Activin–like kinase–3 activity is important for kidney regeneration and reversal of fibrosis Hikaru Sugimoto, Valerie S. LeBleu, Dattatreyamurty Basukonda, Peter Keck, Gangadhar Taduri, Wibke Bechtel, Hirokazu Okada, William Carlson Jr, Philippe Bey, Mary Rusckowski, Björn Tampe, Desiree Tampe, Keizo Kanasaki, Michael Zeisberg and Raghu Kalluri
Supplementary Material and Methods
Quantitative PCR analysis
Quantitative PCR was performed to analyze the gene expression profile of BMP7, BMP
receptors Alk2, Alk3, Alk6 and BMPR II, and BMP–binding proteins chordin, crim1,
fibrillin1, follistatin, KCP, USAG1, gremlin and noggin using ABIprism 7000 (Applied
Biosystems) and normalized to 18S levels. The following primers for the listed genes
were used:
Forward primer Reverse primer Snail 5’–CTTGTGTCTGCACGACCTGT–3’ 5’–AGGAGAATGGCTTCTCACCA–3’ CTGF 5’–GTGGAATATTGCCGGTGCA–3’ 5’–CCATTGAAGCATCTTGGTTCG–3’ COL–I 5’–TGTAAACTCCCTCCACCCCA–3’ 5’–TCGTCTGTTTCCAGGGTTGG–3’ FN–EIIIA 5’–ATCCGGGAGCTTTTCCCTG–3’ 5’–TGCAAGGCAACCACACTGAC–3’ BMPR2 5’–TCCACCTGGGTCATCTCCA–3’ 5’–CCCTGTCACTGCCATTGTTG–3’ Alk2 5’–TGGCCTGACTGGTTGTCAGA–3’ 5’–TTCCGTCAAAGCAGCCACT–3’ Alk3 5’–GGACATGCGTGAGGTTGTGT–3’ 5’–CGCTGTTCCAGCGGTTAGAC–3’ Alk6 5’–GCGGCCTATGCCATTTACAC–3’ 5’–AGTCTCGATGGGCGATTGC–3’ BMP7 5’–CCTCTGTTCTTGCTGCGCTC–3’ 5’–AAGCTGGAGTGCACCTCGTT–3’ Chordin 5’–GTAGCGAGGTGGTGGCCAT–3’ 5’–CAGGACAGTGCGCTGGTTC–3’ Crim 5’–GGACAGCTACGAAACGCAAGT–3’ 5’–CATCTTGCTGGCAGGGTACA–3’ Fibrillin1 5’–TCGACGAGTGTCAGAATGGC–3’ 5’–TGCCTGCAGTGTTGATGCA–3’ Follistatin 5’–TGCCAGTGACAATGCCACAT–3’ 5’–CCAGAAGAGCAGGCAGCTTC–3’ KCP 5’–AGTTCCAACCCATGCCTCC–3’ 5’–GGCACTTCACAGGCACACAT–3’ USAG1 5’–TTAAACCTGTCCCGGCACA–3’ 5’–CTGCCTCCATTCCTGGCTT–3’ Gremlin 5’–TGAAGCAGACCATCCACGAG–3’ 5’–GGCCATAACAGAAGCGGTTG–3’ Noggin 5’–AGCGAGATCAAAGGGCTGG–3’ 5’–CTCAGGCGCTGTTTCTTGC–3’
Nature Medicine doi:10.1038/nm.2629
Animal experiments
Nephrotoxic serum induced nephritis (NTN): NTN was induced in CD1 mice by pre–
immunizing with a subcutaneous injection of normal sheep IgG (200 µg) in complete
Freund’s adjuvant (day 1) followed by intravenous injection of nephrotoxic serum (50 µl,
from day 5 to day 7). Six weeks after NTN induction, treatment with THR–123 (5
mg.Kg–1 given orally every day) was initiated until 9 weeks. Mice were sacrificed at
week 1, week 3, week 6 and week 9 following NTN induction.
Ischemic reperfusion injury: Eight weeks–old C57Bl/6 mice were anesthetized with a
mixture of ketamine and xylazine and the left renal pedicle was clamped for 25 minutes.
On same day after recovery from the surgery, THR–123 (5 mg.Kg–1 given orally every
day) or vehicle (PBS) treatments were initiated. Seven days after surgery and treatment
initiation, mice were sacrificed for analysis.
