Upload
alfred-l
View
216
Download
0
Embed Size (px)
Citation preview
1
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Cellular factors that prevent proteasome binding to
K63-‐conjugates are not eluted from the polyubiquitin chains by high salt or
detergent.
Lysate wash buffer
Bound proteaosmes to UbnN4 after exposure to lysate or control wash buffer (%control ± SD)
No lysate Lysate
Control 100 ± 15 3 ± 0.6
900mM NaCl 146 ± 7 5 ± 0.4
1% Triton-X 100 137 ± 23 3 ± 0.3
0.1% SDS 99 ± 6 3 ± 0.4
The GST-‐ubiquitinated Nedd4 was incubated with or without the HEK293 S100
lysate for 30 minutes, and then all samples washed with TBSG containing either
900mM NaCl, 1% Triton-‐X 100, or 0.1% SDS. The resins were incubated with 10nM
26S particles, and the bound proteasomes measured by LLVY-‐AMC cleavage. At
concentrations higher than 1% Triton-‐X 100 or 0.1% SDS the polyubiquitin
conjugates were partially eluted from the resins, preventing further analysis of
proteasome binding to these chains. Proteasome binding is expressed as percentage
control of the ubiquitinated Nedd4 without S100 lysate.
2
Supplementary Figure 1: Schematic diagram of experimental designs.
A-‐C) Schematic representation of methods used in the experiments. (A)
Measurement of ubiquitin conjugate binding to proteasomes within crude lysates
(see Figures 1A and S2C-‐D). (B) Determining the effect of proteins in lysates on the
binding of ubiquitin conjugates to purified proteasomes (see Figures 1B-‐E, S2E-‐G).
(C) Identification of K48-‐ and K63-‐specific binding proteins (see Figure 2).
3
Supplementary Figure 2: Soluble extracts of different mammalian cells block
K63-‐conjugates binding to the proteasome, and this inhibition is not due to
deubiquitination.
4
A) Autoubiquitination reactions of Nedd4 and E6AP form ubiquitin conjugates of
similar lengths. Representative Coomassie stained gels of the ubiquitinated proteins
(5% of total sample loaded).
B) Coomassie stained gel of forced conjugation of K48Ub4 or K63Ub4 to Nedd4. K48-‐
or K63-‐tetramers were forced onto GST-‐Nedd4 by incubating the resin bound E3
ligase with E1, E2 (UbcH5), 1mM ATP and 5µM K48 or K63Ub4. 10% of total sample
loaded.
C, D) Nedd4-‐K48n conjugates bind proteasomes in a rat muscle extract preferentially
to Nedd4-‐K63n conjugates. 120µg cell extract was incubated with the resin-‐bound
Nedd4 ubiquitin conjugates, and the bound proteasomes measured by their LLVY-‐
amc peptidase activity (C). (D) Representative immunoblot of the resin-‐bound
conjugate samples used in for ubiquitin (C). All values are the means ± SEM.
E) Cell extracts from different cells can prevent proteasomes binding to K63-‐
ubiquitin chains similarly. HEK293 cells were lysed in HEPES buffer with or without
detergent (0.5% Triton-‐X 100). Rat muscle was homogenised in TBSG. Proteasome
binding was measured as described in Figure 1.
F, G) Endogenous proteasomes are efficiently depleted from the extracts by
centrifugation. Representative analysis by immunoblot of 20S α-‐subunits (F) and
peptidase activity (G) of muscle extracts following the 6-‐hour 100,00xg
centrifugation to deplete the endogenous proteasome. Sup=supernatant and
Pel=Pellet after the 6hr centrifugation.
H, I) K63-‐polyubiquitin conjugates are not preferentially deubiquitinated to K48-‐
chains in the cell extract. H) Ubiquitin immunblot of control or ubiquitinated
5
substrates, following incubation with rat muscle lysate and 26S proteasomes at 4°C
for 30 minutes. I) Immunoblot for ubiquitinated E6AP or Nedd4 with or without
4mM NEM and 1mM OPT from samples used in Figure 1C.
J) Depletion of K48-‐binding proteins from the cell extract does not affect its ability of
to prevent K63-‐chains binding to the proteasome. The muscle extract was first
depleted of K48-‐binding proteins by incubation with polyubiquitinated E6AP. The
unbound fraction of the lysate (UbnE6 FT) was then incubated with
polyubiquitinated Nedd4 (UbnN4) and the bound proteasomes measured.
6
Supplementary Figure 3: Soluble extracts prevent K63-‐ubiquitinated His-‐Sic1
from binding to proteasomes.
