JOURNAL OF CLINICAL MICROBIOLOGY, June 1990, p. 1254-12600095-1137/90/061254-07$02.00/0Copyright © 1990, American Society for Microbiology

Use of Polymerase Chain Reaction for Detection ofChlamydia trachomatis

LARS 0STERGAARD,* SVEND BIRKELUND, AND GUNNA CHRISTIANSENInstitute of Medical Microbiology, University ofAarhus, DK-8000 Aarhus C., Denmark

Received 29 September 1989/Accepted 12 February 1990

A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. Fromthe published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection ofamplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved amplified sequences,Southern hybridization, or dot blot analysis. The PCR assay was optimized and, after 40 cycles of amplificationwith primer set Il, demonstrated a sensitivity of 10i- g ofDNA, which corresponds to the detection ofone copyof the plasmid. Because of the high sensitivity, we developed a closed system in which airborne contaminationwas minimized. Analysis of 228 clinical samples tested by cell culture, IDEIA enzyme immunosorbent assay

(Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom), and PCR showed a sensitivity of 100%, a

specificity of 93% when PCR was compared with cell culture, and a corrected specificity of 99% when PCR was

compared with cell culture or IDEIA.

Development of the polymerase chain reaction (PCR) fordetection of low-copy-number DNA sequences by amplifi-cation of a specific DNA fragment by use of a DNApolymerase was first described by Mullis and Faloona (13).Amplification is obtained by repeating a three-step reactionrun at different temperatures. By repeating the reaction n

times, the amount of DNA theoretically rises to 2' (13,18-20). Initially, the Klenow fragment of Escherichia colDNA polymerase I was used for DNA amplification (10, 13,18, 20). The discovery of a polymerase from Thermusaquaticus, the Taq DNA polymerase, which is stable at hightemperatures (19), along with the introduction of automaticequipment for temperature changes, makes PCR relativelyeasy to perform.The PCR technique mainly has been used for diagnostic

tests in genetics and virology (2, 4-9, 21, 22, 26). Detectionsystems that use PCR on bacterial genomic DNA have beendeveloped for Salmonella typhimurium (23), Pseudomonascepacia (25), enterotoxigenic E. coli (14), and Chlamydiatrachomatis (3, 7). We describe here the development of a

method to detect C. trachomatis by amplifying fragments ofthe sequenced common plasmid (24), which is present in allserovars of C. trachomatis (16). This plasmid has no knownhomology to other microorganisms (24).Use of this method for the detection of C. trachomatis in

samples from patients was evaluated. High sensitivity andhigh specificity were obtained for chlamydial detection.

MATERIALS AND METHODSPreparation of C. trachomatis L2 DNA. C. trachomatis L2

DNA was obtained from purified elementary bodies (1) by a

previously described procedure (12). The concentration ofL2 DNA was measured by spectrophotometry with a record-ing spectrophotometer (UV-260; Shimadzu, Kyoto, Japan).PCR technique. Two primer sets from the C. trachomatis

plasmid (24) were constructed: Primer set I was 5'-GTTTAAGTGTTCCCATCATAAAAACATATTC-3', from bases1698 to 1728 (primer IA) (24), and 5'-ATCCTTGTATCCTGTTGGGAAGCCATCAAAG-3', from bases 2200 to 2170(primer IB) (24). Primer set Il was 5'-CGCATGCAAGATA

* Corresponding author.

TCGAGTATGCGTTGTTAGG-3', from bases 1607 to 1638(primer IIA) (24), and 5'-GCGTCGCGATCTCCGGCCAG-3', from bases 2079 to 2060 (primer IIB) (24).The primer sets were constructed such that a common

TaqI site was positioned asymmetrically in the sequence thatwas amplified. Primer IA was localized in the area amplifiedby primer set Il, and primer IIB was localized in the area

amplified by primer set I. Thus, the sequence amplified byeach primer set could be verified by using primer IA or IIBas a probe (Fig. 1).

Reaction mixture. A total of 1 ,ug of each primer fromeither primer set I or II (5 ,ul) was mixed with 20 ,ul of a bufferconsisting of 250 mM KCl, 50 mM Tris (pH 8.4), 12.5 mMMgCl2, and 0.5 mg of gelatin per ml. A total of 30 ,ul of a

mixture of nucleotides, 200 ,uM of each of dATP, dTTP,dGTP, and dCTP, was then added. Two units (in 5 ,ul) of TaqDNA polymerase, which was supplied by either Cetus(Cetus Corp., Emeryville, Calif.) or Stratagene (Stratagene,San Diego, Calif.), was added and the reaction mixture was

