Vitamin E Succinate Induces Fas-mediated Apoptosis in ......mechanism (5, 6). In support of this, Fariss et al. (8) recently dem onstrated that VES-mediated growth inhibition of murine

[CANCER RESEARCH57, 881-890, March 1, 19971

regulate TGF-@3protein production (6, 7). Also, the growth inhibitoryfunctions of VES may be independent of VES's potential antioxidantmechanism (5, 6). In support of this, Fariss et al. (8) recently demonstrated that VES-mediated growth inhibition of murine leukemicbut not normal murine hematopoietic cells occurred by nonantioxidant, nonhydrolyzable ether forms of yES.

In many instances, growth inhibition following terminal differentiation(25â€”27)or anticancer drug treatment (28, 29) results in apoptosis (programmed cell death). Apoptosis is an active process characterized by aseries of metabolic events requiring active gene transcription and proteinsynthesis (28, 30, 3 1). Endonuclease cleavage of chromatin is an initialapoptotic commitment step that occurs in viable cells and gives rise toDNA fragmentation, a measurement of apoptosis (30).

Several interrelated events regulated by families of proteins thatmediate the apoptotic process have been identified. Many extracellular signaling events [irradiation, serum and cytokine deprivation, andtriggering cell surface receptors such as TNF or Fas/APO-l/CD-95(Fas)] can induce apoptosis. Intracellular mediators of apoptosis havealso been identified. Wild-type p53 blocks cell proliferation by preventing G1 progression following either DNA damage or serumderivation, both of which can lead to apoptosis. In particular, wildtype p53 up-regulates p2lc@ [an inhibitor of cyclin-dependent kinases (32)], bax [an inhibitor of bcl-2 (33)], and Fas (34) expression.Wild-type p53 also down-regulates bcl-2 [an inhibitor of apoptosis(33, 35)] expression. In contrast, bcl-2 has been shown to block bothwild-type p53 function (36) and Fas-induced apoptosis (37). Cysteineproteases such as Caenorhabditis elegans cell death gene (ced-3) andthe ced-3 mammalian homologue ICE are common distal effectorcomponents of the apoptotic machinery (38). The activation of ICE orICE-like proteases has been implicated in the apoptotic processthrough their cleavage of vital targets that lead to nuclear events suchas endonuclease activation (39).

We have previously shown VES to induce apoptosis in humanB-lymphoma cells (6). Here, we demonstrate that VES-mediatedgrowth arrest of the estrogen receptor-negative (antiestrogen therapyresistant) breast cancer cell lines, MDA-MB-23l and SKBR-3, resultsin apoptotic cell death. In human breast tumors, estrogen receptornegative status is associated with low expression of bcl-2 and a higherfrequency of p53 gene mutations (40, 41). Both MDA-MB-23 I andSKBR-3 cells have been previously shown to contain mutant p53 (35)and to express undetectable bcl-2 protein (35, 42). Therefore, wefocused our study on the Fas apoptotic signaling pathway and provideevidence that it is involved in VES-mediated cell death.

881

ABSTRACT

Vitamin E succinate (yES), a derivative of the fat-soluble vitaminD-a-tocopherol (vitamin E), inhibited growth and induced apoptotic celldeath of estrogen receptor-negative human breast cancer cells. VESinduced apoptosis in MDA-MB-231 and SKBR-3 cells occurred through aFas pathway. Total protein levels of the Fas receptor (Fas; APO-1/CD-95)and the Fas ligand (Fas-L) were increased following VES treatment. Inaddition, VES increased cell surface Fas expression. Fas-neutralizingantibodies and Fas-L antisense oligonucleotides blocked VES-inducedapoptosis. The presence of Fas-L antisense oligonucleotides also cornpletely blocked the VES-mediated increase in Fas-L protein expression.These data indicate a role for Fas signaling in VES-mediated apoptotic celldeath of human breast cancer cells. These findings also suggest that VESmay be ofclinical use in the treatment of aggressive human breast cancers,particularly those that are refractory to antiestrogen therapy.

INTRODUCTION

The development of more effective biological therapies for breastcancer is under intense investigation. Naturally occurring agentsand/or their derivatives are appealing anticancer agents. Fat-solublevitamins (A, D, E, and K) have been investigated for antitumorproperties and found to possess antiproliferative effects. Vitamin A, inthe form of retinoic acid, has been used successfully in the treatmentof promyelocytic leukemia (1, 2). Vitamin E and VES3 negativelyregulate tumor cell growth in vitro (3â€”8)and in vivo (9â€”12).Currently, Phase I clinical trials are planned in breast and prostate cohortsfor vitamin E and vitamin E derivatives like VES (12). An advantagefor using vitamin E and/or vitamin E derivatives in human cancertherapy is its low level of toxicity in vivo (13).

Vitamin E is characterized as a fat-soluble membrane antioxidant(14). VES, however, does not possess antioxidant properties unlessthe succinate group is removed by a nonspecific esterase (I 1). VEShas been shown to be a widespread potent growth inhibitor of human(5â€”7),murine (15â€”19),and avian (20) cancer cells in vitro. in vivo,vitamin E has been shown to inhibit tumorigenesis in the mouse skinand colon, hamster buccal pouch and tongue, and rat liver and mammary gland (12). The mechanism of action of VES in growth inhibition and differentiation is unknown. Studies have shown vitamin Eand/or VES to modulate adenylate cyclase and cyclic AMP-dependentproteins (21â€”23),inhibit protein kinase C activity (3, 4, 24), and

Received 8/9/96; accepted 1/2/97.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

I The content of this publication does not necessarily reflect the views or policies of the

Department of Health and Human Services nor does mention of trade names, commercialproducts, or organizations imply endorsement by the U.S. government.

2 To whom requests for reprints should be addressed, at Laboratory of Leukocyte

Biology, Building 567, Room 276, National Cancer Institute, Frederick, MD 21702.Phone: (301) 846-1442; Fax: (301) 846-7034.

3 The abbreviations used are: yES, vitamin E succinate; TGF-fJ, transforming growth

factor @3;TNF, tumor necrosis factor; ICE, interleukin I@3-converting enzyme; TUNEL,terminal deoxytransferase-mediated dUTP-biotin nick end labeling; RT, reverse transcription; HPRT, hypoxanthine phosphoribosyl transferase; CHX, cycloheximide; Ab, antibody; Fas-L, Fas ligand.

