulose 5-phosphate (DXP), which is
then used as a substrate by Dxr. A reduction in the expression levels of the dxs gene causes
less production of the Dxs enzyme, which in turn generates less DXP. Lower levels of DXP
reduce the turnover rate of DXP to MEP by Dxr protein and thus a lower Fosmidomycin
dosage is required to further inhibit the enzyme’s activity. These results indicate that the
development of a combinatory therapy targeting Dxs and Dxr could be a promising strategy.
When antibiotics are used frequently, some of the bacteria can acquire resistance by
using three main mechanisms. One way to resist the effects of the drug is to inhibit its action,
for example by expressing efflux pumps, which transport the antibiotic outside of the cell
(69). Alternatively, bacteria can modify the drug target so that it is not recognizable by the
antibiotic anymore (70). A third way to gain resistance is by finding bypass mechanisms, for
instance amplification or activation of genes, that overcome the effect of the drug (71). Since
ispG and ispH genes were found to be promising drug targets during this study and
considering the fact that the strains were the only ones that could not grow in media
containing glucose, mutants were selected to evaluate the type of the acquired mutation. This
assay cannot select for mutations that inhibit the antibiotic or alter the drug target because
antibiotic effects are only mimicked. Two types of mutations were potentially expected: (i)
Mutations that bypass the negative effect on growth, and (ii) mutations that overcome the
gene repression by the araBAD promoter. All the ispG and ispH mutants that were selected on
glucose plates carried point mutations in the araC gene (Table 4). Some mutations were
22
repetitive showing that the nucleotide changes in this gene were not random but specific. The
araC gene encodes for a protein, which acts as a regulator of the araBAD operon. In the
absence of arabinose from the media, the AraC protein forms a dimer that binds to the distant
regulatory DNA sites I1 and O2 and causes the formation of a loop. This structure inhibits the
RNA polymerase from binding to the araBAD promoter and the genes are not transcribed.
When arabinose is added in the media, it binds to the AraC protein dimer, changing its
formation and causing the loop to move to the adjacent I1 and I2 sites. The RNA polymerase is
then free to bind to the promoter and transcribe the genes of the operon (72). The point
mutations that occurred in the araC gene have been shown to modify the structure of the
protein, leading to a constitutive araBAD promoter (62). With this way both strains could
survive and grow in the presence of glucose. A phenotype that is caused by a small number of
specific point mutations generally has a mutation rate of ~ 10-10
per cell/generation (73). It
can therefore be assumed that there is no other more frequent way of altering the growth
inhibition since araC mutations are present in all the sequenced mutants. However, the
existence of a bypassing mechanism with a frequency lower than 10-10
per cell/generation is
possible, but it cannot be demonstrated in this case as the constitutive mutations are preferred.
The urgent need for the discovery of novel antibiotics has become the center of
attention of the scientific world for many decades since antibiotic resistance is increasing
dramatically. Biochemical pathways that are essential for the bacteria are considered to be
attractive drug targets and both the MEP and the NAD pathways that were explored during
this study belong to this category. Especially the MEP pathway has been explored more
thoroughly by many studies since its unique for the bacteria and is absent from humans (6).
However, apart from Fosmidomycin, which targets the Dxr enzyme, no other antibiotic has
been discovered for the other genes of the pathway. During this study, three genes of the MEP
(dxs, ispG, ipsH) and one gene (nadK) of the NAD pathway were demonstrated to be critical
for the bacterial growth and survival. In addition, the findings suggest that a combination
therapy targeting Dxs and Dxr at the same time can have a better outcome than a mono-
therapy. It is therefore proposed that more research should be conducted to identify inhibitors
that block the action of the these four essential genes and this might be a step towards the
discovery of a new, life-saving drug.
ACKNOWLEDGEMENTS
I would like to express my gratitude to Prof. Diarmaid Hughes for letting me perform my
thesis in his laboratory (Department of Medical Biochemistry and Microbiology, Uppsala
University) and for the help I received throughout the project. I also owe a special thanks to
Dr. Gerrit Brandis for making this thesis possible and for all the guidance and support that he
gave me during these six months of the project. Finally, I would like to thank Dr. Sha Cao for
her help and ideas.
23
REFERENCES
1. World Health Organization. Antimicrobial resistance: global report on surveillance. 2014.
Available from:
http://www.who.int/drugresistance/documents/surveillancereport/en .
