Use of Bromovirus RNA2 Hybrids To Mapcis- and trans-Acting

JOURNAL OF VIROLOGY, Jan. 1990, p. 69-770022-538X/90/010069-09$02.00/0Copyright C 1990, American Society for Microbiology

Use of Bromovirus RNA2 Hybrids To Map cis- and trans-ActingFunctions in a Conserved RNA Replication Gene

PATRICIA TRAYNOR AND PAUL AHLQUIST*Institute for Molecular Virology and Department of Plant Pathology, University of Wisconsin-Madison,

Madison, Wisconsin 53706

Received 9 June 1989/Accepted 19 September 1989

Brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV) are related positive-strand RNAviruses with tripartite genomes. RNA replication by either virus requires genomic RNAs 1 and 2, which encodeprotein la and the polymeraselike, 94-kilodalton 2a protein, respectively. Proteins la and 2a share extensivesequence similarity with proteins encoded by a wide range of other positive-strand RNA viruses of animals andplants. Heterologous combinations of BMV and CCMV RNAs 1 and 2 do not support viral RNA replication,and although BMV RNA2 is amplified in CCMV-infected cells, CCMV RNA2 is not amplified by BMV.Construction of hybrids by precise exchange of segments between BMV and CCMV RNA2 has now allowedpreliminary mapping of such virus-specific replication functions in RNA2 and the 2a protein. The ability tosupport replication in trans with BMV RNA1 segregated with a 5' BMV RNA2 fragment encoding the first 3582a gene amino acids, while a 5' fragment extending over 281 BMV 2a codons transferred only cis-actingcompetence for RNA2 amplification in cells coinfected with wild-type BMV. Successful trans-acting functionwith CCMV RNA1 segregated with a CCMV RNA2 3' fragment that included the last 206 2a gene codons.Thus, the less conserved N- and C-terminal 2a segments appear to be involved in required interaction(s) of thispolymeraselike protein with the la protein or RNA1 or both. Moreover, when individual hybrid RNA2molecules that function with either BMV or CCMV RNA1 were tested, BMV- and CCMV-specific differencesin recognition and amplification of RNA3 templates appeared to segregate with RNA1.

Positive-strand RNA viruses collectively encompass

many clinically important animal pathogens and the vastmajority of viral plant pathogens. Strong parallels in genomeorganization and extensive similarities in nonstructural pro-tein sequence are shared by numerous plant virus groups andthe animal alphaviruses, suggesting that plant and animalRNA viruses share common features of gene expression andreplication (8, 15; reviewed in reference 13). Several featuresof plant bromoviruses, including the availability of infectiouscDNA clones for in vitro genetic manipulation (4, 18) and theability to replicate in protoplasts, make this group a usefulmodel system in which to study positive-strand RNA virusreplication.Brome mosaic virus (BMV) and cowpea chlorotic mottle

virus (CCMV) are closely related bromoviruses exhibitingextensive nucleotide and peptide sequence similaritythroughout their tripartite genomes (5; J. Bujarski, personalcommunication). Genomic RNAs 1 and 2, which are re-

quired for replication (12, 20), are monocistronic mRNAs fornonstructural la and 2a proteins, respectively. GenomicRNA3 encodes the 3a protein and is the template forsynthesis of subgenomic RNA4, from which coat protein isexpressed (2, 11, 27). A region of particularly strong se-

quence similarity between BMV and CCMV RNAs is in thecentral portion of RNA2; the protein sequence in this regionincludes a highly conserved motif characterized by a Gly-Asp-Asp peptide, which has been identified in a number ofDNA- and RNA-dependent polymerases (6, 19). In contrastto the central region, amino- and carboxy-terminal portionsof BMV and CCMV 2a protein sequences are much lesssimilar to each other (5) and have no apparent counterpartsin the otherwise similar nonstructural proteins of manyviruses (15).

* Corresponding author.

Despite the apparent close evolutionary relationship andextensive sequence similarity between BMV and CCMV,heterologous mixtures of RNAs 1 and 2 fail to support viralRNA replication (4). This heterologous incompatibility mayreflect failure of required interaction between the encodedproteins, between viral RNAs and proteins, or conceivablybetween RNAs. Such interactions may be direct or mediatedby cellular factors. Protoplast tests also show that BMVRNAs 1 plus 2 (henceforth B1+B2) amplify CCMV RNA3(C3), although to a very low level compared with that ofBMV RNA3 (B3). By contrast, CCMV RNAs 1 plus 2(C1+C2) amplify B3 at least as well as C3 (4). Recognitionand amplification of the heterologous RNA3 demonstratesconservation of some basic replication functions in these twoviruses, but the differential level to which the RNA3 tem-plates accumulate is evidence of another virus-specific dif-ference between BMV and CCMV replicases.To explore the basis of replicative incompatibility between

BMV and CCMV RNAs, and to map determinants of com-patible interaction between homologous RNA1 and -2 com-

binations, we have constructed a number of hybrid RNA2molecules that exchange specific regions of BMV andCCMV RNA2. In vivo testing of these hybrids has identifiedB2 and C2 regions controlling the compatibility of trans-acting RNA2 replication functions with BMV and CCMVRNA1, respectively, and cis-acting regions that influenceRNA2 amplification by wild-type (wt) BMV and CCMVreplicases. The RNA2 hybrid results also implicate a role forRNA1 in the virus-specific differential amplification ofRNA3 templates.