Vitamin E Succinate Induces Fas-mediated Apoptosis in Estrogen Receptor

Negative Human Breast Cancer Cells'

Jennifer M. Turley, Tao Fu, Francis W. Ruscetti, Judy A. Mikovits, Daniel C. Bertolette III, andMaria C. Birchenall-Roberts2Laboratory of Leukocyte Biology. Division of Basic Sciences, National fancer Institute, Frederick, Maryland 21 702 fJ. M. T., F. W. R.J and Intramural Research SupportProgram. Science Applications international Corporation (SA1C)-Frederick, National Cancer Institute-Frederick fancer Research and Development Center, Frederick, Maryland

21702 IT. F., J. A. M., D. C. B., M. C. B-R.J

MATERIALS AND METHODS

Cell Culture. MDA-MB-231 and SKBR-3 human breast cancer cells(American Type Culture Collection, Rockville, MD) were maintained in RPMI

1640 (Life Technologies, Inc., Grand Island, NY) supplemented with 10%fetal bovine serum (Hyclone, Logan, UT), 100 units/ml penicillin, 100 p@g/ml

streptomycin, 4 mM glutamine, nonessential amino acids, and HEPES buffer

(Life Technologies, Inc.). For experiments, the percentage of serum wasreduced to 2.5% in the same medium to more clearly study growth inhibition,

as previously reported (43).

on July 2, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

yES INDUCES APOPTOSIS IN BREAST CANCER CELLS

Proliferation Assay. Cells were removed from tissue culture flasks bytrypsinization, suspended at a concentration of 5 X l0'@/ml,treated in thecells

were washed twice with PBS and lysed for 30 mm on ice in 50 p1radioimmunoprecipitation assay lysis buffer (150 mrviNaCI, 1.0%NP4O,0.5%presence

or absence of 20 @tg1ml,10 @.tWml,or 5 @.tg/mlyES, vehicle (5 ,ig/mldeoxycholic acid, 0.1% SDS, and 50 mMTris, pH 7.4). Cellular debriswassuccinicacid and 0.1% ethanol), or antioxidants [butylated hydroxyanisol (20,removed by centrifugation (10 mm at 15,000rpm), and proteinconcentrations10,

and 5 @.LM),butylated hydroxytoluene (20 ,.LM,10 @.tM,and 5 ,.tM),andwere determined against standards using the Bio-Rad protein assay(Bio-RadN-acetylcysteine(l0@@,@ and l0@ M; Sigma, St. Louis, MO; Refs. 44 andLaboratories, Inc., Melville, NY). Cell lysates containing 300 p@gproteinwere45)

and cultured for 8, 24, and 48 h in a humidified atmosphere of 5% CO2 inmixed with sample buffer and analyzed with a SDS-12% polyacrylamidegel.air.Cell proliferation was determined by cell counting using a hemacytometerProteins were transferred to polyvinylidene difluoride membranes (Novex,Sanor

the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide assay perDiego, CA) by electroblotting and membranes were blocked for 1 h inTBSTthemanufacturer's instructions (Promega, Madison, WI). Cell viability was(0.15 M NaCI, 25 mMTris, and 0.5% Triton X-l00, pH 7.4) containing5%determined

by trypan blue dye exclusion analysis.nonfat dry milk (blocking buffer). Membranes were incubated withprimaryDNAAnalysis. DNA fragmentationanalysis by gel electrophoresiswasantibodies (rabbit anti-human Fas clone N-18 and rabbit anti-humanFas-Lperformed

as described previously (6). Briefly, 1 X 106 MDA-MB-23l orclone N-20; Santa Cruz Biotechnology, Santa Cruz, CA; mouseanti-humanSKBR-3

cells were treated with medium (untreated), vehicle, or VES (10@3-actin clone AC-l5; Sigma) diluted in blocking buffer for I h, washedthree@tg/ml)for 24 or 48 h, washed twice in PBS, and RNase digested for 2 h attimes with TBST, incubated with goat anti-rabbit streptavidin-biotinylated

37Â°Cwith 200 lLWmlDNase-free RNase A (Sigma, St. Louis, MO) in 0.5 mlhorseradish peroxidase secondary antibodies (Amersham, ArlingtonHeights,PBS.Cells were thenpelletedby centrifugation,lysed by theadditionof 50 p1IL) diluted 1:5000 in blockingbufferfor I h, washedthreetimes withTBST,DNAlysis buffer (10 mM Tris, 5 mM EDTA, and 0.5% sodium lauryland developed using enhanced chemiluminescence (Amersham). Allreactionssarcosine,

pH 7.4) containing 0.5 mg/ml proteinase K (Sigma), and proteinswere performed at room temperature on a rocking platform. Quantificationofwere

digested for 2 h at 50Â°C.Cellular debris was removed by centrifugationprotein expression was determined by densitometricanalysis.andDNA from cell lysates was analyzed on a 1.8%TAE-agarose gel contain Cell Surface Fas Analysis. MDA-MB-231 and SKBR-3 cells weretreatedingethidium bromide. DNA was visualized and photographed under UV light.in the presence or absence of VES (10 @g/ml)for 24 h, washed twicewithFor

DNA analysis by flow cytometry, 2 X 106cells were cultured for 24 hPBS, reacted with mouse anti-human Fas (clone CH-l 1; Upstate Biotechnolor 48 h in the presence or absence of VES (10 @.tg/ml).Following culture, cellsogy, Inc., Lake Placid, NY) for 30 mm at 4Â°C,washed twice in PBS,reactedwere

washed twice with PBS and fixed in 1 ml ice-cold ethanol for 1 h at 4Â°C.with FITC-conjugated goat anti-mouse IgG (Kirkegaard and PerryLabs,Fixedcells were pelleted, resuspended in 0.5 ml PBS containing 30 @&g/mlGaithersburg, MD) for 20 mm at 4Â°C,washed twice in PBS, and analyzedbypropidium

iodide and 1 mg/ml RNase A (Sigma), and analyzed for DNAflow cytometry. The flow cytometric analysis was gated into two cell popu

content using flow cytometry. Cell cycle histograms were then analyzed usinglations: one containing large cells and one containing small cells. We perthe multicycle computer program.formed experiments using irrelevant isotype-matched (normal) primary anti

DNA was also analyzed using the TUNEL assay. Cells were treated in thebodies followed by the FITC-labeled secondary antibody or theFITC-labeledpresenceor absence of VES (10 @g/ml)for 24 h, distributed onto glass slidessecondary antibody alone. The results were found to be virtuallyidentical.using

a Shandon Cytospin, and analyzed for apoptosis as described previously(46). Briefly, cells were fixed overnight in 10% formalin, treated with pro

Faa-neutralizing Antibody and Fas-L Antisense Oligonucleotide Assays. Cells were plated at a concentration of 5 X 104/ml and treatedwithteinase

K and then H2O2,probed with terminal deoxynucleotidyl transferasemedium (untreated) or VES (10 @g/ml).Untreated or VES-treated cellswereandextra-avidin peroxidase, and counterstained with methyl green/Alciancultured in the presence of an apoptosis neutralizing monoclonal anti-Fas

antibody (clone ZB4; Immunotech, Inc., Westbrook, ME; 500 ng/ml deter

RT-PCR. MDA-MB-23l andSKBR-3cells weretreatedin thepresenceofmined to be the optimal concentrationin preliminaryexperiments)ortheVES(10 @g/ml)for 0, 4, 8, and 24 h, washed twice with PBS, and RNA wascontrol antibody (mIgG, 500 ng/ml; Sigma). Cells were cultured for 24h,isolated

using the Totally RNA kit per the manufacturer's instructions (Am distributed onto glass slides using a Shandon Cytospin, and analyzedforbion,Austin, TX). RNA (5 @g)was converted to DNA using the eDNAapoptosis using the TUNEL assay and flow cytometry as describedabove.synthesis

system per the manufacturer's instructions (Life Technologies, Inc.).