overlayed with 75 ktl of paraffin oil. The components wereadded to an Eppendorf tube with a set of unused pipettes(Finnpipette; Labsystems, Helsinki, Finland) in a laboratorythat was never exposed to chlamydial DNA. A small holewas made in the tube with a hypodermic needle in the side ofthe lid, and the tube was closed. The tubes were frozen at-20°C until use.For optimization of the PCR assay and for sensitivity

evaluation, 40 pl of purified total C. trachomatis serovar L2DNA was added to the tubes in 10-fold dilutions from 10-1to 10-18 g. For evaluation of samples from patients, 500 ,ul ofthe clinical sample in 2-SP solution (17) was vortexed,aspirated, and added to a microtube (1.5 ml; no. 72.694;Sarstedt, Numbrecht, Federal Republic of Germany). Thetube was centrifuged at 20,000 x g for 20 min at 4°C. Thesupernatant was removed; and the pellet was suspended in100 ,ul of a solution containing 200 ,ug of proteinase K per ml,10 mM Tris, and 1 mM EDTA and was subsequentlyincubated at 37°C for 30 min and boiled for 10 min. A total of40 ,ul was used for PCR. The tubes were opened just enoughfor the preformed holes to become visible, and the DNA or

the treated clinical specimens were injected by using a

disposable syringe. As a negative control, a reaction mixture

1254

Vol. 28, No. 6

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

PCR FOR DETECTION OF C. TRACHOMATIS 1255

was injected with 40 Fil of double-distilled H20 instead ofDNA. The tubes were centrifuged for 3 min at 20,000 x g at4°C to separate the aqueous phase from the oil. PCR wasperformed in a DNA Thermal Cycler (Perkin Elmer-Cetus,Norwalk, Conn.). Initially, the samples were treated at 94°Cfor 2 min to ensure full denaturation. Thereafter, the tem-perature was reduced for 2 min to 40, 42, 45, 47, or 50°C forprimer set I and to 47, 50, 52, 55, 57, or 60°C for primer setII for annealing to optimize the annealing temperature. Forextension of the DNA, the temperature was then raised to70°C for 4 min. A total of 30 or 40 cycles were performed,and after the last cycle the temperature was kept at 70°C for10 min to complete the extension. Primer set Il was used foranalysis of the serotypes and for evaluation of clinicalsamples, using an annealing temperature of 57°C, and TaqDNA polymerase supplied by Stratagene was used.

Preparation of urogenital serotypes of C. trachomatis. C.trachomatis serotypes D, E, F, G, H, J, and K werecultivated in cycloheximide-treated McCoy cells on coverslips as described by Ripa and Mardh (17). The cover slipswere examined, and the total number of inclusions wasdetermined to be approximately 50. The proteinase K treat-ment and DNA amplification by PCR was then performed asdescribed above.

Gel electrophoresis. A total of 20 ,ul of each amplifiedsample was electrophoresed on a 1.2% agarose gel at 120 Vfor 1.5 h. The DNA bands were visualized by ethidiumbromide staining. Bacteriophage lambda DNA cleaved withHindIII was used as a molecular weight standard. The gelswere examined under UV light and were photographed onAgfapan 400 film.

Cleavage with restriction enzymes. A total of 10 ,ul ofamplified samples was cleaved with the restriction enzymeTaqI (Boehringer GmbH, Mannheim, Federal Republic ofGermany) in the buffer recommended by the supplier. TheDNA fragments were separated by electrophoresis on 2%agarose gels that were run for 2 h at 150 V. pBR322 DNAcleaved with the restriction enzyme HaeIII was used as amolecular weight standard.DNA hybridization. To 10 ,uI of each sample amplified with

either primer set I or primer set 11, 60 ,ul 0.3 M NaOH wasadded for 10 min at 0°C; then, 70 ,ul of 12x SSC (lx SSC is0.15 M NaCI plus 0.015 M sodium citrate [pH 7.5]) wasadded and the solution was applied to a nylon filter (Hybond-N; Amersham, Little Chalfont, United Kingdom) with a slotblotter (Minifold II; Schleicher & Schuell, Inc., Keene,N.H.). Each slot was washed with 200 ,ul of6x SSC, and thefilters were cross-linked by using UV light (Stratalinker;Stratagene). The filters were prehybridized in 0.085 ml of 6xSSC per cm2-5 x Denhardt solution (lx Denhardt solution is0.1% polyvinylpyrrolidone, 0.1% Ficoll [Pharmacia LKBBiotechnology, Uppsala, Sweden], and 0.1% bovine serumalbumin)-0.5% sodium dodecyl sulfate-10 mg/100 ml ofyeast RNA for 20 min at 45°C. Probe primer IA was labeledby phosphorylation at the 5' termini with [_y-32P]dATP (ICNRadiochemicals, Irvine, Calif.) and T4 polynucleotide kinaseas described by Maniatis et al. (11) to an activity of 0.3MBq/pmol. Hybridization was done for 4 h at 45°C. Filterswere washed twice at 45°C for 2 h and 15 min in 2 xSSC-0.5% sodium dodecyl sulfate, and the dried filters wereautoradiographed for 4 h.