MATERIALS AND METHODS

Plasmids containing full-length cDNAs of each BMV andCCMV genomic RNA adjacent to a T7 promoter sequencewere previously constructed in this laboratory. Clones

69

Vol. 64, No. 1

70 TRAYNOR AND AHLQUIST

pBlTP3, pB2TP5, and pB3TP8, when linearized with EcoRIand transcribed in vitro with T7 RNA polymerase, yieldinfectious transcripts corresponding to BMV RNAs 1, 2, and3, respectively (18). Clones pCC1TP1, pCC2TP2, andpCC3TP4, when linearized with Xbal and transcribed invitro with T7 RNA polymerase, yield infectious transcriptscorresponding to CCMV RNAs 1, 2, and 3, respectively (4).An RNA2 consensus sequence was generated by using aprogram written by Claire Rhinehart. Dot plots and othersequence analyses were made by using the University ofWisconsin GCG sequence analysis software (9). Oligode-oxynucleotides were obtained from the Protein/DNA Syn-thesis Facility of the University of Wisconsin BiotechnologyCenter.

Plasmid construction. All recombinant DNA techniquesused were essentially those of Maniatis et al. (23). Restric-tion fragments recovered from low-melting-point agarosegels were used to assemble hybrid RNA2 clones. CloneBC2PT3(PT3) contains a 2,735-nucleotide (nt) ScaI-SspIfragment from pB2TP5 (includes BMV RNA2 sequence fromnt 1 to 947) ligated to a 3,207-nt ScaI fragment frompCC2TP2 (CCMV RNA2 sequence from nt 986 to 2774).Clone BC2PT15 (PT15) contains a 3,175-nt AatII-SspI frag-ment from pB2TP5 ligated to a 3,525-nt ClaI-AatII fragmentfrom pCC2TP2 and thus includes nt 1 to 947 from BMVRNA2 and nt 226 to 2774 from CCMV RNA2.Unique restriction sites were introduced into pB2TP5 and

pCC2TP2 by site-directed mutagenesis of single-strandedUTP-containing DNA templates by the method of Kunkel(22). Sites were targeted within small blocks of nucleotideand peptide identity, which were evident in the consensussequence. Oligonucleotide d(TTATGGTACTCGAG[A/T]C),which annealed with one mismatch to sequences corre-sponding to nt 1170 to 1185 in BMV RNA2, created an XhoIsite in pB2TP5 by changing T1174to C. The same primerannealed to nt 1209 to 1224 in CCMV RNA2 and introducedan XhoI site into pCC2TP2 by changing T1213to C (see Fig.2A). Similarly, oligonucleotide d(CTACAAACGTACGGCA),which is complementary with one mismatch to sequencescorresponding to nt 1872 to 1887 in BMV RNA2 and nt 1911to 1926 in CCMV RNA2, created SplI sites by changingC1876 to G in B2 and A1915 to G in C2 (see Fig. 2A). Thesesites, which were confirmed by restriction digest mappingand by sequencing, were used in combination with uniquesites in the plasmid vector to assemble six hybrid moleculesmade up of both BMV and CCMV RNA2 sequences (seeFig. 3).

Frameshift mutations in B2 were made in two sequentialsteps. BamHI linker insertion mutants pB2DR23 andpB2DR24 contain 6-base in-frame insertions after nt 1900and 2119, respectively (D. Richards and P. Ahlquist, unpub-lished data). After linearization of the plasmids with BamHI,the ends were blunted with Klenow polymerase; religationproduced plasmids with cumulative 10-base frame-shiftinginsertions. The open reading frame of clone pB2SB8 encodes599 wt amino acids plus five alternate-frame codons, and thatof pB2SB9 encodes 672 wt amino acids plus six codons.

In vitro transcription, protoplast inoculation, and RNAanalysis. Plasmids were linearized with EcoRI (wt BMV andhybrids having a 3' end derived from BMV) or XbaI (wtCCMV and hybrids having a 3' end from CCMV). In vitrotranscription, protoplast inoculation, RNA extraction, andNorthern (RNA) blot analysis were done essentially asdescribed by French and Ahlquist (10) as modified byKroner et al. (21), except that protoplast incubations were at30°C. Briefly, for each test, approximately 105 barley proto-

A2 3 kb

.. .. .......... .. .._ . _... _.__... ..__ .... ... ........... .....___

BC2PT1 5s sp

_ 261~~~~~~~~~-

770

I 770ACta

BMV

BTranscript 1:

2:3:

RNA I

2

3

BC C CC

B C PT15B C BC

mp d

4 I 4

FIG. 1. Construction and replication assay of RNA2 hybridBC2PT15. (A) The schematic drawing shows linkage of nt 1 to 947from BMV RNA2 (thin lines and open box) and nt 225 to 2774 fromCCMV RNA2 (thick lines and shaded box) in hybrid PT15. Thenumber of amino acids derived from each virus is shown within theboxed coding regions. The overlap between BMV and CCMVsegments reflects alignment of similar sequences in the parentRNAs. Consequently, the single open reading frame created byligation of SspI and ClaI sites includes tandem copies of a similar255-amino-acid segment from BMV and CCMV 2a proteins. (B)Northern blot analysis shows replication of viral RNAs in proto-plasts inoculated with PT15 transcripts in combination with RNA1and RNA3 transcripts from wt BMV (B) or CCMV (C) cDNAclones, as indicated above each lane. The autoradiogram showsblots of total protoplast RNA hybridized with virus-specific probesof equivalent specific activities. Positions of progeny viral RNAs areindicated at left; PT15 RNA (3.5 kilobases) would migrate above theposition of wt RNA1 (3.17 kilobases).

plasts were inoculated by a polyethylene glycol-CaCl2-basedmethod with in vitro transcripts from the specified cDNAclones. After 20 h, total nucleic acids were recovered,electrophoresed in an agarose gel, blotted onto a nylonmembrane, and hybridized with a 32P-labeled probe. Auto-radiograms were scanned with a Zeineh SLR-504-XL softlaser scanning densitometer.