A reverse transcriptaseminus control in the PCRs routinelyconductedandAlternatively,cells were cultured in the presence of 10 p.M(previously

determined optimal concentration) Fas-L sense (A1'@CAGCAGCCCT

verified that genomic DNA was not being amplified. Semi-quantitative RT TCAATTAC), FasL antisense (GTAATI'GAAGGCICTGCTGCAT),or nonPCR was done with an automated thermal cycler (Perkin-Elmer Corporation,sense (AGTFCAGGCAAGAGAGAACCA) oligonucleotides for 1 h at37Â°C.Norwalk,

CT). The following conditions were found to be within the linearThe Fas-L oligonucleotide was directed against the ATG translational startsiterangeof analysis for each primer set: cDNA was incubated with two pairs of(underlined) in the fas-L mRNA. Cells were then treated in the presenceorprimers

(200 ng each) for human Fas, Fas-L, or HPRT, and reactions wereincubated for 30 cycles (denaturation for 30 s at 94Â°C,annealing for 60 s atabsence

of VES (10 @g/ml).Following 24 h of culture, cells were analyzed forapoptosis using the TUNEL assay and flow cytometry as describedabove.60Â°C,

and extension for 60 s at 72Â°C).Samples were analyzed on an 8%For both the Fas-neutralizing antibody and Fas-L antisense TUNEL experpolyacrylamide-Tris-borate EDTA gel. mRNA levels were quantified by den

sitometric analysis of the photographic negative of the ethidium bromide

iments, a minimum of 400 cells per treatment were counted and the percentageof apoptotic cells was determined. The percentage of reversal from yES

stained gel. Levels were normalized for loading differences as determined bythe HPRT control. The following gene-specific primers were used: Fas senseACTGCGTGCCCTGCCAAGAAG, Fas antisense AAGACAAAGCCAC

induced apoptosis was calculated using the following formulas that determinethe control antibody or sense difference minus the neutralizing antibody orantisense difference as a percentage of the control antibody or sensedifference.CCCAAGUAGA,

Fas-L sense GCCTCTGGAATGGGAAGACACC, Fas-Lantisense CATCTGCCCAGTAGTGCAGTAG, HPRT sense TATGGACAGGACTGAACGTCTTGC, and HPRT antisense GACACAAACATGAT

TCAAATCCCTGA.untreated

VES.treated(Control Ab - Control Ab(Neutralizing AbL@@t@ted Neutralizing AbvEs.t@ated)@ 100The

fas message is represented by a 296-bp band, the fas-L messageisrepresentedby a 250-bp band, and the HPRT message is represented by a

496-bp band.Western Blot Analysis. For time-courseWesternblot analysis, 3 X 106x

100MDA-MB-23

I and SKBR-3 cells were cultured for 0, 4, 8, or 24 h inthepresenceof 10 @.tg/mlyES. For CHX protein synthesis experiments, MDA

MB-23l and SKBR-3 cells were cultured for 4 or 8 h in the presenceorabsenceof 10 @g/mlCHX and 10 @.tg/mlyES. For Fas-L antisense experi

ments, cells were cultured in the presence of 10 @.tMFas-L sense orantisenseoligonucleotidefor I h and then treated in the presence or absence of 10g.tg/mlVES

for 8 h (SKBR-3 cells) or 24 h (MDA-MB-231 cells). Following culture,

blue.

(Control Abu@e@@_ Control Abv@t@@)

(Sense(@1@T@ted_ Senseviea@)â€”(Antisenseur@@tc@t_ [email protected]@)

(Senseufh@ed_ SenseV@a@)

RESULTS

Inhibitionof HumanBreastCancerCellProliferationby yES.VES has been previously shown to function as a growth inhibitoryagent (3â€”12).VES inhibited MDA-MB-23 1 and SKBR-3 human

882




breast cancer cell growth in a dose-dependent manner. In MDA-MB23 1 cells, VES at 5, 10, and 20 @g/m1decreased cell number by 24,67, and 85% following 48 h of culture, respectively (Fig. IA). InSKBR-3 cells, VES at 5, 10, and 20 p.g/ml decreased cell number by10, 54, and 74% following 48 h of culture, respectively (Fig. 1B). Theoptimal growth inhibitory concentration of VES was determined to be10 @tg/mlbecause it reduced MDA-MB-23 1 and SKBR-3 cell numberwhile maintaining >90% viability at 24 h and 88 and 68% viability at48 h, respectively. VES at 20 @g/mlwas found to be cytotoxic forboth cell lines. Using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide proliferation assay, treatment with VES (10;.Lg/ml) inhibited both MDA-MB-23 1 and SKBR-3 cell proliferation

by 77% following 48 h of culture (data not shown). The vehicle (0.1%ethanol and 5 @g/mlsuccinic acid), fat-soluble antioxidants butylatedhydroxyanisol and butylated hydroxytoluene, and water-soluble antioxidant N-acetylcysteine did not affect cell proliferation (data notshown). This suggests that antioxidant activity alone cannot explainthe antiproliferative activity of VES.

To determine whether apoptosis occurred during growth inhibition,DNA fragmentation analysis, an indicator of apoptotic DNA (47), wasperformed. Agarose gel electrophoresis demonstrated DNA laddering,typical of apoptosis, following 48 h of VES treatment in MDA-MB23 1 cells and 24 h of VES treatment in SKBR-3 cells (Fig. 2). DNAladdering was not present in MDA-MB-23l cells following 24 h ofVES treatment (data not shown).

VES-induced apoptosis was studied further in MDA-MB-23l andSKBR-3 cells using flow cytometry. Cell cycle analysis following24 h of VES treatment revealed the presence of a sub-01 apoptoticpeak in MDA-MB-23 1 and SKBR-3 cells (Fig. 3A). In MDA-MB-23 1and SKBR-3 cells, apoptosis varied from 30 to 47% following 24 h ofVES treatment and 74 to 81% following 48 h of VES treatment (Fig.3B). Spontaneous apoptosis in untreated control cells increased fromapproximately3% at24 h to12to18% at48 h,possiblyasa resultof the cell culture confluency (Fig. 3B).

Effect of VES onfas andfas-L mRNA Levels. Fan and its ligandare known mediators of apoptosis (48â€”51).Both MDA-MB-231 andSKBR-3 cells have been previously shown to contain mutant p53 (35)and to express undetectable bcl-2 protein (35, 42). Therefore, wedetermined whether VES signals DNA fragmentation via Fas-mediated apoptosis. The effect of VES onfas andfas-L mRNA levels wasstudied using semiquantitative RT-PCR. The conditions establishedfor the RT-PCRs were determined to be within the linear range foreach primer set used (see â€œMaterialsand Methodsâ€•;data not shown).A time-course study (0, 4, 8, and 24 h) showed VES treatment to have

12

4â€”

3â€”2â€”

1.6

0.5â€”

Fig. 2. Induction of apoptosis by VES in human breast cancer cells. DNA fragmentation analysis by agarose gel electrophoresis. MDA-MB-23I cells were cultured for 48 hand SKBR-3 cells were cultured for 24 h in the presence or absence of 10 @zg/mlVES.Following culture, DNA was analyzed using a I.8% agarose gel and photographed underUV light. The data are from a representative experiment (n = 3).

A BMDAâ€”MB-231 SKBR-3

Fig. 1. Inhibition of MDA-MB-23 I and SKBR-3cell growth by yES. yES decreased MDA-MB-23I(A) and SKBR-3 (B) cell number in a dose- andtime-dependent manner. Cells were cultured for 8,24, or 48 h in the presence or absence of increasingconcentrations of yES (0, 5, 10, or 20 @sg/ml)andcounted using a hemacytometer. Data are from arepresentative experiment (n = 3). The SE for thepercentage of growth inhibition of separate experiments was never >8% for MDA-MB-23l cells and9% for SKBR-3 cells.