Clinical specimens. A total of 228 clinical specimens (40from males, 180 from females, and 8 from newborns) wereobtained over a 3-week period from patients consultinggeneral practitioners in the county of Aarhus. All samplesreceived during this period were analyzed. The specimens

were obtained by introducing and pivoting a cotton swab(type MW 142; E.N.T. Swab; Medical Wire Equipment Co.Ltd., Potley, Carsham, Wilshire, United Kingdom) in theurethra in males or the endocervix in females, or specimenswere obtained from the conjunctiva of newborns. The swabwas placed in 2 ml of 2-SP transport medium (17) and frozenat -20°C within 18 h. Cell culture was performed within 5days. All specimens were randomized, and the results ofculture were concealed until the results of PCR were ob-tained.

Cell culture assay. All specimens were tested by cellculturing with 1 ml of the sample material. Culture andmicroscopy for C. trachomatis detection were performed atthe Institute of Medical Microbiology, University of Aarhus.The specimens were cultivated in cycloheximide-treatedMcCoy cells as described by Ripa and Mardh (17) andstained with iodine, and the number of inclusions wascounted. If one or more inclusions were observed by micros-copy, the culture was considered positive. No blind passageto increase the sensitivity of the culture was performed.

Verification of specimens. The specimens that were posi-tive by PCR and negative by cell culturing were examined byan enzyme immunosorbent assay (EIA) (IDEIA; Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom).The sensitivity and specificity of this EIA compared withthose of our culture procedure without blind passage were90.8 and 95.4%, respectively (14a). A total of 50 ,ul of thespecimens used for EIA was taken directly from the protein-ase K-treated specimens, and the EIA was performed asdescribed earlier (14a). All specimens that were false posi-tive by PCR were tested in duplicate by EIA. Positive andnegative controls were included. The microdilution platewas scanned in a single-beam multiphotometer (ImmuneReader NJ-2000; Inter Med, Japan), and the extinctionvalues were read at 490 nm and the cutoff value was set to amean extinction value of 0.05.The sensitivity of the PCR technique was calculated as

follows: the number of samples positive by PCR as well aspositive by cell culture divided by the number of samplespositive by cell culture. The specificity ofthe PCR techniquewas calculated as follows: the number of samples negativeby PCR as well as negative by cell culture divided by thenumber of samples negative by cell culture. The correctedspecificity was calculated as follows: the number of samplesnegative by PCR as well as negative by cell culture dividedby the number of samples negative by cell culture as well asnegative by IDEIA.

RESULTS

Standardization of the PCR assay. The primers used for thePCR assay are shown in Fig. 1. To analyze whether therewas any difference in the amplification of circular versuslinear DNA, the C. trachomatis L2 DNA was cleaved withBamHI. No difference in sensitivity or in the occurrence ofa smear was observed after cleavage (data not shown). Theoptimal annealing temperature was found to be 45°C forprimer set t, and the optimal annealing temperature forprimer set II was found to be 57°C.To determine the optimal concentration of the Taq DNA

polymerase, 10-l' g of L2 DNA was amplified for 40 cyclesat 57°C with primer set Il with 1, 1.5, 2, 2.5, 5, and 10 U ofTaq DNA polymerase per sample. The most distinct bandwas found when 2 U per sample was used. With higheramounts, an overall smear was observed (data not shown).

Tenfold dilutions of L2 DNA were performed for 40 and 30

VOL. 28, 1990

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

1256 0STERGAARD ET AL.

1607 1638 1698 1728 18991 1~ ~~~~~~~~~~~~~~~~~~~~~~~~

5 '-CGCATGCAAGATATCGAGTATGCGTIGTTAGG GTTAAGTGTTCCCATCATAAACATATTC--TCGA- 3'3 ' -AGCT-I [-GCGTCGCGATCTCCGGCCAG GAACTACCGAAGGGTTGTCCTATGTTCCTA--5'

2060 2079 2170 2200Primer IIA Primer IA and probe Primer IIB Primer lB

FIG. 1. Positions and sequences of primer sets I and II. Numbers refer to the base number in the common C. trachomatis plasmid (24).The TaqI restriction site at base 1899 is indicated.

PCR cycles by using primer set II, an annealing temperatureof 57°C, and Taq DNA polymerase. The results are shown inFig. 2. A sensitivity of 10-7 g of L2 DNA could be detectedby performing the PCR technique for 40 cycles by using bothgel electrophoresis and dot blot analysis as verification (Fig.2A). This value corresponds to the detection of one copy ofthe plasmid. When PCR was performed for 30 cycles, asensitivity of 10-16 g of L2 DNA was seen (Fig. 2B). Thiscorresponded to 10 copies of the plasmid, which is theamount included in one to two elementary bodies.

