The Future of Research Communication
Judith BlakeThe Jackson Laboratory
Rocky ISBC
My PerspectiveFuture open access to digital data will speed discovery
Data generation is getting easier, data analysis is getting harder, we are drowning in data
Key to scientific discourse is the ability to reproduce and verify results - currently difficult for computational results that do not include code and data upon publication
Current ‘academic’ publication and rewards systems are inadequate for measuring scientific contributions
Digital data repositories, open access publications, electronic journals, and semantic web enhancements will all contribute to the success of future of science communications
12/8/11
Outline1. Improving knowledge communication
- Vision: What are the communication functionalities needed?- Technology: What are the tools for doing this?
2. Impacting our world- Social Aspects: How do we quantify impact of use/reward system?- Coolness: How do we make it attractive to do/ use?
3. Overcoming obstacles-Financial Considerations: How do we make is sustainable?-Getting the ball rolling: How do we start?
12/8/11Rocky ISBC
12/8/11Rocky ISBC
Elsevier, Wiley, ISI, (Highwire), PLoS, 14 Universities, European Commission, UKRoyal Society
“Where Computer Scientists Meet”
The Reasoned Argument
12/8/11Rocky ISBC
Roxy Laybourne and others, photo by Chip Clark
Managing Biological Information is Nothing New
Bird Collections at the Smithsonian Natural History Museum
12/8/11Rocky ISBC
Rocky ISBC
TCTCTCCCCCGCCCCCCAGGCTCCCCCGGTCGCTCTCCTCCGGCGGTCGCCCGCGCTCGGTGGATGTGGC
TGGCAGCTGCCGCCCCCTCCCTCGCTCGCCGCCTGCTCTTCCTCGGCCCTCCGCCTCCTCCCCTCCTCCT
TCTCGTCTTCAGCCGCTCCTCTCGCCGCCGCCTCCACAGCCTGGGCCTCGCCGCGATGCCGGAGAAGAGG
CCCTTCGAGCGGCTGCCTGCCGATGTCTCCCCCATCAACTACAGCCTTTGCCTCAAGCCCGACTTGCTGG
ACTTCACCTTCGAGGGCAAGCTGGAGGCCGCCGCCCAGGTGAGGCAGGCGACTAATCAGATTGTGATGAA
TTGTGCTGATATTGATATTATTACAGCTTCATATGCACCAGAAGGAGATGAAGAAATACATGCTACAGGA
TTTAACTATCAGAATGAAGATGAAAAAGTCACCTTGTCTTTCCCTAGTACTCTGCAAACAGGTACGGGAA
CCTTAAAGATAGATTTTGTTGGAGAGCTGAATGACAAAATGAAAGGTTTCTATAGAAGTAAATATACTAC
CCCTTCTGGAGAGGTGCGCTATGCTGCTGTAACACAGTTTGAGGCTACTGATGCCCGAAGGGCTTTTCCT
TGCTGGGATGAGCCTGCTATCAAAGCAACTTTTGATATCTCATTGGTTGTTCCTAAAGACAGAGTAGCTT
TATCAAACATGAATGTAATTGACCGGAAACCATACCCTGATGATGAAAATTTAGTGGAAGTGAAGTTTGC
CCGCACACCTGTTATGTCTACATATCTGGTGGCATTTGTTGTGGGTGAATATGACTTTGTAGAAACAAGG
TCAAAAGATGGTGTGTGTGTCCGTGTTTACACTCCTGTTGGCAAAGCAGAGCAAGGAAAATTTGCGTTAG
AGGTTGCTGCTAAAACCTTGCCTTTTTATAAGGACTACTTCAATGTTCCTTATCCTCTACCTAAAATTGA
TCTCATTGCTATTGCAGACTTTGCAGCTGGTGCCATGGAGAACTGGGGCCTTGTTACTTATAGGGAGACT
GCATTGCTTATTGATCCAAAAAATTCCTGTTCTTCATCCCGCCAGTGGGTTGCTCTGGTTGTGGGACATG
AACTCGCCCATCAATGGTTTGGAAATCTTGTTACTATGGAATGGTGGACTCATCTTTGGTTAAATGAAGG
TTTTGCATCCTGGATTGAATATCTGTGTGTAGACCACTGCTTCCCAGAGTATGATATTTGGACTCAGTTT
GTTTCTGCTGATTACACCCGTGCCCAGGAGCTTGACGCCTTAGATAACAGCCATCCTATTGAAGTCAGTG
TGGGCCATCCATCTGAGGTTGATGAGATATTTGATGCTATATCATATAGCAAAGGTGCATCTGTCATCCG
AATGCTGCATGACTACATTGGGGATAAGGACTTTAAGAAAGGAATGAACATGTATTTAACCAAGTTCCAA
CAAAAGAATGCTGCCACAGAGGATCTCTGGGAAAGTTTAGAAAATGCTAGTGGTAAACCTATAGCAGCTG
GTTTCTGCTGATTACACCCGTGCCCAGGAGCTTGACGCCTTAGATAACAGCCATCCTATTGAAGTCAGTG
TGGGCCATCCATCTGAGGTTGATGAGATATTTGATGCTATATCATATAGCAAAGGTGCATCTGTCATCCG
AATGCTGCATGACTACATTGGGGATAAGGACTTTAAGAAAGGAATGAACATGTATTTAACCAAGTTCCAA