2. Bach T, Rohmer M. Isoprenoid Synthesis in Plants and Microorganisms. New York, NY:
Springer; 2013.
3. Pérez-Gil J, Rodríguez-Concepción M. Metabolic plasticity for isoprenoid biosynthesis in
bacteria. Biochemical journal. 2013;452(1):19-25.
4. Rohmer M, Knani M, Simonin P, Sutter B, Sahm H. Isoprenoid biosynthesis in bacteria: a
novel pathway for the early steps leading to isopentenyl diphosphate. Biochemical
Journal. 1993;295(2):517-524.
5. Heuston S, Begley M, Gahan C, Hill C. Isoprenoid biosynthesis in bacterial pathogens.
Microbiology. 2012;158(Pt_6):1389-1401.
6. Lange B, Rujan T, Martin W, Croteau R. Isoprenoid biosynthesis: The evolution of two
ancient and distinct pathways across genomes. Proceedings of the National Academy of
Sciences. 2000;97(24):13172-13177.
7. Wang X, Dowd C. The Methylerythritol Phosphate Pathway: Promising Drug Targets in
the Fight against Tuberculosis. ACS Infectious Diseases. 2018;.
8. Proteau P. 1-Deoxy-d-xylulose 5-phosphate reductoisomerase: an overview. Bioorganic
Chemistry. 2004;32(6):483-493.
9. Jomaa H. Inhibitors of the Nonmevalonate Pathway of Isoprenoid Biosynthesis as
Antimalarial Drugs. Science. 1999;285(5433):1573-1576
10. Singh N, Cheve G, Avery M, McCurdy C. Targeting the Methyl Erythritol Phosphate
(MEP) Pathway for Novel Antimalarial, Antibacterial and Herbicidal Drug Discovery:
Inhibition of 1-Deoxy-D-Xylulose-5-Phosphate Reductoisomerase (DXR) Enzyme.
Current Pharmaceutical Design. 2007;13(11):1161-1177
11. Brown A, Parish T. Dxr is essential in Mycobacterium tuberculosis and fosmidomycin
resistance is due to a lack of uptake. BMC Microbiology. 2008;8(1):78.
12. Armstrong C, Meyers D, Imlay L, Freel Meyers C, Odom A. Resistance to the
Antimicrobial Agent Fosmidomycin and an FR900098 Prodrug through Mutations in the
Deoxyxylulose Phosphate Reductoisomerase Gene (dxr). Antimicrobial Agents and
Chemotherapy. 2015;59(9):5511-5519.
13. Sauret-Güeto S, Urós E, Ibáñez E, Boronat A, Rodríguez-Concepción M. A mutant
pyruvate dehydrogenase E1 subunit allows survival of Escherichia coli strains defective in
1-deoxy-d-xylulose 5-phosphate synthase. FEBS Letters. 2006;580(3):736-740.
14. Perez-Gil J, Uros E, Sauret-Güeto S, Lois L, Kirby J, Nishimoto M et al. Mutations in
Escherichia coli aceE and ribB Genes Allow Survival of Strains Defective in the First
Step of the Isoprenoid Biosynthesis Pathway. PLoS ONE. 2012;7(8):e43775.
15. Spry C, Kirk K, Saliba K. Coenzyme A biosynthesis: an antimicrobial drug target. FEMS
Microbiology Reviews. 2008;32(1):56-106.
16. Brown GM. The metabolism of pantothenic acid. J Biol Chem. 1959;234:370–378
17. Jackowski S. Biosynthesis of pantothenic acid and coenzyme A. In: Neidhardt FC, Curtiss
R, Gross CA, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff W, Riley M,
Schaechter M, Umbarger HE, editors. Escherichia coli and Salmonella typhimurium:
cellular and molecular biology.American Society for Microbiology; Washington, D.C.:
1996. pp. 687–694
18. Kurtov D, Kinghorn J. The Aspergillus nidulans panB gene encodes ketopantoate
hydroxymethyltransferase, required for biosynthesis of pantothenate and Coenzyme A.
Molecular and General Genetics MGG. 1999;262(1):115-120.
19. Gerdes S, Scholle M, D'Souza M, Bernal A, Baev M, Farrell M et al. From Genetic
Footprinting to Antimicrobial Drug Targets: Examples in Cofactor Biosynthetic
Pathways. Journal of Bacteriology. 2002;184(16):4555-4572.