1@x

2Ez

Time (hours) Time (hours)

883

MDA-MB-231 SKBR-3

little or no effect onfas mRNA levels in MDA-MB-23 1 and SKBR-3cells (Fig. 4). In contrast, in both cell lines, VES treatment increasedfas-L mRNA levels by >75% at 8 h of treatment (Fig. 4). At 24 h oftreatment, fas-L mRNA levels were still elevated in MDA-MB-23lcells; however, in SKBR-3 cells, fas and fas-L mRNAs were decreased possibly due to a more rapid rate of VES-mediated apoptosisseen in these cells.

VES Increases Fas and Fas-L Protein Levels. Westernblot analysis was performed to study the effect of VES on Fas and Fas-Lprotein levels. After 8 h of VES treatment, Fas and Fas-L proteinlevels increased by 81% and 48% in SKBR-3 cells, respectively (Fig.5A). At 24 h, VES increased Fan and Fas-L protein levels by 62 and

VES:Mr (Kb)



28124(

20(

16(

12(

8(

4(

(,

I II I I S.. UT

320(

16(

4c

12(

BC

C'S

IS S II I

VES

241

20(

16(â€”

I I I I I -

@ UT12(8(4(C.,@.p

@

VES INDUCES APOPTOSIS IN BREAST CANCER CELLS

A

V

zâ€˜-4V0

V

zâ€˜-4

V0

I

pp

SKBR.3

Fig. 3. Quantification of VES-induced apoptosis in MDA-MB-231 and SKBR-3 cells using flow cytometry. A, cell cycle histograms of 24 h untreated (UT) and VES-treated (10zg/ml) cells. B, quantification of the apoptotic peak (sub-Gt) in untreated and VES-treated cells following 24 and 48 h of culture. as determined by flow cytometry. Data are the

percentage of cells in the apoptotic peak from a representative experiment (n 3). The SE of separate experiments was never >4% at 24 h and 8% at 48 h.

@(UL

60(

50C

40C

30C

20C

1OC

VES

â€”s@@@@@

DNA Caiitexit

B

1@u ibU@@

DNA Content

100@UT

80

WI

I ::@

: 2:@J

MDA-MB-231

92% in MDA-MB-23 1 cells, respectively (Fig. 5A). The decrease inFas and Fas-L protein expression at 24 h in VES-treated SKBR-3 cellsmay be related to a more rapid rate of apoptosis seen at 24 h ascompared to MDA-MB-231 cells. Overall, the VES-mediated increase in Fas-L protein levels correlated with the increase in fas-LmRNA levels (Figs. 4 and 5). MDA-MB-23 I cells express higherlevels of Fas protein and mRNA than SKBR-3 cells. Also, the VESmediated increase in Fas protein levels did not correlate with theresults showing VES to have no effect on fas mRNA levels. Therefore, we next determined whether the VES-induced increase in Fasprotein levels was dependent on protein synthesis. Cells were culturedin the presence or absence of the protein synthesis inhibitor CHX (10@tg/ml)and VES (10 @g/ml).The regulation of Fas protein levels was

analyzed with a SDS-12% polyacrylamide gel and anti-Fas immunoblotting. Fas protein levels declined 82 and 86% in MDA-MB-231and SKBR-3 cells, respectively, following 4 h of CHX and VES

treatment as compared to the levels observed in VES-treated controlcells (Fig. SB). Similar findings were also observed following 8 h ofculture (data not shown). These results indicate that protein synthesisis necessary for the increase in Fas protein expression levels inVES-treated cells.

VES Increases Cell Surface Fas Expression. To determinewhether the VES-induced increase in Fan protein synthesis resulted inincreased levels of cell surface Fas expression, flow cytometry studieswere performed. When analyzing the cells for surface Fas expression,two populations of cells were observed. These populations, containinglarge or small sized cells, were gated separately, giving rise to twoseparate histograms. The population containing small cells couldcontain viable cells committed to apoptosis since cells undergoingapoptosis show a reduction in size (52, 53). After 24 h of treatment,VES increased cell surface Fas expression by 3 1 and 33% in MDAMB-231 and SKBR-3 cells, respectively, as compared to untreated

884

MDA-MB-231 SKBR-3




SKBR-3

â€” + + +

MDA-MB-231

â€” + + +VES:

Fig. 4. Effect of VES on fas and fas-L mRNAlevels. Time-course semiquantitative RT-PCRanalysis offas,fas-L, and HPRT (control) mRNAlevels in MDA-MB-231 and SKBR-3 cells. Cellswere cultured for 0, 4, 8, or 24 h with 10 @zg/m1yES, DNA was synthesized from 5 @gtotal RNA,and RT-PCR was performed as described in â€œMaterials and Methods.â€•Samples were analyzed onan 8% polyacrylamide-Tris-borate EDTA gel. thegel was stained with ethidium bromide, and mRNAlevels were normalized for loading differences asdetermined by densitometric analysis of the photographic negative and as compared to the HPRTcontrol. The HPRT message is represented by a496-bp band, the fas message is represented by a296-bp band, and the fas-L message is representedby a 250-bp band. Data are from a single representative experiment (n = 3).

Time(h) 0 4 8 24 0 4 8 24

control cells (Fig. 6). Similar increases in VES-mediated Fas cellsurface expression were observed whether the larger or the smallercell size populations were examined (Fig. 6).

Neutralizing Antibodies to Fas and Antisense Oligonucleotidesto Fas-L Block YES-inducedApoptosis.To determinewhetherFas-mediated signals were involved in VES-induced apoptosis of

MDA-MB-231 and SKBR-3 cells, apoptosis neutralization experiments using Fas antibodies were performed. Cells were cultured in thepresence of the control antibody (mIgG; Sigma) or Fas-neutralizingantibody (clone ZB4; Immunotech, Inc.; 500 ng/ml) and in the presence or absence of yES. Apoptosis was measured using the TUNELassay following 24 h of culture. In Fig. 7, A and D, cells treated with

AVES:Mr(Kd)

66

MDA-MB-231 SKBR-3â€” + + + â€” + + +

@-p48Fas46 â€”@@

30â€”Fig. 5. VES increases Faa and Fas-L protein

levels. A, time-course Westem blot analysis of Fasand Fas-L protein levels in MDA-MB-231 andSKBR-3 cells. Cells were cultured for 0, 4, 8. or24 h with 10 @.tg/m1yES, and 300 @zgprotein weresubjected to a SDS-l2% polyacrylamide gel andimmunoblotting with specific anti-Fas or anti-Fas-Lantibodies. B, Western blot analysis of Fas following 4 h of culture in the presence or absence of 10,.&g/mICHX and 10 @g/mlyES. Protein (300 @zg)from total cell lysates was subjected to a SDS-l2%polyacrylamide gel and immunoblotting with specific anti-Fas antibodies. Data arc from a representative experiment (n = 3).