CAAAAGAATGCTGCCACAGAGGATCTCTGGGAAAGTTTAGAAAATGCTAGTGGTAAACCTATAGCAGCTG
From the birth of the field of genetics until a decade ago, it was generally assumed that the parental origin of a gene could have no effect on its function. In the vast majority of studies carried out during the last 90 years, this paradigm has appeared to hold true. However, with increasingly sophisticated genetic and embryological investigations in the mouse, important exceptions to this rule have been uncovered over the last decade. First, the results of nuclear transplantation experiments carried out with single-cell fertilized embryos have demonstrated an absolute requirement for both a maternally-derived and a paternally-derived pronculeus to allow full-term development (McGrath and Solter, 1983). Second, in animals that receive both homologs of certain chromosomes or subchromosomal regions from one parent and not the other (through the mating of translocation heterozygotes as described in Section 5.2.3), dramatic effects on development can be observed including enhanced or retarded growth and outright lethality (Cattanach and Kirk, 1985). Third, either of two deletions that cover a small region of mouse chromosome 17 can be transmitted normally from a father to his offspring, but these same deletions cause prenatal lethality when they are maternally transmitted (Johnson, 1974; Winking and Silver, 1984). Fourth, similar parent-of-origin effects have been observed on the phenotypes expressed by animals that carry a targeted knock-out allele at the Igf2 locus (DeChiara et al., 1991). Finally, molecular techniques have been used to directly demonstrate the expression of transcripts from one parental allele and not the other at the Igf2r locus (Barlow et al., 1991) and the H19 locus (Bartolomei et al., 1991). The accumulated data indicate that a subset of mouse genes (on the order of 0.2%) will function differently in normal embryos depending on whether they have been inherited through the male or the female gamete, such that one allele will be expressed and the other will be silent. Genomic imprinting is the term that has been coined to describe this situation in which the phenotype expressed by a gene varies depending on its parental origin (Sapienza, 1989). Further experiments have demonstrated that, in general, the "imprint" is erased and regenerated during gametogenesis so that the function of an imprintable gene is fully determined by the sex of its progenitor alone, and not by earlier ancestors.
The trouble with facts is that there are so many of them.Samuel Crothers: The Gentle Reader (1903)
12/8/11
Manual (mostly) curation of the biomedical literature
Rocky ISBC 12/8/11
Rocky ISBC
Curators use controlled terms from structured vocabularies (ontologies) to annotate complex biological systems described in the literature
The knowledge is in the details
12/8/11
Rocky ISBC 12/8/11
Crash Blossomsand other semantic ambiguities
translating what we say into what we mean: data,
words and knowledge
“Violinist Linked to JAL Crash Blossoms”
“MacArthur Flies Back to Front”
“Squad Helps Dog Bite Victim”
“Red Tape Holds Up New Bridge.”
Today there are many biomedical ontologies…
Open Biomedical Ontologieshttp://www.obofoundry.org/
The ‘s link to the term request trackers for the listed ontologies.
