Transcript
Page 1: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

A genetic variant located in miR-146b promoter region is associated with

prognosis of gastric cancer

Weizhi Wang1,†, Mulong Du2,3,4,†, Zheng Li1,†, Lei Zhang1,5†, Qing Li1†, Zhipeng Xu1,

Bowen Li1, Linjun Wang1, Fengyuan Li1, Diancai Zhang1, Hao Xu1, Li Yang1, Weida

Gong6, Fulin Qiang7, Zhengdong Zhang2,3,*, Zekuan Xu1,*

1Department of General Surgery, the First Affiliated Hospital of Nanjing Medical

University, Nanjing, China; 2Department of Environmental Genomics, Jiangsu Key

Laboratory of Cancer Biomarkers, Prevention and Treatment, Cancer Center, Nanjing

Medical University, Nanjing, China; 3Department of Genetic Toxicology, the Key

Laboratory of Modern Toxicology of Ministry of Education, School of Public Health,

Nanjing Medical University, Nanjing, China; 4Department of Biostatistics, School of

Public Health, Nanjing Medical University, Nanjing, China; 5The Affiliated

Children’s Hospital of Nanjing Medical University; 6Department of General Surgery,

Yixing Tumor Hospital, Yixing, China; 7Core Laboratory, Nantong Tumor Hospital,

Nantong, China.

†These authors contributed equally to this work.

*Correspondence to:

Zekuan Xu, Department of General Surgery, First Affiliated Hospital of Nanjing

Medical University, 300 Guangzhou Road, Nanjing, Jiangsu Province, 210029, China,

Email: [email protected]; Zhengdong Zhang, Department of Environmental

Genomics, School of Public Health, Nanjing Medical University, 101 Longmian

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 2: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Avenue, Jiangning District, Nanjing 211166, China. Tel.: +86 25 86868423; Fax: +86

25 86868499, Email: [email protected].

Running title:Polymorphism in miR-146b with prognosis of gastric cancer

Competing Interests: The authors have declared that there are no competing

interests.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 3: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Abstract

Background: Single nucleotide polymorphisms (SNPs) in the promoter region of

microRNAs (miRNAs) have been reported to be associated with cancer prognosis.

Our previous study found that miR-146b had a strong correlation with the stage

classification of gastric cancer and contributed to tumor progression. The present

study was aimed at investigating whether an SNP located in the promoter region of

miR-146b could affect the survival rate of gastric cancer.

Methods: Using bioinformatics tools, we identified one SNP (rs1536309) that i

s located in the miR-146b promoter. We genotyped this SNP site to assess its

association with gastric cancer prognosis in 940 cases.

Results: We found that the dominant model of miR-146b rs1536309 was associated

with a higher survival rate of gastric cancer. The association remained significant in

the subgroup analysis by age (≤60), sex (male), tumor size (≤5cm), histological type

(diffuse), lymph node metastasis (N0), distant metastasis (M0) and TNM stage (I/II).

Conclusion: Our results suggested that the miR-146b rs1536309 polymorphism may

be a potential biomarker for the prognosis of gastric cancer.

Impact: This is the first evidence showing that patients carrying the miR-146b-5p

rs1536309 CC/CT genotypes exhibited better survival than those carrying the TT

genotype, suggesting the protective effect of the C allele in the prognosis of gastric

cancer.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 4: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Introduction

Gastric cancer is one of the most prevalent life-threatening cancers in the world, with

high incidence rates in Eastern Asia(1). With improvements in surgical and adjuvant

multimodal treatments, the mortality of gastric cancer has declined during the last

decade. However, the prognosis of gastric cancer is still poor, and the 5-year survival

rate is only approximately 20%(2). In China, gastric cancer remains the third leading

cause of cancer death and accounted for approximately 498,000 new deaths in

2015(3). Evidence has revealed that patients with the same tumor grade and

pathological stage who receive similar treatments may have different clinical

outcomes, a finding that indicates the importance of individual variants influenced by

genetic and environmental factors(4). Therefore, identifying genetic variations in key

genes involved in tumor progression as biomarkers to predict the prognosis of gastric

cancer patients is crucial and necessary. It may yield benefits for individualized

therapy and consequently improve survival outcomes.

MicroRNAs (miRNAs) are short, non-coding regulatory RNAs (18-25

nucleotides) that exert post-transcriptional regulatory functions by targeting the

3’-untranslated regions (3’UTR) of mRNAs for cleavage or transcriptional

repression(5). Accumulating evidence has demonstrated that miRNAs are involved in

the development of gastric cancer and can serve as a novel tool for predicting the

prognosis of gastric cancer (6). A miRNA profiling assay has been used to explore the

involvement of miRNAs in cancers. By using this method, our previous study

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 5: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

identified the overexpression of miR-146b-5p in gastric cancer and showed a strong

correlation of its expression with gastric cancer staging classification(7).