Influence of chemicals. To analyze how the Taq DNA

A PCR perforxned for 40 cvcles

log[DNA] 10 il 12 13 '14 15 16 117 18 n

rt oses1|

B

-log [l)NA]

T>CR nnrfn-rnilfi nltr -30 rln

4 s1

FIG. 2. Tenfold dilutions of C. trachomatis L2 DNA performedby PCR for 40 (A) and 30 (B) cycles with primer set Il and verifiedby gel electrophoresis after ethidium bromide staining and dot blotanalysis. Lambda DNA cleaved with HindIII was included in theunmarked lanes on the left in panels A and B.

polymerase was influenced by different chemicals, we am-plified 2.5 x 10-8 g of L2 DNA in a reaction mixture towhich the following chemicals were added: 0.4 and 4 mMEDTA; 0.04% azide; 0.04% Triton X-35; 0.04% TritonX-100; 0.04% Tween 20; 0.04% Tween 40; 0.04% Tween 80;and 0.008, 0.04, and 0.08% spermidine. The most distinctbands were seen with the addition of 0.4 mM EDTA and0.04% azide. The most scanty band was seen with theaddition of 0.04% Triton X-100. Concentrations of 4 mMEDTA and 0.04 and 0.08% spermidine resulted in no ampli-fication (data not shown).

Analysis of serotypes. The urogenital serotypes D, E, F, G,H, J, and K and serovar L2 cultivated in McCoy cells oncover slips were analyzed. After PCR for 40 cycles, allserotypes showed very distinct bands of either 503 or 473base pairs (bp) (Fig. 3A), according to the primer set thatwas used. After TaqI cleavage of the 473-bp DNA amplifiedby use of primer set II, two distinct bands of 292 and 181 bpwere observed for each serotype (Fig. 3B). The dot blothybridizations showed similar activities for all serotypestested (Fig. 3C).

Contamination analysis. To analyze for airborne contami-nation, preparations of the reaction mixture consisting ofprimers, Taq DNA polymerase, deoxynucleoside triphos-phates, and buffer were prepared in or outside a vertical-flowbench in a laboratory that handles chlamydial DNA or in alaboratory in which cervical biopsies were analyzed for thepresence of human papillomavirus. An unused set of pipettes(Finnpipette; Labsystems) and new reagents for the reactionmixture were used in each laboratory. Preparation of con-trols in the laboratory for human papillomavirus research(Fig. 4, lanes 1 to 3) showed specific scanty bands in two ofthe three specimens. All six negative controls prepared inthe laboratory handling chlamydial DNA were positive bySouthern blot analysis (Fig. 4B). Gel electrophoresis of theamplified DNA fragments showed that samples prepared inthe vertical-flow bench displayed distinct specific bands andmultiple smaller and larger nonspecific bands (Fig. 4, lanes 4to 6). Two of the three negative controls prepared outsidethe vertical-flow bench were negative by gel electrophoresis(Fig. 4, lanes 8 to 10), but Southern blot analysis showedspecific bands for all these negative controls. Lane 7 in Fig.4 is amplified total L2 DNA, which was used as a positivecontrol. To avoid contamination, preparation of the reactionmixture was therefore done in a laboratory that had neverbeen exposed to chlamydial DNA; and an unused set ofpipettes (Finnpipette; Labsystems), new reagents for thereaction mixture, and the closed system described abovewere used. When dot blot hybridization was performed onnegative controls prepared as described above, no contam-ination was seen (Fig. 3).

Analysis of clinical specimens. A total of 220 genital spec-imens (40 from males and 180 from females) and 8 specimensobtained from the conjunctiva of newborns were tested bothby culturing and PCR.

Cell culture. Of the 228 specimens, 5 specimens analyzedby cell culture were contaminated with other bacteria and

J. CLIN. MICROBIOL.

R. .11. 1 .1 t 1-4 izn 1( I l".I iggE

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

PCR FOR DETECTION OF C. TRACHOMATIS 1257

L 0 0) V E F G H I K A

473 bp-

B

sid L. 1) E F G H I K

473 bp- b*

L- D E F G H I K

FIG. 4. (A) Gel electrophoresis of amplified negative controls byusing primer set II. Lanes 1 to 3, negative controls prepared in alaboratory analyzing cervical biopsy specimens for human papillo-mavirus; lanes 4 to 6, negative controls prepared in a vertical-flowbench placed in a laboratory handling chlamydial DNA; lane 7,positive control (C. trachomatis L2 DNA); lanes 8 to 10, negativecontrols prepared outside the vertical-flow bench, without use of theclosed system described in the text. As standards (std), lambdaDNA cleaved with HindIII and pBR322 cleaved with HaeIII wereused, as indicated in the two lanes on the left, respectively. (B)Southern blots of the gel described in panel A by using primer IA asa probe.