Hybridization probes. 32P-labeled T7 or SP6 polymerasetranscribed RNAs, complementary to the conserved 3'-proximal 200 nt of BMV (11) or CCMV (5), were used toprobe Northern blots. Probes specific for BMV or CCMVRNA2 were transcribed from dual promoter plasmids which

J. VIROL.

RNA REPLICATION STUDIES WITH BROMOVIRUS RNA2 HYBRIDS 71

AXho I Spi I

I C I IjG IBMV 1169TGTCTTGAGTACCATAAGAAG .... 1868AGTGTGCCCTACGTTTGTAGTAAGBM 9" C L E Y H K K S V P Y V C S K

Xho I Spi II C I IG I

CCMV 120 GGACTTGAGTACCATAAGAAA .... AG1TTGCCATACGMGTAGTAAGG L E YH K K 1S LP YV C SK

B

2000 -

CCMVRNA2

1000 -

/

Spi I SB9

; SB8

Xho I -o.,

1000

BMV RNA22000

FIG. 2. Introduction of restriction sites within a region of high sequence similarity. (A) Partial nucleotide sequences of BMV (upper) andCCMV (lower) RNA2 cDNAs are aligned vertically to show similarity. Numbers indicate corresponding positions in wt RNAs and differ dueto insertion ofgaps to maximize sequence alignment. Base changes introduced by olignucleotide-directed, site-specific mutagenesis are shownabove each cDNA sequence, within brackets marking newly created XhoI and Spll restriction sites. Amino acid sequences, which wereunchanged by the introduced mutations, are shown below the cDNA sequences. (B) A dot plot graphically depicts a nucleotide sequencecomparison between RNA2 cDNAs ofBMV and CCMV, in which thick lines along the horizontal and vertical axes represent the open readingframes. Regions of similarity, at a stringency of 15 matches within a window size of 21, are shown by diagonal lines. Positions of new XhoIand Spil sites are indicated by arrows. Sites of frameshift mutations in BMV RNA2 that encode truncated 2a proteins are marked on thediagonal alignment. B2SB8 (SB8) encodes 599 wt amino acids plus five alternate-frame codons; B2SB9 (SB9) encodes 672 wt amino acids plussix codons.

contained the majority of coding sequences of either RNA2:B2 nt 30 to 2479 or C2 nt 35 to 2450.

RESULTS

Differences between BMV RNA2 (B2) and CCMV RNA2(C2) and their encoded 2a proteins dictate important speci-ficities in viral RNA replication, including the ability tosupport replication with the homologous but not the heter-ologous RNA1 (4). To assess the feasibility of constructingfunctional hybrid BMV/CCMV RNA2 molecules for map-ping and characterizing such phenotypic differences, hybridPT15 was made by using naturally existing restriction siteswithin the cDNA clones ofwt viral RNAs (4, 18). The hybridprotein encoded by this in-frame fusion contains amino acids1 to 281 of BMV 2a followed by amino acids 39 to 808 ofCCMV 2a and thus includes tandem copies of a homologous255-amino-acid segment from both BMV and CCMV 2aproteins (Fig. 1A). A polypeptide of the expected size was

produced in vitro by translation ofT7 polymerase transcriptsof PT15 plasmid DNA (data not shown).

In barley protoplasts, PT15 transcripts did not supportviral RNA replication when coinoculated with B1+B3 (notshown), but did support replication in the presence ofC1+C3 (Fig. 1B). Unlike wt infections, however, in whichRNAs 1 and 2 accumulate to approximately equivalentlevels, accumulation of 3.5-kilobase PT15 RNA was near thelimit of detection, while RNAs 1, 3, and 4 accumulated tonearly wt levels (Fig. 1B). This pattern suggests that thereplicase formed with PT15 protein was comparable inactivity to the wt complex, but the hybrid RNA2 exhibited acis-acting defect that made it a poor template for replicationor reduced its stability.The extensive redundancy of peptide sequence in PT15

allows two different explanations for the activity of thishybrid protein in viral RNA replication. First, the BMV-encoded N terminus may function as an independent domaincapable of whatever normal interactions are required with

. .

a

VOL. 64, 1990

I . I . . I I I I


Xho I1i0

Spi I2 3 kb

CCB2 602

CBB2

CBC2 i=

BBC2 - 591

464

233 | :-- 206

I 206 ...

.. ,. zU~ 0 ..-.

BCC2 -

BCB2 -

I I -39 -:

358 U :: 233 :: U 231 *

BC2PT3 28116

BMV CCMV_

FIG. 3. Construction ofRNA2 exchange hybrids. Positions of restriction sites used in the construction ofRNA2 hybrids are shown on thescale bar. The first six constructs utilized newly created XhoI and Spfl sites; hybrid BC2PT3 is an in-frame linkage of an SspI site in BMVRNA2 and a ScaI site in CCMV RNA2 (not shown; see Materials and Methods). BMV-derived noncoding and coding regions are shown withthin lines and open boxes; CCMV-derived regions are shown with thick lines and shaded boxes. Names of clones, at left, indicate virus sourceof sequential segments within each hybrid molecule. Numbers within boxed coding regions indicate amino acids in each segment; differencesin size between analogous segments are due to insertion of gaps in peptide sequences to maximize alignment. kb, Kilobases.

the CCMV-encoded portion of the hybrid 2a protein andwith CCMV RNA1 and the la protein. Alternatively, theCCMV-derived portion, lacking only the first 38 CCMVamino acids, may supply all requisite 2a gene functions whiletolerating the addition of 281 BMV residues to the aminoterminus. The overlapping structure of PT15 thus preventsunambiguous assignment of any function to a particularregion of the 2a gene.

