HNF4α Regulates the Expression of Pancreatic β-Cell Genes
Implicated in Glucose Metabolism and Nutrient-Induced Insulin
Secretion
Haiyan Wang, Pierre Maechler, Peter A. Antinozzi, Kerstin A. Hagenfeldt, and Claes
B. Wollheim*
Running Title: HNF4α Regulated β-Cell Gene Expression and Insulin Secretion
*To whom correspondence should be addressed: Claes B. Wollheim
Division de Biochimie Clinique
Départment de Médecine interne
Centre Médical Universitaire
CH-1211 Geneva 4
Switzerland
Phone: (41 22) 702 5548
1
Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on August 30, 2000 as Manuscript M006612200 by guest on February 26, 2020
http://ww
w.jbc.org/
Dow
nloaded from
Fax: (41 22) 702 5543
E-mail: [email protected]
2
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
Mutations in the HNF4α gene are associated with the subtype 1 of maturity-onset
diabetes of the young (MODY1), which is characterized by impaired insulin secretory
response to glucose in pancreatic β-cells. HNF4α is a transcription factor critical for
liver development and hepatocyte-specific gene expression. However, the role of
HNF4α in the regulation of pancreatic β-cell gene expression and its correlation with
metabolism-secretion coupling has not previously been investigated. The reverse
tetracycline-dependent transactivator system was employed to achieve tightly
controlled and rapidly inducible expression of both wild type (WT) and dominant-
negative mutant (DN) of HNF4α in INS-1 cells. The induction of WT-HNF4α
resulted in a left-shift in glucose-stimulated insulin secretion, whereas DN-HNF4α
selectively impaired nutrient-stimulated insulin release. Induction of DN-HNF4α
also caused defective mitochondrial function substantiated by reduced [14C]-
pyruvate oxidation, attenuated substrate-evoked mitochondrial membrane
hyperpolarisation and blunted nutrient-generated cellular ATP production.
Quantitative evaluation of HNF4α-regulated pancreatic β-cell gene expression
revealed altered mRNA levels of insulin, glucose transporter-2, L-pyruvate kinase,
aldolase B, 2-oxoglutarate dehydrogenase E1 subunit, and mitochondrial uncoupling
protein-2. The patterns of HNF4α regulated gene expression are strikingly similar to
that of its down-stream transcription factor HNF1α. Indeed HNF4α changed the
HNF1α mRNA levels and HNF1α promoter luciferase activity through altered
HNF4α binding. These results demonstrate the importance of HNF4α in β-cell metabolism-
secretion coupling.
3
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
The hepatocyte nuclear factor 4α (HNF4α), a transcription factor of the nuclear
hormone receptor superfamily, is expressed in liver, kidney, gut and pancreatic islets
(1-3). Mutations in the human HNF4α gene lead to maturity onset diabetes of the
young subtype I (MODY I), which is characterized by autosomal dominant
inheritance and impaired glucose-stimulated insulin secretion from pancreatic β-cells
(4-6). These MODY1 mutations located in various domains of the HNF4α protein
result in defective function of the transcription factor (6). The clinical phenotype of
MODY1 patients is indistinguishable from that of MODY3 patients who carry
mutations in the HNF1α gene (5, 6). HNF4α acts upstream of HNF1α in a
transcriptional cascade that drives liver-specific gene expression and hepatocyte
differentiation (7-9). A naturally occurring mutation in the HNF4α binding site of the
HNF1α promoter identified in a MODY3 family (10) suggests that the transcriptional
hierarchy could also be involved in pancreatic β-cell gene expression and function.
HNF4α defines the expression of liver-specific genes encoding apolipoproteins,
serum factors, cytochrome P450 isoforms, and proteins involved in the metabolism of
glucose, fatty acids, and amino acids (reviewed in reference 11). However, clinical
characterization of MODY1 subjects reveals that the primary defect is impaired
glucose-stimulated insulin secretion from pancreatic β-cells rather than liver
dysfunction (5, 12-14). Unfortunately, little is known as to how HNF4α regulates β-
cell restricted gene expression and glucose-metabolism, and associated insulin
secretion. Targeted disruption of the hnf4α gene results in defective gastrulation of
mouse embryos due to dysfunction of the visceral endoderm (15). This early
embryonic lethality prevents further analysis of the HNF4α function in pancreatic β-
cells. The precise role of HNF4α in pancreatic β-cells would best be examined by
4
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
conditional β-cell specific deletion of the mouse hnf4α gene. Another alternative is to
up- and down-regulate HNF4α function in pancreatic β-cell lines through gene
manipulation.