A) K63-‐polyubiquitinated Sic1 is rapidly degraded by pure proteasomes in vitro.
Ubiquitinated His-‐Sic1 (40nM) was incubated with either pure 26S proteasomes
(2nM), the proteasome-‐depleted cell extract (300µg total protein) or both together
for 15min at 4°C (0 min time point). The samples were then incubated at 37°C for
7
upto 40 min with (right) or without (left) NEM and οPT. Polyubiquitinated Sic1 was
detected by immunoblot (anti-‐His antibody). 26S = proteasome, Lys = lysate.
B) K63-‐Sic1 ubiquitin conjugates are prevented from binding to proteasomes by a
cell extract. Resin bound (NiNTA) K63-‐ubiquitinated Sic1 (30nM) was incubated
with the cell extract and pure proteasomes (10nM) for 30 min at 4°C. All values are
the means ± SEM.
8
Supplementary Figure 4: Characterization of K48-‐ and K63-‐specific binding
proteins.
9
A) USP5 binds to polyubiquitinated E6AP and is eluted from the conjugates by the
His-‐UIM. The polyUb E6AP resin was incubated with the HEK293 lysate and the Ub-‐
bound proteins eluted with the His-‐UIM as described. The UIM elute (left) and GST-‐
resin post elution (right) were separated by SDS-‐PAGE and immunoblotted for
USP5.
B) Upon gel filtration of the cell extract, the UBD-‐containing proteins identified by
MS are found in lysate fractions of 50-‐400kDa size. The rat muscle lysate was
separated according to size by gel filtration as in Figure 1E. The fractions were then
immunblotted for different UBD-‐containing proteins as indicated.
C) Purity of the bacterially expressed UBD-‐containing proteins. Representative
coomassie stained gels of purfied STAM1, Hrs, TOM1, hHR23A and hHR23B.
10
Supplementary Figure 5: Hrs prevents polyubiquitinated-‐Sic1 binding to the
proteasome but the STAM1-‐VHS domain prevents both K48 and K63-‐
conjugates binding to the 26S
A) Hrs prevents K63-‐polyubiquitinated Sic1 from binding to the proteasome. Resin
bound K63-‐Sic1 conjugates (30nM), Hrs (50nM) and 26S proteasomes were
incubated at 4°C and the proteasomes bound to the conjugates measured. All values
are the means ± SEM.
11
B) The STAM1-‐VHS domain was incubated with ubiquinated E6AP (solid black
lines) or Nedd4 (dashed black lines) and the isolated 26S proteasomes, and the
proteasomes bound measured in the usual manner. For comparison, the effect of full
length STAM1 on the binding of K63-‐conjugates to the proteasome is also shown
(grey lines). The purity of the VHS-‐STAM1 is also shown by coomassie staining
(right panel).
12
Supplementary Figure 6: hHR23B does not stimulate the peptidase activity of
the 26S proteasome.
hHR23B does not affect the peptidase activity of the 26S proteasome. The ability of
polyubiqitin conjugates to stimulate proteasomal peptidase activity (gate opening)
was measured as previously described (Peth et al, 2009). E6AP, polyUb-‐E6AP or
polyUb-‐E6AP and hHR23B (300nM) were incubated with pure 26S proteasomes
(2nM) and peptidase activity was measured with GGL-‐AMC cleavage. All values are
the means ± SEM.
0
50
100
150
200
250
300
350
400
E6 UbnE6 UbnE6 hHR23B
GG
L-A
MC
cle
avag
e (%
con
trol
)
E6 UbnE6 UbnE6 hHR23B
13
Supplementary Figure 7: Determining the approximate amounts of UBD-‐
containing proteins in the muscle lysate.
