Supplementary Materials:

Supplementary materials and methods

Drosophila stocks and genetics

Flies were raised on standard cornmeal food at the indicated temperatures. The sources of

the fly lines were: dPINK1B9 (null mutant), Dr. JongKyeong Chung; UAS-yNDI1, parkin1

and parkinΔ21, Dr. Patrik Verstreken; TH-GAL4, Dr. Serge Birman; UAS-mitoGFP, Dr.

William Saxton; UAS-Marf RNAi, Dr. Ming Guo; UAS-ATG1, Dr. Eric Baehrecke; UAS-

Sin1-Flag, Dr. Kazuo Emoto; UAS-Rictor, Tub-AKT WT, Tub-AKT R54A, Tub-AKT

S505A and Tub-AKT T342A, Dr. Stephen Cohen; UAS-PINK1 RNAi, UAS-PINK1 and

UAS-Parkin were generated as described (Yang et al., 2006); UAS-ND75RNAi (2286R-3)

was obtained from National Institute of Genetic Fly Stock Center (Japan); UAS-

CG9672RNAi (v11381) and UAS-Miro RNAi106683 (v106683) from Vienna Drosophila

RNAi Center. UAS-rictor RNAi #1 (B31388) UAS-rictor RNAi #2 (B31527), UAS-AKT-

RNAi (B33615), UAS-Trc-S (B32080), UAS-Trc-L (B32085), UAS-Trc K122A (B32082),

UAS-Trc K122A/T453A (B32086), UAS-Trc S292E (B32081), UAS-Trc T453E (B32089),

UAS-Trc RNAi (B28326) and all other stocks used in the experiments were from

Bloomington Drosophila Stock Center (USA).

Muscle histology

For mitochondria morphology analysis in thoracic muscle, mito-GFP was expressed in

muscle tissue using the Mhc-Gal4 driver, and indirect flight muscles were dissected in

PBS and examined under confocal fluorescence microscope.

Abnormal wing posture and behavioral analyses

Abnormal wing posture was analyzed as described before (Liu and Lu, 2010). Briefly, the

number of flies with abnormal wing posture (either held-up or drooped) was scored after

male flies of the indicated genotypes were aged for 14 days at 29oC. For each experiment,

at least 60 flies per genotype were scored and the percentage of flies with abnormal wing

posture was calculated. For jump/flight ability tests, 10 flies were placed in each vial and

the jump/flight events were counted for two minutes while the vial was gently rolled to

initiate the jump/flight events. Results were averaged to represent the jumping ability of

10 individuals. Each analysis was repeated at least 3 times.

ATP measurement

The ATP level in Drosophila thoracic muscle was measured essentially as previously

described (Liu and Lu, 2010), using a luciferase based bioluminescence assay (ATP

Bioluminescence Assay Kit HS II, Roche Applied Science). For each measurement, 3

thoraxes were used and at least 3 measurements were made for each genotype. The

results were normalized to the ATP level of the control flies.

Stress assays

Five-day-old male flies were starved for 3 hours before being transferred into vials (20

flies per vial) containing filter papers soaked with 5% sucrose solution supplemented

with 1% H2O2 (Sigma Aldrich), 0.4 M NaCl, or 250 μM rotenone (Sigma Aldrich). Flies

were transferred to fresh vials everyday. The survival of the challenged flies was recorded

every day when changing the vials. For the climbing activity assay after rotenone

treatment, the number of individuals that could not climb and stayed at the bottom of the

vials was counted. To detect mitochondrial morphology change and DA neurons loss after

stress treatment, the treated flies were fixed and subjected to the indicated

immunohistochemical analysis.

Immunoprecipitation of PINK1

The HEK293T cell line was used to study the association of PINK1 with mitochondrial

respiratory complexes. Cells were cultured at 37oC and transfected with pcDNA3.1-

PINK1-FLAG. Cells were treated with 10 μM MG132 to stabilize PINK1 and enhance

the formation of complexes between PINK1 and components for the respiratory chain.

Cells were lysed in lysis buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton X-

100, 1 mM EDTA, 10 mM β-glycerophosphate, 50 mM NaF, and 1 mM PMSF), and

PINK1 was immunoprecipitated by incubating the supernatant with pre-equilibrated anti-

Flag M2 affinity beads (Sigma Aldrich) at 4oC for 12 hours. Purified immunocomplexes

were washed 3 times in lysis buffer, and analyzed by western blot.