24
20. Dunn S.D., Snell E.E. Isolation of temperature-sensitive pantothenate kinase mutants of
Salmonella typhimurium and mapping of the coaA gene. Journal of Bacteriology.
1979;140(3):805-808.
21. Vallari D, Rock C. Isolation and characterization of temperature-sensitive pantothenate
kinase (coaA) mutants of Escherichia coli. Journal of Bacteriology. 1987;169(12):5795-
5800.
22. Calder R. B., Williams R.S, Ramaswamy G., Rock C.O., Campbell E., Unkles S.E,
Kinghorn J.R, Jackowski S. Cloning and characterization of a eukaryotic pantothenate
kinase gene (panK) from Aspergillus nidulans. J. Biol. Chem. 1999;274(4):2014-2020
23. Hong B, Yun M, Zhang Y, Chohnan S, Rock C, White S et al. Prokaryotic Type II and
Type III Pantothenate Kinases: The Same Monomer Fold Creates Dimers with Distinct
Catalytic Properties. Structure. 2006;14(8):1251-1261.
24. Jackowski S, Rock CO. Regulation of coenzyme A biosynthesis. Journal of Bacteriology.
1981; 148(3):926-32.
25. Reddy B, Landge S, Ravishankar S, Patil V, Shinde V, Tantry S et al. Assessment of
Mycobacterium tuberculosis Pantothenate Kinase Vulnerability through Target
Knockdown and Mechanistically Diverse Inhibitors. Antimicrobial Agents and
Chemotherapy. 2014;58(6):3312-3326.
26. Strauss E, Kinsland C, Ge Y, McLafferty F, Begley T. Phosphopantothenoylcysteine
Synthetase from Escherichia coli. Identification and characterization of the last
unidentified coenzyme A biosynthetic enzyme in bacteria. Journal of Biological
Chemistry. 2001;276(17):13513-13516.
27. Daugherty M, Polanuyer B, Farrell M, Scholle M, Lykidis A, de Crécy-Lagard V et al.
Complete Reconstitution of the Human Coenzyme A Biosynthetic Pathway via
Comparative Genomics. Journal of Biological Chemistry. 2002;277(24):21431-21439.
28. Patrone J, Yao J, Scott N, Dotson G. Selective Inhibitors of Bacterial
Phosphopantothenoylcysteine Synthetase. Journal of the American Chemical Society.
2009;131(45):16340-16341.
29. Geerlof A, Lewendon A, Shaw W. Purification and Characterization of
Phosphopantetheine Adenylyltransferase from Escherichia coli. Journal of Biological
Chemistry. 1999;274(38):27105-27111.
30. Aghajanian S, Worrall DM. Identification and characterization of the gene encoding the
human phosphopantetheine adenylyltransferase and dephospho-CoA kinase bifunctional
enzyme (CoA synthase). Biochem J. 2002; 365:13–18
31. de Jonge B, Walkup G, Lahiri S, Huynh H, Neckermann G, Utley L et al. Discovery of
Inhibitors of 4′-Phosphopantetheine Adenylyltransferase (PPAT) To Validate PPAT as a
Target for Antibacterial Therapy. Antimicrobial Agents and Chemotherapy.
2013;57(12):6005-6015.
32. Mishra P, Park PK, Drueckhammer DG. Identification of yacE (coaE) as the structural
gene for dephosphocoenzyme A kinase in Escherichia coli K-12. J Bacteriol. 2001;
183:2774–2778.
33. Silverman Richard B. The Organic Chemistry of Enzyme Catalyzed Reactions. Analytical
Biochemistry. 2001; 291(1):172.
34. Honjo T, Nishizuka Y, Hayaishi O. Diphtheria toxin-dependent adenosine diphosphate
ribosylation of aminoacyl transferase II and inhibition of protein synthesis. J. Biol.
Chem. 1968;243(12):3553–3555.
35. Singleton M, Håkansson K, Timson D, Wigley D. Structure of the adenylation domain of
an NAD+-dependent DNA ligase. Structure. 1999;7(1):35-42.
36. Bender DA, Olufunwa R. Utilization of tryptophan, nicotinamide and nicotinic acid as
precursors for nicotinamide nucleotide synthesis in isolated rat liver cells. Br J Nutr
1988;59:279–287.