In the present study, the wild type HNF4α (WT-HNF4α) and its dominant-
negative mutant (DN-HNF4α) could be induced in INS-1 cells under tight control of
the reverse tetracycline-dependent transactivator (16). DN-HNF4α represents the
epitope myc-tagged truncated HNF4α mutant protein lacking the first 111 amino
acids (myc∆111HNF4α) (17). The HNF4α protein consists of an N-terminal ligand-
independent transactivation domain (amino acids 1-24), a DNA binding domain
containing two zinc fingers (amino acids 51-117), and a large hydrophobic portion
(amino acids 163-368) composed of the dimerization, ligand binding, cofactor
binding, and ligand-dependent transactivation domain (18, 19). DN-HNF4α
therefore suppresses the endogenous WT-HNF4α transcriptional activity by the
formation of heterodimers lacking DNA binding capacity (17). We have investigated
in a quantitative manner the consequences of altered HNF4α function on β-cell
specific expression of genes implicated in glucose metabolism and insulin secretion.
This allowed us to elucidate the molecular basis and HNF4α-target genes responsible
for impaired metabolism-secretion coupling in β-cells deficient in HNF4α function.
EXPERIMENTAL PROCEDURES
Generation of stable cell lines-The rat insulinoma INS-1 cell line-derived stable
clones were cultured in RPMI 1640 in 11 mM glucose, unless indicated otherwise
(20). The establishment of the first-step stable clone INS-r3, which expresses the
5
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
reverse tetracycline-dependent transactivator, was reported previously (21). Plasmids
used in the secondary stable transfection were constructed by subcloning the cDNAs
encoding the rat WT-HNF4α (a generous gift from Dr. Darnell Jr., New York) and
DN-HNF4α into the expression vector PUHD10-3 (a kind gift from Dr. H. Bujard,
University Heidelberg, Germany). DN-HNF4α was PCR amplified from WT-
HNF4α using the following primers: ctaggatccttccgggctggcatgaagaaagaagcc;
ccagaattcctgcagatggttgtcctttag. The PCR fragment was subcloned into pcDNA3.1myc
(Invitrogen, Netherlands) and sequenced. Transfection, clone selection, and screening
procedures were described previously (21).
Immunoblot-Immunoblotting procedures were performed as described previously
using enhanced chemiluminescence (Pierce, Illinois) for detection (22). Dilutions for
antibody against HNF4α, (kindly supplied by Dr. F. M. Sladek, University of
Califernia, Riverside, CA) and anti-myc-tag (9E 10) in myeloma SP2/0 culture
medium were 1:6,000 and 1:10.
Insulin secretion and cellular insulin content-Cells in 24-well dishes were cultured in
2.5 mM glucose medium with or without indicated doses of doxycycline for 14 or 48
h. Insulin secretion was measured over a period of 30 min, in Krebs-Ringer-
Bicarbonate-HEPES buffer (KRBH, 140 mM NaCl, 3.6 mM KCl, 0.5 mM
NaH2PO4, 0.5 mM MgSO4, 1.5 mM CaCl2, 2 mM NaHCO3, 10 mM HEPES, 0.1% BSA)
containing indicated stimulators. Insulin content was determined after extraction with
acid ethanol following the procedures of Asfari et al. (20). Insulin was detected by
radioimmunoassay using rat insulin as standard (22).
6
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
Intracellular ATP-Cells in 6-well dishes were cultured in 2.5 mM glucose medium
with or without 500 ng/ml doxycycline for 48 h. The production of ATP was
measured during 8 min stimulation in KRBH. ATP assay was performed as
previously reported (22).
[14C]-pyruvate oxidation-The production of 14CO2 from [1-14C]-pyruvate or [2-
14C]-pyruvate was measured over 1 h in KRBH containing either 0.05 or 1.0 mM
pyruvate as previously described (23, 24).
Mitochondrial Membrane Potential (∆Ψm)-After a 48 h culture period in 2.5 mM glucose
medium with or without 500 ng/ml doxycycline, cells were trypsinized (0.025%
trypsin, 0.27mM EDTA) and the cell suspension was maintained for 2 h in a spinner
culture with 2.5 mM glucose RPMI1640 plus 1% new born calf serum at 37°C.
Mitochondrial membrane potential (∆Ψm) was measured as described (25). Briefly,
after the spinner culture period, cells were loaded with 10 µg/ml rhodamine-123 (Rh-
123) for 10 min at 37°C. After centrifugation, the cells were resuspended and
transferred to the fluorimeter cuvette at 37°C with gentle stirring in an LS-50B
fluorimeter (Perkin-Elmer, Bucks, England) and fluorescence, excited at 490 nm, was
measured at 530 nm.
Total RNA isolation and Northern blotting-Cells in 10-cm dishes were cultured in
7
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
2.5 mM glucose medium with or without 500 ng/ml doxycycline for 14 or 48 h,
followed by an additional 8 h in culture medium with 2.5, 6, 12 and 24 mM glucose.
Total RNA was extracted and blotted to nylon membranes as described previously (22).
The membrane was prehybridized and then hybridized to 32P-labeled random primer
cDNA probes by the technique of Sambrook et al. (26). To ensure equal RNA loading
and even transfer, all membranes were stripped and re-hybridized with "house-
keeping gene" probes such as β-actin or cyclophilin. cDNA fragments used as probes
for L-pyruvate kinase (L-PK), glucose transporter-2 (GLUT-2), glucokinase,
insulin, PDX1, HNF4α, upstream stimulatory factors (USF), c-Jun, and C/EBPβ
mRNA detection were digested from corresponding expression vectors kindly
provided by, respectively, Drs. A. Kahn, B. Thorens, P. B. Iynedjian, J. Philippe, T.