Western blot analysis of Drosophila tissues

Western blot analyses of Drosophila tissues were performed essentially as described (Liu

and Lu, 2010). The primary antibodies used in the western blots were anti-pS505-dAKT,

anti-AKT, (Cell Signaling Technology), anti-Actin (Millipore), anti-FLAG, anti-HA

(Sigma Aldrich), anti-GFP (Abcam), anti-NDUSF1 (GeneTex), anti-NDUSF3, anti-

SDHA, anti-ATP5A (MitoScience), and anti-mTOR (Santa Cruz). The anti-TH antibody

was generated as described (Yang et al., 2006). Anti-Trc, anti-pS292-Trc and anti-pT453-

Trc antibodies were generous gifts from Dr. Emoto.

Mitophagy assay in mammalian cells

Mouse embryonic fibroblast (MEF) derived from rictor deficient mice was kindly

provided by Dr. M. Magnuson (Shiota et al., 2006). MEF from PINK1 deficient mice was

generated and maintained as described previously (Matsuda et al., 2010). MEFs were

transfected with a recombinant retroviral vector or Lipofectamine LTX (Invitrogen).

HeLa cells expressing Venus-Parkin (Venus-Parkin/HeLa cells) were generated and

maintained as described previously (Liu et al., 2012). HeLa cells stably expressing GFP-

Parkin and non-tagged Parkin were generated by retroviral infection. Stealth siRNA

duplexes (Invitrogen) were transfected using Lipofectamine RNAiMAX (Invitrogen)

according to manufacturer’s instructions. Stealth siRNAs for control, Rictor, Raptor,

mTOR, NDR1 and NDR2 were purchased from Life Technologies.

To depolarize mitochondria, cells were treated with 10 μM (for

Venus-Parkin/HeLa cells, Parkin/HeLa cells or GFP-Parkin/HeLa cells), 20 µM (for

Rictor MEF), or 30 µM (for PINK1 MEF) CCCP, fixed with 4% paraformaldehyde in

PBS and permeabilized with 50 μg/ml digitonin or 0.2% Triton X-100 in PBS, and

stained with anti-Tom20 in combination with anti-GFP or anti-HA antibodies. Cells were

imaged using laser-scanning confocal microscope systems (LSM510 META, Carl Zeiss

or TCS-SP5, Leica) with 63x/1.4 oil-immersion objectives.

The Phospho-S281 and phospho-T444 NDR antibodies were kindly provided by Dr. B.

Hemmings (Tamaskovic et al., 2003). Other antibodies used in this study are as follows:

anti-FLAG and anti-Tubulin (Sigma-Aldrich), anti-Tom20, anti-Parkin and anti-NDR1/2

(Santa Cruz Biotechnology), anti-COX I and anti-COX IV (Invitrogen), anti-GFP

(Nacalai Tesque), anti-HA (Covance), anti-PINK1 (Novus), anti-Rictor (Bethyl

Laboratories and Cell Signaling Technology), anti-mTOR and anti-Raptor (Cell Signaling

Technology), anti-Hexokinase1 (Cell Signaling Technology), anti-Tim23, anti-

Cytochrome c and anti-Hsp60 (BD), anti-RHOT1/Miro1 and anti-Mitofusin1 (Abnova),

anti-Actin (Millipore). Human PINK1-FLAG (wild-type and kinase-dead forms), HA-

Parkin and GFP-Parkin cloned in a retroviral pMXs-puro vector were described

previously (Matsuda et al., 2010). Myc-tagged human Rictor was obtained from Addgene

and was subcloned in pMXs-puro vector. Human NDR1 with FLAG and 6x His-tag

cloned in pCI-neo vector were provided by Drs. K. Nakagawa and Y. Hata. Human

PINK1-Myc and siRNA-resistant human NDR1 were generated in this study.

For making the siRNA-resistant silent mutations, c.432A>T, c.435C>T,

c.438T>C, c.441G>A, c.447T>A, and c.450G>C were introduced into human NDR1

using the following primers; Forward primer: 5’- tgggtagtcaaaatgttctatagt -3’, Reverse

primer: 5’- taagctatcagcctccactaga -3’. Phos-tag western blot was performed as described

(Imai et al., 2010).