37. Seifert J, Kunz N, Flachmann R, Läufer A, Jany K, Gassen H. Expression of the E. coli
nadB Gene and Characterization of the Gene Product L-Aspartate Oxidase. Biological
Chemistry Hoppe-Seyler. 1990;371(1):239-248.
25
38. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M et al. Construction of
Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.
Molecular Systems Biology. 2006;2(1).
39. Osterman AL, Begley TP. A subsystems-based approach to the identification of drug
targets in bacterial pathogens. Prog Drug Res. 2007;64:133-170.
40. Han S, Forman M, Loulakis P, Rosner M, Xie Z, Wang H et al. Crystal Structure of
Nicotinic Acid Mononucleotide Adenylyltransferase from Staphyloccocus aureus:
Structural Basis for NaAD Interaction in Functional Dimer. Journal of Molecular Biology.
2006;360(4):814-825.
41. Sershon V, Santarsiero B, Mesecar A. Kinetic and X-Ray Structural Evidence for
Negative Cooperativity in Substrate Binding to Nicotinate Mononucleotide
Adenylyltransferase (NMAT) from Bacillus anthracis. Journal of Molecular Biology.
2009;385(3):867-888.
42. Zhang H, Zhou T, Kurnasov O, Cheek S, Grishin N, Osterman A. Crystal Structures of E.
coli Nicotinate Mononucleotide Adenylyltransferase and Its Complex with Deamido-
NAD. Structure. 2002;10(1):69-79.
43. Sorci L, Cimadamore F, Scotti S, Petrelli R, Cappellacci L, Franchetti P et al. Initial-Rate
Kinetics of Human NMN-Adenylyltransferases: Substrate and Metal Ion Specificity,
Inhibition by Products and Multisubstrate Analogues, and Isozyme Contributions to
NAD+Biosynthesis. Biochemistry. 2007;46(16):4912-4922.
44. Zhou T, Kurnasov O, Tomchick DR, Binns DD, Grishin NV, Marquez VE, Osterman AL,
Zhang H. Structure of human nicotinamide/nicotinic acid mononucleotide
adenylyltranferase. Basis for the dual substrate specificity and activation of the oncolytic
agent tiazofurin. J Biol Chem. 2002;277:13148-13154.
45. Sorci L, Pan Y, Eyobo Y, Rodionova I, Huang N, Kurnasov O et al. Targeting NAD
Biosynthesis in Bacterial Pathogens: Structure-Based Development of Inhibitors of
Nicotinate Mononucleotide Adenylyltransferase NadD. Chemistry & Biology.
2009;16(8):849-861.
46. Allibert P, Willison JC, Vignais PM. Complementation of nitrogen-regulatory (ntr-like)
mutations in Rhodobacter capsulatus by an Escherichia coli gene: Cloning and sequencing
of the gene and characterization of the gene product. J Bacteriol. 1987;169: 260–271.
47. Nessi C, Albertini AM, Speranza ML, Galizzi A. The outB gene of Bacillus subtilis codes
for NAD synthetase. J Biol Chem. 1995;270: 6181–6185.
48. Zerez CR, Wong MD, Tanaka KR. Partial purification and properties of nicotinamide
adenine dinucleotide synthetase from human erythrocytes: Evidence that enzyme activity
is a sensitive indicator of lead exposure. Blood. 1990;75: 1576–1582.
49. Bellinzoni M, Buroni S, Pasca MR, Guglierame P, Arcesi F, De Rossi E, Riccardi G.
Glutamine amidotransferase activity of NAD+ synthetase from Mycobacterium
tuberculosis depends on an amino-terminal nitrilase domain. Res Microbiol.
2005;156: 173–177.
50. Hara N, Yamada K, Terashima M, Osago H, Shimoyama M, Tsuchiya M. Molecular
Identification of Human Glutamine- and Ammonia-dependent NAD Synthetases. Journal
of Biological Chemistry. 2003;278(13):10914-10921.
51. Velu S, Cristofoli W, Garcia G, Brouillette C, Pierson M, Luan C et al. Tethered Dimers
as NAD Synthetase Inhibitors with Antibacterial Activity. Journal of Medicinal
Chemistry. 2003;46(15):3371-3381.
52. Moro W, Yang Z, Kane T, Brouillette C, Brouillette W. Virtual screening to identify lead
inhibitors for bacterial NAD synthetase (NADs). Bioorganic & Medicinal Chemistry
Letters. 2009;19(7):2001-2005.