Edlund, J. E. Darnell Jr., M. Sawadogo, W. Schlegel, and U. Schibler. cDNA probes
for rat aldolase B, glyceraldehyde-3 phosphate dehydrogenase (GAPDH),
dimerization cofactor for HNF1α (DcoH), mitochondrial adenine nucleotide
translocator 1 and 2 (ANT1 & ANT2), mitochondrial uncoupling protein-2 (UCP-2),
mitochondrial 2-oxoglutarate dehydrogenase (OGDH) E1 subunit, glutamate
dehydrogenase (GDH), Pax4, Pax6, Nkx2.2, Nkx6.1, Isl1, insulin receptor substrate-
2 (IRS2), cyclin-dependent kinase-4 (Cdk4), and cyclophilin were prepared by RT-
PCR and confirmed by sequencing.
Nuclear extract preparation and electrophoretic mobility-shift assay (EMSA)-Cells in
10-cm dishes were grown in culture medium with or without 500 ng/ml doxycycline
for 48 h. The following double-stranded oligonucleotides were used as probes:
5’GGCTGAAGTCCAAAGTTCAGTCCCTTCGC3’ (8). EMSA procedures including
8
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
conditions for nuclear extract preparation, probe labeling, binding reactions,
unlabeled-probe competition, and antibody supershift were performed as previously
reported (22).
Transient transfection and luciferase assay-The HNF1α gene promoter luciferase
reporter plasmids, WT-HNF1αLuc (wild type) and ∆AHNF1αLuc (HNF4α binding
site deleted), were kindly provided by Dr. N. Miura (Akita University, Japan) (27).
Transient transfection experiments and luciferase reporter enzyme assays were carried
out as previously reported (22).
RESULTS
WT-HNF4α or DN-HNF4α protein was induced in INS-1 cells in a dose- and time-
dependent manner-We have obtained 10 and 8 clones positively expressing WT-
HNF4α and DN-HNF4α, respectively. The clones, designated as WT-HNF4α#28
and DN-HNF4α#26 that displayed highest induction levels of transgene proteins,
were chosen for the present study. The time course and dose-response of doxycycline
effect on WT-HNF4α and DN-HNF4α expression was illustrated in Fig. 1A and Fig.
1B, respectively. WT-HNF4α protein could be induced within a range from 2- to
50-fold above the endogenous protein level (Fig. 1A). Thus, graded overexpression
of WT-HNF4α could be achieved by culturing the WT-HNF4α#28 cells with
varying doses of doxycycline in a defined period of time. Similar induction of DN-
HNF4α protein was detected in the nuclear extracts from DN-HNF4α#26 cells (Fig.
9
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
1B). No leakage of this doxycycline-dependent promoter was observed, since the
expression of DN-HNF4α protein was not detectable in non-induced DN-
HNF4α#26 cells (Fig. 1B). Therefore, the dominant-negative suppression of HNF4α function in
INS-1 cells could be rapidly achieved by culturing the DN-HNF4α#26 cells with a
maximum dose of doxycycline (500 ng/ml).
Effects of WT-HNF4α and DN-HNF4α on insulin secretion-Impaired glucose-
stimulated insulin secretion from pancreatic β-cells is the primary defect causing
hyperglycemia in MODY 1 patients carrying HNF4α mutations. We therefore
examined the consequences of induction of WT-HNF4α and DN-HNF4α on insulin
secretion in INS-1 cells. The graded overexpression of WT-HNF4α led to a left-
shift of glucose-stimulated insulin secretion (Fig. 2A). However, the maximal (above
12 mM) glucose-elicited insulin secretion remained unchanged (Fig. 2A).
Glucose generates ATP and other metabolic coupling factors important for insulin
secretion through glycolysis and mitochondrial oxidation (28). The physiological
insulin secretagogue, leucine, is transported directly into mitochondria to provide
substrates for the tricarboxylic acid (TCA) cycle (28). K+ causes insulin secretion by
depolarisation of the β-cell membrane, resulting in an increase in cytosolic Ca2+
(28). We therefore examined the insulin secretory responses to these three
secretagogues that act at different levels of the signal transduction cascade following
induction of DN-HNF4α. As demonstrated in Fig. 2B, DN-HNF4α selectively
inhibited glucose and leucine stimulated insulin secretion. This could be explained by
defective glucose and leucine metabolism.
10
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
Effects of DN-HNF4α on cellular ATP production and mitochondrial oxidation-To
investigate whether impaired nutrient-evoked insulin secretion is correlated to
defective cellular ATP production, we analysed the impact of DN-HNF4α expression
on the level of ATP generated by glucose and leucine. As shown in Fig. 3A, induction
of DN-HNF4α indeed abolished the ATP generation by glucose and leucine. Since
the mitochondrial substrate leucine failed to generate ATP after induction of DN-
HNF4α, it would seem that HNF4α is required for maintaining normal mitochondrial
function.