Construction of RNA2 hybrids by nonoverlapping sequenceexchanges. To allow clear identification of regions contribut-ing to virus-specific phenotypes by precise exchange ofRNA2 segments, new restriction sites were introduced intothe BMV and CCMV RNA2 cDNAs (Fig. 2A). Translation-ally silent mutations were made by oligonucleotide-directedbase substitutions at equivalent positions in the alignedRNA, and thus protein, sequences. Both the new XhoI andSplI sites are within a central region of high nucleotidesequence similarity (Fig. 2B). This central portion of bromo-viral 2a genes shares significant peptide similarities with anextensive array of RNA, and to a lesser extent DNA,

polymerases (5, 6, 19). When tested in protoplasts withhomologous RNAs 1 and 3, BMV and CCMV RNA2 deriv-atives bearing the XhoI site, the SplI site, or both sitestogether supported infection with no detectable alteration inviral RNA accumulation (data not shown).The new XhoI and SplI sites, which divide B2 and C2 into

three segments, were utilized to construct a set of sixrecombinant molecules consisting of all ordered combina-tions of these segments (Fig. 3). As shown, the three lettersin the names of the resulting RNA2 hybrids indicate thesource of each segment in the chimeric molecules. Forexample, CBC2 contains the internal XhoI-SplI fragmentfrom BMV and both flanking regions from CCMV. Construc-tion of an additional nonoverlapping hybrid, PT3 (Fig. 3),made use of restriction sites in the wt cDNA clones. Correctligation of fragments in all seven hybrids was checked byrestriction analysis and sequencing across the ligated junc-tions (data not shown). The integrity of the open readingframe encoded by each of the hybrid molecules was furtherconfirmed by in vitro translation (data not shown).

231m

m ---aI m

ir 0 :.. lllli.MAl%n -i

0

I --- m - - ...m ---t= I

m

J. VIROL.

358


Awt 62

-Iwt C2

No

822 H- BCB2

-I808

358 * 233 * 231

*....

Transcript 1: B B2: B B3: B C

C CC CB C

Transcript 1: B B C C2: -BCB23: B C B C

RNA 1I2 a3 1

4c1

BBC2I - ....................

RNA 12

3 8

4 e

DBCC2

s ~~591 206 -I

Transcript 1: B B C C2: -BBC23: B C B C

RNA 1 _2

3 _~ "i

* 3|^#44

358 1 : -:

Transcript 1: B B C C2:- BCC2-3: B C B C

RNA 1 i~w'l*2

4

FIG. 4. Protoplast assays of RNA2 exchange hybrids. Northern blot analyses of viral RNA accumulation are shown. Schematics andinocula are as described in the legend to Fig. 1. Autoradiograms were exposed for 10 to 14 h, except as noted. Inoculations were of wt RNAs1 and 3 and (A) wt RNA2s; (B) hybrid BCB2; (C) hybrid BBC2 (the two lanes on right were exposed 48 h); (D) hybrid BCC2 (all lanes wereexposed for 48 h).

trans-Acting function of RNA2 exchange hybrids. The com-patibility of each RNA2 hybrid with either BMV or CCMVRNA1 was tested by assaying for viral RNA replication afterinoculation of barley protoplasts with transcripts corre-sponding to a hybrid RNA2 plus B1+B3 or C1+C3 tran-scripts. Three hybrids, CCB2, CBB2, and CBC2, did notsupport detectable viral RNA replication when inoculatedwith either B1+B3 or C1+C3 (data not shown). In resultsdescribed below, three other hybrids, BBC2, BCC2, andBCB2, did support RNA replication.Hybrid BCB2, in which the central conserved portion of

B2 has been replaced with the corresponding region from

C2, supported replication in the presence of B1+B3 but notC1+C3 (Fig. 4B). Total viral RNA accumulation inB1+BCB2+B3 infections was approximately two-thirds ofthe level seen in wt BMV infection, as estimated by scanningdensitometry of autoradiograms from duplicate experiments.Hybrid BBC2 supported the replication of viral RNAs

when inoculated into barley protoplasts with B1+B3 (Fig.4C). RNAs 1, 3, and 4 accumulated to nearly wt levels.Somewhat surprisingly, protoplasts inoculated with C1+BBC2+C3 also accumulated viral RNAs, though to a levelonly 10% that of a wt CCMV infection (Fig. 4C). Thelimitation of wt B2 to function only with Bi, and of C2 to

C

-1

I ---I

a

-m

0 5 m

VOL. 64, 1990


function only with Cl (4), thus is overcome by hybrid BBC2,which is compatible with both RNAls.A third hybrid RNA2, BCC2, functioned at a low level

when inoculated with either B1+B3 or C1+C3 (Fig. 4D).Overall, the level of viral RNA accumulation supported ineither combination was approximately 10% of the corre-sponding wt inoculation. Although it might have been pre-dicted that the more CCMV-like nature of BCC2 wouldallow greater activity with Cl than BBC2 did, this was notthe case.Hybrid BCC2 shows that inclusion of only the 5'-proximal

1,174 nt or 358 amino acids of B2 is sufficient to make ahybrid RNA2 that is functional in directing RNA replicationwith Bi. To assess the minimal B2 sequence required forcompatibility with Bi further, an additional hybrid, PT3, wasconstructed (Fig. 3). The encoded hybrid protein consists ofthe N-terminal 281 amino acids of B2a and the C-terminal

A

B

Cl + C2 + C3B1 plusB2 B2SB8SB9

RNA12 0

33

4

Bl + B2 + B3 plus

C2 PT15 BCC CCB CBCIC1 PT3 BBC BCB CBB

RNA12

3

4

C

RNA12

3

C1 + C2 + C3 plus

B2 PT15 BCC CCB CBCjBi PT3 BBC BCB CBBt~~

4

516 amino acids of C2a; thus, PT3 contains 77 fewer BMV-derived amino acids than BCC2. In protoplast assays of PT3with B1+B3 or C1+C3, no viral RNA replication wasdetected (data not shown).

