Transcript
Page 1: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

FAC

ILIT

IES

Page 2: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

FACILITIES

72

JJuJuuusstt aa ffffeeww mmmmininutteseses ooffffff thhe fffreereeweweway bbbbutututu stiitillllll wwitittthhhhtththe e e ffefeelelliinining g ofofof beieinngngng iiinn hththe e mimimiddddddd lele oofff non whwhwhw erree ee . .. . oororr at t lleleleasssttt clcloososose to nnnowowowowhheheherererere!!!

TThhhrreee-e-anannnddd-a-a--hhhahalff-m-m-mmililile didirt roaoaadddd ses tstss ttthee sssstaat ggeg fffforoo tththhe iiiddeeeaea tthhahahat “w“w“wwe aarree e ggegettttttininingg g awawa ayyy fffrommm m itt aaallll.”.”.

Thhhe WWWaayyyy StSttaaatioiooonn,,, ooooouuur rregegisistrtrattta ioioionn n offioffiffioffi ceceee,, isss ttheheee bbigii bbbuiilllddinnnng ttto tththheee e ririghghhttt asas yyouououo ppasassa ss s ththht e weeeew lcl ooommeee sssigggnn.

SSuurrooounnddeeddd ooonn ttthhreeeee sssisideeessss bbyyy ggggovvo eeerrrnnnmmeeentt lannnd,,, tthheee ccaammmp iis ggguuaarrannntteeeede tooo o beeee issollaaattteddd ffrrrommmm thhhe wwoooorldddd. OOOOurr nnneeeaareeeestts nnei hghbobooor iisss mmmmillleeess aaawwaaaay. AAtt t tttheee e saaaamemeee ttimimmmme,e,e,ee mmmededee icalalal rrreesppooonsseee uuunnniitsss arrree jjuuusttt mmminnnuuteeeess aawawwaayyy. WeWeWeeWW hhavavveee EMEMEMEMTTT trtraaiaiinnenenedd d ssttaaaffaff aaaas wwwwelelll ass aannnn exxxxteet nnsnsn ivvee e sesesecucucuriir tytyy andndnd sssaafaffeetettyy ppprprogogggrammmm fofofor aalaa l offoo ooour rrresse ididdi ennt tt stststaffffffa .

FIRST IMPRESSIONS

Except the L build the house, they labour in vain that

build it: except the L keep the city, the watchman

waketh but in vain. Psalm 127:1

Page 3: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

73

Page 4: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

74

The Grande Veranda

DINING FACILITIES

WWeesststt Sididddeee Haallllll seatatss 30303 00 anandd is gggrer att fffforoo lllaarargege grgrgrooupspspss anddd bbananqquququetets with the lannteteternrnr ligigghthh llowowoww.

WWeWeeesst SSSiideee HHHalll iiiisss equipppped withhh aaaa commpmpputtteree aaandnn vviviiddeeooo pprrrooojecccttototor foforr r thththeeme mealalalsss ororo annnnnnouo ncncccemmme ene tstsst oon sscrcrreeeen

WWWCC’’s’ss Caaafafé sssseeeaatstss 11606060 aaandndnd iiis ididideaaeae lll fooff rr r ssmalalaa lerrr grg ooouupspss. TTThheee coozzzzy wwwwaallllpppaapappererer aandnd rraiaisesed wowoodddoo pppannaa elell rrooooomm aaanndddcooommffoooortaaabbllee e atatatmmmoospspsphhhehere canan bbbee eeennnjoooj yyey ddd arrrrouo nnndn rorooounnddd tataaabblleeses wwwwwiitthh oooaoak chchchchaiairssrs.

CCCooff ffeeee ssservvvicceee iss aavaaaiailaabbblble bebebb foooore,, duud rrrinnnggg, annnd aaaafteeerr eeeaachhhh mmeeeal..

