Vascular mineralocorticoid receptor regulates microRNA-155 to promote vasoconstriction

and rising blood pressure with aging

Jennifer J. DuPont1, Amy McCurley1, Ana P. Davel1,2, Joseph McCarthy1, Shawn B. Bender3,4,5,

Kwangseok Hong3,6, Yan Yang3, Jeung-Ki Yoo7, Mark Aronovitz1, Wendy E. Baur1, Demetra D.

Christou7, Michael A. Hill3,6, and Iris Z. Jaffe1*

1Molecular Cardiology Research Institute, Tufts Medical Center, Boston, MA

2Department of Structural and Functional Biology, Institute of Biology, University of Campinas-

UNICAMP, Brazil

3Dalton Cardiovascular Research Center, University of Missouri, Columbia, MO

4Research Service, Harry S. Truman Memorial Veterans’ Hospital, Columbia, MO

5Department of Biomedical Sciences, University of Missouri, Columbia, MO

6Department of Medical Pharmacology and Physiology, University of Missouri School of

Medicine, Columbia, MO

7Department of Applied Physiology and Kinesiology, University of Florida, Gainesville, FL

Supplemental Materials:

Supplemental Figure 1. Aldosterone increases MMTV-luciferase activity.

Simultaneous with the miR-155 host gene reporter assays in Figure 2C, human embryonic

kidney-293 (HEK293) cells were co-transfected with a full length human

mineralocorticoid receptor (MR)-expressing vector and a luciferase reporter plasmid

driven by the mouse mammary tumor virus (MMTV)-MR-response element. Twenty-four

hours later, cells were switched to serum-free media and treated with either vehicle or

aldosterone (10 nM) for 18 hours. Luciferase activity was measured and normalized to β-

galactosidase activity. *p<0.05 vs. vehicle.

Supplemental Figure 2. miR-155 overexpression does not alter mRNA expression of

the α2δ-1 subunit of the L-type calcium channel or the angiotensin II type-2

receptor. Mesenteric resistance vessel smooth muscle cells were transfected with either

scrambled control miR (Scr) or miR-155 mimic. After 48 hours, mRNA abundance of the

α2δ-1 subunit of the L-type calcium channel and the angiotensin II type-2 receptor

(Agtr2) were quantified. N = 3 independent experiments performed in triplicate, p>0.05.

Supplemental Figure 3. miR-155 overexpression decreases Cav1.2 and Angiotensin type-1

receptor expression in mouse aortic smooth muscle cells. Mouse aortic smooth muscle cells

were transfected with either scrambled control miR (Scr) or miR-155 mimic for 48 hours.

Abundance of mRNA of Cav1.2, the pore-forming subunit of the L-type calcium channel, and

the angiotensin II type-1a receptor (AT1a) were measured 48 hours after miR-155 transfection. N

= 3 independent experiments performed in triplicate, *p<0.05 versus scrambled control, un-

paired student’s t-tests.

Supplemental Figure 4. Diastolic blood pressure in young and aged MR-intact & SMC-

MR-KO mice. Blood pressure was measured via telemetry in young and aged mineralocorticoid

receptor (MR) intact and smooth muscle cell (SMC) MR-knockout mice. N= 4 young

mice/group, 10 aged mice/group.

Supplemental Figure 5. Confirmation of L-type calcium channel (LTCC) specific currents.

Patch clamp studies of freshly dispersed mesenteric resistance vessel smooth muscle cell (SMC)

from young and aged mineralocorticoid receptor (MR)-intact and SMC-MR-Knockout mice

were performed and current density was measured with LTCC agonist BayK-8644 in the absence

(Figure 3C) and the presence of the LTCC blocker nifedipine to confirm that these are indeed

LTCC-mediated currents. n = 16-18 cells, 3 young mice/group, 4 aged mice/group, P>0.05.