Single nucleotide polymorphisms (SNPs), a major type of genetic variant, in

miRNA precursors and their promoter regions may affect miRNA expression levels,

leading to alterations in a variety of biological processes and thereby influencing the

survival of patients(8,9). Therefore, it is rational to postulate that SNPs located in the

promoter or the precursor of miR-146b-5p might exist and be associated with

prognosis in gastric cancer patients. By using the 1000 Genomes Project database as a

resource, we identified a common [minor allele frequency (MAF) > 0.05] SNP

(rs1536309) in the miR-146b-5p promoter. Whether this site is related to the prognosis

of gastric cancer is still unknown. In this study, we genotyped the rs1536309 SNP in

miR-146b-5p in a follow-up study of 940 gastric cancer patients to evaluate its

association with the survival of gastric cancer.

Methods and materials

Ethics statement

The study was approved by the institutional review board of Nanjing Medical

University. Informed written consent was obtained from all subjects. The

experimental protocol was carried out in accordance with International Ethical

Guidelines for Biomedical Research Involving Human Subjects (CIOMS).

Study subjects

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 6: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

The details of the recruited subjects were described in the previous study(10). A total

of 1,022 gastric cancer patients who underwent gastrectomy between January 1999

and December 2006 were recruited from Yixin People’s Hospital, Yixin City, China;

78 of these patients (7.6%) were excluded due to a lack of adequate follow-up

information. Four patients who did not have adenocarcinoma according to the

pathological diagnosis by senior pathologists were also excluded from this study.

Finally, 940 gastric cancer cases with 100% R0 resection were involved in further

analyses. The maximum follow-up time was 119.0 months, and the median follow-up

time was 68.5 months. Survival time was estimated from the date of surgery to the

date of death or last follow-up (March 2009). Clinical features such as tumor site,

tumor size, histological type, depth of invasion, lymph node metastasis, distant

metastasis and TNM classification were collocated from the medical records of the

patients.

SNP selection

We focused on both the miR-146b gene and its promoter region (2 kb upstream from

the transcription start site: chr10: 104194269-104196341) using the UCSC browser

(http://genome.ucsc.edu/), in which a total of 9 SNPs resided. After based on the

criteria of minor allele frequency (MAF) > 0.05 in the CHB (Han Chinese in Beijing,

China [CHB]) and JPT (Japanese in Tokyo, Japan [JPT]) populations in the 1000

Genomes Project, only SNP rs1536309 were enrolled for further genotyping.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 7: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Genotyping

Genomic DNA was extracted from paraffin sections of tumor tissues from all 940

cases. miR-146b-5p rs1536309 (Primer: Forward:

5’-TGCCTGGATCGCCTTAGCT-3’; Reverse:

5’-AGTCCAGTTTCTCATTTTGAAGCA-3’. Probe G: 5’-CATTCCCCGTCATC-3’;

Probe A: 5’-CATTCCCCGTCATC-3’.) was genotyped by the TaqMan SNP

genotyping assay on the ABI 7900HT Real-time PCR System (Applied Biosystems,

Foster City, CA, USA). Approximately 10% of all samples were randomly selected

for further confirmation, and the results were 100% concordant.

Real-time PCR

A total of 56 freshly frozen cancer tissues, which were included in the 940 cases, were

subjected to total RNA extraction by the TRIzol Reagent (Invitrogen, Carlsbad, CA,

USA). The expression of miR-146b-5p was measured by real-time PCR (ABI 7300)

with the SYBR Green assay (TaKaRa Biotechnology, Dalian, China) after reverse

transcription. The conditions for real-time PCR were the same as those in the previous

study(7).

Cell culture

Two different gastric cancer cell lines (SGC-7901 and BGC-823) were purchased

from the cell bank of Chinese Academy of Sciences in 2012 and authenticated by

Beijing Microread Genetech Co; Ltd by using STR Multi-amplification Kit

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 8: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

(MicroreaderTM 21 ID System) and 3100 DNA Analyzer (Applied Biosystems®) in

2014. Cells were cultured in Dulbecco’s Modified Eagle Medium/high glucose culture

medium with 10% FBS, 10 mM HEPES, 2 mM L-glutamine, 1 mM sodium pyruvate,

100 U/ml penicillin, and 100 μg/ml streptomycin. All cells were grown at 37°C in a

humidified atmosphere with 5% CO2. Most reagents were obtained from GIBCO

(Burlington, Ontario, Canada).