To test this hypothesis, we examined the consequences of DN-HNF4α
induction on mitochondrial oxidation of pyruvate. Pyruvate-derived carbons enter
the TCA cycle as either acetyl CoA, catalyzed by pyruvate dehydrogenase, or
oxaloacetate via pyruvate carboxylase. By using pyruvate radiolabled at either the
first or second carbon, the putative defects at various steps in pyruvate metabolism
can be assessed. The radiolabled carbon of [1-14C]pyruvate is lost to CO2 at the
pyruvate dehydrogenase step as pyruvate is converted into acetyl CoA. Alternatively,
if pyruvate enters the TCA cycle via oxaloacetate, the label is lost to CO2 at isocitrate
dehydrogenase within one turn of the cycle. Radiolabled CO2 is generated from [2-
14C] at either OGDH or isocitrate dehydrogenase when pyruvate enters the TCA cycle
as acetyl CoA. Overexpression of DN-HNF4α reduced CO2 formation from [2-
14C] pyruvate by 41 % (Fig. 3B), whereas CO2 formation from [1-14C] pyruvate was
not different between non- and induced conditions (Fig 3C). These results suggest
that the defect in mitochondrial metabolism is not at the point of entry of pyruvate
11
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
into the TCA cycle, rather that the defect appears in reactions within the TCA cycle.
This is in full agreement with the impairment of leucine-stimulation of insulin
secretion since leucine metabolism bypasses pyruvate and enters the TCA cycle solely
as acetyl-CoA. Decreased isocitrate dehydrogenase activity would also be unlikely
since impairment at this step would be observed by both [1-14C] and [2-14C]
pyruvate oxidation. These oxidation experiments suggest that steps following this
reaction beginning with OGDH may be responsible for impaired [2-14C] pyruvate
oxidation.
Effect of DN-HNF4a on mitochondrial membrane potential (∆Ψm) in INS-1 cells-
The ∆Ψm was measured in a suspension of INS-1 cells by monitoring rhodamine-123
fluorescence. In control cells (-Dox) addition of 10 mM glucose (12.5 mM final)
potently hyperpolarized ∆Ψm while 1 µM of the protonophore FCCP depolarized
∆Ψm (Fig. 4A). In cells expressing DN-HNF4α (+Dox), the glucose response was
inhibited by 65% (P<0.02). Impaired hyperpolarization of ∆Ψm was also observed
when the glycolysis was bypassed by stimulating cells with the end product of
glycolysis pyruvate (Fig. 4B), indicating mitochondrial dysfunction. Direct activation
with methyl-succinate of the electron transport chain at complex II resulted in a
diminished response in DN-HNF4α induced cells (Fig. 4C). The amplitude of
complete ∆Ψm depolarization by FCCP was also reduced in cells treated with
doxycycline (-43%; P<0.01), suggesting that the mitochondria were partially
uncoupled by suppression of HNF4α function (Fig. 4D).
12
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
Effects of WT-HNF4α and DN-HNF4α on pancreatic β-cell gene expression-The
expression of genes involved in glucose metabolism (Fig. 5A&B) or in pancreatic β-
cell development and differentiation (Fig. 5C&D) was quantitatively evaluated in
WT-HNF4α#28 (Fig. 5A&C) and DN-HNF4α#26 cells (Fig. 5B&D). As shown in
Fig. 5A, WT-HNF4α mRNA could be induced by 2-, 8-, and 50-fold above the
endogenous level. This graded overexpression of WT-HNF4α resulted in a stepwise
increase in the expression of three glucose responsive genes encoding respectively
GLUT-2, L-PK and aldolase B (Fig. 5A). However, the mRNA level of GAPDH,
which is also responsive to glucose, remained unaltered (Fig. 5A). Induction of WT-
HNF4α also caused incremental expression of OGDH E1 subunit transcript (Fig 5A).
Consistently, The mRNA levels of GLUT-2, aldolase B, L-PK, and OGDH E1
subunit were significantly reduced after induction of DN-HNF4α (Fig. 5B). On the
other hand, induction of DN-HNF4α led to increased UCP-2 mRNA expression (Fig.
5B). Therefore, HNF4α regulates the expression of genes involved in both glycolysis
and mitochondrial metabolism. The profile of HNF4α-targeted genes is strikingly
similar to that of HNF1α (29). HNF4α may regulate the expression of genes
implicated in glucose metabolism through HNF1α function as in hepatocytes (7-9).
Since HNF4α is required for liver development and hepatocyte differentiation (9),
we investigated whether HNF4α regulates the expression of genes important for the
pancreatic β-cell phenotype. Induction of WT-HNF4α (Fig. 5C) or DN-HNF4α
(Fig. 5D) did not alter the expression patterns of PDX1, Pax4, Pax6, NKx2.2,
NKx6.1, and Isl-1, which are necessary for normal pancreatic cell development or
differentiation (30). Moreover, HNF4α did not regulate the mRNA levels of USF, c-
Jun, and C/EBPβ (Fig. 5C&D). The expression of these transcription factors appeared
13
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
to be responsive to glucose (Fig. 5C&D). The expression of another glucose-
responsive transcription factor, DcoH, was slightly affected by induction of WT-
HNF4α but not by expression of DN-HNF4α (Fig. 5C&D), suggesting the
involvement of an indirect mechanism. Both Cdk4 and IRS2 are involved in
pancreatic β-cell development (31, 32), but their expression was not regulated by
HNF4α (Fig 5C&D). Induction of DN-HNF4α for 48 h caused 50% reduction in
insulin mRNA levels (Fig. 5D). This may be secondary to decreased HNF1α function,
since HNF1α is required for insulin gene transcription (29).