53. Wang X, Ahn Y, Lentscher A, Lister J, Brothers R, Kneen M et al. Design, synthesis, and
evaluation of substituted nicotinamide adenine dinucleotide (NAD + ) synthetase
inhibitors as potential antitubercular agents. Bioorganic & Medicinal Chemistry Letters.
2017;27(18):4426-4430.
26
54. Garavaglia S, Raffaelli N, Finaurini L, Magni G, Rizzi M. A Novel Fold Revealed by
Mycobacterium tuberculosis NAD Kinase, a Key Allosteric Enzyme in NADP
Biosynthesis. Journal of Biological Chemistry. 2004;279(39):40980-40986.
55. Sakuraba H, Kawakami R, Ohshima T. First Archaeal Inorganic Polyphosphate/ATP-
Dependent NAD Kinase, from Hyperthermophilic Archaeon Pyrococcus horikoshii:
Cloning, Expression, and Characterization. Applied and Environmental Microbiology.
2005;71(8):4352-4358
56. Kawai S, Mori S, Mukai T, Suzuki S, Yamada T, Hashimoto W et al. Inorganic
Polyphosphate/ATP-NAD Kinase of Micrococcus flavus and Mycobacterium tuberculosis
H37Rv. Biochemical and Biophysical Research Communications. 2000;276(1):57-63.
57. Lerner F, Niere M, Ludwig A, Ziegler M. Structural and Functional Characterization of
Human NAD Kinase. Biochemical and Biophysical Research Communications.
2001;288(1):69-74.
58. Gelin M, Poncet-Montange G, Assairi L, Morellato L, Huteau V, Dugué L et al. Screening
and In Situ Synthesis Using Crystals of a NAD Kinase Lead to a Potent
Antistaphylococcal Compound. Structure. 2012;20(6):1107-1117
59. Paoletti J, Assairi L, Gelin M, Huteau V, Nahori M, Dussurget O et al. 8-Thioalkyl-
adenosine derivatives inhibit Listeria monocytogenes NAD kinase through a novel
binding mode. European Journal of Medicinal Chemistry. 2016;124:1041-1056.
60. Gay P, Le Coq D, Steinmetz M, Berkelman T, Kado CI. Positive selection procedure for
entrapment of insertion sequence elements in gram-negative bacteria. Journal of
bacteriology. 1985;164(2):918–21. pmid:2997137
61. Näsvall J. Direct and Inverted Repeat stimulated excision (DIRex): Simple, single-step,
and scar-free mutagenesis of bacterial genes. PLOS ONE. 2017;12(8):e0184126.
62. Dirla S., Chien J. and Schleif R. (2009). Constitutive Mutations in the Escherichia coli
AraC Protein. Journal of Bacteriology, 191(8), pp.2668-2674.
63. Miller B, Heuser T, Zimmer W. Functional involvement of a deoxy-D-xylulose 5-
phosphate reductoisomerase gene harboring locus of Synechococcus leopoliensis in
isoprenoid biosynthesis. FEBS Letters. 2000;481(3):221-226.
64. Brown A, Eberl M, Crick D, Jomaa H, Parish T. The Non mevalonate Pathway of
Isoprenoid Biosynthesis in Mycobacterium tuberculosis Is Essential and Transcriptionally
Regulated by Dxs. Journal of Bacteriology. 2010;192(9):2424-2433.
65. Masini, T. and Hirsch, A. (2014). Development of Inhibitors of the 2C-Methyl-d-
erythritol 4-Phosphate (MEP) Pathway Enzymes as Potential Anti-Infective
Agents. Journal of Medicinal Chemistry, 57(23), pp.9740-9763.
66. Masini, T., Kroezen, B. and Hirsch, A. (2013). Druggability of the enzymes of the non-
mevalonate-pathway. Drug Discovery Today, 18(23-24), pp.1256-1262.
67. Greenwood D, Fosfomycin and Fosmidomycin. In: Finch R, Greenwood D, Norrby S,
Whitley R. Antibiotic and Chemotherapy. 9th ed. 2012. p. 259-261.
68. Poe, M. (1976). Antibacterial synergism: a proposal for chemotherapeutic potentiation
between trimethoprim and sulfamethoxazole. Science, 194(4264), pp.533-535.