Construction of promoter-reporter plasmids and luciferase assays

The 5’ flanking region (-2 kb from the transcriptional start site of the miR-146b

promoter region) fragments with different rs1536309 alleles were constructed and

inserted into the pGL3-promoter vector. DNA sequencing was used to confirm the

plasmids.

Cells were cultured in a 24-well plate for 24 h. The cells were then transfected

with the luciferase reporter constructs mentioned above and pRL-SV40 (as control)

by using Lipofectamine 2000. Luciferase activity was evaluated with a Dual

Luciferase Reporter Assay System (Promega, WI, USA) according to the

manufacturer’s instructions.

Bioinformatic analysis

To explore the potential functions of the polymorphism, bioinformatic analysis was

performed by using HaploReg v4.1

(http://www.broadinstitute.org/mammals/haploreg).

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 9: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Statistical analysis

Survival time was calculated from the date of gastric cancer diagnosis to the date of

death or last follow-up. Survival curves were assessed by Kaplan-Meier analyses. The

associations between the survival time and rs1536309, patient characteristics and

clinical information were estimated with the log-rank test. The mean survival time

was presented when the median survival time was not available. Hazard ratios (HRs)

and their 95% confidence intervals (CIs) with adjustments were calculated by

univariate or multivariate Cox regression models, and the Schoenfeld residual was

used to evaluate the proportional hazards assumption. The clinical features with

significant association of gastric cancer survival served as adjustment variables in the

multivariate model (Table S1). To determine the predictive factors for the prognosis of

gastric cancer, Cox stepwise regression analysis was used with P < 0.05 for entering

and P > 0.10 for removing the individual explanatory variables. All statistical analyses

were performed with SAS software (version 9.4; SAS Institute Inc., Cary, NC, USA)

with a two-sided P-value.

Results

Patient characteristics

As shown in Table S1, a total of 940 gastric cancer patients, including 724 males

(77.0%) and 216 females (23.0%), were included in our study. All of the patients were

treated with surgical resection, and 32.4% of them received adjuvant chemotherapy

after surgery. Over a follow-up period of up to 119.0 months, 439 deaths were

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 10: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

recorded. Histological type, lymph node metastasis, distant metastasis, depth of

invasion and TNM stage showed a significant association with survival time (log-rank

P < 0.05). Compared to patients with diffuse-type gastric cancer, those with

intestinal-type histology had better survival (HR = 0.72, 95% CI = 0.59-0.87).

Patients with lymph node metastasis or distant metastasis were found to have a higher

risk of death (lymph node metastasis: HR = 1.86, 95% CI = 1.51-2.28; distant

metastasis: HR = 1.67, 95% CI = 1.18-2.36) than those without lymph node

metastasis or distant metastasis. In addition, the risk of death increased in a

dose-response manner (log-rank P < 0.001) as the depth of invasion or the TNM stage

increased.

Association between miR-146b-5p rs1536309 and gastric cancer prognosis

The log-rank test and Kaplan-Meier survival curves were used to evaluate the

association between miR-146b-5p rs1536309 and gastric cancer survival in different

genetic models (Table 1). In the co-dominant model, patients carrying the CT

genotype had a better overall survival than those carrying the TT genotype (HR = 0.76,

95% CI = 0.61-0.96) (Fig. 1A). In the dominant model, patients with the CT/CC

genotypes had a reduced risk of death compared to patients with the TT genotype (HR

= 0.78, 95% CI = 0.63-0.98) (Fig. 1B). In addition, the Schoenfeld test showed the

existence of proportional hazards assumption for dominant model of rs1536309 (P =

0.669) and even the global model (P = 0.497).

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 11: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Stratified analyses and stepwise Cox regression models for the prognosis of

gastric cancer

Stratified analyses were further performed to evaluate the association between

miR-146b-5p rs1536309 and gastric cancer survival. As shown in Table 2, better

survival was observed in patients with CT/CC genotypes than in those with the TT

genotype among the following subgroups: age > 60 (HR = 0.73, 95% CI = 0.54-0.98),

male (0.73, 0.57-0.94), tumor size ≤ 5cm (0.72, 0.54-0.96), intestinal histology (0.69,

0.48-0.99), T1 depth of invasion (0.44, 0.22-0.87), no lymph node metastasis (0.61,

0.41-0.91), no distant metastasis (0.79, 0.63-0.99), TNM stage I/II (0.65, 0.45-0.93)

and patients without chemotherapy (0.65, 0.49-0.86). A stepwise Cox regression

model was subsequently used to assess the association between the variables

containing the selected characteristics of the patients (age and sex), clinical features

(tumor size, tumor sites, histological type and TNM stage), miR-146b-5p rs1536309

and gastric cancer prognosis. Finally, two variables (TNM stage and rs1536309) were

included in this model (TNM stage: P < 0.001; rs1536309: P = 0.022) (Table 3).