In vitro kinase assay of Trc

The protocol was modified from a previous study (Ultanir et al., 2012). For Trc

immunoprecipitation, flies were crossed and raised at 25oC. Male flies expressing Flag-

tagged Trc were collected and homogenized in lysis buffer (1% Nonidet P-40, 10%

glycerol, 1 mM Na3VO4, 20 mM β-glycerol phosphate, 50 mM NaF, 1 mM PMSF, 1X

phosphatase inhibitor cocktail I (Sigma) in 20 mM Tris-HCl pH 8.0 and 150 mM NaCl).

Lysate was incubated on ice for 30 min and centrifuged at 20,000 g for 15 min.

Supernatant was precleared with IgG- Sepharose (GE Healthcare) for 30 min and

incubated with anti-Flag M2 affinity beads (Sigma Aldrich) for 3 hours at 4°C to

immunoprecipitate FLAG-tagged Trc kinase. Beads were washed 2X with lysis buffer,

1X with lysis buffer containing 1 M NaCl for 10 min, followed by one 10 min wash in

lysis buffer and 2X with kinase reaction buffer (20 mM Tris-HCl pH 7.5, 10 mM MgCl2,

1 mM dithiothreitol (DTT), 1 μM cyclic AMP- dependent protein kinase inhibitor peptide

and 1 μM okadaic acid).

AAK1 containing a HA tag was used as the substrate. The expression construct

was a gift from the Jan lab (UCSF). It was transfected in HEK293T cells. The protein

was purified using mouse anti-HA antibody (Sigma Aldrich) and protein-G beads

(Thermo Scientific) as described for Trc Kinase immunoprecipitation, except that no

phosphatase inhibitor was added. AAK1-HA was eluted from the beads in 20 mM Tris-HCl

pH 7.5, 100 mM NaCl, 1 mM DTT, 10 mM MgCl2 and 1 mg/ml HA peptide (GenScript).

For Trc kinase reactions with AAK1 as substrate, 0.5 μg of purified HA-AAK1

together with 0.1 μg of purified FLAG-tagged Trc was included in the reaction, 0.5 mM

ATP-γ-S (Sigma Aldrich) was also included in the reaction. Reaction was incubated at

30oC for 60 min, and followed immediately by alkylation reaction (1 hour at room

temperature) by adding 2 μl of 100 mM p-nitro mesylate (PNBM, Epitomics) per 30μl

kinase reaction. Beads were precipitated by centrifugation. Supernatant was run on a

western blot. Thiophosphorylation was detected using an anti-thiophosphate ester

antibody (1:5000; Epitomics).

Supplementary Figure Legend

Figure S1. Effects of mTORC2 LOF or GOF in wild type or PINK1B9 mutant

backgrounds. Mhc-Gal4 was used to drive transgene expression. Wing posture (A),

jump/flight ability (B), thoracic ATP level (C) for the wild type background, or wing

posture in PINK1B9 mutant background (D) are shown. *, p<0.05 in one-way ANOVA

tests.

Figure S2. Interaction between PINK1 and mitochondrial complex-I (CI). (A, B) Mhc-

Gal4 driven RNAi of CI subunits ND75 or CG9762 phenocopied Mhc>PINK1 RNAi

effects. Note that the effects of CI RNAi were evident only after more complete

knockdown using two copies (2x) of the RNAi transgenes. (C) RNAi of CI subunits

induced mitochondrial aggregation in DNs. (D) In vitro phosphorylation of human GST-

AKT-KD by Drosophila TORC2, which were affinity-purified using anti-Flag from

control or ND75-RNAi animals expressing a Sin1-Flag transgene. Similar amounts of

Sin1 and dTOR were present in the extracts or immunoprecipitated TORC2. After the

kinase reaction, AKT phosphorylation was detected with anti-pS473-AKT. Total GST-

AKT-KD protein was detected by Coomassie Blue staining (CBS). Bar graph shows data

quantification. (E-G) RNAi of CI enhanced, whereas yNDI1 co-expression suppressed

PINK1 RNAi-induced abnormal wing posture (E), drop of ATP level (F), or

mitochondrial aggregation (G). * or #, p<0.05; ** or ## , p<0.01; and *** or ###, p<0.005 in

one-way ANOVA tests, when data from DAY1 (*), or DAY14 (#) were compared. (H)

Western blot analysis showing that PINK1 associates with mitochondrial complex-I

subunits. HEK cells transfected with PINK1-FLAG and treated or mock treated with

MG132 were subjected to immunoprecipitation with anti-FLAG. The presence of

respiratory chain CI, CII, or CV subunits was detected by western blot analysis.