69. McMurry L, Petrucci R, Levy S. Active efflux of tetracycline encoded by four genetically
different tetracycline resistance determinants in Escherichia coli. Proceedings of the
National Academy of Sciences. 1980;77(7):3974-3977.
70. Haenni M, Galofaro L, Ythier M, Giddey M, Majcherczyk P, Moreillon P et al. Penicillin-
Binding Protein Gene Alterations in Streptococcus uberis Isolates Presenting Decreased
Susceptibility to Penicillin. Antimicrobial Agents and Chemotherapy. 2010;54(3):1140-
1145.
71. Sandegren L, Andersson D. Bacterial gene amplification: implications for the evolution of
antibiotic resistance. Nature Reviews Microbiology. 2009;7(8):578-588.
72. Hamilton E, Lee N. Three binding sites for AraC protein are required for autoregulation of
araC in Escherichia coli. Proceedings of the National Academy of Sciences.
1988;85(6):1749-1753.
73. Drake J. A constant rate of spontaneous mutation in DNA-based microbes. Proceedings of
the National Academy of Sciences. 1991;88(16):7160-7164.
27
Supplementary Material
Name Primer sequence (5’→3’) Type dfp_fw ACTGTTTCTCCATACCCGTTTTTTTGGATGGAGTGAAACGATGAGCCTGGCCGG
TAAAAA
A
dfp_rv AGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATTAACGTCGATTTTT
TTCAT
A
coaD_fw ACTGTTTCTCCATACCCGTTTTTTTGGATGGAGTGAAACGATGCAAAAACGGGC
GATTTA
A
coaD_rv AGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCACTACGCTAACTTCGC
CATCA
A
coaE_fw ACTGTTTCTCCATACCCGTTTTTTTGGATGGAGTGAAACGATGAGGTATATAGTT
GCCTT
A
coaE_rv AGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATTACGGTTTTTCCTG
TGAGA
A
nadD_fw ACTGTTTCTCCATACCCGTTTTTTTGGATGGAGTGAAACGATGAAATCTTTACAG
GCTCT
A
nadD_rv AGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATCAGCGATACAAGCC
TTGTT
A
nadE_fw ACTGTTTCTCCATACCCGTTTTTTTGGATGGAGTGAAACGATGACATTGCAACA
ACAAAT
A
nadE_rv AGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATTACTTTTTCCAGAA
ATCAT
A
nadK_fw ACTGTTTCTCCATACCCGTTTTTTTGGATGGAGTGAAACGATGAATAATCATTTC
AAGTG
A
nadK_rv AGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCATTAGAATAATTTTTT
TGACC
A
Ddfp_fw AAAAATCATCATGAGCCTGGCCGGTAAAAAAATCGTTCTCCCGCTCGATCCGGT
GCGTTAGTGTAGGCTGGAGCTGCTTC
B
Ddfp_rv CGGAGCTGTGATTAGAGATATAACGCACCGGATCGAGCGGGAGAACGATTTTT
TTACCGGGTGTAGGCTGGAGCTGCTTC
B
DcoaD_fw TGAGGTTGTTATGCAAAAACGGGCGATTTATCCGGGTACTCATCAGGCGCTGAT
GGCGAAGTGTAGGCTGGAGCTGCTTC
B
DcoaD_rv GGCATAAACGCTACGCTAACTTCGCCATCAGCGCCTGATGAGTACCCGGATAAA
TCGCCCGTGTAGGCTGGAGCTGCTTC
B
DcoaE_fw TGGGTCTGCATTACGGTTTTTCCTGTGAGACAAACTGCGAGCCTCCCGTTAAGG
CAACTAGTGTAGGCTGGAGCTGCTTC
B
DcoaE_rv AATATAAATTATGAGGTATATAGTTGCCTTAACGGGAGGCTCGCAGTTTGTCTC
ACAGGAGTGTAGGCTGGAGCTGCTTC
B
DnadD_fw ACGACAGGTATCAGCGATACAAGCCTTGTTGGTTAATGTAGCCGCCAAACAGA
GCCTGTAGTGTAGGCTGGAGCTGCTTC
B
DnadD_rv GACGGTTGATATGAAATCTTTACAGGCTCTGTTTGGCGGCTACATTAACCAACA
AGGCTTGTGTAGGCTGGAGCTGCTTC
B
DnadE_fw GAGGGGTTCAATGACATTGCAACAACAAATAATAAAGGCGACCGTTTTCGATG
ATTTCTGGTGTAGGCTGGAGCTGCTTC
B
DnadE_rv GTGCAAATTATTACTTTTTCCAGAAATCATCGAAAACGGTCGCCTTTATTATTTG