Supplemental Figure 6. Injection of a smooth muscle cell (SMC)-targeted mirR155

lentivirus specifically increases vascular miR-155 expression. Aged mineralocorticoid

receptor (MR)-intact mice were treated with either control (CTL) virus (n=5) or SMC-specific

miR-155 expressing lentivirus (miR-155 Virus) (n=5) and compared to aged SMC-MR-

Knockout mice treated with the control virus (n=3). miR-155 level was measured by QRT-PCR

in the aorta (A), liver (B), kidney (C), and heart (D) from lentivirus-treated mice. *p<0.05, One-

Way ANOVA with Bonferroni post hoc testing.

Supplemental Figure 7. Aortic mineralocorticoid receptor levels were measured in aged MR-

intact mice treated with control lentivirus (n=4), aged MR-intact mice treated with miR-155

lentivirus (n-5) and aged SMC-MR-KO mice treated with control lentivirus (n=3).

Supplemental Figure 8. Mesenteric resistance vessel contraction to phenylephrine in aged MR-

intact mice treated with control lentivirus (n-5), aged MR-intact mice treated with miR-155

lentivirus (n=5), and aged SMC-MR-KO mice treated with control lentivirus (n=3).

Supplemental Figure 9. Serum miR-155 levels were measured after 4 weeks of placebo and

eplerenone treatment. N=16 patients (8M, 8F).

Supplemental Table 1. Aging-induced alterations in vascular microRNA expression in MR-intact mice.