@e-p40Fas-L

B

46â€”

30 â€” -

Time(h) 0 4 8 24 0 4 8 24

MDA-MB-231 SKBR-3VES: + + + +CHX: â€” + â€” +

Mr(Kd)66 â€”

Â°Ã¸-p48Fas46 â€”

30 â€”

885

*496bp HPRT

.uI@ â€˜@@ -@ Â°4-296bpFas

@ ..@ +250bp Fas-L




Ez

C,

A

B

1 10 100Fluorescence Intensfty

1 10

Fluorescence Intensfty

Â° _â€œ) ./@

I..'

hi ,â€˜4@_\

ba C

@./

WI

f

..

t. vsFig. 7. Effect of Fas-neutralizing antibodies on VES-induced apoptosis in MDA-MB-231 (aâ€”c)and SKBR-3 (dâ€”J)cells as determined with the TUNEL assay. Cells were

treated with control antibody or Fas-neutralizing antibody. Cells were also treated with medium (control) or 10 p@g/mlVES. Following 24 h of culture. cells were distributedonto glass slides using a Shandon Cytospin and analyzed for apoptosis using the TUNEL assay. Cells stained brown are positive for apoptosis. a and d, cells treated with thecontrol antibody in the absence of VES; b and e, cells treated with the control antibody in the presence of VES; and c and f, cells treated with the Fas-neutralizing antibodyin the presence of yES. Cells treated with the Fas-neutralizing antibody in the absence of VES (data not shown) were similar to the cells shown in a and d. Data are from arepresentative experiment (,i = 3).

886

MDA-MB--231 SKBR-3

Fig. 6. VES increases cell surface Fas expression in MDA-MB-231 and SKBR-3 cells. Cells were treated in the presence or absence of VES (10 @zWml)for 24 h and then analyzedfor cell surface Fas expression using flow cytometry. The flow cytometric analysis was gated into two populations: one containing large cells (A) and one containing small cells (B).Data are from a representative experiment (n = 3). The SE of the separate experiments was never >6% for both cell lines. UT, untreated.

MDA-MB-231

p

SKBR-3

a,;.....

â€˜S @. e

I-@



apoptosis in the presence of the Fas-neutralizing antibody (Fig. 8B).Thus, the Fas-neutralizing antibody reversed VES-induced apoptosisby 91% in MDA-MB-23l cells and 97% in SKBR-3 cells.

To further implicate VES as a mediator of Fas-induced apoptosis inU MDA-MB-23l andSKBR-3cells,apoptosisexperimentswerecon. UT ducted with Fas-L antisense oligonucleotides. Cells were cultured in

VES the presence of an optimal concentration (10 .LM)of sense or antisense

Fas-L oligonucleotides or a nonsense oligonucleotide and in thepresence or absence of yES. Apoptosis was measured using theTUNEL assay following 24 h of culture. The cells treated in thepresence of the nonsense, sense, or antisense oligonucleotides onlycontained 1â€”7%apoptotic cells (Fig. 9, A and B). In MDA-MB-23lcells, VES induced 77% apoptosis in the presence of the nonsenseoligonucleotide, 68% apoptosis in the presence of the sense oligonucleotide, and 23% apoptosis in the presence of the antisense oligonucleotide (Fig. 9A). In SKBR-3 cells, VES induced 78% apoptosis inthe presence of the nonsense oligonucleotide, 79% apoptosis in thepresence of the sense oligonucleotide, and 24% apoptosis in thepresence of the antisense oligonucleotide (Fig. 9B). Thus, Fas-L

____________ antisense oligonucleotides reversed VES-induced apoptosis by 52% in

MDA-MB-23 1 cells and 48% in SKBR-3 cells. Western blot analysiswas performed using antibodies specific for Fas-L or j3-actin (control). Fas-L antisense oligonucleotides prevented the VES-mediatedincrease in Fas-L protein levels (Fig. 9C). A similar reversal ofVES-induced apoptosis by Fas-neutralizing antibodies and Fas-L an

U UT tisenseoligonucleotideswasseenusingflow cytometncDNA anal@ VES ysis (data not shown). These findings indicate a role for Fas signaling

in YES-mediated apoptosis of MDA-MB-231 and SKBR-3 cells.

DISCUSSION

VES was found to inhibit growth and induce apoptosis in MDAMB-23 1 and SKBR-3 estrogen receptor-negative human breast cancercells. Three separate methodologies, agarose gel electrophoresis, flowcytometry, and TUNEL analysis, showed YES-induced growth arrestof MDA-MB-23l and SKBR-3 cells to result in DNA fragmentationand apoptosis. We also presented evidence suggesting that YESmediates apoptosis through the FaslFas-L pathway in these humanbreast cancer cells. Although this study focuses on VES regulation ofestrogen receptor-negative cells, we and others (54) have found thatMCF-7, an estrogen receptor-positive cell line, also undergoes VESinduced apoptosis. In contrast, preliminary results show that T47Destrogen receptor-positive cells and BT-20 estrogen receptor-negativecells undergo growth arrest but not apoptosis following identical VEStreatment protocols.4 Studies with cell populations from tumor sampies are needed to determine whether VES-induced apoptosis isrelated to estrogen sensitivity or other cofactors.

Fas has been shown to be constitutively expressed in a variety ofepithelial cells (55). Normal mammary epithelial cells are heterogeneous for Fas expression whereas their neoplastic counterparts areprimarily positive for Fas expression (55). MCF-7 cells in particularare weakly positive for Fas expression with intense Fas expressionoccurring after WN-'y treatment (55). Shown here, MDA-MB-23l andSKBR-3 cells constitutively express low levels of Fas and Fas-Lprotein. YES positively regulated Fas and Fas-L protein expressionlevels in both cell lines. The VES-mediated increase in Fas proteinlevels required protein synthesis and led to increased cell surface Faaexpression. The YES-mediated increase in Fas-L protein levels maybe due to increasedfas-L mRNA levels. Similarly, in MDA-MB-231cells, tamoxifen has been shown to induce apoptosis following 24 and48 h of culture (56). Tamoxifen induction of apoptotic DNA frag

4 Unpublished observations.


__,__F_Neutralizing AntibodyControl Antibody

A

aaU

00.00.4

0

00)a

0U

00.

B

a0C.)

U

00.00.4

0

00)aC0U

00.

Control Antibody Neutralizing Antibody

Fig. 8. Effect of Fas-neutralizing antibodies on VES-induced apoptosis in MDA-MB231 (A) and SKBR-3 (B) cells. Cells were cultured for 24 h with control antibody orFas-neutralizing antibody in the presence or absence of VES (10 @sg/ml).Using a ShandonCytospin, cells were distributed onto glass slides and analyzed for apoptosis with theTUNEL assay. The percentage of apoptotic cells was determined by counting a minimumof 400 cells per treatment. Data are from a representative experiment (n = 3). UT,untreated.

the control antibody in the absence of YES were negative for apoptosis. Similar results were seen when cells were treated with theFaa-neutralizing antibody in the absence of YES (photograph notshown). VES induced apoptosis in the control antibody-treated cells(Fig. 7, B and E). In contrast, YES-mediated apoptosis was blocked bythe Faa-neutralizing antibody (Fig. 7, C and F). The percentage ofapoptotic cells was determined by counting a minimum of 400 cellsper treatment. The cells treated in the presence of control or Fasneutralizing antibody only contained 3â€”4%apoptotic cells (Fig. 8, Aand B). In MDA-MB-23 1 cells, YES induced 77% apoptosis in thepresence of the control antibody and 10% apoptosis in the presence ofthe Faa-neutralizing antibody (Fig. 8A). In SKBR-3 cells, YES induced 79% apoptosis in the presence of the control antibody and 7%

887

MDA-MB-231

SKBR-3



yes INDUCESAPOFTOSISINBREASTCANCERCELLS

mentation, as measured by gel electrophoresis, was found to dependprimarily on protein synthesis (56).