Unilateral ureteral obstruction: Eight to twelve weeks–old CD1 mice were
anesthetized with a mixture of ketamine and xylazine. The ureter was separated from the
surrounding tissues and two ligatures are placed about 5 mm apart in upper two–thirds of
the ureter of the left kidney to obtain reliable obstruction. On the same day after surgery
and recovery, mice were treated with BMP7 (300 µg.Kg–1 given i.p. every other day),
THR–123 (5 mg.Kg–1 or 15 mg.Kg–1 given orally every day, or 5 mg.Kg–1 given i.p.
every day) or PBS (i.p. every day) as control. Mice were sacrificed at day 5 or 7 post
UUO and treatment.
Type IV collagen α3 chain knockout mice (COL4A3KO): Eight weeks–old
COL4A3KO mice on C57Bl/6 background were treated with either THR–123 (5 mg.Kg–1
Nature Medicine doi:10.1038/nm.2629
given orally every day) or vehicle (PBS). COL4A3KO mice were sacrificed at 16 weeks
of age.
Diabetic nephropathy: Eight weeks–old male CD–1 mice were used for all the diabetic
nephropathy related experiments. Diabetic nephropathy was initiated with a single intra–
peritoneal (i.p.) injection of streptozotocin (STZ: 200 mg.Kg–1) to each mouse. Induction
of diabetes was assessed by elevated blood glucose levels ( > 16 mM) 2 weeks after STZ
injection. One month after induction of diabetes, mice were separated into three groups
and treated with BMP7 (300 µg.Kg–1 given i.p. every other day) or vehicle. Five months
after induction of diabetes, mice were treated with THR–123 (5 mg.Kg–1 given orally
every day). Mice were sacrificed at five months (before the treatment) or six months after
induction of diabetes. For the captopril (CPR) and THR–123 combination therapy trial,
diabetic mice were separated into three groups seven months after induction of diabetes
and treated with CPR (50 mg.Kg–1 given orally every day) or a combination of CPR and
THR–123 (5 mg.Kg–1 given orally every day). Mice were sacrificed at seven months
(before the treatment) or eight months after induction of diabetes.
Morphometric analysis
Kidney sections were stained with hematoxylin and eosin (H&E), Masson's trichrome
(MTS), and periodic acid–Schiff (PAS). The extent of renal injury was estimated by
morphometric assessment of the tubulointerstitial injury and glomerular damage. For the
analysis of glomerulosclerosis in NTN mice, 20 glomeruli per each mouse were
randomly picked and each glomerulus was evaluated according to the following scale: 0,
no sclerosis; 1: 0 to ¼ of a glomerular surface area sclerotic; 2: ¼ to ½ sclerotic; 3: ½ to
¾ sclerotic; and 4 or more: ¾ sclerotic or with crescents. A glomerulosclerosis score was
Nature Medicine doi:10.1038/nm.2629
calculated as an arithmetic mean of these numbers for each mouse. The
glomerulosclerosis scores from all mice were arbitrarily divided into 4 groups: no disease
group, mild, moderate and severe disease group. The percentage of scores within these 4
groups was calculated. For morphometric analyses of glomerular damage in COL4A3KO
mice, 100 glomeruli were counted per slide from random fields of view, and five such
slides were counted per experimental group. The number of normal glomeruli was
expressed as a percentage of the total number of glomeruli counted. For glomerular
damage analysis in DN mice, we evaluated mesangial matrix expansion and enlargement
(hypercellularity) of the glomeruli. A point counting method was used to quantify
mesangial matrix deposition. We analyzed 20 PAS–stained glomeruli from each mouse
on a digital microscope screen grid containing 667 (29 x 23) points. The number of grid
points that hit pink or red mesangial matrix deposition were divided by the total number
of points in the glomerulus to obtain the percentage of mesangial matrix deposition in a
given glomerulus. For tubular atrophy score in NTN mice, ten 200x visual fields were
randomly selected for each slide and tubular atrophy was assessed according to the
following scale: 0: no atrophy, 1: 0 to ¼ of a visual field was occupied by atrophied
tubules, 2: ¼ to ½ , 3: ½ to ¾ , and 4: more than ¾. A tubular atrophy score was then
calculated for each mouse as an arithmetic mean of these numbers. The tubular atrophy
scores from all mice were arbitrarily divided into 4 groups: no disease group, mild,
moderate and severe disease group. The percentage of mice within these 4 groups was
calculated and presented on the graph. In IRI mice, percentage of renal tubular necrosis
was estimated by the number of necrotic tubules divided by the total number of tubules
evaluated (~400) in the outer medulla. For the analysis of interstitial fibrosis in NTN
Nature Medicine doi:10.1038/nm.2629
mice, ten 200x visual fields were also selected randomly for each MTS stained kidney
section and interstitial fibrosis was evaluated according to the following scale; 0: no
fibrosis, 1: 0 to ¼ of a visual field was affected by interstitial fibrosis, 2: ¼ to ½, 3: ½ to
¾, and 4: more than ¾. A fibrosis index was calculated for each mouse as an arithmetic
mean of these numbers. The fibrosis indices from all mice were arbitrarily divided into 4
groups: no disease group, mild, moderate and severe disease group. The percentage of
mice within these 4 groups was calculated and presented in a bar graph. Finally, the
relative interstitial volume was evaluated by morphometric analysis using a 10 mm2
graticule. Five to ten randomly selected cortical areas were evaluated for each mouse.