Segregation of RNA3 template selection. In vivo, BMV andCCMV replicases differ with respect to amplification ofheterologous RNA3 templates (4). B1+B2 amplify C3 verypoorly compared with B3 (Fig. 4A). By contrast, Cl+C2replicate B3 to a level similar to or exceeding that of C3,usually showing a concomitant decrease in C1+C2 levelsthat may be due to competition effects (Fig. 4A). Thisvirus-specific difference in replicase activity may be encodedby RNA1, RNA2, or both. Accordingly, to follow potentialsegregation ofRNA3 template amplification with a particularB2 or C2 segment, each functional RNA1-hybrid RNA2combination was assayed in coinoculations with B3 and withC3 (Fig. 1B; Fig. 4B and D).

In no case tested did exchange of an RNA2 segmentbetween the two viruses transfer the differential amplifica-tion of B3 and C3. Rather, a BMV-like pattern of strong B3and weak C3 replication was apparent in all inoculations thatincluded Bi, regardless of which RNA2 was present (Fig. 4Band D), and a CCMV-like pattern of nearly equivalent C3and B3 replication was observed in all inoculations thatincluded Cl (Fig. 1B; Fig. 4C and D). Significantly, thisbehavior extended to hybrids BBC2 and BCC2, whichfunctioned with either Bi or Cl. Thus, inoculations differingonly with respect to RNA1 exhibited the same patterns ofvirus-specific RNA3 replication that were reported for wtBMV and CCMV.Hybrid RNA2 template activities. To examine the suitabil-

ity of an RNA as a template for replication without requiringactivity of its encoded protein, that RNA can be coinocu-lated with a full complement of wt BMV or CCMV genomicRNAs which provide functional la and 2a proteins in trans.Such four-component inoculations have shown that B2, butnot Bi, is replicated by CCMV and that neither Cl nor C2 isdetectably replicated by BMV (R. Allison and P. Ahlquist,unpublished results; see also Fig. 5A to C). In a four-component inoculation, the level of B2 amplification byCCMV is comparable to that in a normal BMV infection(Fig. 5A). The failure to detect template activity in three offour combinations is not due to instability or poor recoveryof the fourth component, since BMV and CCMV coat

FIG. 5. Four-component assays of template activity of wt RNAs1 and 2, RNA2 hybrids, and frameshift mutants. Protoplast inoculaconsisted of transcripts corresponding to four RNAs. The completeset of wt transcripts is shown above the brackets, and the individualheterologous transcript included as a fourth component is indicatedabove each lane. Positions of progeny viral RNAs are shown at left.(A) The accumulation of wt B2 RNA in a normal three-componentBMV infection is shown relative to the amplification of wt andaltered B2 RNA templates by CCMV. Frameshift mutants SB8 andSB9 encode nonfunctional B2a proteins that terminate after 599 and672 amino acids, respectively. Amplification of the B2 fourthcomponent was detected by hybridization with a probe specific forB2. (B) Template activity of RNA2 hybrids for wt BMV replicasedetected by hybridization to a mixture of two probes, one specificfor CCMV 3' end and the other specific for the C2 open readingframe. Faint bands visible in lanes Cl, C2, CCB, CBB, and CBC aresimilar in intensity to those seen from inoculation with an individualRNA and thus reflect residual input inoculum. (C) Template activityofRNA2 hybrids for wt CCMV replicase, detected by hybridizationto a mixture of two probes specific for BMV 3' end and the B2 openreading frame. As noted above, faint bands in lanes Bi, CCB, CBB,and CBC reflect input inoculum.

J. VIROL.

I I.",

f--..


proteins each encapsidate the RNAs of the heterologousvirus (4).To examine replication of B2 in the presence of a full

CCMV genome further, frameshifting 10-base insertionswere introduced within the 2a gene of B2, creating mutantsSB8 and SB9 (Fig. 2B). These mutations completely blockedRNA replication when inoculated with wt B1+B3 tran-scripts. However, when inoculated with the full complementof CCMV RNAs, both templates were replicated (Fig. 5A).Replication of B2 RNA in cells coinoculated with CCMVthus does not require a fully functional B2a protein, butdepends on trans-acting functions provided by C2 as well asCi.The template activity of all RNA2 hybrids was also tested

in four-component inoculations with wt BMV and CCMVgenomic RNAs. In BMV-infected cells, hybrids BBC2,BCC2, and BCB2 were highly amplified (Fig. 5B); whencompared with a normal BMV infection, these three hybridsaccumulated to a level at least half that of wt B2. BMV alsoreplicated hybrid PT3, although this molecule did not sup-port viral RNA replication in the presence of B1+B3 (Fig.SB). However, neither PT15 nor hybrids bearing 5' C2sequences (CCB2, CBB2, and CBC2) were amplified abovethe level of the input inoculum (Fig. SB).