Young MR-intact vs. Aged MR-intact

Transcript ID Fold Change P valuemmu-miR-196a -31.454994 4.55E-08

mmu-miR-1 -19.960717 1.99E-06

mmu-mir-382 -14.258368 0.00018

mmu-mir-17 -13.440985 1.7E-07

mmu-mir-155 -13.340421 9.73E-08

mmu-mir-99b -11.255955 7.03E-07

mmu-let-7d -11.038603 8.04E-08

mmu-mir-329 -10.777953 1.62E-05

mmu-mir-127 -10.665678 0.002481

mmu-mir-337 -10.087154 2.62E-07

mmu-mir-720 -10.001292 5.87E-06

mmu-miR-133a -9.9095289 0.000588

mmu-mir-27b -9.9058297 3.03E-06

mmu-mir-324 -9.5135738 2.19E-05

mmu-mir-133b -9.383319 7.06E-07

mmu-mir-130b -9.0911079 9.99E-05

mmu-mir-200c -8.4689873 0.000444

mmu-mir-500 -8.2769652 7.82E-06

mmu-mir-193 -8.2269231 2.02E-05

mmu-mir-532 -8.1039841 0.000541

mmu-mir-497 -8.0862028 0.000586

mmu-mir-206 -7.9872731 0.00868

mmu-mir-541 -7.8297291 0.003527

mmu-mir-30e -7.3264955 0.000177

mmu-miR-125b-3p -6.972812 2.74E-05

mmu-mir-154 -6.6635529 1.8E-05

mmu-miR-199a-5p -6.6336851 0.006193

mmu-mir-423 -6.5970844 0.000319

mmu-mir-125a -6.5590783 0.00073

mmu-mir-1937a -6.3065666 0.003731

mmu-mir-134 -6.2906912 1.92E-06

mmu-mir-433 -6.2564602 2.85E-06

mmu-mir-708 -6.1928938 0.001487

mmu-miR-30c-1-star -6.0791701 1.87E-06

mmu-mir-342 -6.0730216 0.006428

mmu-mir-192 -6.0281338 7.24E-06

mmu-mir-98 -6.0131142 0.000361

mmu-mir-1981 -5.8597672 0.000803

mmu-mir-34a -5.7687483 0.002342

mmu-mir-328 -5.7264268 0.003277

mmu-mir-342 -5.6520423 1.61E-06

mmu-mir-181c -5.5635262 1.26E-06

mmu-miR-128 -5.5154379 0.00623

mmu-mir-351 -5.3724236 5.73E-05

mmu-miR-685 -5.3633639 8.68E-06

mmu-mir-434 -5.3500815 0.000326

mmu-mir-210 -5.2410407 0.005704

mmu-miR-3473 -5.1232784 0.005581

mmu-mir-423 -5.0321859 0.001588

mmu-mir-149 -4.9658632 0.0007

mmu-mir-183 -4.9539423 0.000305

mmu-miR-714 -4.9293034 5.53E-06

mmu-mir-181d -4.8729883 0.00769

mmu-mir-338 -4.8111653 0.000997

mmu-mir-30e -4.7956017 0.002475

mmu-miR-30c-2-star -4.5651217 0.007823

mmu-miR-138 -4.4567205 0.000869

mmu-mir-30b -4.240968 1.61E-05

mmu-mir-148a -4.207615 0.000477

mmu-mir-532 -4.1870779 5.26E-05

mmu-mir-299 -4.110415 6.46E-05

mmu-mir-22 -4.0989035 0.001982

mmu-mir-339 -4.0860316 0.000316

mmu-mir-1949 -4.079467 0.003746

mmu-mir-1198 -4.0515459 0.009018

mmu-mir-148b -4.0350891 0.001644

mmu-miR-689 -3.9294149 0.001255

mmu-mir-93 -3.7448734 0.000101

mmu-mir-485 -3.6633101 0.001504

mmu-mir-409 -3.5205878 0.002822

mmu-mir-671 -3.4899811 0.000916

mmu-mir-331 -3.1416564 0.000769

mmu-mir-466e -3.1414322 2.06E-05

mmu-mir-345 -3.0976449 0.006536

mmu-mir-673 -3.0960036 4.56E-05

mmu-mir-196b -3.092741 0.007776

mmu-mir-1940 -3.0911316 5.34E-06

mmu-mir-425 -3.0606115 6.55E-06

mmu-mir-350 -2.9484049 0.002046

mmu-mir-1946b -2.9448328 0.000124

mmu-mir-346 -2.880319 0.001687

mmu-mir-466c -2.7776728 0.000762

mmu-mir-501 -2.7229089 0.001951

mmu-mir-324 -2.6505418 0.000519

mmu-mir-345 -2.6497629 0.000439

mmu-mir-700 -2.6285465 0.009678

mmu-mir-1946a -2.6218116 0.00027

mmu-mir-322 -2.2845431 0.000705

mmu-mir-362 -2.2412142 0.002769

mmu-mir-503 -2.1913193 0.001521

mmu-mir-1982 -2.1501165 0.002955

mmu-mir-184 -2.1303763 0.000911

mmu-mir-214 -2.0951654 0.008664

mmu-mir-1965 -2.093159 0.002122

mmu-mir-1907 -2.090282 0.006287

mmu-mir-674 -2.0658172 0.000407

mmu-let-7g -2.0049106 0.001776

mmu-miR-2145 2.14292619 0.006949

mmu-mir-574 2.75474665 0.002212

mmu-mir-1196 2.82329364 0.008262

mmu-miR-2133 3.472153 0.00556

mmu-mir-2146 3.82389016 0.000174

mmu-mir-1893 4.41745363 0.000451

mmu-miR-805 4.42453802 6.79E-05

mmu-mir-705 4.42907102 0.007995

mmu-mir-1895 6.56493572 0.008052

mmu-miR-466f-3p 10.2030277 0.000103

mmu-mir-1931 12.0982976 0.002665

Supplemental Table 2. Aging-induced alterations in vascular microRNA expression in SMC-MR-KO mice.