Protein Amount
(ng protein/µµg lysate ±
SEM)
Concentration in lysate (nM ± SEM)
Crude estimate of Intracellular
Concentration (nM)
STAM1 0.58 ± 0.08 27.8 ± 3.9 1400
Hrs 0.07 ± 0.1 3.1 ± 1.4 200
hHR23B 0.21 ± 0.03 11.3 ± 0.8 600
hHR23A 0.09 ± 0.06 5.3 ± 1.8 300
Rel. FU/min µµg
protein
(LLVY-AMC peptidase activity)
Estimated amount of
26S
(ng protein/µµg lysate ±
SD)
Concentration in
lysate (nM ± SD)
Crude estimate of
Intracellular Concentration (nM)
S100 input 0.36 ± 0.04 2.7 ± 0.29 4 ± 0.5 200
Pure 26S 132 ± 7.2
B
0
2
4
6
8
10
0 2 4 6 8
Inte
nsity
(AU
)
pure protein (ng)
STAM1
0
2
4
6
8
0 1 2 3 4 In
tens
ity (A
U)
pure protein (ng)
0
20
40
60
80
0 2 4 6 8
Inte
nsity
(AU
)
pure protein (ng)
0 2 4 6 8
10 12 14
0 1 2 3 4
Inte
nsity
(AU
)
pure protein (ng)
Hrs
hHR23B hHR23A
C
D
14
A-‐C) Protein content of hHR23B, hHR23A, STAM1 and Hrs in the rat muscle cell
extract. Indicated amounts of the pure UBD-‐containing proteins and cell extracts
were separated by SDS-‐PAGE and immunoblotted for hHR23B, hHR23A, STAM1 and
Hrs (A). The intensities of the bands for the pure proteins were quantified using
ImageJ software, and plotted against the known pure protein amounts to generate
standard curves for each of the UBD-‐containing proteins (B). The intensities of the
bands specific to the UBD-‐containing proteins in the total protein lysates were then
used to approximate the amount of the Rad23 and ESCRT0 proteins in the lysate (ng
UBD-‐containing protein/µg lysate) (C). The concentration of the UBD-‐containing
proteins was estimated from the known concentration of the muscle lysate
(4mg/ml). The cellular proteasome content was measured by comparing the
proteasome specific peptidase activity of the lysate with the activity in the isolated
26S proteasomes (D). Crude estimates of intracellular protein concentration were
calculated from the assumption that the total protein concentration in mammalian
cells is between 200-‐300mg/ml (Ellis, 2001). All values are the means ± SEM.
15
Supplementary Figure 8: MHC Class I molecules depleted of β2m bind to the
proteasome, but a reduction in cellular ESCRT0 does not cause proteasomal
degradation of cell surface MHC Class I.
16
A) MHC Class I molecules are not degraded following siRNA-‐mediated depletion of
ESCRT in Hela-‐K3 cells. At 72 hours after siRNA transfection the cells were treated
with 20µM MG132 for three hours. Cell surface MHC Class I molecules were
immunoprecipitated as previously described. Immunoblots of immunoprecipitated
cell surface Class I (top panel) and lysates for STAM1 and Hrs (middle panels) are
shown. β-‐actin (lower panel) served as a loading control.
B) Misfolded MHC Class I molecules associate with the proteasome following β2m
siRNA-‐mediated depletion. HeLa and HeLa-‐K3 cells were transfected with siRNA
targeting STAM1 and Hrs or β2m. After 72 hours the cells were treated with or
without 20µM MG132 for three hours. The cells were then lysed and the 26S
proteasomes isolated using the Ubl-‐affinity method. Class I molecules bound to the
proteasomes were analysed by immunoblot (top panel). The immunoblot of the 20S
α-‐subunits confirms the affinity isolation of the 26S proteasomes (bottom panel). H-‐
K3=HeLa-‐K3.
C) ESCRT0 is required for the lysosomal degradation of MHC Class I molecules in
Hela-‐K3 cells. ESCRT0 was reduced in HeLa-‐K3 cells by siRNA to Hrs and STAM. 72
hrs later, the cells were fixed and the levels of STAM and MHC Class I visualised by
confocal microscopy.
D) After an ESCRT0 knockdown some 26S proteasomes are found in association
with recycling endosomes and MHC Class I molecules. HeLa-‐K3 cells were incubated
with the W6/32 antibody or fluorescently tagged transferrin (AlexoFluor 594-‐
Transferrin) for 15 min. The cells were fixed with 4% paraformaldehyde and 26S
proteasomes visualised with an anti-‐β5 antibody.