Association between rs1536309 genotype and the expression of miR-146b-5p

We analyzed the expression level of miR-146b-5p in gastric cancer tissues with the

different rs1536309 genotypes in the present study. As shown in Fig. 2, patients

carrying the CT/CC genotypes expressed lower levels of miR-146b-5p than those

with the TT genotype.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 12: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Effect of miR-146b-5p rs1536309 on transcriptional activity in cell lines

To explore the biological functions of rs1536309 on miR-146b-5p expression, we

constructed luciferase reporter plasmids with either the C or T allele of rs1536309 and

transfected them into different cell lines to assess whether this SNP could alter the

promoter activity. We observed that the transcriptional activity of the construct with

the C allele was significantly lower than that of the construct with the T allele (Fig. 3),

which indicated that the C allele could reduce the promoter activity of miR-146b-5p

and influence its expression level.

The potential effect of miR-146b-5p rs1536309 on the binding affinity of

transcription factors

Given that rs1536309 is located in the promoter region of miR-146b, this genetic

variant may affect the promoter activity by altering the binding of transcription factors.

Bioinformatic analysis by HaploReg v4.1 suggested that the rs1536309 C allele may

significantly reduce the binding affinity of MZF1 (Myeloid zinc finger 1) (Table 4).

Discussion

MiRNAs have been reported to play an important role in the occurrence and

development of cancer by modulating the expression of cancer-related genes. In our

previous miRNA profiling study, we identified the overexpression of miR-146b-5p in

gastric cancer tissues, which also showed a strong correlation with the TNM stage(7).

These findings indicated that miR-146b-5p may function as a proto-oncogene and

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 13: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

may be associated with the prognosis of gastric cancer. Consistent with these findings,

Yoon et al. reported that the elevation of miR-146b-5p was a strong risk factor for

tumor relapse and the poor survival rate of gastric cancer through the inhibition of

NOVA1(11). MiR-146b-5p was also observed to play a vital role in the migration and

invasion of several tumor cells(12,13).

Increasing evidence has demonstrated that genetic variants such as SNPs in

miRNA promoters or precursor miRNAs are associated with cancer

prognosis(9,14,15). These variants may affect the expression levels of mature

miRNAs or change the binding between the miRNAs and their targets, resulting in a

corresponding regulation of target mRNA translation and leading to multiple

functional consequences(16-18). Therefore, investigating the association between

miR-146b-5p-related SNPs and the prognosis of gastric cancer is necessary. In this

study, we focused on SNPs located in the promoter and precursor regions of

miR-146b-5p. By using the database of the 1000 Genomes Project, only one SNP

(rs1536309) site, which was located 1066 bp upstream of the TTS (transcription start

site) of the miR-146b-5p precursor, was selected. The association between

miR-146b-5p rs1536309 and gastric cancer survival was subsequently evaluated in a

follow-up study of 940 GC patients. Our results showed that individuals carrying the

C allele had better survival. In the stepwise Cox regression analysis, miR-146b-5p

rs1536309 was identified as an independent prognostic factor for gastric cancer.

In particular, this protective effect was significantly represented in the subgroups

of patients with age > 60, male, tumor size ≤ 5cm and intestinal histology. Compared

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 14: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

with elderly patients, the young patients with gastric cancer were more likely to be

associated with higher grade, distant metastases and adjacent organ invasion(19).

Thereby the protective effect of rs1536309 might be more easily observed in older

patients. In a recent study, the up-regulated miR-146b-5p was found correlated with

E2 expression(20). Thus, the influence of this SNP site might be attenuated in female

due to the higher level of miR-146b-5p. In our study, a worse survival was observed

among patients with diffuse type or tumor size > 5cm. The effect of rs1536309 might

be confounded by the bigger tumor size or diffuse type. The survival benefits of

rs1536309 were also observed among patients with T1 depth of invasion, no lymph

node metastasis, no distant metastasis, and TNM stage I/II. The TNM stage, which is

identified by depth of invasion, lymph node metastasis and distant metastasis, was

considered as the independent prognostic factor in gastric cancer in this study.