SSpppeccciai ll ddiiettte aareeeaa alalaa lows yyyyooouu too bbrrrinnggg ittttemmmssnneeeceessssaarrry y ttooo ssstatatayy onononn yyououurrr dididieet. ItIttt iiis eqeqeqqquuuiippppeeedd wwwwithhh aareefffriggeere atatttorro , , mmiiim crrrcc owowo avavve,ee,e ttoaoastststteerer, aannddd sssinnnkk.

FFuFulllll aauddddioi ccccapaa ababba illi itititieeeii ss.s.

FuF lllll -ooptptp ioonnenn dd babab rbrbeccecueueue cccapapappababablele ooofff f seeerrrvrvinggg g ovovoverr 660606 0, coommmpletetette ee wiwithththth ssmom ker anannddd rorotisssssseeeriee cccapppaableleee offf fffulu l l pipp g g tututurn.

ClClCllimimatatatte e cooontnn rorolllllll ededed and immenseseelylylyy flfl exixixibbble wwwwithh aa wweeststts ere nn thththt eme.ee.

Grraaannnnddeeee VVVVeerrraaanannndddaaaa————o—o—oovvveerr r 333,3,0000000000 sqsqsqsquauauaareeerer -f-f-f-foooooot tt poooopp rccchhhh wwwwiiw tht aa vvvviviieeweweww oof f f tthththee e e uusususuuauauallllllllyyyyyy dddrdryy y y MoMoMoM jaaajajaj veeevevev RRRivivii eeerer aaaannndd SSooollo dddidiid eer MMMoooouunnntataaainnn

Page 5: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

75

The Homestead

WC’s Cafe

West Side Hall

Page 6: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

LODGING

76

Small Western Cottage

• Each cabin is climate controlled (heat and cool)

and has a bathroom, shower, sink, carpet, one

queen-size bed and bunk beds.

• Linens are provided for every adult camp (pillow,

sheets, blankets, and towels). An iron and ironing

board are available upon request.

• Comfortable “real” mattresses on queen beds

and bottom twin bed of bunks.

• Most cabins have space to allow you to park your

vehicle nearby.

• Small western cottages sleep up to four and

large western cottages can sleep ten.

• Beautiful wood siding, individualized décor, and

handmade quilts give each room a personal and

unique ambience.

Page 7: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

77

Large Western Cottage

Page 8: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

78

11414444 LLLLaarrrrggegee WWWWWeesssteteeeerrrnrnrnn CCCCCotototottatatatagegeeegegeg ssss

11000001 SSSSmmmmaaalllll WWWWeeeessttteeerrnnnr CCCCotttto tatatataggggegeeess

RRRRRRIIVVVVVVEEEERRRRTTTTOOOOOOWWWWWWWWWWNNNNNNN

MMMeMeMeeeetttinininn’’ HaHaHaalllllll—4440x0x0x606060’’ roomomm ssseaeae tingnggg uupp tototot 2225252555

wwiithththh sssooooundndd aandndndd vviidideo capappababababililittieieies, aaaa bbababbaa y y

gggrgrannnnddd pipipianannnoo,o, pppadadaddddedededdd hch iaiairssrsrs, , ana ddd anana oooututttsiss dedeee

lligghghghteeeddd ccocoununnnssselilingngngng aaarerea

RRRuuusssttyyy y WhWhWhWheeeeeelll—2—222444xxx303030’’’ roororoomomom ssseaeaee titiingngnn uuuup p ttotoo 6660,0,

wwiwiththhh soooounndndnd aaanndndndd vvvvidideo, , a didigiigigig tatatalll piip aaananoo,o,, smmmaaam lll

kkkittcccheeeeneeeetttteee,e, aaannndd ppppadadded chhhchaiiaa rsrsss

CCaaatttllleemmmmaannn’sss LLLoodddgdgeee—2—2—2—20xxx0 44004 ’’’ rroroooommm wiiitthh

ccoooucchheesss aaannnddd ooovverrrsttuuuff edddd cchhaaiiirss,,, a fifi rrreeppplacccee,,

sssoouunnu ddd aanna ddd vviviv ddedeeo—o———easilylyyy sseeeaattsss 11122 annnnd iss

pppeerrrfececcct ffofof rr a a plplpllpp aannnnininn ng ggroupupupp!!!