. SI.

FIG. 3. (A) Amplified fragments of C. trachomatis L2 DNA andamplified fragments of the proteinase K-treated serotypes D, E, F,G, H, t, and K, using primer set Il and an annealing temperature of57°C. PCR was performed for 40 cycles. The fragments weredetected by ethidium bromide staining after agarose gel electropho-resis. Lanes marked 0 indicate negative controls. (B) The amplifiedfragments described for panel A cleaved with TaqI and detected byethidium bromide staining after agarose gel electrophoresis. HaeIII-cleaved pBR322 was used as a standard (std). (C) Dot blot ofamplified fragments from panel A. -y-32P-end-labeled primer IA wasused as a probe for detection of amplified fragments.

were excluded from analysis. Culture results were thusavailable for only 223 specimens. Of the 215 genital speci-mens, 24 (6 from males and 18 from females) were found tobe positive by culturing. Two of the eight conjunctivalspecimens showed a positive result by culturing. The num-ber of inclusion bodies in the culture-positive specimensvaried from between 1 and more than 500.PCR technique. PCR was performed for 115 specimens for

40 cycles, and PCR was performed for 108 specimens for 30cycles. Representative gels for 40 and 30 cycles are shown inFig. SA and B, respectively. For PCR for 40 cycles, 21specimens were positive and 94 specimens were negative.For PCR for 30 cycles, 19 specimens were positive and 89

specimens were negative. All positive samples showed a

very distinct band at 473 bp by gel electrophoresis. Aftercleavage with the TaqI restriction enzyme, distinctive bandsof 181 and 292 bp were seen (data not shown).Comparison of the two diagnostic procedures. All 26 cul-

ture-positive specimens (14 specimens from PCR for 40cycles and 12 specimens for PCR for 30 cycles) also were

found to be positive by PCR, giving a total sensitivity of thePCR technique of 100% when either 30 or 40 cycles were

used (Table 1). Specimens that were positive by PCR andnegative by cell culture were tested by the IDEIA EIA.For PCR performed for 40 cycles, seven specimens (one

from a male, five from females, and one from a newborn)were positive by PCR and negative by culture; this gave a

specificity of 93% (94 of 101 specimens) (Table 1). All seven

specimens were positive when tested by IDEIA EIA.For PCR performed for 30 cycles, seven specimens (four

from males and three from females) were positive by PCRand negative by culture; this also gave a specificity of 93%(89 of 96 specimens) (Table 1). Five of the seven PCR-positive and culture-negative specimens gave a positive EIAresult.The bands of those 14 specimens observed by gel electro-

phoresis were not more scanty than the bands observed forspecimens with positive culture results.

DISCUSSIONDetection of genital chlamydial infections is primarily

based on the cell culture technique, enzyme-linked immuno-

A.

473bp-

292bp'SlSbp-t.

C

VOL. 28, 1990

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

1258 0STERGAARD ET AL.

A

U 50:020 C, 0o~

r-

FIG. 5. Samples from patients verified by gel electrophoresisafter PCR was performed for 40 (A) and 30 (B) cycles. Numbers at

the bottom of the gel refer to the amount of inclusion bodies found

by culturing. Abbreviations: Sec., when analyzed by cell culture,

this sample was contaminated with other bacteria and was excluded

from analysis; pos., positive control; neg., negative control. The

unmarked lanes on the left contained lambda DNA cleaved with

HindIII.

sorbent assays, or immunofluorescence assays. The last two

tests are based on poly- and monoclonal antibodies against

components that are part of the chlamydial membrane,

either the lipopolysaccharide or the major outer membrane

protein. None of these tests or the cell culture techniqueshow an optimal sensitivity, and only cell culture has a

specificity of 100%. We wanted to develop a more sensitive

test system by using a PCR that also showed a high speci-

ficity.The efficiency of the PCR technique is influenced by

different parameters, the most important of which seems to

be the composition of primers, both in relation to each other

and in relation to the target DNA, and the temperature at

which annealing of primers is performed.

Compared with the percent G+C content of our target

DNA (39%), primers A and B of primer set had relativelylow percent G+C contents, 29 and 45%, respectively. Prim-

ers A and B in primer set Il had different lengths, but theyhad the same absolute G+C content, and the percent G+C

content for both primers exceeded that of the target DNA.