12/8/11Rocky ISBC
Rocky ISBC 12/8/11
Something very important and very weird is happening to the book right now: It’s shedding its papery corpus and transmigrating into a bodiless digital form, right before our eyes. We’re witnessing the bibliographical equivalent of the rapture. If anything we may be lowballing the weirdness of it all. Lev Grossman, NYTimes Book Review Sept 4, 2011
Semantic Web
Semantic Web Layer Cake (Berners-Lee, 2000)12/8/11Rocky ISBC
Rocky ISBC
…..into the Future
The current back-propagation of biomedical literature of semantic integration using ontologies is not scalable to necessary level of granularity and context needed
A key element of data integration is the mark-up of data at the time of generation
Reasoned Argument communication includes providing methods and data to enable reproducibility, and requires
open access to the semantically enriched discussion, machine-readable metadata, accessible datasets, peer review discussions, and possibility of testing for reproducibility
12/8/11
Rocky ISBC
1 - Improving Knowledge Communication
What are functionalities neededdetail methods, both wet and dry
provide data with appropriate metadata
support interactive results, i.e., tables and figures
track metrics of utility, usage, and impact
12/8/11
Technologyelectronic lab books that are easy and functional
data collection and repositories that provide standards and persistence
new models for data interconnections
real-time metrics available
Rocky ISBC
What’s Changing - 2
Peer Review
Journal Impact (the Myth of Impact Factors)
Supplementary Material (i.e., the DATA) missing and or incomplete
Metrics of Impact of Research
Persistence of Data
12/8/11
Rocky ISBC
Peer Review-1 – bad reviewhard to engage expert reviews for multi-
component research
12/8/11
The Scientist
Rocky ISBCSlide from Carol Bult
12/8/11
Large computation analysis require multiple coordinated
reviews
Peer Review – bad review 2Computation analysis verity depends on
data input
12/8/11
Rocky ISBCFaculty of 1000
Ascertainment bias refers to a systematic distortion in measuring the true frequency of a phenomenon due to the way in which the data are collected.
Rocky ISBC
We need to enable reproducibility
12/8/11
Rocky ISBC 12/8/11
Rocky ISBC
Research data is simply not available
50 highest impact research journals
1st 10 original research articles of 2009
88% of journals had ‘some’ statement on sharing of data
50% of articles did not meet journal standards
9% of articles in full compliance
algorithms and meta-date required for reproducibility not required by any journal
12/8/11Alsheikh-Ali et al., PLoS One 2011;6(9):e24357. Epub 2011 Sep 7.
Rocky ISBC
Changing Incentives to Publish - 1
12/8/11
Rocky ISBC
Changing Incentives to Publish - 2
12/8/11
Nature Medicine 16, 744 (2010) doi:10.1038/nm0710-744
Rocky ISBC
2 - Impacting Our World
Open Access to data within supportive environment accelerates knowledge discovery
Social Aspects: How do we quantify impact of use/reward system?
Coolness: How do we make it attractive to do/ use?
12/8/11
Rocky ISBC
Sharing Data – Crowd Sourcing
12/8/11
Rocky ISBC
Interactive Communication
Imbedded links to data for figures
Immediate access to referenced material
Interactive community
12/8/11
Blogs and commentary
Analytics of impact
Rocky ISBC
Initiatives to Access Data
12/8/11
uvm biomedical figuresearch
Rocky ISBC
Interactive Publications
12/8/11
Jonathan Eisen's Blogspot – 9/6/11
Rocky ISBC
Metrics of Paper Impact -1
12/8/11
Rocky ISBC
3 – Overcoming Obstacles
New Publication Models
Data Preservation –
12/8/11
Rocky ISBC 12/8/11publish your data – datadryad.org
Rocky ISBC
Key PointsCommunication of research methods, data and results is changing.
Access to research is limited outside northern hemisphere - institutional access missing – thus limiting the globalization of science.
Utility of research depends on inter-connections and access to data and results; cloud-sourcing of science imminent.
The reward mechanism (tenure /cash) via publication record is changing, but slowly for most of us.
The business model of scientific publishing is under great stress.
Government investment mechanisms for support and sharing of science endeavors are under intense discussion.
New research communication mechanisms are coming; some are already here.
12/8/11
Rocky ISBC
Summary
We must continue to support the Reasoned Argument
- in context of massive amounts of digital data, this includes comprehensive data access to maximize data integration and enable reproducibility
The necessary upheaval in scientific communication requires both technological and sociological innovations
YOU can be part of this sea change in research communication
12/8/11
Rocky ISBC 12/8/11
Gene Ontology Consortium
Mouse Genome Informatics
FoRCe Workshop
Rocky ISBC
Acknowledgements
MGI PIsCarol Bult, Janan Eppig, Jim Kadin, Joel Richardson, Martin
Ringwald
GO Consortium PIs and CouncilMichael Ashburner, Mike Cherry, Suzanna Lewis, Paul
Thomas, Paul Sternberg;
Rolf Apweiler, Rex Chisholm, Eva Huala
GO @ MGIAlex Diehl, Mary Dolan, David Hill,
Li Ni, Harold Drabkin, Li Ni,
Dmitry Sitnikov
Funding: NIH-NHGRI P-41 grants to MGI and GOC; GM080646 to PRO
12/8/11