HNF4α regulates pancreatic β-cell gene expression through HNF1α function-We
performed EMSA for studying HNF4α binding activity to HNF1α promoter,
luciferase reporter enzyme assay for HNF1α promoter activity, and Northern blotting
for the HNF1α mRNA expression. Nuclear extracts were prepared from WT-
HNF4α#28 and DN-HNF4α#26 cells cultured for 48 h in the presence or absence of 500
ng/ml doxycycline. The murine HNF1α promoter segment, which contains the
HNF4α binding site, was used as probe (8). Induction of WT-HNF4α resulted in a dramatic
increase in the signal density of HNF4α binding (Fig. 6A). On the other hand,
induction of DN-HNF4α almost completely abolished the binding activity of
endogenous HNF4α to the HNF1α promoter (Fig. 6A). DN-HNF4α exerts its
dominant-negative function by forming DN-HNF4α/WT-HNF4α heterodimers that
lack DNA binding capacity (11). The retarded DNA binding complexes
14
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
corresponding to endogenous WT-HNF4α and/or induced transgene WT-HNF4α
homodimers were supershifted by a specific antibody against HNF4α (Fig. 6A).
Consistently, induction of WT-HNF4α resulted in a 2-fold increase in
endogenous HNF1α mRNA level, while DN-HNF4α completely eliminated the
HNF1α expression (Fig. 6B). To confirm that HNF4α directly regulates HNF1α
transcription, we transiently transfected WT-HNF4α#28 and DN-HNF4α#26 cells
with a luciferase reporter construct containing either the wild type HNF1α gene
promoter (HNF1αLuc) or a promoter that lacks a functional HNF4α-binding site
(∆AHNF1αLuc). As demonstrated in Fig. 6C, ovexpression of WT-HNF4α caused a 2.5-
fold increase in the luciferase reporter enzyme activity in WT-HNF4α#28 cells
transfected with HNF1αLuc. Deletion of the HNF4α-binding site in the HNF1α
promoter (∆AHNF1α) abolished the activation induced by WT-HNF4α (Fig. 6C). In
contrast, induction of DN-HNF4α caused a 71% reduction in wild-type HNF1α
promoter activity (Fig. 6C). The inhibitory effect of DN-HNF4α was no-longer
present in DN-HNF4α#26 cells transfected with ∆AHNF1αLuc (Fig. 6C). Therefore,
HNF4α directly controls HNF1α gene expression in pancreatic β-cells as it does in
hepatocytes.
DISCUSSION
It has been demonstrated that HNF4α controls the expression of a large array of liver-
specific genes encoding several apolipoproteins, metabolic proteins, and serum factors
which are essential for hepatocyte differentiation and liver development (9). HNF4α
15
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
is also required for HNF1α expression in hepatocytes (7-9). Another study in
embryonic stem cell differentiated embryoid bodies (33) shows that the absence of
HNF4α affects the expression of genes encoding GLUT-2, aldolase B, and L-PK,
which are involved in glucose transport and glycolysis. However, little is known as to
how HNF4α regulates pancreatic β-cell gene expression. The primary cause of the
MODY1 phenotype is impaired glucose stimulated insulin secretion from pancreatic
β-cells (5). The present study was therefore designed to investigate the role of HNF4α
in the regulation of the expression of β-cell genes implicated in glucose metabolism,
and associated insulin secretion.
We found that overexpression of WT-HNF4α caused a left-shift of glucose-
stimulated insulin secretion while dominant-negative suppression of HNF4α
selectively blunted the insulin release induced by glucose and leucine, but not by K+
depolarization. The diminished nutrient-evoked insulin secretion is associated with
reduced ATP production in DN-HNF4α expressing cells. The physiological insulin
secretagogue leucine raises the cytosolic and mitochondrial Ca2+ concentrations
through mitochondrial metabolism down-stream of glycolysis (28, 34). We therefore
suggest that loss of HNF4α function leads to defective mitochondrial metabolism and,
as a consequence, impaired insulin secretion. The reduced mitochondrial oxidation of
[2-14C]-pyruvate and the abrogation of mitochondrial membrane hyperpolarisation
elicited by glucose, pyruvate, and methyl-succinate indicate impaired mitochondrial
TCA-cycle enzyme activity and partial uncoupling of the mitochondrial respiratory
chain.