The percent G+C content of primers is important when

the optimal annealing temperature is determined. When

primer set was changed to primer set II, the optimal

temperature of annealing changed from 45 to 570C. The

bands became much more distinct, and a slight increase in

sensitivity was seen. Therefore, each primer in a primer set

should be as similar as possible to each other with regard to

TABLE 1. Number of positive and negative specimenstested by culture and PCR

No. of culture results

PCR result Positive NegativeTotal

M F N M F N

40 CyclesPositive 3 10 1 1 5 1 21Negative 0 0 0 16 75 3 94Total 14 101 115

30 CyclesPositive 3 8 1 4 3 0 19Negative 0 0 0 12 75 2 89Total 12 96 108

a M, Specimens from males; F, specimens from females; N, conjunctivalsmears from newborns.

their percent G+C contents. Furthermore, the percent G+Ccontents of primers should exceed that of target DNA toavoid reannealing of target DNA before annealing of prim-ers. A higher sensitivity should be obtained under conditionsof high annealing temperatures, since this reduces the for-mation of a secondary structure in the single-stranded DNA.When the number of cycles is raised, the efficiency per cycledecreases, probably because of reannealing of the amplifiedproducts (8).The concentration of Mg2` is important. It is required for

the Taq DNA polymerase, but the presence of the cation inexcess causes a decrease in the amplification efficiency (8).We determined that a concentration of 0.9 mM free Mg2+gave the optimal result.The sensitivity of primer set I of 10-l' g of total L2 DNA

corresponded well to the sensitivity of 10-l' g of hepatitis Bvirus DNA found by Kaneko et al. (9), when gel electropho-resis stained with ethidium bromide was used for verifica-tion. The higher sensitivity seen with the use of primer set Ilwas probably due to the higher G+C content of theseprimers in combination with the change to Stratagene TaqDNA polymerase. Since our sensitivity corresponds to de-tection of one to two chlamydial elementary bodies, andsince one elementary body contains about 10 copies of theplasmid (16), we found it adequate that detection of C.trachomatis was done only by gel electrophoresis of un-cleaved and restriction enzyme-cleaved amplified DNA frag-ments.PCR used for serotypes and clinical specimens was per-

formed directly on crude cell lysates, as described previ-ously (19) for the preparation of other sources of target DNAfor PCR analysis. Therefore, the need for purification ofDNA, which results in the loss of target DNA and aprolongation of preparation time, was eliminated.

Recently, Dutilh et al. (7) described a PCR procedure forDNA amplification of a fragment of 129 bp from the majorouter membrane protein gene in the genital serotypes of C.trachomatis. They used phenol-chloroform extraction, eth-anol precipitation, and RNase treatment of their samples. Allgenital serotypes showed a positive reaction when portionsof a cell culture containing 106 to 107 elementary bodies wereused. The difference in sensitivity from our one to twoelementary bodies could be due to inactivation of the TaqDNA polymerase or to loss of target DNA during phenol-chloroform extraction or ethanol precipitation. Further-more, our target DNA was placed on the plasmid, of whichabout 10 copies were found in every elementary body. For

J. CLIN. MICROBIOL.

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

PCR FOR DETECTION OF C. TRACHOMATIS 1259

PCR, Dutilh et al. (7) used 0.75 U of Taq polymerase, whichwe found resulted in a lower sensitivity. Dean et al. (3) usedPCR for amplifying and radiolabeling a probe that wasgenerated from the plasmid of C. trachomatis serovar C.This probe was used to hybridize with conjunctival speci-mens from patients with trachoma. By this method, theyfound a sensitivity of 90% and a specificity of 94% when thismethod was compared with multiple tissue culture passages.Because of the extreme sensitivity of the PCR technique,

contamination is probably the most extensive problem.Kaneko et al. (9) and Lo et al. (Y. M. D. Lo, W. Z. Mehal,and K. A. Fleming, Lancet ii:679, 1988) have described theproblems with contaminated reagents, pipettes, and primers.Concerning our experiments in which negative controls wereprepared in different places (Fig. 4), we conclude thatairborne target DNA contamination is a factor of greatimportance. It is therefore crucial to handle reagents andtarget DNA in absolutely closed systems. By use of a systemin which all reagents are mixed with unused pipettes (Finnpi-pettes; Labsystems) in a place that had never been exposedto the target DNA, and by ensuring that sample mixing isperformed in a closed system with disposable syringes andcontainers, a very low risk of contamination is ensured.Negative controls should therefore be included in eachprocessing step.The PCR technique used in the direct detection of C.

