Molecular genetic markers complement

archaeological, breeding and geographical

investigations of the origins, history and

domestication of plants. With increasing

access to wild apples from Central Asia,

along with the use of molecular genetic

markers capable of distinguishing between

species, and explicit methods of phylogeny

reconstruction, it is now possible to test

hypotheses about the origin of the

domesticated apple. Analyses of nuclear

rDNA and chloroplast DNA (cpDNA)

sequences indicate that the domesticated

apple is most closely related to series

Malus species. Moreover, the occurrence of

a shared 18-bp duplication in the cpDNAs of

wild and cultivated apple supports the close

relationship between them. Hypotheses

about the hybridization and the origin of the

domesticated apple cannot be rejected

completely until more variable,

phylogenetically informative markers

are found.

The domesticated apple is one of the mostimportant fruit crops of the colder andtemperate parts of the world [1]. Vavilovsuggested that the wild apple of Turkestan(Kazakstan, Kyrgystan, Uzbekistan,Turkmenistan and Tajikistan) and its closerelatives were the progenitors of thedomesticated apple*; the whole process ofwild apple domestication being traced toAlmaty (Kazakstan). Vavilov reasoned that,because the wild apple bears similar fruitsto the domesticated apple, it must havebeen the progenitor. Recent fieldwork in theregion appears to confirm the similaritybetween wild and cultivated apples [2,3].Furthermore, Janick et al. suggested that‘this area [Central Asia] is the area ofgreatest diversity and the centre of origin’of the domesticated apple [4]. This is linkedto Vavilov’s ‘oversimplified’idea that thecentre of diversity is the place of origin [5,6].The Central Asian wild apple (Box 1) is adiverse species with a wide range of forms,colours and flavours [7], whilst its allozymediversity is significantly greater than that

found in four widely distributedNorthAmerican wild apples [8,9].

The Central Asian wild apple is closelyrelated to a group of apples that havedifferent-sized fruits. One of these,Malus baccata (Siberian Crab), has small,red fruits that hang in clusters and arebird-dispersed (Fig. 1). Malus baccatamight have had a wider distribution thanthat of the present day, and we think thatpopulations became ‘trapped’as theTien Shan began to rise out of the TethysOcean. Over seven million years, perhaps

up to ten million years, mammals, such asbears, acted as distribution vehicles byselecting the largest and juiciest fruits; a small, bird-distributed, cherry-likedelicacy giving way to a large mammal-distributed form. Small apples have evenbeen observed to pass intact through abear’s jaw and guts; it should be noted,however, that apple seeds retained in theapple core do not germinate.

By the time humans began to occupythe area ~5000–8000 years ago, the early evolution of the apple was almostcomplete, and its migration, ably assistedby the now domesticated horse [10], wasunder way. Over several more thousandsof years, from within this migrating flowcame the many thousands of applecultivars now known, as a result of bothunconscious and conscious selection [11].

Based on combined archaeological andmolecular data, it seems likely that, in the late Neolithic or early Bronze Age,travellers on the great trade routes thatran from central China to the Danube(Fig. 2), carried the seed of the Central

TRENDS in Genetics Vol.18 No.8 August 2002

http://tig.trends.com 0168-9525/02/$ – see front matter © 2002 Elsevier Science Ltd. All rights reserved. PII: S0168-9525(02)02689-6

426 Forum

Science Chronicle

Genetic clues to the origin of the apple

Stephen A. Harris, Julian P. Robinson and Barrie E. Juniper

Species are arranged according to a taxonomichierarchy, in which they are placed into largergroups or divided into smaller groups toaccount for observed variation. Each of thesegroups is given a particular name. Thus, thefamily Rosaceae includes the genus Malus(apples) with its ~55 species, which are groupedinto infrageneric groups (section, series), andeach species can be divided into intraspecificgroups (cultivar). Malus spp. are arrangedaccording to Phipps et al.’s classification [a].