Quantitative Northern blot analysis allows us to identify HNF4α-target genes
16
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
responsible for defective metabolism-secretion coupling. HNF4α indeed regulates the
expression of genes encoding GLUT-2, aldolase B and L-PK in pancreatic β-cells
(Fig. 5), as inferred from previous studies in hepatocytes and embryonic stem cell
differentiated embryoid bodies (8, 9). Most importantly, we demonstrate that HNF4α
alters the mRNA expression of mitochondrial OGDH E1 subunit and UCP-2 (Fig. 5),
which may indeed contribute more significantly to the impaired metabolism-secretion
coupling. The phenotype and gene expression patterns in DN-HNF4α expressing
cells are strikingly similar to those of DN-HNF1α expressing cells (22, 29). This
prompted us to investigate whether HNF4α regulates β-cell expression through
HNF1α function, as in hepatocytes (9). We provide unprecedented evidence that
HNF4α is required for HNF1α expression in pancreatic β-cells.
This conclusion is based on the use of an artificial dominant-negative hnf4α
mutation. The naturally occurring human mutations of HNF4α do not function in a
dominant-negative manner (6, 35). It is to be expected that a mutation with such
repressive action on the endogenous HNF4α function would cause embryonic
lethality, as is the case in the hnf4α knock out mouse (15). Haploinsufficiency or
reduced gene dosage of HNF4α may thus explain the mechanism leading to the
MODY1 phenotype (33). The INS-1 cell line expressing DN-HNF4α provides a
convenient model to explore the impact of impaired HNF4α function on β-cell gene
expression and metabolism-secretion coupling. This goal can not be achieved by the
introduction of one of the human HNF4α mutations into β-cell lines. In fact, the
induction of a nonsense mutation HNF4αQ268X to a level similar to DN-HNF4α
had no detectable consequences on β-cell gene expression and metabolism-secretion
coupling (unpublished results).
17
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
MODY1 patients display secretory defects not only in β-cells but also in the
glucagon secreting α-cells and the pancreatic polypeptide secreting cells (36, 37).
This general effect on islet hormone release does however not seem due to an effect
on the development and differentiation of the endocrine pancreas, since altered
HNF4α function did not affect the expression of PDX1 and other transcription factors
determining pancreatic phenotype. On the other hand, loss of HNF4α function may
cause reduced β-cell insulin content secondary to defective HNF1α function (22, 29).
ACKNOWLEDGEMENTS
We are grateful to D. Harry, G. Chaffard, C. Bartley, and E.-J. Sarret for expert
technical assistance. We are indebted to Drs F. M. Sladek (HNF4α antibody), J. E.
Darnell Jr. (HNF4α cDNA), W. Schlegel (c-Jun cDNA), P.B. Iynedjian (glucokinase
cDNA), U. Schibler (C/EBPβ cDNA), T. Edlund (PDX1 cDNA), M. Sawadogo (USF
cDNA), A. Kahn (L-PK cDNA), B. Thorens (GLUT-2 cDNA), J. Philippe (insulin I
cDNA), H. Bujard (PUHD 10-3 plasmid), and N. Quintrell (pTKhygro plasmid). This
work was supported by the Swiss National Science Foundation (grant no. 32-
49755.96), and by a European Union Network Grant (through the Swiss Federal
Office for Education and Science), and by a research grant from the Eli-Lilly
Company, Indianapolis, IN.
REFERENCES
18
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
1. Sladek, F. M., Zhong, W., Lai, E., and Darnell Jr., J. E. (1990) Genes Dev. 4,
2353-2365
2. Taraviras, S., Monaghan, P. A., Schütz, G., and Kelsey, G. (1994) Mechan. Dev. 48, 67-79.
3. Miquerol, L., Lopez, S., Cartier, N., Tulliez, M., Raymondjean, M., and Kahn, A. (1994) J. Biol.
Chem., 269, 8944-8951.
4. Yamagata, K., Furuta, H., Oda, N., Kaisaki, P., Menzel, S., Cox, N. J., Fajans, S. S., Signorini, S.,
Stoffel, M., and Bell, G. I. (1996) Nature 384, 458-460.
5. Hattersley, A. T. (1998) Diabet. Med., 15, 15-24.
6. Lausen, J., Thomas, H., Lemm, I., Bulman, M., Borgschulze, M., Lingott, A., Hattersley, A.T., and
Ryffel, G. U. (2000) Nucleic. Acids Res. 28, 430-437.
7. Tian, J-M., and Schibler, U. (1991) Genes Dev. 5, 2225-2234.
8. Kuo, C. J., Conley, P. B., Chen, L., Sladek, F. M., Darnell Jr., J. E., and Crabtree, G. R. (1992)
Nature 355, 457-461.
9. Li, J., Ning, G., and Duncan, S. A. (2000) Genes Dev. 14, 464-474.
10. Gragnoli, C., Lindner, T., Cockburn, B. N., Kaisaki, P. J., Gragnoli, F., Marozzi, G., and Bell, G. I.
(1997) Diabetes 46, 1648-1651.