YES-induced apoptosis was blocked by Fas-neutralizing antibodiesand partially blocked by Fas-L antisense oligonucleotides which prevented VES induction of the Fas-L protein. These data indicate thatVES mediates apoptosis in MDA-MB-231 and SKBR-3 cells throughactivation of the FaslFas-L pathway. The Fas receptor is a member ofa family of cell surface receptors containing structural homology toTNF receptors (52). Faa and its ligand have been shown to mediateapoptosis in vitro and in vivo (48â€”51). A death domain has beenmapped in Fas and in other receptors like the TNFR1 and cytoplasmicsignaling proteins like FADD (57). Also, CrmA, a poxvirus geneproduct has been shown to block Fas-induced apoptosis (53). CrmA isbelieved to block Fas-mediated cell death by inhibiting ICE or otherICE-related proteases (53). A recent study by Duan et a!. (39) identified ICE-LAP3 activation during Fas- and TNF-induced apoptosis ofMCF-7 human breast cancer cells. Western blot analysis showed YESto have no effect on steady-state ICE protein levels in MDA-MB-23land SKBR-3 cells (data not shown). Other mediators of apoptosishave been identified including p53, bcl-2, and bax (32â€”37,52).VES-induced apoptosis occurred in MDA-MB-23l and SKBR-3 cellswhich express mutant p53 and undetectable levels of bcl-2 (35, 42).Wild-type p53 functions to block cell proliferation whereas mutatedforms of p53 have lost their growth inhibitory function (58, 59) andtherefore may contribute to cellular proliferation. Simultaneous withthe onset of apoptosis, VES decreased mutant p53 protein levels (datanot shown). Although MDA-MB-23l and SKBR-3 cells do not express detectable bcl-2 or bcl5, Western blot analysis revealed that YESincreased bax protein levels in MDA-MB-231 cells (data not shown).Recently, low bax expression levels in tumor cells was associated withresistance to apoptosis (60). In the same study, nonmalignant epithehal cells expressing high levels of bax were responsive to Fas apoptotic signaling, suggesting that bax may be a downstream componentin Fas-mediated apoptosis (60).

Retinoic acid, another fat-soluble vitamin growth inhibitor andapoptotic agent, although toxic at high doses, has been used successfully in the treatment of promyelocytic leukemia (1). Vitamin E, apowerful inhibitor of many neoplastic cells (3â€”12),has been shown tohave few side effects when taken at high doses in human double-blindstudies and in animal studies (13). We found that YES inhibitsantiestrogen therapy-resistant (estrogen receptor-negative) humanbreast cancer cell growth via induction of Faa-mediated apoptosis.This finding, along with our previous study showing that YES andretinoic acid induce apoptosis in human B-lymphoma cells (6) andstudies by Qian et a!. (61) showing that YES induces apoptosis inavian retrovirus-transformed T cells, suggest a potential use for YESin human cancer therapy. Many of YES's antiproliferative functions,

Â°4-Fas-L asindicatedin thisstudy,cannotbeexplainedby its potentialantioxidant property alone (5, 6, 8). It is likely that YES mediates growtharrest and/or apoptosis through different mechanisms (antioxidant andnonantioxidant) based on the cell type and transforming events. Additional studies are needed to better characterize the effects of YES onFas-mediated apoptosis in general and the regulation of growth inhibition and apoptosis of breast cancer cells.

ACKNOWLEDGMENTS

We thank Dr. Richard R. Gontarek for his careful review of this manuscriptand for assistance with the RT-PCRs, Louise Finch for performing the fluorescence-activated cell-sorting analysis, and Can Petrow for technical assist

ance.

MDA-MB-231

Nonsense Sense Antisense

A

UI

C)0

U

00.00.4

0

C)0)aCC)U

C)a.

B

U)

C)0

U

0

0.00.4

0

C)0)aCC)(I

C)0.

C

SKBR-3

Nonsense Sense Antisense

MDA-MB-231SKBR-3VES:â€”â€”++â€”â€”++Sense:+â€”+â€”+â€”+â€”Antisense:â€”+â€”+â€”+â€”+

â€”â€”â€”@ .+ 13-Actin

Fig. 9. Effect of Fas-L antisense oligonucleotides on VES-induced apoptosis inMDA-MB-23 1 (A) and SKBR-3 (B) cells. Cells were cultured for 24 h in the presenceor absence of 10 zg/ml VES and 10 jzM nonsense oligonucleotides, Fas-L senseoligonucleotides, or Fas-L antisense oligonucleotides. Using a Shandon Cytospin,cells were distributed onto glass slides and analyzed for apoptosis with the TUNELassay. The percentage of apoptotic cells was determined by counting a minimum of400 cells per treatment. To demonstrate the efficiency of the Fas-L antisense oligo

nucleotide in blocking Fas-L mRNA translation, the Fas-L protein was analyzed byWestern blotting (C). Fas-L antisense oligonucleotides blocked the VES-inducedincrease in Fas-L protein levels at 24 h in MDA-MB-23 I cells and at 8 h in SKBR-3cells. Western blotting for the @-actinprotein shows that an equal amount of proteinwas analyzed per sample. Data are from a representative experiment (n = 3). UT,untreated.

888



yes INDUCES APOPTOSIS IN BREAST CANCER CELLS

Basis of Cell Death, pp. 175â€”192.Cold Spring Harbor, NY: Cold Spring HarborLaboratory Press, 1991.

28. Wyllie, A. H. Apoptosis and the regulation of cell numbers in normal and neoplastictissues: an overview. Cancer Metastasis Rev., 11: 95â€”103,1992.

29. Hickman, J. A. Apoptosis induced by anticancer drugs. Cancer Metastasis Rev., 11:121â€”139,1992.

30. Compton, M. M. A biochemical hallmark of apoptosis: intemucleosomal degradationof the genome. Cancer Metastasis Rev., 11: 105â€”119, 1992.

31 . Tenniswood, M. P.. Guenette, R. S., Latkins, i. Mooibroek, M., Wong, P., andWelsh, J-E. Active cell death in hormone-dependent tissues. Cancer Metastasis Rev.,11: 197â€”220,1992.

32. Li, C., Jenkins, C. W.. Nichols, M. A., and Xioong, Y. Cell cycle expression and p53regulation of the cyclin-dependent kinase inhibitor p21 . Oncogene, 9: 2261â€”2268,I994.

33. Miyashita.T., Krajewska,S., Krajewska,M.,Wang,H.G.,Lin,H. K.,Liebermann,D. A., Hoffman, B., and Reed, J. C. Tumor suppressor p53 is a regulator of bc!-2 andbax gene expression in vitro and in vivo. Oncogene, 9: 1799â€”1805,1994.

34. Owen-Schaub, L. B., Zhang, W., Cusack, J. C., Angelo, L. S., Santee, S. M.,Fujiwara, T., Roth, J. A., Deisseroth, A. B., Zhang, W-W., Kruzel, E., and Radinsky,R. Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-lexpression. Mol. Cell. Biol., 15: 3032â€”3040, 1995.

35. Haldar, S., Negrini, M., Monne, M., Sabbioni, S., and Croce, C. M. Down-regulationof bcl-2 by p53 in breast cancer cells. Cancer Res., 54: 2095â€”2097, 1994.

36. Chiou, S-K., Rao, L., and White, E. Bcl-2 blocks p53-dependent apoptosis. Mol. Cell.Biol.,14:2556â€”2563,1994.

37. Jaattela, M., Benedict, M., Tewari, M., Shayman, J. A., and Dixit, V. M. Bcl-x andbcl-2 inhibit TNF and Faa-induced apoptosis and activation of phospholipase A2 inbreast carcinoma cells. Oncogene. 10: 2297â€”2305, 1995.