Overall, the relative template activity of these eight hy-brids in CCMV-infected cells did not parallel that in BMV-infected cells. When inoculated with C1+C3, hybrids BBC2and BCC2 supported equivalent low levels of viral RNAaccumulation (Fig. 4C and D), but they had clearly differenttemplate activities in four-component assays (Fig. SC). Rel-ative to the level of wt B2, BBC2 accumulation was reducedby about half, but amplification of BCC2 was 10-fold less.CCMV replicated BCB2 to a level similar to that of BBC2(Fig. SC), although BCB2 did not contribute to viral RNAreplication when inoculated with only C1+C3. CCMV rep-licated both PT3 and PT15 weakly (Fig. SC). CCMV, likeBMV, did not amplify hybrids CCB2, CBB2, and CBC2above the level of input inoculum (Fig. SC). Thus, whiletemplates having noncoding sequences from B2 at the 5' endand from C2 at the 3' end, such as BBC2, were replicated byboth BMV and CCMV, all hybrids having C2 5' and B2 3'noncoding sequences were not templates for either repli-case. Nucleotide sequencing confirmed that bases 1 to 150 inthese hybrids were unchanged from wt C2 (data not shown).To ensure that the observed differences in hybrid RNA

accumulation in these four-component experiments did notresult from possible differences in packaging efficiency,template activity of each hybrid RNA2 was tested in theabsence of either RNA3. The relative levels of hybrid RNA2accumulation were similar to those observed when an RNA3was included (data not shown). The in vivo stability of wtand hybrid RNAs appeared similar, since similar levels ofthese RNAs persisted 20 h after individual inoculation (datanot shown). Also, in all four-component assays of both wtand hybrid RNAs, the coinoculation of a heterologous fourthRNA did not detectably stimulate or inhibit replication of thecomplete BMV or CCMV genome (data not shown). Theamplification, or failure to be amplified, of wt and hybridmolecules in these experiments thus reflects cis-acting tem-plate properties of the heterologous RNA rather than effectsof stability or trans-acting interference with the wt replica-tion complex by the fourth component RNA or its encodedprotein.When the accumulation of RNA2 hybrids in three- and

four-component assays was directly compared by using blotsprobed as in Fig. 5, the effects of cis- and trans-acting

deficiencies were seen to be additive, as expected (data notshown). Thus, in all cases, the accumulation of hybrid RNA2in a functional three-component inoculation was lower thanthat seen in the corresponding four-component inoculation,which provided wt 2a protein.

DISCUSSION

In this study, interviral hybrids were used to map cis- andtrans-acting RNA replication functions in BMV and CCMVRNA2. The RNA2 segments exchanged were large (0.7 to1.2 kilobases) and somewhat arbitrarily bounded and intro-duced 46 to 202 amino acid substitutions; that half of theresulting hybrid proteins showed enzymatic function in vivosuggests that bromovirus 2a proteins are surprisingly mal-leable. Also, this result illustrates the potential usefulness ofchimeric molecules for identifying and mapping proteinfunctions. Similar approaches have been used in a number ofprevious studies, including experiments to identify domainswithin yeast transcription activator proteins (reviewed inreference 25), to assign a trans-activator role to a viralprotein (7), and to effect a switch in the substrate specificityof a bacterial enzyme (17). Among other results discussedbelow, bromovirus RNA2 hybrids have allowed localizationof sequences required for compatibility between BMV andCCMV RNAs 1 and 2. While such requirements must reflectnecessary interactions between viral proteins or betweenviral proteins and RNAs, these interactions may be direct orindirect. Cellular factors may, for example, mediate interac-tion of viral proteins with RNA sequences such as the RNApolymerase III promoterlike elements found in BMV andrelated viral RNAs (10, 24). Nevertheless, identifying thedeterminants of essential interactions among such viralcomponents provides important clues to the RNA replica-tion process and should be useful in guiding further replica-tion studies.

Virus-specific utilization of wt and hybrid RNA2s as tem-plates for in vivo replication. In BMV-infected cells, theamplification of C3 is weak and that of C2 is undetectable,while in CCMV-infected cells, both B2 and B3 are amplifiedto high levels (4; R. Allison, unpublished results). TheCCMV-directed amplification of B2 frameshift mutants re-ported here shows that expression of a functional BMV 2aprotein is not required for B2 replication in CCMV-infectedcells (Fig. SA). Thus, the CCMV la and 2a proteins are ableto perform all required interactions with a B2 template, whileone or both of the corresponding proteins from BMV areunable to successfully interact with wt C2. Among hybridRNA2s, only those with a 5'-proximal segment from B2 wereamplified in BMV-infected cells. In particular, BMV-di-rected amplification of hybrid PT3 showed that the first 947bases of B2 supply a BMV-specific replication signal whichis not supplied by the corresponding segment of C2. Inter-estingly, hybrid PT15, which included all B2 and C2 se-quences present in PT3, was not detectably amplified inBMV-infected cells. Inclusion in PT1S of additional internalsequences from C2 (Fig. 1) somehow impaired BMV-di-rected amplification of PT15 or greatly affected its stability invivo. This suggests that the 5' B2 portion of PT3 and PT15does not function as an independent cis-acting domain, butrequires an appropriate sequence or structural context whichis provided in PT3 but abolished in PT1S.Four-component inoculations with CCMV (Fig. SC) also

showed that control of RNA2 template activity involvesmore than short, independent 5' and 3' elements. AlthoughB2 and C2 are both productive templates for CCMV, RNA2

VOL. 64, 1990


hybrids combining large C2 5' and B2 3' segments (CCB2and CBB2) were not amplified by CCMV. Similarly, CBC2failed to be amplified in CCMV-infected cells, indicating thatcentral as well as terminal sequences contribute in cis toRNA2 template function, as found previously for BMVRNA3 (10). Finally, despite containing more CCMV se-quence, BCC2 was a substantially poorer template for rep-lication in CCMV-infected cells than BBC2 or BCB2, whichpair the common B2 5' end with other, coadapted B2segments. This was not due to low BCC2 RNA stability,since all three hybrids accumulated to significant levels whenbarley cells were coinoculated with wt BMV. Collectively,these results emphasize the apparent importance of mutualadaptation among different regions ofRNA2 for full templateactivity.