Therefore, the main factor for the prognosis in advanced gastric cancer might not be

rs1536309. Moreover, no differences of rs1536309 genotypes were found in the

prognosis of patients with postoperative chemotherapy. The relative sample size of the

patients and the use of several different regimens might be the reason. Further studies

are still needed to evaluate the effect of rs1536309 on patients with chemotherapy.

In addition, given that rs1536309 was genotyped in tumor tissues, we cannot

exclude the possibility that the genotypes might include mutations specific to the

cancer genome. However, our previous study demonstrated the high concordance rate

between tumor tissues and the peripheral blood, suggesting that the majority of SNPs

could be accurately genotyped using the DNA isolated from tumor tissues(21). These

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 15: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

data suggested that miR-146b-5p rs1536309 may serve as a promising biomarker for

the prognosis of gastric cancer patients.

SNPs in the promoters of miRNAs were reported to participate in the alteration

of transcriptional activity and thereby affect the expression levels. In our study,

patients carrying the rs1536309 C allele were found to have lower expression of

miR-146b-5p. The luciferase assay also showed that the rs1536309 C allele

significantly reduced the promoter activity. To further explore the potential function

of rs1536309, we also searched the Haploreg database and found that the C allele may

reduce the binding affinity of the MZF1 (Myeloid zinc finger 1) transcription factor,

which belongs to the SCAN zinc finger (SCAN-ZF) transcription factor family. MZF1

has been found to be involved in the etiology of several major solid tumors(22). In

gastric cancer, MZF1 was found to facilitate the growth, invasion, metastasis, and

angiogenesis of cancer cells through the activation of the MMP-14 promoter (23).

Taken together, these data suggest that the rs1536309 C allele may reduce the binding

affinity of MZF1, thus attenuating miR-146b-5p promoter activity, which ultimately

results in the down-regulation of miR-146b-5p and has a protective effect in the

prognosis of gastric cancer. Further studies are needed to address these questions.

Some limitations of this study should be acknowledged. First, although we

collected the data of overall survival, the data of disease specific and recurrence-free

survival was not available due to the incomplete death records. Considering that

gastric cancer-related death was found in most of the patients, the overall survival

could be used as a surrogate endpoint of disease specific survival. Second,

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 16: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Helicobacter pylori infection, which was regarded as an important risk factor in

gastric cancer, was not analyzed due to the lack of information. Third, by using the

luciferase assay and bioinformatic analyses, rs1536309 C allele was believed

associated with the reduced binding affinity of MZF1. However, functional

experiments, such as chromatin immunoprecipitation assay (ChIP), are still needed for

further validation.

In conclusion, our results provide the first evidence that the miR-146b-5p

rs1536309 CC/CT genotypes are associated with better survival than the TT genotype,

suggesting a protective effect of the C allele in the prognosis of gastric cancer. These

results indicated that this SNP site may serve as a biomarker to predict and improve

prognosis in patients with gastric cancer. However, further validation and functional

studies are needed to clarify these findings.

Grant Support

This work was partially supported by the Natural Science Foundation of Jiangsu

Province (SBK2017042797, W. Z. Wang); the National Natural Science Foundation of

China (81572362, Z. K. Xu; and 81473049, Z. D. Zhang; and 81230068, Z. D. Zhang);

the National Natural Science Foundation Project of International Cooperation

(NSFC-NIH, 81361120398, Z. K. Xu); the Primary Research & Development Plan of

Jiangsu Province (BE2016786, Z. K. Xu); 333 Project of Jiangsu Province

(BRA2015474, Z. K. Xu); the Priority Academic Program Development of Jiangsu

Higher Education Institutions (PAPD, JX10231801, Z. K. Xu); the Key Medical

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 17: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Subjects of Jiangsu Province (General Surgery) (ZDXKA2016005, Z. K. Xu); the

Program for Development of Innovative Research Team in the First Affiliated

Hospital of NJMU (Z. K. Xu); Jiangsu Key Lab of Cancer Biomarkers, Prevention

and Treatment, Collaborative Innovation Center for Cancer Personalized Medicine,

Nanjing Medical University (Z. K. Xu and Z. D. Zhang). The funding agencies had no

role in the study design, data collection and analysis, decision to publish, or the

preparation of the manuscript.

The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance

with 18 U.S.C. Section 1734 solely to indicate this fact.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 18: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

References

1. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al.

Cancer incidence and mortality worldwide: Sources, methods and major

patterns in GLOBOCAN 2012. Int J Cancer 2015;136(5):E359-86 doi

10.1002/ijc.29210.