Three hundred to five hundred tubules were evaluated for their widened lumen and
thickened basement membranes to estimate percentage of atrophied tubules. For
morphometric analyses of immunolabeled cells or tubules, the number of cells or tubules
positively stained for the indicated marker(s) were counted in five random visual fields at
indicated magnification from three to five mice per experimental groups. The number of
positive cells per tubule was then expressed as a percent of all tubules evaluated.
Cell lines and in vitro assays
HK–2 (ATTC, CRL–2190) are immortalized proximal tubule epithelial cells derived
from normal adult human kidney. The cells were cultured in DMEM or RPMI1640 media
supplemented with penicillin (100 µg.ml-1) and streptomycin (100 µg.ml-1) and 10%
heat–inactivated fetal bovine serum at 37°C in 5% CO2. Elisa kit for IL–6, IL–8 and
ICAM–1 was purchased from R&D system and Elisa were performed according to the
manufacturer’s directions. The tubular epithelial cell line NP–1 was generated from
freshly isolated tubuli from a C57BL/6J mouse1-3. MCT cells are mouse proximal
Nature Medicine doi:10.1038/nm.2629
originally harvested from the renal cortex of SJL mice4. Inflammatory cytokine
production following TNF-α incubation, EMT program and apoptosis in vitro analyses
are detailed below.
Inflammatory cytokine production
Human proximal tubular epithelial cells–derived HK–2 cells were cultured on 24–well
plates (30,000 cells per well). Cells were exposed to K–SFM medium alone or with TNF-
α (5 ng.ml-1). Twenty hours after TNF-α incubation, cells were washed twice with pre–
warmed culture media and the cells were subsequently incubated with various
concentration of THR–123 or BMP7 for 60 hours. At the end of incubation, culture
medias were harvested and ELISA analysis for IL–6, IL–8 and ICAM–1 were performed.
EMT Program analysis in vitro
We induced EMT in several TEC lines. EMT was induced in NP–1 or MCT cells by
exposing them to 3 ng.ml-1 recombinant human TGF-β1 for 48 hours. When EMT
occurred, the culture medium was replaced with culture medium supplemented with
THR–123 (10 µM) or recombinant human BMP7 (100 ng.ml-1). Arginine buffer (0.44 M
L–arginine, 55 mM Tris, 21 mM NaCl, 0.88 mM KCl, pH 8.2) was used to dissolve
THR–123 (100 mM stock). The stock of THR–123 was then diluted in DMEM to the
indicated final concentration. We also used Arginine buffer alone as control. The stability
of THR–123 in culture medium is ~48 hours, and the culture medium was changed every
~24 hours. After 48 hours, we characterized the cells by immunocytochemistry using
primary monoclonal antibodies to E–cadherin (2.5 g.ml-1) and rhodamine–conjugated
secondary antibodies (Jackson Immunoresearch). We visualized the staining using
fluorescence microscopy and documented representative pictures using Spot advanced
Nature Medicine doi:10.1038/nm.2629
software (Carl Zeiss). Protein and total RNA were also harvested at the end of
experiment. For the morphometric analysis of EMT, length to width ratio of cells in
bright field pictures were measured by image J software.
Apoptosis
HK–2 cells are passaged into 24–well plates (~25,000 to 30,000 cell per well). Once the
cells attached to the well, they were exposed to K–SFM medium alone or K–SFM
medium containing THR–123 (250 µΜ). BMP7 (1 µg.ml-1) serves as a positive control in
these experiments. Two hours after incubation, cells were exposed to cisplatin (10
µΜ) for 60 hours. Apoptosis was determined by staining of Annexin V–FITC, followed
by fluorescence microscopy.