Young SMC-MR-KO vs. Aged SMC-MR-KOTranscript ID Fold Change P value

mmu-mir-206-58.0826 1.52E-05

mmu-mir-541-40.0634 5.12E-07

mmu-mir-382-29.1249 3.71E-06

mmu-mir-127-27.8794 0.000327

mmu-mir-187-24.9565 0.000174

mmu-miR-30c-2-star-22.5589 0.00745

mmu-miR-196a-21.688 9.93E-06

mmu-mir-708-20.7187 3.09E-05

mmu-mir-379-19.5064 0.000525

mmu-mir-181d-17.9565 1.26E-05

mmu-miR-133a-17.0271 3.25E-06

mmu-mir-1198-16.2428 3.01E-05

mmu-mir-27b-16.183 3.14E-06

mmu-mir-1839-14.6185 0.002883

mmu-mir-425-14.1007 0.000769

mmu-mir-210-13.9967 0.000602

mmu-miR-3473-13.9415 0.001686

mmu-miR-1-13.092 0.00218

mmu-mir-1981-13.0184 4.12E-06

mmu-mir-10b-12.6139 0.002044

mmu-mir-328-12.2726 5.34E-05

mmu-mir-669c-12.2494 1.44E-05

mmu-mir-130b -11.6107 0.001783

mmu-mir-125a-11.3766 3.82E-05

mmu-mir-139-11.1958 0.002054

mmu-mir-99b-11.0801 0.009181

mmu-mir-200c-10.8383 5.65E-05

mmu-mir-423-10.4189 0.00503

mmu-mir-182-10.1968 0.003299

mmu-mir-423-10.1378 1.6E-05

mmu-mir-329-10.1009 3.38E-06

mmu-mir-1937a-9.54807 0.002594

mmu-miR-199a-5p-9.52139 0.006548

mmu-miR-194-9.02003 0.003355

mmu-mir-324-8.90113 0.002021

mmu-mir-106b-8.87615 0.00724

mmu-mir-421-8.80743 0.000371

mmu-mir-30a-8.3332 0.00706

mmu-mir-193-8.08454 4.3E-05

mmu-mir-98-7.91604 1.54E-06

mmu-mir-330-7.07044 0.001249

mmu-mir-26b-7.06025 0.002848

mmu-mir-674-6.08485 0.000837

mmu-mir-181c-5.85904 0.00024

mmu-mir-30b-5.17697 0.001957

mmu-mir-183-4.18795 0.009952

mmu-mir-671-4.02421 0.001537

mmu-mir-485-3.1196 0.003695

mmu-mir-345-3.08801 0.004506

mmu-mir-503-2.69332 0.003458

mmu-mir-346-2.63265 0.002614

mmu-let-7c-2.19744 0.004733

mmu-mir-1894-2.13212 0.009839

mmu-miR-699-2.02882 0.003654

mmu-mir-6902.645503 0.002799

mmu-mir-21463.744318 0.009381

mmu-miR-21333.845987 0.001164

mmu-miR-21354.081907 0.009011

mmu-mir-7055.017692 0.005219

Supplemental Table 3. Subject Characteristics.

Subject Characteristics N = 16 (8M/8F)Age (years) 64 ± 2BMI 29 ± 1.6Body Fat % 38.6 ± 2.4SBP (mmHg) 127 ± 3DBP (mmHg) 78 ± 2MAP (mmHg) 94 ± 2

Supplemental Table 4. qRT/PCR Primer Sequences.

Gene Name Gene Symbol Primer Sequence (5’-3’)

Calcium channel, voltage-dependent, L-type, alpha 1C subunit (Cav1.2)

Cacna1c F) ATGAAAACACGAGGATGTACGTT

R) ACTGACGGTAGAGATGGTTGC

Calcium channel, voltage-dependent, alpha2/delta subunit 1

Cacna2d1 F) GTCACACTGGATTTTCTCGATGC

R) GGGTTTCTGAATATCTGGCCTGA

Angiotensin II type 1 a receptor

Agtr1a F) AACAGCTTGGTGGTGATCGTC

R) CATAGCGGTATAGACAGCCCA

Angiotensin II type 1 b receptor

Agtr1b F) TGGCTTGGCTAGTTTGCCG

R) ACCCAGTCCAATGGGGAGT

Angiotensin II type 2 receptor Agtr2 F) AACTGGCACCAATGAGTCCG

R) CCAAAAGGAGTAAGTCAGCCAAG

Beta-2-microglobulin B2m F) GCTATCCAGAAAACCCCTCAA

R) CATGTCTCGATCCCAGTAGACGGT

Mmu-miR-155-5p miR-155 UUAAUGCUAAUUGUGAUAGGGGU