2. Nagini S. Carcinoma of the stomach: A review of epidemiology, pathogenesis,

molecular genetics and chemoprevention. World J Gastrointest Oncol

2012;4(7):156-69 doi 10.4251/wjgo.v4.i7.156.

3. Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics

in China, 2015. CA Cancer J Clin 2016;66(2):115-32 doi 10.3322/caac.21338.

4. Zabaleta J. Multifactorial etiology of gastric cancer. Methods Mol Biol

2012;863:411-35 doi 10.1007/978-1-61779-612-8_26.

5. Pasquinelli AE. MicroRNAs and their targets: recognition, regulation and an

emerging reciprocal relationship. Nat Rev Genet 2012;13(4):271-82 doi

10.1038/nrg3162.

6. Wu WK, Lee CW, Cho CH, Fan D, Wu K, Yu J, et al. MicroRNA

dysregulation in gastric cancer: a new player enters the game. Oncogene

2010;29(43):5761-71 doi 10.1038/onc.2010.352.

7. Chen Z, Saad R, Jia P, Peng D, Zhu S, Washington MK, et al. Gastric

adenocarcinoma has a unique microRNA signature not present in esophageal

adenocarcinoma. Cancer 2013;119(11):1985-93 doi 10.1002/cncr.28002.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 19: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

8. Xie K, Liu J, Zhu L, Liu Y, Pan Y, Wen J, et al. A potentially functional

polymorphism in the promoter region of let-7 family is associated with

survival of hepatocellular carcinoma. Cancer Epidemiol 2013;37(6):998-1002

doi 10.1016/j.canep.2013.09.005.

9. Qiu F, Yang L, Ling X, Yang R, Yang X, Zhang L, et al. Sequence Variation in

Mature MicroRNA-499 Confers Unfavorable Prognosis of Lung Cancer

Patients Treated with Platinum-Based Chemotherapy. Clin Cancer Res

2015;21(7):1602-13 doi 10.1158/1078-0432.CCR-14-1174.

10. Wang M, Bai J, Tan Y, Wang S, Tian Y, Gong W, et al. Genetic variant in

PSCA predicts survival of diffuse-type gastric cancer in a Chinese population.

Int J Cancer 2011;129(5):1207-13 doi 10.1002/ijc.25740.

11. Yoon SO, Kim EK, Lee M, Jung WY, Lee H, Kang Y, et al. NOVA1 inhibition

by miR-146b-5p in the remnant tissue microenvironment defines occult

residual disease after gastric cancer removal. Oncotarget 2016;7(3):2475-95

doi 10.18632/oncotarget.6542.

12. Xu E, Zhao J, Ma J, Wang C, Zhang C, Jiang H, et al. miR-146b-5p promotes

invasion and metastasis contributing to chemoresistance in osteosarcoma by

targeting zinc and ring finger 3. Oncol Rep 2016;35(1):275-83 doi

10.3892/or.2015.4393.

13. Lima CR, Geraldo MV, Fuziwara CS, Kimura ET, Santos MF.

MiRNA-146b-5p upregulates migration and invasion of different Papillary

Thyroid Carcinoma cells. BMC Cancer 2016;16:108 doi

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 20: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

10.1186/s12885-016-2146-z.

14. Wang S, Lv C, Jin H, Xu M, Kang M, Chu H, et al. A common genetic

variation in the promoter of miR-107 is associated with gastric

adenocarcinoma susceptibility and survival. Mutat Res 2014;769:35-41 doi

10.1016/j.mrfmmm.2014.07.002.

15. Du M, Lu D, Wang Q, Chu H, Tong N, Pan X, et al. Genetic variations in

microRNAs and the risk and survival of renal cell cancer. Carcinogenesis

2014;35(7):1629-35 doi 10.1093/carcin/bgu082.

16. Luo X, Yang W, Ye DQ, Cui H, Zhang Y, Hirankarn N, et al. A functional

variant in microRNA-146a promoter modulates its expression and confers

disease risk for systemic lupus erythematosus. PLoS Genet

2011;7(6):e1002128 doi 10.1371/journal.pgen.1002128.

17. Wang M, Chu H, Li P, Yuan L, Fu G, Ma L, et al. Genetic variants in miRNAs

predict bladder cancer risk and recurrence. Cancer Res 2012;72(23):6173-82

doi 10.1158/0008-5472.CAN-12-0688.

18. Yang Q, Jie Z, Ye S, Li Z, Han Z, Wu J, et al. Genetic variations in miR-27a

gene decrease mature miR-27a level and reduce gastric cancer susceptibility.