The genus Malus comprises some55 species [a], although between eight and79 species have been recognized. Part of theproblem of Malus taxonomy is the intimateassociation that humans have with apples,where the distinction between wild andcultivated species could become blurred andhence the recognition of distinct categoriesdifficult. Furthermore, the scientific namesthat have been applied to the domesticatedapple are legion, and include Malus pumilaMiller, M. communis Desf., M. sylvestris (L.)Miller and M. domestica Borkh. Recently, ithas been argued that M. pumila is the correctname for the domesticated apple and that thisalso includes the presumed wild relative,M. sieversii (Ledeb.) M. Roem [b]. We useM. domestica to refer to ‘domesticated apple’

and M. sieversii to refer to the Central Asian‘wild apple’. However, the term ‘wild apple’has been applied to all Malus spp. other thanthe domesticated apple. For example, inEurope, the common name ‘wild apple’ refersto M. sylvestris Miller, whilst in North Americathe term has been applied to species includingM. angustifolia (Ait.) Michx. and M. coronaria(L.) Miller. The situation is further complicatedby the application of the name ‘wild apple’ tohybrids between domesticated apple andother members of the genus Malus.

The taxonomic hierarchy for thedomesticated apple ‘Bramley’s Seedling’would be:• Family: Rosaceae• Subfamily: Maloideae• Genus: Malus• Section: Malus• Series: Malus• Species: domestica• Variety/cultivar: ‘Bramley’s seedling’

References

a Phipps, J.B. et al. (1990) A checklist of thesubfamily Maloideae (Rosaceae). Can. J. Bot.68, 2209–2269

b Mabberley, D.J. et al. (2001) The name of theapple. Telopea 9, 421–430

Box 1. Taxonomic hierarchy and apple classification

TRENDS in Genetics

(a) (b)

Fig. 1. Range of variation in apple fruit types: (a) Malusbaccata, a bird-dispersed species; and (b) domesticatedapple, a mammal-dispersed species.

* Vavilov, N.I. (1930) Wild progenitors of the fruittrees of Turkistan and the Caucasus and the problemof the origin of fruit trees. InternationalHorticultural Congress Group B, 271–286

Asian wild apple west, either in saddlebags or horses’guts. We now know that theimportant technique of grafting (describedas ‘instant domestication’ [12]), where thevariety can be preserved forever, wasprobably discovered in Mesopotamia atMari, as early as 3800 years ago (S. Dalley,pers. commun.). The description, oncuneiform tablets, concerns vines(Vitis spp.), but the techniques are easilytransferable. From there, the fruits andthe necessary technology passed throughthe Persians and Greeks to the Romans,who perfected orchard economies. TheRomans brought the whole package to Western Europe and, for the last2000 years, the domesticated apple hasdiversified and flourished worldwide.Archaeological evidence for the collectionof apples from the wild in Europe can be found in Neolithic (11 200 years ago)and Bronze Age (c. 4500 years ago) sitesthroughout Europe [13,14], and for applecultivation as early as 1000 BC in Israel [1].

In terms of apple domestication, seriesMalus is the most important group ofspecies. However, the nomenclature of thespecies in series Malus is complex. Withfew discrete characters to differentiatespecies, the difficulty of speciesdelimitation has hampered investigationsinto the origins of apples [15];morphological characters used to delimitspecies in series Malus are continuous andoverlapping. Such problems perhapscontributed to Zohary and Hopf’sstatement that ‘it is therefore futile to try todelimit the area of initial domestication on

the basis of the evidence available from theliving plant’ [1]. However, the molecularsystematics revolution potentially providesan excellent source of potential charactersfor analyses of these type.

The origin of the domesticated apple and

relations with other Malus spp.

Combinations of nuclear (nDNA) andcytoplasmically [chloroplast (cpDNA) and mitochondrion (mtDNA)] inheritedmolecular genetic markers provideimportant clues about the origins ofdomesticated plants, for example,Citrus spp. [16], beans [17] and potatoes[18]. In Malus, the chloroplast genomeprovides data about evolutionaryrelationships of the maternal line, whilstbiparentally inherited nDNA providesindependent data, which, combined withcpDNA, could enable the origin of thedomesticated apple to be determined.Hybridization and introgression areexpected to have been important factors inthe development of domesticated applecultivars. Therefore, for investigations thataim to determine the earliest origins of thedomesticated apple, it is necessary to usecultivars that are as ancient as possible.