Figure S3. Sensitivity of TORC2 LOF mutants to mitochondrial CI inhibition. (A-D)

Survival of wild type, rictor mutant, and sin1 mutant flies under H2O2 (A), NaCl (B), heat

shock (C), and rotenone (D) induced stresses. (E) Impaired climbing activity of rictor and

sin1 mutant flies after rotenone treatment. Non-treated rictor and sin1 mutant flies exhibit

normal climbing activity (data not shown). (F) Loss of PPL1 cluster DNs in rictor mutant

flies after rotenone treatment. The number of DNs in the PPL1 clusters of the left and

right brain lobes of DMSO mock-treated or rotenone-treated animals was counted. (G)

Synergy between rictor mutation and ND75 RNAi in inducing abnormal wing posture. *,

p<0.05; **, p<0.01 in one-way ANOVA tests.

Figure S4. Lack of genetic interaction between PINK1 and AKT. (A, B) The abnormal

wing posture (A) and reduced jump/flight activity (B) phenotypes caused by Mhc-

Gal4>PINK1 RNAi were not affected by genetic manipulations of AKT activity. (C) The

mitochondrial aggregation phenotype in indirect flight muscle of Mhc-Gal4>PINK1

RNAi animals was not modified after AKT OE or AKT RNAi.

Figure S5. Effects of Trc LOF or GOF in wild type or PINK1B9 mutant backgrounds.

Mhc-Gal4 was used to drive transgene expression. Wing posture (A), jump/flight ability

(B), thoracic ATP level (C) for the wild type background, or wing posture in PINK1B9

mutant background (D) are shown. *, p<0.05 in one-way ANOVA tests.

Figure S6. Genetic evidence that Trc acts downstream of TORC2. (A) Co-expression of

Trc-S292E or Trc-L attenuated the enhancement of Mhc>PINK1 RNAi-induced

abnormal wing posture by rictor deletion. (B) While Rictor OE was able to suppress

Mhc>PINK1 RNAi-induced abnormal wing posture phenotype in an otherwise wild type

background, it failed to do so in a dominant negative Trc K122A/T453A co-expression

background. (C) Co-expression of Trc-S292E attenuated the exacerbation of

Mhc>PINK1 RNAi-induced mitochondrial aggregation by rictor deletion. (D) Rictor OE

failed to rescue Mhc>PINK1 RNAi-induced mitochondrial aggregation in a dominant

negative Trc K122A/T453A co-expression background. ** or ## , p<0.01 in one-way

ANOVA tests.

Figure S7. Effects of Trc LOF in DNs. (A) TH-Gal4-driven Trc RNAi caused loss of

DNs in the PPL1 cluster. (B) TH-Gal4-driven Trc RNAi caused mitochondrial

aggregation in TH-positive DNs. (C) Quantification of mitochondrial size showing an

increase in the number of DNs with mitochondrial size greater than 2 μm in diameter in

TH-Gal4>Trc RNAi animals. *, p<0.05; **, p<0.01 in Student’s t-tests.

Figure S8. Evidence that activated p-Trc and mTORC2 are present on mitochondria. (A)

Western blot analysis showing that phosphorylated Trc was primarily found in the

mitochondrial fraction, whereas total Trc protein was evenly distributed between the

mitochondrial and cytoplasmic fractions. NDUFS3 and actin serve as mitochondrial and

cytoplasmic markers, respectively. (B) Western blot analysis showing that TORC2

components were found in the mitochondrial fraction. NDUFS3 was used as

mitochondrial marker, and Actin as a cytoplasmic marker.

Figure S9. Inhibition of NDR1 function in mammalian cells impairs the recruitment of

Parkin to damaged mitochondria and the clearance of damaged mitochondria by

mitophagy. (A) siRNA treatment against NDR1, but not NDR2, compromised Parkin

translocation to mitochondria damaged by CCCP treatment. Venus-Parkin/HeLa cells

were treated with the indicated siRNA for 69 hrs, and were further treated with 10 µM