Oncogene 2014;33(2):193-202 doi 10.1038/onc.2012.569

19. Theuer CP, Kurosaki T, Taylor TH, Anton-Culver H. Unique features of gastric

carcinoma in the young: a population-based analysis. Cancer

1998;83(1):25-33 doi

10.1002/(SICI)1097-0142(19980701)83:1<25::AID-CNCR4>3.0.CO;2-D.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 21: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

20. Zierau O, Helle J, Schadyew S, Morgenroth Y, Bentler M, Hennig A, et al.

Role of miR-203 in Estrogen Receptor-Mediated Signaling in the Rat Uterus

and Endometrial Carcinoma. J Cell Biochem 2018 doi 10.1002/jcb.26675.

21. Shao W, Ge Y, Ma G, Du M, Chu H, Qiang F, et al. Evaluation of

genome-wide genotyping concordance between tumor tissues and peripheral

blood. Genomics 2017;109(2):108-12 doi S0888-7543(17)30003-4.

22. Mudduluru G, Vajkoczy P, Allgayer H. Myeloid zinc finger 1 induces

migration, invasion, and in vivo metastasis through Axl gene expression in

solid cancer. Mol Cancer Res 2010;8(2):159-69 doi

10.1158/1541-7786.MCR-09-0326.

23. Zheng L, Jiao W, Mei H, Song H, Li D, Xiang X, et al. miRNA-337-3p

inhibits gastric cancer progression through repressing myeloid zinc finger

1-facilitated expression of matrix metalloproteinase 14. Oncotarget 2016 doi

10.18632/oncotarget.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 22: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Table 1. Association of the miR-146b-5p rs1536309 polymorphism and gastric cancer survival miR-146b-5p rs1536309

Patients /Deaths

MST (months)

Log-rank P Undjusted HR (95%CI)

Adjusted HR (95% CI) a

Co-dominant model TT 668/332 56.93 1.00 (reference) 1.00 (reference) CT 251/97 62.24* 0.003 0.71 (0.57-0.89) 0.76 (0.61-0.96) CC 21/10 26.02* 0.594 1.09 (0.58-2.04) 1.08 (0.58-2.03)

Additive model 0.010 0.78 (0.64-0.96) 0.83 (0.68-1.01) Dominant model

TT 668/332 56.93 1.00 (reference) 1.00 (reference) CC+CT 272/107 61.51* 0.005 0.73 (0.59-0.91) 0.78 (0.63-0.98)

Recessive model CT+TT 919/429 68.53 1.00 (reference) 1.00 (reference) CC 21/10 26.02* 0.594 1.19 (0.63-2.22) 1.16 (0.62-2.17)

a Adjusted for age, sex, tumor size, histological types, tumor site and TNM stage. *Mean survival time was provided when MST could not be calculated. MST, median survival time; HR, hazard ratio; CI, confidence interval.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 23: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Table 2. Subgroup analysis of the miR-146b-5p rs1536309 genotypes associated with survival in patients with gastric cancer

Variables rs1536309 (patients/deaths) Log-rank P

Unadjusted HR (95%CI)

Adjusted HR (95%CI)a

TT CC+CT Total 668/332 272/107 0.005 0.73 (0.59-0.91) 0.78 (0.63-0.97) Age (years)

≤ 60 318/153 123/49 0.113 0.77 (0.56-1.06) 0.84 (0.61-1.17) > 60 350/179 149/58 0.018 0.70 (0.52-0.94) 0.73 (0.54-0.98)

Sex Male 512/254 212/81 0.004 0.69 (0.54-0.89) 0.73 (0.57-0.94) Female 156/78 60/26 0.668 0.91 (0.58-1.42) 0.93 (0.59-1.46)

Tumor size ≤ 5cm 404/185 175/60 0.008 0.68 (0.51-0.91) 0.72 (0.54-0.96)

> 5cm 264/147 97/47 0.366 0.86 (0.62-1.19) 0.88 (0.63-1.23) Tumor sites

Cardia 267/131 93/36 0.061 0.70 (0.49-1.02) 0.74 (0.51-1.07) Non-cardia 401/201 179/71 0.029 0.74 (0.57-0.97) 0.81 (0.62-1.06)