TTGTTGTGTAGGCTGGAGCTGCTTC
B
DnadK_fw CCTCGGAAAAATGAATAATCATTTCAAGTGTATTGGCATTAAGCTCGGCTGGTC
AAAAAAGTGTAGGCTGGAGCTGCTTC
B
DnadK_rv TGGCGTAAAATTAGAATAATTTTTTTGACCAGCCGAGCTTAATGCCAATACACT
TGAAATGTGTAGGCTGGAGCTGCTTC
B
PCR dfp_fw TTTTTCACCTTCACCTCCTT C
PCR dfp_rv AATATGAATCGCCAGCCC C
PCR coaD_fw GGGCCGCATACTTTTAACT C
PCR coaD_rv GTGTTGCTGCGTTCGATT C
PCR coaE_fw GCCGGTCAAGTTCTTTCA C
PCR coaE_rv ACGCTATCATACGCACTAAT C
PCR nadD_fw CCAGATCAAAGGAAACACCA C
PCR nadD_rv AACGGAACTCACCCTCAAA C
PCR nadE_fw TCTTGTTCATATTCCGTCCT C
PCR nadE_rv CTCCGAATGCTGGTTATCT C
PCR nadK_fw GGGGATCAGTTTCAGGGT C
PCR nadK_rv CCGGTCTCGCCAGTTATT C
HP580 CACGGCAGAAAAGTCCACATTG D,E
28
A: primers used to insert the gene after the ara promoter
B: primers used for the deletion of the gene in the original position (DIRex method)
C: primers used to verify the deletion of the original gene
D: universal primers for the amplification of the ara location
E: primers for the amplification and sequencing of the araC and the ara promoter
F: primers used for the yfp-kan cassette fusions
Supplementary Table 1: List of the primers used for insertions and deletions of genes as well as for
sequencing.
HP581 ATAAAACCTGCCTGCGCCAC D,E
araC_fw AAAAAGCGTCAGGTAGGA E
araC_rv CCAGAAAGGCCACCAACA E
dxs yfp-kan fw CGCTGGTATGGAAGCCAAAATCAAGGCCTGGCTGGCATAATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
dxr yfp-kan fw TGAAGTCGCCAGAAAAGAGGTGATGCGTCTCGCAAGCTGATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
ispD yfp-kan fw GTTTTACCTCACCCGAACCATCCATCAGGAGAATACATAATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
ispE yfp-kan fw AGGCGCTAATCTTTCCCCATTGCACAGAGCCATGCTTTAATACAGAAAGAGGAG
AAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
ispF yfp-kan fw CTGTGAAGCGGTGGCGCTACTCATTAAGGCAACAAAATGATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
ispG yfp-kan fw CGAAGCGCGTCGAATTGACGTTCAGCAGGTTGAAAAATAATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
ispH yfp-kan fw GCCGAAAGAGCTGCGTGTCGATATTCGTGAAGTCGATTAATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
nadD yfp-kan fw GGTACTGACTTACATTAACCAACAAGGCTTGTATCGCTGATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
nadE yfp-kan fw TCCGCCAATTACCGTTTTCGATGATTTCTGGAAAAAGTAATACAGAAAGAGGAG
AAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
nadK yfp-kan fw ATTAAGCACCAAGCTCGGCTGGTCAAAAAAATTATTCTAATACAGAAAGAGGA
GAAATACTAGATGGTTAGCAAGGGCGAAGAACT
F
yfp-kan rv AGCCTGGTTTCGTTTGATTGGCTGTGGTTTTATACAGTCACATATGAATATCCTC
CTTAG
F
29
Supplementary Figure 1: Results of the spot assay for strains of the MEP and NAD pathways. No
antibacterial effect was observed for strains ispDara
, ispFara
, nadDara
and nadEara
but smaller colonies
were obtained for the first two as the arabinose concentration was decreasing. A clear inhibition of
bacterial growth at lower arabinose concentrations was noticed for strains dxsara
, ispGara
and nadKara
.