Shhhererrriffffffi ’’’s s OffiffiffiffiOO ceeecc —2—2—2—— 4x4x4 2020’’ bbbrbrbreaeaeakk oooutt t t rroroooomom

sseses atatatininnng gg upupupp ttoooo 4004

TTooT wwwwn HHHalalallll l—3—3336x6x66 500’’ rororoomomom tthhatt ccacacan sseseeattt upppp tooo

121212200 ananaa d dd caac nnnn beb usesesedddd ffofoforr ieithherererr gggamamamesesss oorr r aa

mememm etetete ini g ggg ror omomm..

CCCCCCCCCCCCCCCCCCaaaaaaaaaaaaaaabbbbbbbbbbbbbiiiiiiiiinnnnnnnnnnnnnnnnsssssssssssss

MMMMMMMeeeeeeeeettttiiinnnngggggg RRRRRRRoooooooooooommmmmmmssssss

Page 9: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

79

The Cattleman’s Lodge

Meetin’ Hall

Rusty Wheel

Page 10: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

80

• Landd TTTTrorororoollllllllleyeyyy

• HHuHuuuummmaaannnn FFooooosososbbbaallllll

•• OOlOlOlldddd WWWeWeststst PPPhohohohotoo EEEEmpmpmpmpororororiuiuiui m

•••• DDoDoooc’sss WWWWoonndndnderererr WWWWheheelel

•• UUUnnnclclllee WWWWaaaalllllyy’yy sss s s SoSoSoSoSoouvuveneniirir aaandddndndnn SSSSnanaaan ckkkkc SSShhooohh pp

••• PPPoonnnyy Esssspprrerereesssssssssoo CCCoCoooffffff ff eeeeee SSSShohooopppp

•• TTToowwwnnnn HHHalll GGGGaammmmeee RRoooommmm

••• TTThheee e LLiLiLiveveeeryryyy SSSSSttaat bblblble———e 20202020xxx4x444000’ wwwwwiiittthh 2222000’’’ cceeeilllinnnngg

•• SSaaaSS ndndddnn TTTrararar pppp GoGoooG lflflflfl

AAAAAAAAAccccttttttiivvvvviiiittttttiiiieeeeessssss

RRRRRRIIVVVVVVEEEERRRRTTTTOOOOOOWWWWWWWWWWNNNNNNN

Livery Stable

The Pony Espresso

Page 11: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

81

Town Hall

Old West Photos

Doc’s Wonder Wheel

Human Foosball

Whistle Stop

Page 12: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

82

99 LLLLaLaarrgrgrggeeee WWWeWeWeestststterererrnnn CCoCoCoCoCooottttttttttagagagagesssesese

333 BBBuuuunnnkkhhhoooouususseeeess

BBBBBBRRRRROOOOOOOOKKKKKKKEEEEEEEENNNNNNNN IIII RRRRRRRAAAAAAAAANNNNNNCCCCCCHHHHHHH

The RReReReReeendndndddeezezzzvvvvooousususs—3—3—3—300x0x0x45454545’ rorooroommmmomo sseaeaeaae tititiitit ngngnnn up

to 11111555505000 wwwwwiiitittthhhh sssosooununununddddd anananandddd vivivividededed o ooo caaaccc paaapapp bibibiibb liill tititit eesessss, , ana

didigggggiittatataal l l ppipipiaanannooo o aanananndddd ppapapapapaddddddddddddedddededed ccccchahahahahh irirri ssss

TTThhhheee WWWWinnccchhhheesssttteeeeerrr—————sseeeeaaaatitititinngggnn uupppp tttotoooo 22255

TThhhhhee ChChhhC uuuccckbbbbkk ooxoxoxx———s—s—sss— eaeaaaee titititingngngng uuuupppppp tttotototoo 2225555

CCCCCaaabbbbiiinnnsss MMMMMMMMMeeeeeeeeeeeettttiiiiinnnnnnnggggggg RRRRRRRoooooooooooooommmmmmmmmssssss