17
EXPERIMENTAL PROCEDURES
Plasmids and antibodies
The clone for TOM1 (IMAGE Clone 6470390) was purchased from Open Biosystems,
and cloned into the bacterial expression vector pET15b using the following primers:
Tom1 NdeI For GGAATTCCATATGATGGACTTTCTCCTGGGGAACCCGTT and Tom1
XhoI Rev CCGCTCGAGGACCCCACACTCATAAGGCAAACAGC. The GST-‐Nedd4 and
GST-‐E6AP plasmids were generously provided by Allan Weissman (National Cancer
Institute). The E6AP construct lacks the first 32 residues and the Nedd4 encodes the
full-‐length protein without the calcium binding C2 domain. GST-‐Hrs (pGEX4T2-‐Hrs),
and His-‐STAM1 (pTrcHisA-‐Hbp/STAM1) were gifts from Sylvie Urbé (University of
Liverpool). GST-‐hHR23A and GST-‐hHR23B were kind gifts from Peter Howley
(Harvard Medical School). The following antibodies were used: mouse monoclonal
to Hrs (Enzo Life Sciences), rabbit polyclonal to STAM (Santa Cruz), rabbit
polyclonal to hHR23A (Bethyl Laboratories), rabbit polyclonal to hHR23B (Bethyl
Laboratories and Enzo Life Sciences), rabbit polyclonal to the 20S Beta5 subunit
(PW8895, Enzo Life Sciences) and mouse monoclonals to ubiquitin (FK1, Enzo Life
Sciences and P4D1, Santa Cruz). All MHC Class I antibodies were kind gifts of Paul
Lehner (Cambridge Institute for Medical Research). Rabbit antiserum to TOM1 was
kindly given by Wanjin Hong (Institute of Molecular and Cell Biology, Singapore).
The AlexoFluor594-‐transferrin was given by Margaret Robinson (Cambridge
Institute for Medical Research).
18
Purification of UBD-‐containing proteins
GST conjugated Hrs, hHR23A and hHR23B were expressed in BL21DE3star E.
Coli, and purified using glutathione columns and FPLC (Biorad). The GST tag was
then cleaved, using thrombin or Prescission protease (GE Healthcare), and removed
by incubation with GSH sepharose (GE Healthcare). The eluted proteins were
further purified by ion-‐exchange chromatography, dialysed, and stored in 25mM
HEPES, 40mM KCL, 1mM DTT and 10% glycerol. His-‐tagged proteins were similarly
expressed in E. Coli and purified using a NiNTA column and FPLC, but the His tag
was not removed.
Mass spectrometry analysis
For samples separated by SDS-‐PAGE, gel bands of interest were excised, cut
into ~1mm3 pieces and destained in a 50% (v/v) methanol, 50 mM NH4HCO3 buffer
for Coomassie stained gels. Silver stained gel pieces were destained using the
BioRad silver stain destaining kit. Destained gel pieces were dehydrated with
acetonitrile for 15 minutes and dried in vacuuo for 5 minutes. Proteins were
digested in-‐gel by, firstly, allowing dehydrated gel pieces to absorb an ice-‐cold 5
ng/uL trypsin in 50 mM NH4HCO3 solution on ice, then incubated at 37 °C overnight.
Digested peptides were extracted by a 50% (v/v) acetonitrile, 5% (v/v) formic acid
buffer, followed by 100% acetonitrile. Samples were acidified to pH 2-‐3 with formic
acid, desalted by C18 solid-‐phase extraction (3M Empore), dried in vacuuo,
resuspended in a 5% (v/v) acentonitrile, 4% (v/v) formic acid buffer, and analysed
by LC-‐MS/MS on a LTQ-‐Orbitrap XL (Thermo Fischer Scientific) equipped with a
19
Famos autosampler (LC Packings) and an Agilent 1100 binary HPLC pump (Agilent
Technologies). Peptides were separated on a 100 µm I.D. microcapillary column
packed first with 20 cm of Magic C18 resin (5 µm, 100 Å, Michrom Bioresources).
Separation was achieved through applying a gradient from 5 to 35% acetonitrile in
0.125% formic acid over 33 min at approximately 300nl/min. Electrospray
ionization was enabled through applying a voltage of 1.8 kV through a PEEK
junction at the inlet of the microcapillary column.
For whole samples that were TCA precipitated, protein pellets were
resuspended in a 100mM NH4HCO3, 10% (v/v) acetonitrile buffer and digested
using a 1:50 ratio of trypsin:protein at 37 °C overnight. The digest was quenched
with a 50% (v/v) acetonitrile, 5% (v/v) formic acid buffer, desalted analysed by LC-‐
MS/MS as described above.
All proteins identified, including single peptide hits that were manually
verified, are detailed in the Supplementary file.
Immunofluorescence
HeLa-‐K3 cells were fixed with 4% paraformaldehyde for 15 min and then
permeabilized for 5 min in 0.2% Triton-‐X 100 PBS. Cells were blocked for 15 min in
0.2% BSA PBS before appropriate staining with primary and secondary antibodies.
Images were visualised using a Zeiss LSM710 Confocal Microscope. The transferrin
uptake experiments were performed as described, except that the cells were
deprived of serum for 30 min prior to a 15 min incubation with the AlexoFluor594-‐
transferrin and the W6/32 Class I antibody.