CCCP for 60 or 90 mins. Anti-Tom20 staining revealed that recruitment of Parkin to

mitochondria was reduced after NDR1 RNAi, and that the perinuclear aggregation of

mitochondria was impaired. Scale bars = 10 µm. (B) Impairments of Parkin recruitment

and mitophagy induced by NDR1 siRNA were rescued by RNAi-resistant NDR1

overexpression, but not by PINK1 overexpression. Cells expressing transfected plasmids

are indicated with asterisks. Scale bars = 10 µm. Note that in CCCP-treated cells NDR1

protein colocalizes with the mitochondria marker Tom 20. (C) Analysis of Parkin auto-

degradation and mitophagy through western blot analysis of mitochondrial marker

expression. Control or NDR1 siRNA-treated Venus-Parkin/HeLa cells were incubated

with 10 µM CCCP for the indicated periods. Mitochondrial markers for the outer

membrane (Tom20, VDAC1), the intermembrane space (Cytochrome c; Cyto c), the

inner membrane (Tim23) and the matrix (Hsp60) were examined by western blot to

monitor the elimination of damaged mitochondria. Note that Parkin-mediated degradation

of the mitochondrial outer membrane proteins occurs earlier than the removal of inner

membrane and matrix proteins by autophagosomes in the mitophagy process (Chan et al.,

2011; Okatsu et al., 2012). Therefore, the outer membrane protein (Tom20 and VDAC1)

and intermembrane protein (Cyt C) markers exhibit differential kinetics in their clearance

than inner membrane (Tim23) and matrix (Hsp60) markers. Also note that NDR1 but not

NDR2 is mainly expressed in Venus-Parkin/HeLa cells as knockdown of NDR1 caused

the disappearance of anti-NDR1/2-immunoreactive bands. (D) Western blot analysis

demonstrating the persistence of the RNAi-resistant NDR1 after NDR1 RNAi.

Figure S10. Effects of PINK1 on NDR1 phosphorylation in mammalian cells. (A)

Western blot analysis showing that pT444-NDR1 level was reduced in PINK1(-/-) MEF

cells reconstituted with a kinase-dead (KD) form of PINK1 compared to PINK1(-/-) MEF

cells reconstituted with wild-type (WT) PINK1, after treatment with CCCP for the

indicated times. Lysate form MEF transiently transfected with FLAG-His-NDR1 were

subjected to Ni-NTA pull-down, then precipitates were analyzed with the indicated

antibodies. To preserve p-NDR1 signals, cells were treated with the phosphatase inhibitor

okadaic acid (OA). (B) Quantification of p-T444 NDR1 signals in the samples shown in

(A). (C) Similarly to (A), endogenous pT444-NDR1 level was analyzed without OA

treatment. (D) Quantification of p-T444 NDR1 signals in the samples shown in (C). *,

p<0.05 in Student’s t-tests.

Figure S11. Inhibition of Rictor function in mammalian cells impairs the recruitment of

Parkin to damaged mitochondria and the clearance of damaged mitochondria by

mitophagy. (A) Knockdown of Rictor but not Raptor compromised Parkin translocation

to mitochondria upon CCCP treatment. Venus-Parkin/HeLa cells were treated with the

indicated siRNA for 69 hrs, and were further treated with 10 µM CCCP for 3 hrs. Anti-

Tom20 staining revealed that recruitment of Parkin to mitochondria was reduced after

Rictor RNAi, and that the perinuclear aggregation of mitochondria was impaired. Scale

bars = 10 µm. (B) Loss of Rictor delayed the mitochondrial translocation of Parkin and

subsequent mitophagy. Rictor (+/+) and Rictor (-/-) MEFs expressing HA-Parkin were

treated with 20 µM CCCP for the indicated periods. Anti-Tom20 stain (red) and DAPI

counterstain (blue) help visualize mitochondrial morphology and mitophagy progression.

Note the increased Parkin expression in Rictor (-/-) MEF, which was reproducible in

three independent experiments (see also western blot data in C). Scale bar = 10 µm. (C)

Analysis of mitophagy through western blot analysis of mitochondrial marker expression.

Rictor (+/+) or Rictor (-/-) MEFs stably expressing HA-Parkin were treated with 20 µM

CCCP for the indicated periods. Mitochondrial markers for the outer membrane (Tom20,

Hexokinase1 and Mitofusin1) and the inner membrane (COXI and COXIV) were

examined by western blot to monitor the elimination of damaged mitochondria. Actin

serves as a loading control. Expression levels of transfected Parkin and endogenous

Hexokinase1 were increased in Rictor (-/-) MEF in three independent experiments. (D)

Western blot analysis examining knockdown efficiencies of Rictor, Raptor and mTOR

siRNAs. HEK293T cells were treated with three different siRNAs (1-3, 10 nM each) or a

mixture of them (M, 10 nM). Note that treatment with mTOR siRNA affected the

stability of Rictor and Raptor; therefore we did not use mTOR siRNA in this study. (E)

Impairments of Parkin recruitment and mitophagy in Rictor (-/-) MEFs were rescued by

the overexpression of Rictor. Rictor (-/-) MEF were retrovirally transfected with pMXs-

puro-human Rictor or an empty vector (mock) along with pMXs-puro-HA-Parkin. Cells

were analyzed as in (B).