Histological type Diffuse 400/216 141/67 0.205 0.84 (0.64-1.10) 0.84 (0.64-1.11) Intestinal 268/116 131/40 0.013 0.64 (0.45-0.91) 0.69 (0.48-0.99) Depth of invasion T1 90/34 60/11 0.009 0.42 (0.21-0.82) 0.44 (0.22-0.87) T2 140/57 60/26 0.812 1.06 (0.67-1.68) 1.07 (0.67-1.70) T3 403/220 142/64 0.096 0.79 (0.60-1.04) 0.82 (0.62-1.09) T4 35/21 10/6 0.814 0.90 (0.36-2.22) 1.01 (0.37-2.79) Lymph node metastasis N0 255/100 119/31 0.012 0.60 (0.40-0.90) 0.61 (0.41-0.91) N1/N2/N3 413/232 153/76 0.216 0.85 (0.66-1.10) 0.87 (0.67-1.13) Distant metastasis M0 628/307 254/97 0.006 0.73 (0.58-0.91) 0.79 (0.63-0.99) M1 40/25 18/10 0.484 0.77 (0.37-1.60) 0.65 (0.30-1.40) TNM stages I/II 304/122 143/41 0.011 0.63 (0.45-0.90) 0.65 (0.45-0.93) III/IV 364/210 129/66 0.389 0.89 (0.67-1.17) 0.89 (0.67-1.17) Postoperative chemotherapy No 457/238 178/63 < 0.001 0.60 (0.46-0.80) 0.65 (0.49-0.86) Yes 211/94 94/44 0.766 1.06 (0.74-1.51) 1.10 (0.76-1.58)

a Adjusted for age, sex, size, site, histological type and TNM stage in the Cox regression model.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 24: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Table 3. Stepwise Cox regression analysis of patient survival Entered variables β SE HR (95% CI) P TNM stage (III/IV vs. I/II) 0.60 0.10 1.82 (1.50-2.21) < 0.001 rs1536309 (CT/CCvs.TT) -0.25 0.11 0.78 (0.62-0.97) 0.022

β, regression coefficient.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 25: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Table 4. Altered regulatory motif scores of the different alleles for rs1536309 based on HaploReg v4.1

a PWM, position weight matrix b Library from Kheradpour and Kellis, 2013

PWM IDb PWMa match score T allele: TGAGGCTTCCCCTAGCACCTCCATTCCCCATCATCCTGCTTCAAAATGAGAAACTGGAC T allele C allele C allele: TGAGGCTTCCCCTAGCACCTCCATTCCCCGTCATCCTGCTTCAAAATGAGAAACTGGAC

Egr-1_disc4 -8.9 -10.4 RACTACAWBTCCCRGMRKGCMYCGC MZF1::1-4_2 13.8 4.2 KWBCCCMYMVHHM MZF1::1-4_3 11.9 4.7 YYHCCCMTMV Znf143_disc3 13.8 13.1 VCYVCVNBBCCCVSVVBSC

on February 16, 2021. ©

2018 Am

erican Association for C

ancer Research.

cebp.aacrjournals.org D

ownloaded from

Author m

anuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Author M

anuscript Published O

nlineFirst on A

pril 23, 2018; DO

I: 10.1158/1055-9965.EP

I-17-1054

Page 26: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Figure Legends

Fig. 1. Kaplan-Meier (KM) curves for the survival of patients carrying different

genotypes of miR-146b-5p rs1536309. (A) Overall survival of miR-146b-5p

rs1536309 codominant genotypes. (B) Overall survival of miR-146b-5p rs1536309

dominant genotypes.

Fig. 2. Correlation between the different rs1536309 genotypes and miR-146b-5p

expression levels in tumor tissues.

Fig. 3. Reporter vectors with different alleles of rs1536309 were transfected into

SGC-7901 and BGC-823 cells. The relative luciferase activity was subsequently

detected and normalized to Renilla luciferase as an internal control. The data were

from three independent experiments. *P < 0.05.

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 27: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 28: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 29: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054

Page 30: A genetic variant located in miR-146b promoter region is ......Apr 21, 2018  · Finally, 940 gastric cancer cases with 100% R0 resection were involved in further analyses. The maximum

Published OnlineFirst April 23, 2018.Cancer Epidemiol Biomarkers Prev   Weizhi Wang, Mulong Du, Zheng Li, et al.   associated with prognosis of gastric cancerA genetic variant located in miR-146b promoter region is

  Updated version

  10.1158/1055-9965.EPI-17-1054doi:

Access the most recent version of this article at:

  Material

Supplementary

  http://cebp.aacrjournals.org/content/suppl/2018/04/21/1055-9965.EPI-17-1054.DC1

Access the most recent supplemental material at:

  Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  [email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cebp.aacrjournals.org/content/early/2018/04/21/1055-9965.EPI-17-1054To request permission to re-use all or part of this article, use this link

on February 16, 2021. © 2018 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 23, 2018; DOI: 10.1158/1055-9965.EPI-17-1054


Recommended