Page 13: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

83

The Rendezvous

Pyrite Pete’s Porch

Game Room

Page 14: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

84

• Tumbbleleleeeewwwweweweededededd

• BaBaBaaaarrrrrrreelelelel ooooffff FFuFuFunnnn

• HHHoHoootwtwtwwwaalalllkkekekeeerrr r SSSSwSwSwwiininininngggg

•• DDDaaaannngggglllinnnngggg DDDDuuuououoooo gggggiaiaiaia tntnt sssswiwiiwww ngngngngggn

•• RRiiccoooccchhhheettt

•• BBuuuuB ckckckkiinini gggg BBBaaB rrrrrr elelelelee

• CChChhhCC ucucccu k kk WWaWaWaW gogogogonnnn annanana dddd TTTrTr dadadadaddinininingg g g g PPPoPooossststtt

• MMoMoooo’J’JJavavavva aaaa RiRiiRiRR vevever rrr CoCoCoCoffffffff eeeeeeee SSSShhohohohoopppp

AAAAAAAAAccccttttttiivvvvviiiiittttttiiiieeeeesssss

BBBBBBRRRRROOOOKKKKKEEEENNNNN III RRRRRAAAAAANNNNNNNCCCCCHHHHHH

Barrel of Fun Ricochet

Page 15: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

85

The Mo’Java

Tumbleweed

Page 16: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

86

••• TThThThe Twwwigigig—32x4040’ lolog g cabin,n, ssseatinngngg uppp

to 11000000

•• ThThhhe LoLooftftft—cononfeference e tytype rrrooooo m ininni thehee

TTTwigigg

CCCCabbiiinss

112 WWWeessttterrrn CCoottaaaggges,s, eeacchhh wiwithhht qqqueeeeen bbbedd

annddd buuunnnkkk bbbedd ccooommplete withth lllini eennss

AAAccttivvviittiiieess

•• MMMoonddoo RRRoockkkeetbbaaall

•• MMMoo’JJavva RRivveeer CCoCooff ee SSSShooppp

• CCCoozzzyy aanddd reeellaxa innggg ffefelloowwwshhiiip aaareeeaa wwittthh

ccaaammmppfi firer ooooptp ioioonn

MMMMMMMeeeeeeettttinnnngggg RRRRRRooooooooommmmmmsss

IIKKKKKEEEE’’’’SSS RRRROOOOOOOOOOOOOSSSSSTTTTTT

Campfi res

The Loft

The Twig

Page 17: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

87

Small Western Cottage

Page 18: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

88

• Eight-acre lake with plenty of room to fi sh, swim, and canoe.

• The giant slide is over six stories tall and over 165 feet long, allowing you to travel at speeds over 35 miles per hour.

• High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options.

• The fi shing dock sets you right in the middle of prime fi shing for blue gill (really easy to catch) and catfi sh (a bit harder to catch).

• The lake shade is useful for barbecues, roasting marshmallows, or just getting out of the sun for awhile.

• The two-acre Pond is great for kayaks, the Rock-it (water seesaw), water volleyball, and two islands make the Pond a unique and fun experience.

TTTTTHHHHHEEEE LLLLAAAAKKKKKEEEEEEE &&&&&&& TTTTTTTHHHHHHHEEEEEEE PPPPPPOOOOOONNNNNDDDDDD

The Lake

Page 19: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

89The Pond

Page 20: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

90

• Leap of Faith—climb the pole, stand on top of the pole, and then leap out to a dangling trapeze bar. If you miss the bar, your harness will keep you safe.

• The Wall—over 30-foot-high climbing wall with two routes up.

• Narrow Way—think tight-rope walker with a bit of help.

• Flying Squirrel—once hooked into the harness, a few of your friends pull you up and up and up. You pull your rip cord and enjoy several feet of free fall before swinging back and forth to a stop.

• Jacob’s Ladder—you and a trusted friend must work together to get to the top. This one is challenging!