Western blot analyses
Cells or kidneys were homogenised in RIPA lysis buffer supplemented with protease
cocktail inhibitor (Roche). Proteins were resolved by SDS–PAGE acrylamide gel
electrophoresis and transferred onto PVDF membranes (Millipore Corporation) and
blocked in 5% dry milk in TBS–T (TBS pH 7.6, 0.1% Tween–20) or 5% BSA in TBS–T
before incubation with respective primary and secondary HRP-conjugated antibodies.
Relative band densities for E–cadherin, Alk3 and BMP7 were analyzed using ImageJ gel
analyser software and normalized to band densities of actin.
Supplementary References
1 Strutz, F. et al. Identification and characterization of a fibroblast marker: FSP1. J Cell Biol 130, 393–405 (1995).
Nature Medicine doi:10.1038/nm.2629
2 Strutz, F. et al. TGFb1 induces proliferation in human renal fibroblasts via induction of basic fibroblast growth factor (FGF–2). Kidney International 59, 579–592 (2001).
3 Koziolek, M.J. et al. Role of CX3C–chemokine CX3C–L/fractalkine expression in a model of slowly progressive renal failure. Nephrol Dial Transplant 25, 684–698 (2010).
4 Haverty, T.P. et al. Characterization of a renal tubular epithelial cell line which secretes the autologous rarget antigen of autoimmune experimental interstitial nephritis. J Cell Biol 107, 1359–68 (1988).
Supplementary Figures and Figure Legends
Nature Medicine doi:10.1038/nm.2629
Supplementary Figure 1: Alk3 and BMP7 expression profile and anti–inflammatory action of THR–123 in NTN induced fibrosis. (a) Representative pictures of kidneys from control mice and mice three weeks following NTN induction immunolabeled for Alk3 and BMP7. Scale bar: 50 µm. (b) Western blot analyses band intensities graphs for Alk3 and BMP expression in kidney lysates from
Nature Medicine doi:10.1038/nm.2629
control mice and mice at week 1, 3, 6, and 9 following NTN induction. (c) Representative pictures of kidneys from Alk3 f/f and γGT–Cre; Alk3 f/f mice three weeks following NTN induction immunolabeled for Alk3 and F4/80 and morphometric analysis of the number of F4/80+ and F4/80+ / Alk3+ cells per 400X field of view. Scale bar: 50 µm. (d) LacZ substrate staining in liver of γGT–cre; R26R–Rosa–LSL–LacZ reporter mice, eosin counter stain. Scale bar: 10 µm. (e) Representative images of kidneys from Alk3 f/f and γGT–Cre; Alk3 f/f mice following NTN induction immunolabeled for p–Smad2 and quantitation of percent of p–Smad2 positive tubule. Scale bar: 50 µm. (f) Representative mages of H&E stained kidneys from unchallenged adult wild–type (WT), γGT–Cre, Alk3 f/f, and γGT–Cre; Alk3 f/f mice. Scale bar: 10 µm. (g) Representative images of MTS stained kidneys from unchallenged wild–type (WT) and γGT–Cre mouse kidneys and wild–type (WT) and γGT–Cre mice nine weeks following NTN induction and morphometric analysis for relative interstitial volume in indicated groups. Scale bar: 10 µm. (h) Representative images of kidneys from indicated experimental groups immunolabeled for Mac–1. Scale bar: 50 µm. Data are shown as mean ± s.e.m. * : P < 0.01, ns: not significant.
Nature Medicine doi:10.1038/nm.2629
Supplementary Figure 2: Anti–apoptosis and anti–inflammatory activities of THR–123. (a) IL–6, IL–8 and ICAM–1 production by HK–2 cells exposed to K–SFM medium alone or medium supplemented with TNF–α with and without various concentration of THR–123 (µM) or BMP7 (ng.ml–1). (b) Representative merged picture (bright field and Annexin V (green)) overlay images of NP–1 cells incubated with TGF-β1 in the presence of the indicated molecules. (c) Representative merged picture (bright field and Annexin V (green)) of NP–1 cells incubated in hypoxia in the presence of indicated molecules. (d) Representative merged picture (bright field, Annexin V (green) and propidium idodide (red)) of HK–2 cells exposed either to K–SFM media alone or K–SFM medium containing cisplatin, with or without THR–123. Scale bar: 10 µm. Data are shown as mean ± s.e.m. * : P < 0.01, ** : P < 0.05.