38. Muzio. M.. Chinnaiyan. A. M., Kischkel, F. C., O'Rourke, K., Shevchenko, A., Ni,J., Scaffidi, C., Bretz, J. D., Zhang, M., Gentz, R., Mann, M., Krammer, P. H., Peter,M. E., and Dixit, V. M. FLICE, a novel FADD-homologous ICEICED-3-like protease. is recruited to the CD95 (Fas/APO-l) death-inducing signaling complex. Cell.85: 817â€”827,1996.

39. Duan, H., Chinnaiyan, A. M.. Hudson, P. L., Wing, J. P.. He, W. W., and Dixit, V. M.ICE-LAP3. a novel mammalian homologue of the Caenorhabditis elegans cell deathprotein Ced-3 is activated during Fas- and tumor necrosis factor-induced apoptosis.J. Biol. Chem., 271: 1621â€”1625,1996.

40. Silvestrini, R., Veneroni, S., Daidone, M. G., Benini, E., Boracchi, P., Mezzetti, M.,Di Fronzo. G.. Rilke, F., and Veronesi, U. The bcl-2 protein: a prognostic indicatorstrongly related to p53 protein in lymph node-negative breast cancer patients. J. NatI.Cancer Inst., 86: 499â€”504, 1994.

41. Mazars, R., Spinardi, L., BenCheikh, M., Simony-Lafontaine, J., Jeanteur, P., andTheillet, C. p53 mutations occur in aggressive breast cancer. Cancer Res., 52:3918â€”3923,1992.

42. Kiguchi, K., Glesne, D., Chubb, C. H., Fujiki, H., and Huberman, E. Differentialinduction of apoptosis in human breast tumor cells by okadaic acid and relatedinhibitors of protein phosphatase I and 2A. Cell Growth & Differ., 5: 995â€”1004,1994.

43. Turley, J. M., Falk, L. A., Ruscetti, F. W., Kasper, J. 1., Francomano, T., Fu, T., Bang,0., and Birchenall-Roberts, M. C. Transforming growth factor f3l functions inmonocytic differentiation of hematopoietic cells through autocrine and paracrinemechanisms. Cell Growth & Differ.. 8: 1535â€”1544,1996.

44. Hoffeld, J. T. Agents which block membrane lipid peroxidation enhance mousespleen cell immune activities in vitro: relationship to the enhancing activity of2-mercaptoethanol. Eur. J. lmmunol., II: 371â€”376,1981.

45. Schreck. R., Rieber, P., and Baeuerle, R. A. Reactive oxygen intermediates asapparently widely used messengers in the activation of the NF-kB transcription factorand HIV-l. EMBO J., 10: 2247â€”2258, 1991.

46. Gavrieli, Y., Sherman, Y., and Ben-Sasson, S. A. Identification of programmed celldeath in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol., 119:493â€”501,1992.

47. Martin, S. J.. Green, D. R., and Cotter, T. G. Dicing with death: dissectingthe components of the apoptotic machinery. Trends Biochem. Sci.. 19: 26â€”30,I994.

48. Yonehara, S., Ishii, A., and Yonehara, M. A cell-killing antibody (anti-Fas) to a cellsurface antigen co-downregulation with the receptor of tumor necrosis factor. J. Exp.Med., 169: 1747â€”1756,1989.

49. Ogasawara, J., Suda, T., and Nagata. S. Selective apoptosis of CD4+CD8+ thymocytes by the anti-Fas antibody. J. Exp. Med., /81: 485â€”491, 1995.

50. Ogasawara. i. Watanabe-Fukunaga, R., Adachi, M., Matsuzawa, A.. Kasugai. T..Kitmura, Y., Itoh, N., Suda, T., and Nagata. S. Lethal effect of the anti-Faa antibodyin mice. Nature (Lond.), 364: 806â€”809, 1993.

51. Coney, L. R., Daniel. P. T., Sanborn, D., Dhein, J.. Debatin, K.-M., Krammer,P. H., and Zurawski, V. R. J. Apoptotic cell death induced by a mouse-humananti-Ape-I chimeric antibody leads to tumor regression. Int. J. Cancer, 58:562â€”567.1994.

52. Schulze-Osthoff, K. The Fas/APO-l receptor and its deadly ligand. Trends Cell Biol.,4:421â€”426,1995.

53. Chinnaiyan, A. M., O'Rourke, K., Tewari, M., and Dixit, V. M. FADD, a novel deathdomain-containing protein, interacts with the death domain of Fas and initiatesapoptosis. Cell, 81: 505â€”512.1995.

54. Thao, B., Yu, W., Kline, K., and Sanders, B. Vitamin E succinate induction ofapoptosis in MCF-7 human breast cancer cells. Proc. Am. Assoc. Cancer Res.. 37:285,1996.

55. Leithauser, F., Dhein, J., Mechterscheimer, G., Koretz, K., Bruderlein, S., Henne,C., Schmidt, A.. Debatin, K., Krammer, P. H., and Moller, P. Constitutive and

889

REFERENCES

1. Meng-er, H., Yu-chen, Y., Shu-rong, C.. Jin-ren, C., Jia-Xiang, L., Lin, Z., Long-jun.G., and Zhen-yi, W. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood, 72: 567â€”572,1988.

2. Castaigne. S., Chomienne. C., Daniel, M. T., Ballerini, P., Berger, R., Fenaux, P.. andDegos, L. All-trans retinoic acid as a differentiation therapy for acute promyelocyticleukemia. I. Clinical results. Blood, 76: 1704â€”1709, 1990.

3. Boscoboinik, D., Szewezyk, A., Hensey. C., and Azzi, A. Inhibition of cell proliferation by alpha-tocopherol: role of protein kinase C. J. Biol. Chem., 266: 6188â€”6194,1991.

4. Boscoboinik, D., Szewezyk, A., and Azzi, A. Alpha-tocopherol (vitamin E) regulatesvascular smooth muscle cell proliferation and protein kinase C activity. Arch. Biochem. Biophys., 286: 264â€”269, 1991.

5. Turley, J. M., Sanders, B. G., and Kline, K. RRR-alpha-tocopheryl succinate modulation of human promyelocytic leukemia (HL-60) cell proliferation and differentiation. Nutr. Cancer, 18: 201â€”213,1992.

6. Turley, J. M., Funakoshi, S., Ruscetti, F. W., Kasper, J., Murphy, W. J., Longo, D. L.,and Birchenall-Roberts, M. C. Growth inhibition and apoptosis of RL human B-lymphoma cells by vitamin E succinate and retinoic acid: role for transforminggrowth factor (3. Cell Growth & Differ.. 6: 655â€”663, 1995.

7. Charpentier, A., Groves, S., Simmons-Menchaca. M., Turley, J., Zhao, B., Sanders,B. G., and Kline, K. RRR-alpha-tocopheryl succinate inhibits proliferation andenhances secretion of transforming growth factor-f3 (TGF-f3) by human breast cancercells. Nutr. Cancer, 19: 225â€”239,1993.

8. Fariss, M. W., Fortuna, M. B., Everett, C. K., Smith, J. D., Trent, D. F., and Djuric.z. The selective antiproliferative effects of alpha-tocopheryl hemisuccinate andcholesteryl hemisuccinate on murine leukemia cells results from the action of theintact compounds. Cancer Res., 54: 3346â€”3351, 1994.