• Shaded discussion area and trained leaders make the Edge more than just a fun activity. The spiritual lessons and teachable moments will make the Edge a highlight of your visit.

TTTTTHHHHHEEEE EEEEDDDDDGGGGGGEEEEEE

The Edge

Page 21: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

91

Narrow Way

Jacob’s Ladder

The Wall

Page 22: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

92

• Barn is complete with three stalls, indoor training ring, wash rack, classroom, offi ce, and a cabin.

• Six training rings and two arenas.

• Entire area can be lit for night riding.

• Our breeding program with registered Quarter Horses provides a wide age range of horses to work with.

• Three tack rooms, harness shed, stagecoach, Studebaker wagon, and hay wagon.

HHHHHHOOOOORRRRRSSSSEEEE AAAAAARRRRRREEEEEAAAAAA

The Barn

Page 23: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

93

• Pulled by a tractor

• Night rides give you a gorgeous view of the stars and the milky way.

• Sing a song, talk to a friend, or just enjoy God’s creation. A hayride is always fun.

HHHHHHAAAAAYYYYRRRRRRIDDDDDDDEEEESSSSSS

Page 24: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

94

Shooting Range

• Skeet shooting

• Pistol and rifl e—large and small caliber

• Bring your own guns or shoot some of ours.

• Shoot up to 100 yards.

• Several courses available:

The Bluff s—off er gullies and buttes that make you feel like you’re playing in a miniature Grand Canyon.

The Mesa—off ers giant tires, the ditch, and open play.

The River Bottom—is great fun at night; the soft sand and midsize trees give you the feeling of playing on a deserted island.

Painted Acres—off ers a close course of urban warfare among trailers and RVs.

• Adventure-style games that give you many opportunities for strategy and play.

• Christian environment with referees who are not just concerned with who wins but also how competitors play.

• Rentals available.

SSSSSSHHHHHOOOOOOOOOTTTTIIIINNNNNNGGGGGGGG RRRRRRAAAAAAANNNNNNNGGGGGEEEEEEESSSSSS PPPPPPAAAAAAINNNNNTTTTBBBBAAAAAAALLLLLLLLLLLLL

Page 25: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

95

• Lighted basketball court.

• Surrounded by chain link.

• Excellent game venue with lots of creative possibilities.

• Two acres of green grass in the desert.

• Sound available.

• Venue for games like sprinkler soccer, milk jug lacrosse, and every possible variation of kickball.

TTTTTHHHHHEEEE CCCCAAAAAGGGGGGGEEEEEE

AAAAAATTTTTHHHHHLLLLEEEETTTTTTIIICCCCCC FFFFFIIIEEEEEELLLLLLLDDDDDDD

Athletic Field

The Cage

Page 26: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

96

Trust Fall

Jed’s Quest is used to teach valuable life lessons through short, hands-on challenges. It will stretch your communication skills and will create teachable moments in areas such as trust, giving, leadership, and character. Each Jed’s Quest event has a unique problem and solution that a group must work through. After a group succeeds, a time of discussion about what they can learn from the experience helps solidify the lessons. Approximately four events can be done in an hour and a half. Jed’s Quest can be customized for junior highers through adults.

JJJEEEEDDDDDD’SSSSSS QQQQQQQUUUUEEEEEESSSSSTTTTT

3-Way Shuffl e

All Aboard

Amazon

The Beam

Bermuda Triangle

Blocks

Chicken Wire Crossing

Chuck-a-Hunk

Croc Pit

Do I Go?

Electric Fence

Flashfl ood

The Grid

Hole-in-One

King’s Finger

Knots

The Muse

Mohawk Walk

Mojave Lizard Egg

Native Tours

Nitro Crossing

Oopsy Daisy

Over/Under

Prouty’s Landing

Pygmy Hi-Grade

Rope Geometry

Sand Trolley

Spider Web

Stepping Stones

Stump Jockeys

Teeter-Totter Crossing

Tire Traverse

Toxic Waste

TP Shuggle

Trust Fall

The Wall

Warp Speed

Whale Watch

Wild & Woosie

Page 27: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

97

• Located just below historical Lookout Point (used by the cavalry in the 1860s to watch over Fort Cady).