matK, a cpDNA-encoded region~1800-bp long, of which 1341 bp was sequenced, showed only16 phylogenetically informative charactersacross the genus Malus, and thus poorresolution in the phylogenetic tree [19](Fig. 3). However, two duplications werefound 39 bp from the 3′ end of the matKcoding region. Duplication I is an imperfect

8-bp duplication that differs by a T residue,whereas duplication II is a perfect 18-bpduplication. Duplications I and II werealways present together, suggesting thateach has arisen only once during theevolution of Malus spp. (Fig. 3).Duplication II was polymorphic in both the Central Asian wild apple and thedomesticated apple, suggesting that theCentral Asian wild apple could be themajor maternal contributor, as proposedby Watkins et al. [20].

The nuclear ribosomal internaltranscribed spacer (ITS) showed89 phylogenetically informative charactersfrom the 617 bp sequenced. A stronglysupported group comprised the CentralAsian wild apple and the domesticatedapple, as well as M. asiatica, M. orientalis,M. niedzwetzkyana and M. prunifolia (allfrom section Malus spp.), although therewas little resolution within this group(Fig. 4). Together, data from the chloroplastand nuclear genomes support the view thatthe domesticated apple is most closelyrelated to the series Malus spp. These dataalso indicate that the Central Asian wildapple could be most closely related to thedomesticated apple. Savolainen et al. wereunable to determine the origin of thedomesticated apple because of a lack ofvariation in the cpDNA-encoded atpB-rbcLspacer and the absence of the Central Asianwild apple in their sample [21]. However,additional phylogenetically useful DNAsequence information should be sought, so that this hypothesis can be confirmed;additional sampling of Central Asian wildapples and domesticated apples is neededto ensure that rare hybridization eventswith other Malus spp. that might have

TRENDS in Genetics Vol.18 No.8 August 2002

http://tig.trends.com

427Forum

TRENDS in Genetics

Regions of high concentrations of 'ancient' apples Pre-history. Surmized distribution of Malus sieversii 'Silk roads'

N

Fig. 2. Location of great trade routes (‘silk roads’, red), surmized distribution of Malus sieversii (green) and regions ofhigh concentrations of present-day ‘ancient’ apples (yellow). Scale bar = 500 km.

contributed to the early domestication ofapples have not been overlooked.

The need for more variable DNAmarkers has led to analyses of Malusphylogeny using randomly amplifiedpolymorphic DNA (RAPD) [22] and nuclearmicrosatellites [single sequence repeats(SSR)] [23]. Dunemann et al.’s resultsindicated that M. pumila and M. sylvestris(section Malus) were involved in the originof cultivated apples [23]. However, theysuggested that M. sylvestris, M. florentinaor M. dasyphylla could be the female parentof M. domestica. By contrast, Hokansonet al.’s SSR studies were not useful indetermining the relationships among the142 accessions from 23 species analysed[23]. However, it has been argued thatRAPD data are not appropriate for thereconstruction of phylogeny because of

reproducibility, primer structure,dominance, product competition, homology,allelic variation, genome sampling andnon-independence of loci, whilst similarproblems have been highlighted for the useof SSRs in phylogenetic analyses [23–25].

Variation within the domesticated apple

Many thousands of named domestic applevarieties (both dessert and cider) havebeen selected for hundreds of years inEurope, Asia and North America, and morerecently in the Southern Hemisphere.Together with wild species, these aremaintained in national collections asgenetic resources for breeding, particularlyas sources of resistance to apple scab[Venturia inaequalis (Cooke) Winter],powdery mildew [Podosphaera leucotricha(Ellis and Everh) Salmon] and fireblight

[Erwinia amylovora (Burill) Winslowet al.] [26]. As with wild species, thetaxonomy of apple varieties is fraught withproblems, including environmental anddevelopmental variation within varieties,and limited numbers of morphological and chemical characters to distinguishvarieties [11]. In addition the triad ofdecreasing budgets, but increasingcollection size and running cost, traps acollection manager whose goal is to have a well-characterized but easily utilizedcollection, and forces choices to be made totry and minimize genotypic redundancy.Thus, molecular genetic markers provide a valuable aid to the identification ofduplicates (possible cultivar synonyms),correctly naming mis-identified plants and enabling managers to make effectivedecisions about the reduction of collectionsize without reducing genetic variation(i.e. creation of core collections) [27].