9. Benner, S. E., Winn, R. J., Lippman, S. M., Poland, J.. Hansen. K. S., Luna, M. A.,and Hong. W. K. Regression of oral leukoplakia with alpha-tocopherol: a communityclinical oncology program chemoprevention study. J. NatI. Cancer Inst., 85: 44â€”47,1993.

10. Jaakkola, K., Lahteenmaki, P., Laakso, J., Harju, E., Tykka, H., and Mahlberg, K.Treatment with antioxidant and other nutrients in combination with chemotherapy andirradiation in patients with small-cell lung cancer. Anticancer Res., 12: 599â€”606,1992.

I 1. Prasad. K. N., and Edwards-Prasad, J. Vitamin E and cancer prevention. Recentadvances and future potentials. J. Am. CoIl. Nutr., 11: 487â€”500,1992.

12. Kelloff, G. J., Crowell, J. A., Boone, C. W., Steele, V. E., Lubet, R. A., Greenwald,P., Alberts, D. S., Covey, J. M., Doody, L. A., Knapp, G. G., Nayfield. S., Parkinson,D. R., Prasad. V. K., Prorok, P. C., Sausville, E. A., and Sigman, C. C. Clinicaldevelopment plans for cancer chemopreventive agents. 3. Cell. Biochem. Suppl.. 20:282â€”294,1994.

13. Bendich, A., and Machim, L. J. Safety of oral intake of vitamin E. Am. J. Clin. Nutr..48:612â€”619.1988.

14. Niki, E., Yamamoto, Y., Komour, M., and Miyana, Y. Inhibition of oxidation ofbiomembranes by tocopherol. Vitamin E: biochemistry and health implications. Ann.NY Mad. Sci., 539: 23â€”25,1989.

15. Helson. L.. Verma, M., and Helson, C. Vitamin E and human neuroblastoma. In: F.L. Meyskens and K. N. Prasad (eds.), Modulation and Mediation of Cancer byVitamins, pp. 258â€”265,Basel: Karger, 1983.

16. Slack, R., and Proulx, P. Studies on the effects of vitamin E on neuroblastoma NIE115 cells. Nutr. Cancer, 12: 75â€”82,1989.

17. Cobra, R. J., Torelli, S., Prasad, K. N., Edwards-Prasad, J., and Sharma, 0. K. Effectof vitamin E succinate and a cAMP stimulating agent on the expression of c-myc,N-myc and H-ras in murine neuroblastoma cells. Int. J. 0ev. Neurosci.. 9: 187â€”194,I991.

I 8. Prasad, K. N., Cohrs, R. J., and Sharma, 0. K. Decreased expression of c-myc andH-ras oncogenes in vitamin E succinate induced morphologically differentiatedmurine B-l6 melanoma cells in culture. Biochem. Cell Biol., 68: 1250â€”1255,1990.

19. Prasad, K. N., and Edwards-Prasad, J. Effects oftocopherol (vitamin E) acid succinateon morphological alterations and growth inhibition in melanoma cells in culture.Cancer Rca., 42: 550â€”555, 1982.

20. Kline, K., Cochran, G. S., and Sanders, B. G. Growth-inhibitory effects of vitamin Esuccinate on retrovirus-transformed tumor cells in vitro. Nutr. Cancer, 14: 27â€”41,1990.

21 . Prasad, K. N. Mechanisms of action of vitamin E on mammalian tumor cell lines inculture. In: C. Grobstein (ed), Nutrition, Growth, and Cancer, pp. 363â€”375.NewYork: Alan R. Liss, 1988.

22. Sahu, S. N., Edwards-Prasad, J., and Prasad, K. N. Effect of alpha tocopherylsuccinate on adenylate cyclase activity in murine neuroblastoma cells in culture. J.Am. Coll. Nutr., 7: 285â€”293,1988.

23. Torelli, S., Masoudi, F., and Prasad, K. N. Effect of tocopheryl succinate activity oncyclic AMP-dependent protein kinase activity in B 16 melanoma cells in culture.Cancer Lett., 39: 129â€”136,1988.

24. Chatelain, E., Boscoboinik, D. 0., Bartoli, G. M., Kagan. V. E., Gey, F. K., Packer,L., and Azzi, A. Inhibition of smooth muscle cell proliferation and protein kinase Cactivity by tocopherols and tocotrienols. Biochim. Biophys. Acta, I I 76: 83â€”89,1993.

25. Mymryk,J. S.,Shire,K.,andBayley,S.T. Inductionofapoptosisbyadenovirustype5 EIA in rat cell requires a proliferation block. Oncogene. 9: 1187â€”1193, 1994.

26. Heintz, N. Cell death and the cell cycle: a relationship between transformation andneurodegradation? Trends Biochem. Sci., 18: 157â€”159,1993.

27. Gerschenson, L. E., and Rotello, R. J. Apoptosis and cell proliferation are terms of thegrowth equation. In: L. D. Tomei and F. 0. Cope (eds.), Apoptosis: The Molecular




induced expression of APO-l, a new member of the nerve growth factor/tumor 59. Beckwith, M., Ruscetti, F. W., Sing, G. W., Urba, W. J., and Longo, D. L. Anti-IgMnecrosis factor receptor superfamily, in normal and neoplastic cells. Lab. Invest., induces transforming growth factor-j3 sensitivity in a human B-lymphoma cell line:69: 415â€”429, 1993. inhibition of growth is associated with a downregulation of mutant p53. Blood, 85:

56. Perry, R. R., Kang, Y., and Greaves, B. Effects of tamoxifen on growth and apoptosis 2461â€”2470, 1995.ofestrogen-dependent and-independent human breast cancer cells. Ann. Surg. Oncol., 60. Bargou, R. C., Daniel, P. T., Mapara, M. Y., Bommert, K., Wagener, C., Kallinich,2: 238â€”245,1995. B., Royer, H. D., and Dorken, B. Expression of the bcl-2 gene family in normal and

57. Cleveland, J. L., and IhIe, J. N. Contenders in FasLII'NF death signaling. Cell, 81: malignant breast tissue: low bax-a expression in tumor cells correlates with resistance479â€”482, 1995. towards apoptosis. Int. J. Cancer. 60: 854â€”859, 1995.

58. Gannon, J. V., Greaves, R., Iggo, R., and Lane, D. P. Activating mutations in p53 61. Qian, M., Sanders, B. G., and Kline, K. RRR-a-tocopheryl succinate inducesproduce a common conformational effect. A monoclonal antibody specific for the apoptosis in avian retrovirus-transformed lymphoid cells. Nutr. Cancer, 25: 9â€”26,mutant form. EMBO J., 9: 1595â€”1602,1990. 1996.

890



1997;57:881-890. Cancer Res Jennifer M. Turley, Tao Fu, Francis W. Ruscetti, et al. Estrogen Receptor-Negative Human Breast Cancer CellsVitamin E Succinate Induces Fas-mediated Apoptosis in

Updated version

http://cancerres.aacrjournals.org/content/57/5/881

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/57/5/881To request permission to re-use all or part of this article, use this link


http://cancerres.aacrjournals.org/content/57/5/881http://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerres.aacrjournals.org/content/57/5/881http://cancerres.aacrjournals.org/

Documents

Vitamin E Succinate Induces Fas-mediated Apoptosis in ......mechanism (5, 6). In support of this, Fariss et al. (8) recently dem onstrated that VES-mediated growth inhibition of murine