trachomatis in urogenital specimens from patients has notbeen evaluated by others. Our sensitivity revealed a value oflo-17 g of DNA when PCR was performed for 40 cycles.This value corresponds to the detection of one copy of theplasmid. When PCR was performed for 30 cycles, thesensitivity corresponded to the detection of 10 copies of theplasmid, which corresponds to the number of copies found inone elementary body. Compared with cell culture, we foundthat the PCR technique had a sensitivity of 100%. Thespecificity of the PCR was 93% for either 40 or 30 cycles.The 14 false-positive specimens were tested with an EIA kit(IDEIA) after proteinase K treatment. Of the 14 false-positive specimens, 12 were positive by this test system.Because the EIA had a sensitivity of 90.8% and a specificityof 95.4%, as we evaluated previously (14a), it seems reason-able to calculate an approximated corrected specificity ofabout 99% when PCR is performed for either 40 or 30 cycles.This is in agreement with the results reported by Mahony etal. (J. B. Mahony, K. E. Luinstra, and M. A. Chernesky, 8thMeet. Int. Soc. Sex. Transm. Dis. Res., abstr. no. 20, 1989).On the basis of the results presented here, we conclude

that the PCR technique is a valuable tool for diagnosinggenital C. trachomatis infections because of its high sensi-tivity and specificity. The PCR is not time-consuming.Specimen manipulation can be reduced to very few incuba-tion steps before the sample from the patient is added to thereaction mixture, and sample evaluation can be judgeddirectly from the presence of DNA bands in agarose gels.The importance of contamination must, however, be consid-ered. Development of closed systems and the use of dispos-able utensils might eliminate this risk of contamination.

ACKNOWLEDGMENT

This work was supported by a grant from the Danish Biotechno-logical Center for Microbiology.

LITERATURE CITED1. Birkelund, S., A. G. Lundemose, and G. Christiansen. 1988.

Chemical cross-linking of Chlamydia trachomatis. Infect. Im-mun. 56:654-659.

2. Cai, S.-P., J.-Z. Zhang, D.-H. Huang, Z.-X. Wang, and Y.-W.Kan. 1988. A simple approach to prenatal diagnosis of ,B-thalassemia in a geographic area where multiple mutationsoccur. Blood 71:1357-1360.

3. Dean, D., C. R. Pant, and P. O'Hanley. 1989. Improved sensi-tivity of a modified polymerase chain reaction amplified DNAprobe in comparison with serial tissue culture passage fordetection of Chlamydia trachomatis in conjunctival specimensfrom Nepal. Diagn. Microbiol. Infect. Dis. 12:133-137.

4. Demmler, G. J., G. J. Buffone, C. M. Schimbor, and R. A. May.1988. Detection of cytomegalovirus in urine from new newbornsby using polymerase chain reaction DNA amplification. J.Infect. Dis. 158:1177-1184.

5. DiLella, A. G., W. M. Huang, and S. L. C. Woo. 1988. Screeningfor phenylketonuria mutations by DNA amplification with thepolymerase chain reaction. Lancet i:497-499.

6. Duggan, D. B., G. D. Ehrlich, F. P. Davey, S. Kwok, J. Sninsky,J. Goldberg, L. Baltrucki, and B. J. Poiesz. 1988. HTLV-I-induced lymphoma mimicking Hodgkin's disease. Diagnosisby polymerase chain reaction amplification of specific HTLV-Isequences in tumor DNA. Blood 71:1027-1032.

7. Dutilh, B., C. Bébéar, P. Rodriguez, A. Vekris, J. Bonnet, andM. Garret. 1989. Specific amplification of a DNA sequencecommon to all Chlamydia trachomatis serovars using the poly-merase chain reaction. Res. Microbiol. 140:7-16.

8. Guatelli, J. C., T. R. Gingeras, and D. D. Richman. 1989.Nucleic acid amplification in vitro: detection of sequences withlow copy numbers and application to diagnosis of humanimmunodeficiency virus type 1 infection. Clin. Microbiol. Rev.2:217-226.

9. Kaneko, S., R. H. Miller, S. M. Feinstone, M. Unoura, K.Kobayashi, N. Hattori, and R. H. Purcell. 1989. Detection ofserum hepatitis B virus DNA in patients with chronic hepatitisusing the polymerase chain reaction assay. Proc. Natl. Acad.Sci. USA 86:312-316.

10. Lee, M.-S., K.-S. Chang, F. Cabanillas, E. J. Freireich, J. M.Trujillo, and S. A. Stass. 1987. Detection of minimal residualcells carrying the t(14;18) by DNA sequence amplification.Science 237:175-178.

11. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual, p. 122-123. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

12. McClenaghan, M., A. J. Herring, and I. D. Aitken. 1984.Comparison of Chlamydia psittaci isolates by DNA restrictionendonuclease analysis. Infect. Immun. 45:384-389.

13. Mullis, K. B., and F. A. Faloona. 1987. Specific synthesis ofDNA in vitro via a polymerase-catalyzed chain reaction. Meth-ods Enzymol. 155:335-350.