Two contrasting types of moleculargenetic marker can be used to characterizeapples. The first type is those that identifyfew, high information content loci, such asmicrosatellites. The second are those thatidentify many, low information content loci,such as RAPD. Studies of RAPD variationin Malus spp. have focused on the diversitypresent in domesticated apples andgermplasm collections. Dunemann et al.investigated RAPD variation at 52 putativeloci in a collection of 27 domesticated applecultivars and were able to differentiatebetween cultivars [22]. Furthermore,RAPD markers have also been used toanalyse the maternal and paternalcontributions to pedigrees [22,28,29]. In alarge study by Oraguzie et al., 43 RAPDmarkers were used to assess the variationin a worldwide collection of 50 olddomesticated apple varieties, currentbreeding lines and a collection of 105 otherapples, including wild species [30].Individual cultivars could be distinguishedand ~95% of the RAPD variation occurredwithin cultivars, breeding lines and wildspecies. Furthermore, Central Asian wildapple accessions were scattered in a cluster analysis based on genetic distance.However, RAPD markers have beencriticized for the analysis of geneticvariation on both technical and theoreticalgrounds [24] and, given the problem of poor inter-laboratory result reproduction,arbitrary fragment length polymorphismscould be a more effective way of producinggenotypes based on many, low informationcontent, loci [31].

TRENDS in Genetics Vol.18 No.8 August 2002

http://tig.trends.com

428 Forum

TRENDS in Genetics

Domesticated apple

Wild apple

Malus sylvestris

Malus asiaticaMalus micromalus

Malus orientalis

Malus baccata

Docynia delavayi

Malus sieboldii

Malus prattii

Malus hupehensis

Malus toringoides

Malus kansuensis

Malus fusca

Malus coronaria

Malus florentinaMalus trilobata

Malus tschonoskii

Malus ioensis

Malus doumeri

Maloid outgroups

Malus yunnanensis

8-bp

dup

licat

ion

18-b

p du

plic

atio

n

Series Malus

Section Sorbomalus

Section Eriolobus

Series Baccata

Section Chloromeles

Section Docyniopsis

Section Malus

Weak(50–74%) support

Strong (75–100%) support

Duplication present

Duplication polymorphic

Duplication absent

aaattctatttaaatattaaataattaagagataacaaaaaattaagagataacaaaaaattaat

matK 3′ trnK

8-bp duplication I 18-bp duplication II

(a)

(b)

Fig. 3. Phylogeny of the chloroplast DNA-encoded gene matK in the genus Malus (a). A cartoon of matK is shown in (b) and the positions of the two duplications are indicated. Wild apple refers to the Central Asian wild apple,M. sieversii. Circles indicate the level of statistical support for particular groups. The distribution of the two matKduplications is shown on the tree.

Eight apple SSR loci (seven dinucleotiderepeat loci and one trinucleotide repeatlocus) were developed by Szewc-McFaddenand colleagues [27,32] and used byHokanson [33] to identify the genotypes of a core collection of 66 domesticated applevarieties. All but seven pairs of accessions(five of these were either mutations or their progenitors) of the 2145 possiblepair-wise varietal combinations could bedistinguished. The probability of any twosingle locus genotypes matching by chancein this study ranged from 0.027 to 0.970,although this dropped to 0.156 × 10−8 formultilocus comparisons. The highdiscrimination power shows the value ofSSR markers for varietal genotyping,whilst their co-dominance and highrepeatability makes them more reliablemarkers than RAPDs. SSR loci also appearto be very useful anchor markers in applegenome-mapping projects. The occurrenceof low frequency alleles potentially makesSSRs valuable markers for pedigreeanalysis, although large numbers ofco-dominant markers are likely to benecessary if complex crossing patterns areto be disentangled.