Determinants of RNA2 compatibility for trans-acting func-tion with Bi and Cl. The hybrids showing trans-actingfunction with Bi in three-component inoculations (Fig. 4) allcontain B2 5' segments (BBC2, BCB2, and BCC2), whilethose showing trans-acting function with Cl contain C2 3'segments (BBC2 and BCC2). Thus, the 5' portion of B2encodes a critical determinant of successful interaction withBi, and the 3' portion of C2 encodes a determinant forinteraction with Cl. While these B2 5' and C2 3' segmentsare important, other regions also influence RNA2 interactionwith Bi and Cl. For example, there appears to be nointrinsic defect in the enzymatic activity of the 2a proteinencoded by BBC2, since this hybrid directs high-level repli-cation with Bi. The very weak activity of BBC2 with Cl(Fig. 4C) thus shows that important features specificallyadapted for high-level compatibility with Cl are also en-coded in the 5' two-thirds of C2. Since BCC2 activity withCl is no greater than BBC2, and BCB2 shows no compati-bility with Cl, there is no evidence for CCMV specificity inthe middle segment. Thus, compatibility with Cl likely ismediated by the 5' as well as the 3' C2 segment. Middle and3' B2 segments also influence hybrid function with Bi tovarying extents, although in these cases it is more difficult toseparate effects on intrinsic 2a protein function(s) fromeffects on extrinsic compatibility with Bi.The behaviors of PT15 (Fig. 1) and a previously reported

B2 derivative (26) show that dramatic reductions from RNA2levels in normal infection can be tolerated without significanteffect on amplification of RNAs 1 and 3. However, indepen-dently of any consideration of RNA2 amplification andexpression, some hybrid proteins may be so labile that theyappear nonfunctional in our assays. Interpretation of nega-tive results, such as with hybrids CCB2, CBB2, and CBC2,must await further tests to assess the possible activity oftheir encoded 2a proteins.While trans-acting function with Bl (Fig. 4) and cis-acting

template activity for BMV replicase (Fig. 5) both mapped to5'-proximal sequences of B2, the two characteristics wereclearly distinguishable: PT3, BBC2, BCC2, and BCB2 allcontained varying lengths of 5' B2 sequence and were allamplified well in BMV-infected cells. Nevertheless, BCC2,containing 358 codons from the N-terminus of BMV 2a,supported replication with Bi, while PT3, with only 281N-terminal BMV 2a codons, did not. The lack of detectabletrans-acting function in the PT3 hybrid may reflect disrup-tion of either an enzymatic function or the stability of thehybrid protein, as well as a requirement for compatibilitywith Bi.

trans-Acting RNA2 functions in RNA replication. BecauseB2 is fully functional in cis as a replication template inCCMV- as well as BMV-infected cells (Fig. 5), the failure of

B2 to support replication in combination with Cl must reflectincompatibility of a trans-acting B2 function with either ClRNA or its encoded la protein. In principle, RNA2 itselfmight provide a nontemplate, trans-acting function in RNAreplication. However, strong intraviral amino acid sequenceconservation (8, 15) and comparison of results with frame-shift mutations (Fig. 2B), nonframeshift insertions, and other2a gene mutants (P. Traynor, P. Kroner, and P. Ahlquist,unpublished results) suggest that the 2a protein is the prin-cipal mediator of trans-acting RNA replication function(s)encoded by RNA2. Taken together, these results suggestthat successful bromovirus RNA replication requires the 2aprotein to interact with the la protein, or to contribute torecognition of RNA1 as a replication template, or both.

Either of these possible interactions is consistent withprevious observations. Since some BMV 2a gene mutationsalter the ratios of genomic to subgenomic RNA and positive-to negative-strand RNA (21), the BMV 2a protein mayindeed have a role in template recognition. It is also quitepossible that the la and 2a proteins form an active complexfor at least some steps in RNA replication. Bromovirus 2aproteins consist of a central core with sequence similarity toknown polymerases, flanked by less conserved N- andC-terminal extensions (5, 15, 19). Since the hybrid resultsdiscussed above implicate N- and C-terminal 2a gene seg-ments as important determinants of RNA1 and RNA2 com-patibility, these less-conserved extensions could be involvedin virus-specific interactions complexing the polymeraselike2a protein core with the la protein. The la protein containstwo conserved domains (3), of which the C-terminal containsextended similarities to known helicases (14, 16). Associa-tion between such putative 2a polymerase and la helicasedomains could explain the previously observed ability of anin vitro BMV polymerase extract to copy through BMVtemplate regions hybridized to cDNA fragments hundreds ofnucleotides in length (1). A la-2a protein complex would alsobe functionally similar to the tobacco mosaic virus 180-kilodalton readthrough protein, in which la-like and 2a-likedomains are fused in a single polypeptide. Perhaps becauseof this direct covalent linkage, tobacco mosaic virus does notencode any obvious counterparts to the N- and C-terminal 2aprotein extensions, but fuses a polymeraselike segmentequivalent to the 2a core directly to the C terminus of ala-like protein (15).Virus specificity in RNA3 amplification. As noted in Re-

sults, the behavior of infections with BBC2 and BCC2 aswell as other hybrids suggests that the differential responsesof BMV and CCMV to heterologous RNA3 templates maybe encoded in RNA1. However, this possibility must betested further by more direct means such as moleculargenetic studies of RNA1 or biochemical analyses.

ACKNOWLEDGMENTS

We thank Philip Kroner for helpful discussions and constructionof frameshift mutation clones SB8 and SB9 and Ben Young and JulieDickson for excellent technical assistance at several stages of thisproject.