Figure S12. Biochemical evidence that NDR1 acts upstream of Parkin and the key MQC

executors in mammalian cells. (A) Effects of NDR1 RNAi on CCCP-induced Parkin

phosphorylation. HeLa cells stably expressing non-tagged Parkin were transfected with

siRNA against NDR1 or control siRNA. Cells were further treated with 10 µM CCCP or

DMSO solvent alone for 60 min. Phosphorylated and non-phosphorylated forms of

Parkin and NDR1 separated on a Phos-tag gel (Wako) were indicated. Phosphorylated

proteins disappeared after lambda phosphatase treatment (PP). Levels of NDR1, Miro1,

and Mfn1 were detected by western blot analysis. Actin serves as loading control. Note

that in control siRNA treated cells, CCCP treatment led to increased Parkin

phosphorylation, and degradation of Miro1 and Mfn1. These effects were significantly

attenuated by NDR1 RNAi. (B) Effects of NDR1 RNAi on the autoubiquitination activity

of Parkin. HeLa cells stably expressing GFP-tagged Parkin (GFP-Parkin/HeLa) were

transfected with siRNA against PINK1 or NDR1, or control siRNA. Seventy-one hours

after transfection, cells were treated with 10μM CCCP or DMSO for 60 min. After that,

cells were lysed with RIPA buffer and analyzed by western blot with anti-Parkin. β-actin

serves as loading control. Auto-ubiquitination of GFP-Parkin results in higher molecular

weight species. (C) A diagram depicting possible mechanisms of mitochondrial quality

control by the PINK1 pathway. Our data suggest that PINK1 acts through mitochondrial

CI to regulate the activity of TORC2, which then signals through Trc/NDR kinase to

direct mitochondrial quality control (MQC) through a number of distinct but not mutually

exclusive mechanisms: (a) Trc/NDR could act through the actin cytoskeleton to affect

MQC; (b) Trc could act through Parkin to regulate MQC; (c) Trc could cooperate with

Parkin to directly target certain MQC execution proteins through a phosphorylation-

dependent ubiquitination and ubiquitin proteasome system (UPS)-mediated degradation

mechanism.

Supplementary References:

Chan, N.C., Salazar, A.M., Pham, A.H., Sweredoski, M.J., Kolawa, N.J., Graham, R.L.,

Hess, S.,

and Chan, D.C. (2011). Broad activation of the ubiquitin-proteasome system by

Parkin is

critical for mitophagy. Hum Mol Genet 20: 1726-1737.

Imai, Y., Kanao, T., Sawada, T., Kobayashi, Y., Moriwaki, Y., Ishida, Y., Takeda, K.,

Ichijo, H.,

Lu, B., and Takahashi, R. (2010). The Loss of PGAM5 Suppresses the

Mitochondrial Degeneration Caused by Inactivation of PINK1 in Drosophila.

PLoS Genet 6: e1001237.

Matsuda, N., Sato, S., Shiba, K., Okatsu, K., Saisho, K., Gautier, C.A., Sou, Y.S., Saiki,

S.,

Kawajiri, S., Sato, F., et al. (2010). PINK1 stabilized by mitochondrial

depolarization

recruits Parkin to damaged mitochondria and activates latent Parkin for

mitophagy. J

Cell Biol 189: 211-221.

Okatsu, K., Iemura, S., Koyano, F., Go, E., Kimura, M., Natsume, T., Tanaka, K., and

Matsuda,

N. (2012). Mitochondrial hexokinase HKI is a novel substrate of the Parkin

ubiquitin

ligase. Biochem Biophys Res Commun 428: 197-202.

Shiota, C., Woo, J.T., Lindner, J., Shelton, K.D., and Magnuson, M.A. (2006).

Multiallelic

disruption of the rictor gene in mice reveals that mTOR complex 2 is essential for

fetal

growth and viability. Dev Cell 11: 583-589.

Tamaskovic, R., Bichsel, S.J., Rogniaux, H., Stegert, M.R., and Hemmings, B.A. (2003).

Mechanism of Ca2+-mediated regulation of NDR protein kinase through

autophosphorylation and phosphorylation by an upstream kinase. J Biol Chem

278: 6710-

6718.