11. Sladek, F. M. (1994) Liver Specific Gene Expression. R. G. Landes Co., Austin, Tex.
12. Byne, M. M., Sturis, J., Fanjans, S. S., Ortiz, F. J., Stoltz, A., Stoffel, M., Smith, M. J., Bell, G. I.,
Halter, J. B. and Polonski, K. S. (1995) Diabetes 44, 699-704.
13. Linder, T., Gragnoli, C., Furuta, H., Cockburn, B. N., Petzold, C., Rietzsch, H., Weiβ, U.,
Schulze, J., and Bell, G. I. (1997) J. Clin. Invest. 100, 1400-1405.
14. Lehto, M., Bitzén, P-O., Isomaa, B., Wipemo, C., Wessman, Y., Forsblom, C.,
Toumi, T., Taskinen, M-R, and Groop, L. (1999). Diabetes 48, 423-425.
15. Chen, W. S., Manova, K., Weinstein, D. C., Duncan, S. A., Plump, A. S.,
Prezioso, V. R., Bachvarova, R. F., and Darnell Jr., J. E. (1994) Genes Dev. 8,
2466-2477.
16. Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W., and Bujard, H.
19
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
(1995) Science 268, 1766-1769.
17. Fraser, J. D., Keller, D., Martinez, V., Santiso-Mere, D., Straney, R., and Briggs,
M. R. (1997) J. Biol. Chem. 272, 13892-13898.
18. Hadzopoulou-Cladaras, M., Kistanova, E., Evagelopoulou, C., Zeng, S., Cladaras,
C., and Ladias, J. A. A. (1997) J. Biol. Chem. 272, 539-550.
19. Sladek, F. M., Ruse Jr., M. D., Nepomuceno, L., Huang, S-M., and Stallcup, M.
R. (1999). Mol. Cell. Biol. 19, 6509-6522.
20. Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P. A., and Wollheim, C. B. (1992)
Endocrinology, 130, 167-178.
21. Wang, H., and Iynedjian, P. B. (1997) Proc. Natl. Acad. Sci. USA. 99, 4372-
4377.
22. Wang, H., Maechler, P., Hagenfeldt, K. A., and Wollheim, C. B. (1998) EMBO J.,
17, 6701-6713.
23. Noel, R. J., Antinozzi, P. A, McGarry, J. D., and Newgard, C. B. (1997) J. Biol.
Chem., 272, 18621-18627.
24. Antinozzi, P. A., Segall, L., Prentki, M., McGarry, J. D., and Newgard, C.B.
(1998) J. Biol. Chem., 273, 16146-16154.
25. Maechler, P., Kennedy, E. D., Pozzan, T., and Wollheim, C.B. (1997). EMBO J.
16, 3833-3841.
26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.
27. Muira, N., and Tanaka, K. (1993) Nucleic Acids Res. 21, 3731-3736.
28. Wollheim, C. B. (2000) Diabetologia. 43, 265-277.
29. Wang, H., Antinozzi, P. A., Hagenfeldt, K. A., Maechler, P., and Wollheim, C. B.
20
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
(2000) EMBO J., 19, 1-8.
30. Edlund, H. (1998) Diabetes, 47, 1817-1823.
31. Rane, G. R., Dubus, P., Mettus, R. V., Galbreath, E. J., Boden, G., Reddy, E. P.,
and Barbacid, M. (1999) Nat. Genet. 22, 44-52.
32. Withers, D. J., Burks, D. J., Towery, H. H., Altamuro, S. L., Flint, C. L., and
White, M. F. (1999) Nat. Genet. 23, 32-40.
33. Stoffel, M. and Duncan, S.A. (1997) Proc. Natl. Acad. Sci. USA, 94, 13209-
31214.
34. Kennedy, E. D. and Wollheim, C. B. (1998) Diabetes and Metab. 24, 15-24.
35. Hani, E-H, Suaud, L., Boutin, P., Chèvre J-C, Durand, E., Philippi, A.,
Demenais, F., Vionnet, N., Furuta, H., Velho, G., Bell, G. I., and Laine, B. (1998)
J. Clin. Invest. 101, 521-526.
36. Herman, W. H., Fajans, S. S., Smith, M. J., Polonsky, K. S., Bell, G. I., and
Halter, J. B. (1997) Diabetes, 46, 1749-1754.
37. Ilag, L. L., Tabaei B. P., Herman, W. H., Zawacki, C. M., D’Souza, E., Bell, G. I.,
and Fajans, S. S. (2000) Diabetes, 49, 961-968.
21
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
FIGURE LEGENDS
FIG. 1. Dose-response and time-course of doxycycline effect on WT-HNF4α (A)
and DN-HNF4α (B) expression. For studying dose-response, cells were cultured
with the indicated doses of doxycycline (Dox) for 48 h. For studying time-course,
cells were cultured in medium containing 500 ng/ml doxycycline and harvested for
nuclear extracts at the indicated times. Nuclear extracts from WT-HNF4α#28 (50
µg/lane) (A) and DN-HNF4α#26 (10 µg/lane) (B) were resolved in 9% SDS-PAGE,
transferred to nitrocellulose, and immunoblotted with antibodies against HNF4α (A)
and the Myc-tag (B) respectively.