Nature Medicine doi:10.1038/nm.2629
Supplementary Figure 3: THR–123 inhibits epithelial–to–mesenchymal transition program. (a) Representative bright field image of NP–1 cells exposed to TGF-β1 with or without either BMP7, THR–123, or control peptide. Scale bar: 50 µm. (b) Representative images of E–cadherin (green) staining of NP–1 cells exposed to TGF-β1 with or without either BMP7, THR–123, or control peptide (ctrl. Peptide). Nuclei are labeled with DAPI (blue). Scale bar: 10 µm. (c) Western blot analysis for E-cadherin and band intensity graph of NP1 cell lysates with the indicated conditioning of the cells. Actin was used as normalizing control. (d) Western blot for p–Smad1/5 in NP–1 cells exposed to arginine buffer or THR–123 at the indicated concentration. (e) Representative bright field images
Nature Medicine doi:10.1038/nm.2629
of MCT cells exposed to TGF-β1 and EGF with or without THR–123 and qPCR analysis plot for CTGF and Snail1 expression in MCT cells conditioned with the indicated molecules. Scale bar: 10 µm. (f) Representative bright field images of NP–1 cells incubation with TGF-β1 and EGF with and without BMP7, THR–123, or control peptide. Scale bar: 10 µm. (g) Representative images of NP–1 cells in indicated conditions immunolabeled for E–cadherin (green). Scale bar: 10 µm. (h) Ratio of length to width of NP–1 cells in the indicated conditions and percent epithelial phenotype ( > basal ratio) plotted using basal length to width ratio of NP–1 cells as 1.4 ± 0.2 (arbitrary scale). Data are shown as mean ± s.e.m. * : P < 0.05.
Supplementary Figure 4: THR–123 inhibits renal injury and fibrosis in mice with IRI and UUO. (a) Representative image of H&E stained kidney of mice after ischemia re–perfusion injury (IRI) treated with PBS (n = 5) or THR–123 (n = 4, 5 mg.Kg–1 given orally every day), and morphometric analysis of percent tubular necrosis and blood urea nitrogen measurements (day 7 post IRI). Scale bar: 10 µm, arrows: necrotic tubules. (b)
Nature Medicine doi:10.1038/nm.2629
Representative image of MTS stained kidneys of control mice (n = 4), mice five days following unilateral uretal obstruction (UUO) (n = 4), five days following UUO and treated with 5 mg.kg-1 THR–123 (n = 4), and mice five days following UUO and treated with 15 mg.kg-1 THR–123 (n = 4), and morphometric analysis for percent of relative interstitial volume. Scale bar: 50 µm. (c) Representative image of MTS stained kidneys of mice seven days following UUO (n = 4), seven days following UUO and treated with BMP7 (n = 8), seven days following UUO and treated with THR–123 i.p. (n = 7), and seven days following UUO and treated with THR–123 p.o. (n = 7), and morphometric analysis for percent relative interstitial volume. Scale bar: 50 µm. (d) Quantitative qPCR analysis for fibronectin–EIII (FN–EIII) and type I collagen (COL–I) expression levels in normal kidney and kidneys of mice seven days following UUO with or without the indicated treatment. Data are shown as mean ± s.e.m. * : P < 0.01, ** : P < 0.05, ns: not significant.
Nature Medicine doi:10.1038/nm.2629
Supplementary Figure 5: THR–123 action on NTN–induced histology and macrophage infiltration is associated with p–Smad1/5. (a) Representative picture of H&E stained kidneys from mice six and nine weeks following NTN induction and mice nine weeks following NTN induction and treated with THR–123. Scale bar: 50 µm. (b) Quantitative qPCR analysis for fibronectin (FN–EIII) and type I collagen (COL–I) expression in kidneys of control mice (0 week NTS) (n = 5), mice at one (n = 6), three (n = 8), and six (n = 6) weeks following NTN induction, and mice at nine weeks following NTN and treated with THR–123 (n = 6). (c) Representative image of kidneys from indicated experimental groups immunolabeled for Mac–1. Scale bar: 50 µm. (d) Morphometric analysis of the number of Mac–1+ macrophages per 400X field of view. (e) Representative image of kidneys from the indicated experimental groups immunolabeled for p–Smad1/5 and percent p–Smad1/5 positive tubules. Scale bar: 50 µm, arrows: positive nuclear p–Smad1/5 staining. Data are shown as mean ± s.e.m. * : P < 0.01, ** : P < 0.05.