This research was supported by Public Health Service grantGM35072 from the National Institutes of Health.

LITERATURE CITED1. Ahlquist, P., J. J. Bujarski, P. Kaesberg, and T. C. Hall. 1984.

Localization of the replicase recognition site within bromemosaic virus RNA by hybrid-arrested RNA synthesis. PlantMol. Biol. 3:37-44.

2. Ahlquist, P., V. Luckow, and P. Kaesberg. 1981. Complete

J. VIROL.


nucleotide sequence of brome mosaic virus RNA3. J. Mol. Biol.153:23-38.

3. Ahlquist, P., E. G. Strauss, C. M. Rice, J. H. Strauss, J.Haseloff, and D. Zimmern. 1985. Sindbis virus proteins nsPl andnsP2 contain homology to nonstructural proteins from severalRNA plant viruses. J. Virol. 53:536-542.

4. Allison, R., M. Janda, and P. Ahlquist. 1988. Infectious in vitrotranscripts from cowpea chlorotic mottle virus cDNA clonesand exchange of individual RNA components with brome mo-

saic virus. J. Virol. 62:3581-3588.5. Allison, R., M. Janda, and P. Ahiquist. 1989. Sequence of

cowpea chlorotic mottle virus RNAs 2 and 3 and evidence of a

recombination event during bromoviral evolution. Virology172:321-330.

6. Argos, P. 1988. A sequence motif in many polymerases. NucleicAcids Res. 16:9909-9916.

7. Chattopadhyay, D., and A. K. Banerjee. 1988. NH2-terminalacidic region of the phosophoprotein of vesicular stomatitisvirus can be functionally replaced by tubulin. Proc. Natl. Acad.Sci. USA 85:7977-7981.

8. Cornelissen, B., and J. Bol. 1984. Homology between theproteins encoded by tobacco mosaic virus and two tricornavi-ruses. Plant Mol. Biol. 3:379-384.

9. Devereux, J., P. Haeberli, and 0. Smithies. 1984. A comprehen-sive set of sequence analysis programs for the VAX. NucleicAcids Res. 12:387-395.

10. French, R., and P. Ahlquist. 1987. Intercistronic as well as

terminal sequences are required for efficient amplification ofbrome mosaic virus RNA3. J. Virol. 61:1457-1465.

11. French, R., and P. Ahlquist. 1988. Characterization and engi-neering of sequences controlling synthesis of brome mosaicvirus subgenomic RNA. J. Virol. 62:2411-2420.

12. French, R., M. Janda, and P. Ahiquist. 1986. Bacterial geneinserted in an engineered RNA virus: efficient expression inmonocotyledonous plant cells. Science 231:1294-1297.

13. Goldbach, R. 1987. Genome similarities between plant andanimal RNA viruses. Microbiol. Sci. 4:197-202.

14. Gorbalenya, E. A., E. V. Koonin, A. P. Donchenko, and V. M.Blinov. 1988. A conserved motif in putative helicases. Nature(London) 333:22.

15. Haseloff, J., P. Goelet, D. Zimmern, P. Ahlquist, R. Dasgupta,

and P. Kaesberg. 1984. Striking similarities in amino acidsequence among nonstructural proteins encoded by RNA vi-ruses that have dissimilar genomic organization. Proc. Natl.Acad. Sci. USA 81:4358-4362.

16. Hodgman, T. C. 1988. A new superfamily of replicative pro-teins. Nature (London) 333:22-23.

17. Houghton, J. E., G. A. O'Donovan, and J. R. Wild. 1989.Reconstruction of an enzyme by domain substitution effectivelyswitches substrate specificity. Nature (London) 338:172-174.

18. Janda, M., R. French, and P. Ahlquist. 1987. High efficiency T7polymerase synthesis of infectious RNA from cloned bromemosaic virus cDNA and effects of 5' extensions on transcriptinfectivity. Virology 158:259-262.

19. Kamer, G., and P. Argos. 1984. Primary structural comparisonof RNA-dependent polymerases from plant, animal and bacte-rial viruses. Nucleic Acids Res. 12:7269-7282.

20. Kiberstis, P., L. S. Loesch-Fries, and T. C. Hail. 1981. Viralprotein synthesis in barley protoplasts inoculated with nativeand fractionated brome mosaic virus RNA. Virology 112:804-808.

21. Kroner, P., D. Richards, P. Traynor, and P. Ahlquist. Definedmutations in a small region of the brome mosaic virus 2a genecause diverse temperature-sensitive RNA replication pheno-types. J. Virol. 63:5302-5309.

22. Kunkel, T. A., 3. D. Roberts, and R. A. Zakour. 1987. Rapid andefficient site-specific mutagenesis without phenotypic selection.Methods Enzymol. 154:367-382.

23. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

24. Marsh, L. E., and T. C. Hall. 1987. Evidence implicating atRNA heritage for the promoters of positive-strand RNA syn-thesis in brome mosaic and related viruses. Cold Spring HarborSymp. Quant. Biol. 52:331-341.

25. Ptashne, M. 1988. How eukaryotic transcriptional activatorswork. Nature (London) 335:683-689.

26. Sacher, R., R. French, and P. Ahlquist. 1988. Hybrid bromemosaic virus RNAs express and are packaged in tobacco mosaicvirus coat protein in vivo. Virology 167:15-24.

27. Shih, D. S., and P. Kaesberg. 1973. Translation of brome mosaicviral RNA in a cell-free system derived from wheat embryo.Proc. Natl. Acad. Sci. USA 70:1799-1803.

VOL. 64, 1990

Documents

Use of Bromovirus RNA2 Hybrids To Mapcis- and trans-Acting