FIG. 2. HNF4α regulates nutrient-evoked insulin secretion in INS-1 cells. Insulin
secretion was quantified as described in the Experimental Procedures and normalized
by cellular DNA content. (A) Glucose-stimulated insulin secretion in WT-
HNF4α#28 cells induced with indicated doses of doxycycline for 14 h. Data represent the mean
+ SEM of six independent experiments. Statistical significance between doxycycline-
induced and non-induced cells was obtained at 2.5 and 6 mM glucose (p<0.001,
unpaired Student’s t-test). (B) Glucose-, leucine-, and K+-elicited insulin secretion
in DN-HNF4α#26 cells induced with 500 ng/ml doxycycline for 48 h. Insulin
secretion was measured during 30 min incubation with 2.5 mM (Basal) and 24 mM
glucose in KRBH, or with 20 mM leucine and 20 mM KCl added in KRBH
containing 2.5 mM glucose. Data are the mean + SEM of six separate experiments.
Statistical significance between doxycycline-induced and non-induced cells was
22
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
observed at 24 mM glucose and 20 mM leucine stimulated conditions (p<0.001).
Insulin content was reduced by 30 + 8.2% after induction of DN-HNF4α.
FIG. 3. Induction of DN-HNF4α impairs cellular ATP production and mitochondrial
oxidation. (A) Cellular ATP levels in DN-HNF4α#26 cells were measured after 8
min incubation with 2.5 mM (Basal) and 24 mM glucose in KRBH or 20 mM leucine
and 20 mM KCl added in KRBH containing 2.5 mM glucose. Data represent mean +
SEM of three independent experiments. Glucose and leucine stimulated ATP
production was significantly inhibited after treatment with 500 ng/ml doxycycline for
48 h (P<0.005 and P<0.001, respectively). (B) [2-14C] Pyruvate oxidation was
measured during 1 h incubation in KRBH containing 0.05 or 1 mM pyruvate. Data
represent the mean ± SE performed in triplicate from one of four similar experiments.
*P<0.02. (C) [1-14C] Pyruvate oxidation was measured with identical conditions in
the same preparation of cells as in Figure 3B. Data represent the mean ± SE
performed in triplicate from one of three similar experiments.
FIG. 4. Effect of DN-HNF4α on mitochondrial membrane potential (∆Ψm) in INS-1
cells. The ∆Ψm was measured in a suspension of 2x106 INS-1 cells per 2 ml KRBH
using rhodamine-123 (Rh-123) fluorescence after a spinner culture period. In panel
A, glucose-induced (12.5mM final) hyperpolarization of ∆Ψm was tested followed by
the complete depolarization of ∆Ψm using 1µM of the uncoupler FCCP. In panel B,
the end product of glycolysis pyruvate (10mM) was added 10 min before FCCP. In
panel C, the mitochondrial substrate methyl-succinate (10 mM) was tested. The
23
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
effects of these various substrates (5 min after addition) as well as that of FCCP are
summarized with statistics in panel D. *P<0.05; **P<0.01. Each trace (A-C) is
representative of 4-8 independent experiments.
FIG. 5. Effects of WT-HNF1α and DN-HNF1α on pancreatic β-cell gene
expression. Northern blotting was used to quantify the gene expression in WT-
HNF4α#28 (A&C) and DN-HNF4α#26 (B&D) cells induced with indicated doses of
doxycycline and cultured at given concentrations of glucose (detailed in Experimental
Procedures). RNA samples were analysed by hybridization with the indicated cDNA
probes.
FIG. 6. Induction of WT-HNF1α and DN-HNF1α regulates the HNF1α mRNA
expression and HNF1α promoter luciferase activity through altered HNF4α binding.
EMSA (A), Northern blotting (B), and luciferase enzyme reporter activity (C) assays
were performed in WT-HNF4α#28 and DN-HNF4α#26 cells cultured in the
presence or absence of 500 ng/ml doxycycline for 48 h. (A). For EMSA, the
oligonucleotide duplex corresponding to the murine HNF1α promoter fragment
containing HNF4α binding site was used as probe. (B). For Northern blot analysis,
cells were cultured in 2.5 mM glucose medium for 48 h, and continued for 8 h with
indicated glucose concentrations. RNA samples from WT-HNF4α#28 (upper panel)
and DN-HNF4α#26 (lower panel) cells were hybridized with HNF1α cDNA probe.
(C). Cells were transiently transfected with HNF1αLuc or ∆AHNF1αLuc by calcium
phosphate-DNA co-precipitation. Luciferase activity measured in non-induced cells
24
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
was defined as 100%. Data are the mean + SEM of six separate experiments.
25
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from
WollheimHaiyan Wang, Pierre Maechler, Peter A. Antinozzi, Kerstin A. Hagenfeldt and Claes B.
metabolism and nutrient-induced insulin secretionHNF4alpha regulates the expression of pancreatic beta-cell genes implicated in glucose
published online August 30, 2000J. Biol. Chem.
10.1074/jbc.M006612200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on February 26, 2020http://w
ww
.jbc.org/D
ownloaded from