Nature Medicine doi:10.1038/nm.2629
Supplementary Figure 6: THR–123 inhibits renal fibrosis in COL4A3 deficient mice. (a) Representative images of PAS stained (upper panels) and MTS stained (lower panels) glomeruli from 16 weeks–old wild–type (WT) (n = 5), 16 weeks–old COL4A3KO (KO) (n = 5), and 16 weeks–old COL4A3KO mice treated with THR–123 (n = 5). Scale bar upper panels: 10 µm, scale bar lower panels: 50 µm. (b) Morphometric analyses for the indicated experimental groups for percent normal glomeruli, tubular damage index, and relative interstitial volume. (c) Blood urea nitrogen measurement for the indicated experimental groups. (d) Representative images of kidneys immunolabeld for FSP1 (green) and E–cadherin (red) in kidneys of indicated experimental groups and quantitation of the percent E–cadherin / FSP1double positive tubules. Scale bar: 50 µm. (e) Representative images for Mac–1 immunolabeling of kidneys from indicated experimental groups and number of interstitial macrophages counted per 400X field of
Nature Medicine doi:10.1038/nm.2629
view. Scale bar: 50 µm. f. Representative image of kidneys from the indicated experimental groups immunolabeled for p–Smad1/5 and percent of p–Smad1/5 positive tubules. Scale bar: 50 µm. Data are shown as mean ± s.e.m. * : P < 0.01.
Supplementary Figure 7: THR–123 and captopril treatment of mice with diabetic nephropathy. (a) Representative images of PAS stained kidneys of control mice (n = 5), mice five months following DN induction (n = 6), six months following DN induction (n = 10), six months following DN induction and treated with BMP7 (n = 4), and six months following DN induction and treated with THR–123 (n = 9). Scale bar: 50 µm. (b)
Nature Medicine doi:10.1038/nm.2629
Representative images of kidneys from mice from the indicated experimental groups immunolabeled for Mac–1 and quantitation of the number of Mac–1+ macrophages counted per 400X field of view. Scale bar: 50 µm. (c) Representative images for F4/80 immunolabeling of kidneys from indicated experimental groups and quantitation of the number of F4/80+ macrophages counted per 400X field of view. Scale bar: 50 µm. (d) Representative image of kidneys from the indicated experimental groups immunolabeled for p–Smad1/5 and percent of p–Smad1/5 positive tubules. Scale bar: 50 µm, arrow: p–Smad1/5 positive tubules. (e) Representative images of kidneys from mice seven month following DN induction, eight month following DN induction, eight month following DN induction and treated with captopril (CPR), and eight month following DN induction and treated with both CPR and THR–123 immunolabeled for Mac–1 and number of Mac–1+ macrophages counted per 400X field of view. Scale bar: 50 µm. (f) Representative image of TUNEL stained kidneys from the indicated experimental groups and quantitation of the number of TUNEL+ tubules per 200X field of view. Nuclei are stained with DAPI (blue). Scale bar: 50 µm, arrow: TUNEL positive tubules. (g) Representative image of kidneys from the indicated experimental groups immunolabeled for p–Smad1/5 and percent of p–Smad1/5 positive tubules. Scale bar: 50 µm, arrow: p–Smad1/5 positive tubules. (h-i) Blood glucose level (h) and body weight (i) measurements in the indicated experimental groups. Data are shown as mean ± s.e.m. in the graph. * : P < 0.01, ** : P < 0.05, #: P = 0.058, ##: P = 0.05, ns: not significant.
Nature Medicine doi:10.1038/nm.2629
Supplementary Figure 8: Effect of THR–123 is inhibited in the kidneys of Alk3 deleted mice. (a) Representative images of H&E stained kidneys from Alk3 f/f and γGTCre; Alk3 f/f
mice following IRI with or without THR–123 treatment and morphometric analysis for the percent of renal tubular necrosis. Scale bar: 50 µm. (b) Representative images of kidneys of mice from the indicated experimental groups immunolabeled for Mac–1 and quantitation of the number of Mac–1+ macrophages counted per 400X field of view. Scale bar: 50 µm. (c) Representative image of TUNEL stained kidneys from the indicated experimental groups and number of TUNEL+ tubules per 200X field of view. Nuclei are stained with DAPI (blue). Scale bar: 50 µm. (d) Representative image of TUNEL stained kidneys from the indicated experimental groups and number of TUNEL+ tubules per 200X field of view. Nuclei are stained with DAPI (blue). Scale bar: 50 µm. Data are shown as mean ± s.e.m. in the graph. * : P < 0.01, ** : P < 0.05.
Nature Medicine doi:10.1038/nm.2629