Limited surveys of apple varieties haverevealed two cpDNA mutations thattogether provide evidence for multipleorigins of the maternal component of the domesticated apple, because applecultivars are propagated vegetatively. In a survey of 40 cultivars (36 named andfour unnamed), Savolainen et al. showedthat cultivars could be divided into twocpDNA haplotypes depending on a C→Ttransition at position 17 of the atpB–rbcLspacer [21]. Similarly, Robinson et al., in a survey of nine cultivars, showed thatthese could be divided into two groupsbased on the occurrence of an 18-bpduplication in the matK–3′trnK spacerregion [19]. The duplication was foundonly in the domesticated apple and oneaccession of the Central Asian wild applefollowing a broad survey of the genus,highlighting the close relationshipbetween the Central Asian wild anddomesticated apple. Unfortunately,because the objectives of these two studieswere different, complementary cultivarswere not included. However, combiningthese two markers into the same studymight allow major lineages in cultivatedand wild apples to be identified.Investigations of restriction fragmentlength polymorphism provide additionalevidence for uncharacterized variation in

both the chloroplast and mitochondrialgenomes of domesticated apples [34,35].

Conclusions

Two stages appear to have been importantin the domestication of apples across therange of the genus; the initial introductionof apples into Western Europe and laterhybridizations between cultivars andbetween cultivars and wild species. Basedon molecular data, it was members ofsection Malus that were important,particularly the wild apple, in the initialintroduction. The morphological,biochemical and molecular variationwithin wild apple indicates that theearliest selections of domesticated applescould have come directly from the wildapple, without the involvement of otherspecies. However, later hybridizationscould have been important in the creationof new cultivars that carry economicallyimportant characteristics. The detailedanalysis of these stages requires moresampling of the variation within CentralAsia. Given the extensive range of the wildapple, detailed analysis of known old

apple cultivars using highly variablemolecular genetic markers such as SSRs,identification of DNA sequences thatallow resolution of the section Malus spp.a comprehensive taxonomic account of the genus Malus and additionalarchaeological evidence of human use ofapples in Central Asia and the Near Eastwill be important. Clearly, there is stillmuch to be discovered about the origin ofthe domesticated apple, the processes thatled to its domestication and the origins ofboth dessert and cider apples.

Acknowledgements

We thank The Leverhulme Foundation forfunding the work described in this article;the Merlin Trust for travel grants; thestaff at the USDA-ARS Plant GeneticResources Unit, Cornell University, inparticular P. Forsline, H. S. Aldwinkle,A. Szewc-McFadden and W. Lamboy, forpractical help and support; K. Tobutt and the staff at Horticultural ResearchInternational, East Malling, for providingwild species material from theircollections; I. Belolipov and L.Samieva of

TRENDS in Genetics Vol.18 No.8 August 2002

http://tig.trends.com

429Forum

TRENDS in Genetics

Do

mesticated

app

leD

om

esticated ap

ple

Wild

app

leM

alus orientalisW

ild ap

ple

Malus asiatica

Do

mesticated

app

leD

om

esticated ap

ple

Wild

app

le

Do

mesticated

app

le

Malus niedzw

etzkyana

Malus niedzw

etzkyana

Malus niedzw

etzkyana

Wild

app

le

Wild

app

le

Malus orientalis

Malus prunifolia

Malus baccata

Malus halliana

Malus sieboldii

Malus prattii

Malus yunnanensis

Malus transitoria

Malus hupehensis

Malus toringoides

Malus m

andshurica

Malus sargentii

Malus honanensis

Malus kansuensis

Malus fusca

Malus coronaria

Malus om

brophilaM

alus florentinaM

alus trilobataM

alus tschonoskiiM

alus angustifolia

Malus ioensis

Malus doum

eriM

aloid outgroups

Malus yunnanensis

Series Malus

Section Sorbomalus

Section Eriolobus

Series Baccata Section Chloromeles

Section DocyniopsisSection Malus

Weak (50–74%) support

Strong (75–100%) support

Fig. 4. Phylogeny of the nuclear ribosomal internal transcribed spacer gene in the genus Malus. Where the samename appears at different places on the tree, this indicates that multiple accessions were used. Wild apple refers tothe Central Asian wild apple, M. sieversii. Circles indicate the level of statistical support for particular clades.

the University of Tashkent for assistance inthe field collecting in Uzbekistan andKirghistan; the staff of LES-IC, theKhirghiz Swiss Forestry SupportProgramme and the Forestry Institute ofthe Republic of Kirghistan, Jalal-Abad,Kirghistan; N. Ajtkhozina andN.Ajtkhozina of the Ministry of Sciencesand the University of Almaty for assistancein field collecting in Kazakhstan. Inparticular, we thank R. Wise of the Dept ofPlant Sciences, Oxford, UK for all theartwork. B.E.J. is currently a LeverhulmeEmeritus Research Fellow in the Dept ofPlant Sciences, Oxford.