• Constantly shaded and a beautiful view of the Mojave River, camp, and mountains.

• Prayer journal for you to record your prayers or read some of the prayers and praises of others.

PPPPPPRRRRRAAAAAYYYYEEEEERRRRR CCCCCCCCHHHHHHHAAAAAAAPPPPPPPEEEEEEELLLLLLL

• Take some time to “be still” and spend some time with God. A marked path has benches along the way to pause and remember, and then thank God for His goodness

• A perfect blend of exercise and personal time with God.

• No rush, take it at your own speed.

PPPPPPRRRRRAAAAAYYYYEEEEERRRRR WWWWWWWWWAAAAAAALLLLLKKKKKKK

• An elevation of 2,500 feet above sea level which provides each climber with an almost nine-hundred-foot climb.

• Traditionally, you’ve not made it to the top until you touch the cross. From the top, you can see thirty plus miles in every direction.

• The massive sand dune on the back of Soldier Mountain makes going down much more fun than going up.

SSSSSSOOOOOLLLLDDDDDDIEEEEEERRRRRR MMMMMMMMOOOOOOUUUUUUUNNNNNTTTTTAAAAAAIIINNNNN

Prayer Chapel

Prayer Walk

Soldier Mountain

Page 28: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

98

• Soap Sculpture

• Wrist Rockets

• Hatchet Throwing

• Skeet Shooting

• Balloon Sculpture

• Watercrafts

• Blow Darts

• BB Guns

• Archery

• .22 Rifl es

• Vaulting

• Trick Photography

• Fishing

• Sand Trap Golf

SSSSSSKKKKKILLLLLLLLLSSSS AAAAAAACCCCCCCTTTTTTIIIIVVVVVVVVIIIIIIITTTTTTTIIIIEEEESSSSSS

Sand Trap Golf

Vaulting

Page 29: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

99Archery

Hatchet Throwing

Blow Darts

.22 Rifl es

Page 30: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

100

Ironwood Institute of Ministry is a ministry of Ironwood using the unique aspects of the camping ministry to disciple young adults for an extended time through practical classes, hands-on ministry experience, and exposrue to dedicated mentors. The purpose is to enable young adults to live consistent Christian lives and minister in their homes and churches.

• One to three year program

• For 18–23 year olds

• For those who want to do what is right

• We use a three-pronged approach to help prepare young adults for a life of ministry:

» Mentoring relationships

» Classroom instruction

» Ministry involvement

IINNNNNSSSSSTTTTTIITTTTTUUUUUUTTTTEEEEEE OOOOOOOFFFFFFF MMMMMMMMIIIINNNNNNIIISSSSSTTTTTRRRRYYYY

Page 31: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

101

IIM Dorms

Ministry Shop

Toolbox Laundry Room

IIM Dorms

Page 32: 04 Facilities 2017 - Ironwood · • High tower, rope swing, raft, two docks, and shaded waterfront area give you many play options. • The fi shing dock sets you right in the middle

102

• Home-cooked meals as opposed to pre-packaged meals.

• Full bakery capabilities which give you warm chocolate chip cookies and fresh bread, not to mention pizza with crust that is tasty instead of cardboard.

• Eight ovens, eight feet of griddle space, three fryers, and everything we need to bake, fry, or griddle your favorite food.

• In the summer, over 20 people are dedicated full time to preparing, serving, and cleaning up each meal.

• 5,000 square feet under roof.

• Commercial washers and dryers capable of turning over 60 cabins worth of laundry in just a few hours.

• Volunteer project room that is the starting place for all kinds of creativity.

• Lost and Found facility with a turnaround of less than 48 hours for items lost.

KKKKKKIITTTTCCCCHHHHHEEEENNNNN

LLLLLAAAAAUUUUUNNNNNDDDDRRRRRYYYYYYY RRRRROOOOOOOOOOOOOMMMMMMM

Laundry Room