14. Olive, D. M. 1989. Detection of enterotoxigenic Escherichia coliafter polymerase chain reaction amplification with a thermo-stable DNA polymerase. J. Clin. Microbiol. 27:261-265.

14a.0stergaard, L., A. G. Lundemose, S. Birkelund, and G. Chris-tiansen. 1990. Age and sex correlation of Chlamydia trachoma-tis infections evaluated by the culture technique and by anenzyme immunosorbent assay, IDEIA. Eur. J. Obstet. Gyne-col. Reprod. Biol. 34:273-281.

15. Ou, C.-Y., S. Kwok, S. W. Mitchell, D. H. Mack, J. J. Sninsky,J. W. Krs, P. Feorino, D. Warfield, and G. Schochetman. 1988.DNA amplification for direct detection of HIV-1 in DNA ofperipheral blood mononuclear cells. Science 239:295-297.

16. Palmer, L., and S. Falkow. 1986. A common plasmid in Chla-mydia trachomatis. Plasmid 16:52-62.

17. Ripa, K. T., and P. A. Mardh. 1977. Cultivation of Chlamydiatrachomatis in cycloheximide-treated McCoy cells. J. Clin.Microbiol. 6:328-331.

18. Saiki, R. K., T. L. Bugawan, G. T. Horn, K. B. Muilis, andH. A. Erlich. 1986. Analysis of enzymatically amplified P-globinand HLA-DQa DNA with allele-specific oligonucleotideprobes. Nature (London) 324:163-166.

19. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi,G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostableDNA polymerase. Science 239:487-491.

VOL. 28, 1990

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

1260 0STERGAARD ET AL.

20. Scharf, S. J., G. T. Horn, and H. A. Erlich. 1986. Direct cloningand sequence analysis of enzymatically amplified genomic se-quences. Science 233:1076-1078.

21. Shibata, D. K., N. Arnheim, and W. J. Martin. 1988. Detectionof human papilloma virus in paraffin-embedded tissue using thepolymerase chain reaction. J. Exp. Med. 167:225-230.

22. Shibata, D., W. J. Martin, M. D. Appleman, D. M. Causey,J. M. Leedom, and N. Arnheim. 1988. Detection of cytomega-lovirus DNA in peripheral blood of patients infected with humanimmunodeficiency virus. J. Infect. Dis. 158:1185-1192.

23. Shyamala, V., and G. F.-L. Ames. 1989. Amplification of bac-terial genomic DNA by the polymerase chain reaction anddirect sequencing after asymmetric amplification: application

J. CLIN. MICROBIOL.

to the study of periplasmic permeases. J. Bacteriol. 171:1602-1608.

24. Sriprakash, K. S., and E. S. Macavoy. 1987. Characterizationand sequence of a plasmid from the trachoma biovar of Chla-mydia trachomatis. Plasmid 18:205-214.

25. Steffan, R. J., and R. M. Atlas. 1988. DNA amplification toenhance detection of genetically engineered bacteria in environ-mental samples. Appl. Environ. Microbiol. 54:2185-2191.

26. Wong, C., C. E. Dowling, R. K. Saiki, R. G. Higuchi, H. A.Erlich, and H. H. Kazazian, Jr. 1987. Characterization ofP-thalassaemia mutations using direct genomic sequencing ofamplified single copy DNA. Nature (London) 330:384-386.

on Novem

ber 24, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

ERRATA

Use of Polymerase Chain Reaction for Detection ofChlamydia trachomatis

LARS 0STERGAARD, SVEND BIRKELUND, AND GUNNA CHRISTIANSEN

Institute ofMedical Microbiology, University ofAarhus, DK-8000 Aarhus C, Denmark

Volume 28, no. 6, p. 1254: The sequence for primer IIB should read "5'GACCGGCCTCTAGCGCTGCG3'."

Ability of Clinical Laboratories To Detect AntimicrobialAgent-Resistant Enterococci

FRED C. TENOVER, JEROME TOKARS, JANA SWENSON, SINDY PAUL,KENNETH SPITALNY, AND WILLIAM JARVIS

Nosocomial Pathogens Laboratory Branch and Epidemiology and Surveillance Branch, Hospital InfectionsProgram, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta,

Georgia 30333, and Division of Epidemiology, Environmental, and Occupational HealthServices, New Jersey Department of Health, Trenton, New Jersey 08625-0369

Volume 31, no. 7, p. 1695, line 7: "27%" should read "29%."Page 1695, line 8: "16%" should read "17%."Page 1695, line 9: "74%" should read "71%."Page 1695, line 10: "66 and 8%" should read "63 and 8%."Page 1696, Table 1, column 4, line 2 under "Ampicillin": "64" should read ">256."

3081