References

1 Zohary, D. and Hopf, M. (2000) Domestication ofPlants in the Old World, Oxford University Press

2 Forsline, P.L. (1995) Adding diversity to thenational apple germplasm collection: collectingwild apples in Kazakstan. N. Y. Fruit Quart. 3, 3–6

3 Forsline, P.L. et al. (1994) Collection of wildMalus, Vitis and other fruit species geneticresources in Kazakstan and neighboringrepublics. HortScience 29, 433

4 Janick, J. et al. (1996) Apples. In Fruit Breeding:Tree and Tropical Fruits (Janick, J. andMoore, J.N., eds), pp. 1–77, John Wiley & Sons

5 Vavilov, N.I. (1926) Studies on the origin of cultivatedplants. Trudy Byuro. Prikl. Bot. 16, 139–245

6 Harlan, J.R. (1992) Crops and Man, AmericanSociety of Agronomy

7 Way, R.D. et al. (1990) Apples (Malus). In GeneticResources of Temperate Fruit and Nuts(Moore, J.N and Ballington, R., eds), pp. 1–62,International Society of Horticultural Science

8 Lamboy, W.F. et al. (1996) Partitioning of allozymediversity in wild populations of Malus sieversii L.and implications for germplasm collection. J. Am. Soc. Hort. Sci. 121, 982–987

9 Dickson, E.E. et al. (1991) Isozymes in NorthAmerican Malus (Rosaceae): hybridisation andspecies differentiation. Syst. Bot. 16, 363–375

10 Vila, C. et al. (2001) Widespread origin of domestichorse lineages. Science 291, 474–477

11 Morgan, J. (1993) The Book of Apples, Ebony Press12 Zohary, D. and Spiegel-Roy, P. (1975) Beginnings

of fruit growing in the Old World. Science187, 319–327

13 Hopf, M. (1973) Apfel (Malus communis L.);Aprikose (Prunus armeniaca L.). In Reallexikonder Germanischen Altertumskunde (Vol. 1)(Beck, H. et al. eds), pp. 363–372, Walter de Gruyter

14 Schweingruber, F.H. (1979) Wildapfel undprähistorische Apfel. Archaeo-Physika 8, 283–294

15 Rohrer, J.R. et al. (1994) Floral morphology ofMaloideae (Rosaceae) and its systematicrelevance. Am. J. Bot. 81, 574–581

16 Moore, G.A. (2001) Oranges and lemons: clues tothe taxonomy of Citrus from molecular markers.Trends Genet. 17, 536–540

17 Beccara Veläsquez, V.L. and Gepts, P. (1994) RFLPdiversity of common bean (Phaseolus vulgaris) inits centres of origin. Genome 37, 256–263

18 Hosaka, K. (1995) Successive domestication andevolution of the Andean potatoes as revealed bychloroplast DNA restriction endonucleaseanalysis. Theor. Appl. Genet. 90, 356–363

19 Robinson, J. et al. (2001) Taxonomy of the genusMalus Mill. (Rosaceae) with emphasis on thecultivated apple, Malus domestica Borkh. PlantSyst. Evol. 226, 35–38

20 Watkins, R. (1995) Apple and pear. In Evolution ofCrop Plants (Smartt, J. and Simmonds, N.W.,eds), pp. 418–422, Longman

21 Savolainen, V. et al. (1995) Chloroplast DNAvariation and parentage analysis in 55 apples.Theor. Appl. Genet. 90, 1138–1141

22 Dunemann, F. et al. (1994) Genetic relationships inMalusevaluated by RAPD ‘fingerprinting’ofcultivars and wild species. Plant Breed.113, 150–159

23 Hokanson, S.C. et al. (2001) Microsatellite (SSR)variation in a collection of Malus (apple) speciesand hybrids. Euphytica 118, 281–294

24 Harris, S.A. (1999) RAPDs in systematics – auseful methodology? In Advances in MolecularSystematics (Hollingsworth, P.M., et al. eds),pp. 211–228, Taylor & Francis

25 Robinson, J. and Harris, S.A. (2000) Amplifiedfragment length polymorphisms andmicrosatellites: a phylogenetic perspective.In Which DNA Marker for Which Purpose?(Gillet, E.M., ed.), pp. 95–121, Institut fürForstgenetik und Forstpflanzenzüchtung

26 Manganaris, A.G. et al. (1994) Isozyme locus Pgm-1is tightly linked to a gene (Vf) for scab resistance inapple. J. Am.Soc. Hort. Sci. 119, 1286–1288

27 Szewc-McFadden, A.K. et al. (1996) Utilisation ofidentified simple sequence repeats (SSRs) inMalus x domestica (apple) for germplasmcharacterisation. HortScience. 31, 619

28 Harada, T. et al. (1993) DNA-RAPDs detectgenetic variation and paternity in.Malus. Euphytica 65, 87–91

29 Landry, B.S. et al. (1994) Phylogeny analysis of 25apple rootstocks using RAPD markers and tacticalgene tagging. Theor. Appl. Genet. 89, 847–852

30 Oraguzie Nnadozie, C. et al. (2001) Genetic diversityand relationships in Malussp. germplasm collectionsas determined by randomly amplified polymorphicDNA. J. Am. Soc. Hort. Sci. 126, 318–328

31 Jones, C.J. et al. (1997) Reproducibility testing ofRAPD, AFLP and SSR markers in plants by anetwork of European laboratories. Mol. Breed.3, 381–390

32 Szewc-McFadden, A.K. et al. (1995) Identificationof simple sequence repeats in Malus (apple).HortScience. 30, 855

33 Hokanson, S.C. et al. (1998) Microsatellite (SSR)markers reveal genetic identities, geneticdiversity and relationships in a Malus xdomestica Borkh. core subset collection.Theor. Appl. Genet. 97, 671–683

34 Ishikawa, S. et al. (1992) Organelle DNApolymorphism in apple cultivars and rootstocks.Theor. Appl. Genet. 83, 963–967

35 Kato, S. et al. (1993) Mitochondrial DNArestriction fragment length polymorphisms inMalus species. Plant Breed. 111, 162–165

Stephen A. Harris

Barrie E. Juniper*

Dept of Plant Sciences, University of Oxford,South Parks Road, Oxford, UK OX1 3RB.*e-mail: barrie.juniper@plants.ox.ac.uk

Julian P. Robinson

Sir William Dunn School of Pathology,University of Oxford, South Parks Road,Oxford, UK OX1 3RE.

TRENDS in Genetics Vol.18 No.8 August 2002

http://tig.trends.com

430 Forum

Book Review

Dog-gone good genetics

The Genetics of

the Dog

edited by A. Ruvinskyand J. SampsonCAB International,2001. £85.00 hbk (X + 564 pages)ISBN 0851995209

Phenotypic variation is the stuff ofgeneticists’dreams. With hundreds ofpure breeds showing extraordinary

differences in size, shape, physiology andbehavior, the domestic dog is uniquelysuited among mammals for moderngenetic analysis. Why then has caninegenetics not had a more prominent role inthis, the genomics era? There are severalreasons, some of which become apparentwhile reading The Genetics of the Dog.This book is a loosely organized collectionof reports from leading canine geneticiststhat describe the latest research resultsand molecular tools. Unfortunately, this isall the book aspires to do. The Genetics ofthe Dog does not address obstacles in thefield or put forth hypotheses that catalyze

future research. As is often the case withmulti-authored compendiums, there islittle continuity. The chapters are notcoordinated to support a common contextor theme, leading to a lack of overallcommentary on the ‘big picture’ of caninegenetics. The book also fails to create asense of excitement and discovery arounda species that has so much to offer tostudies of mammalian development,behavior, evolution and health. Thus, thisbook represents a missed opportunity – to be provocative, to chart a course forfuture work, and to excite readers with the enormous promise that dog genetics