University of Groningen

In principio erat Lactococcus lactisCoelho Pinto, Joao Paulo

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Coelho Pinto, J. P. (2015). In principio erat Lactococcus lactis: Towards a membrane protein overproducerhost. ([Groningen] ed.). University of Groningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 15-06-2021

https://research.rug.nl/en/publications/in-principio-erat-lactococcus-lactis(e5ba7f4d-6659-4239-a093-6c2777c6d17a).html

CHAPTER 6

UPGRADING THE TOOLKIT OF

LACTOCOCCUS LACTIS§

§ João P. C. Pinto, Araz Zeyniyev, Sjoerd van der Meulen, Oliwia Bieniek, Harma Karsens, Hein

Trip, Juke S. Lolkema, Oscar P. Kuipers and Jan Kok

Part of this chapter was published in:

João P. C. Pinto, Araz Zeyniyev, Harma Karsens, Hein Trip, Juke S. Lolkema, Oscar P. Kuipers,

and Jan Kok. “pSEUDO, a Genetic Integration Standard for Lactococcus Lactis.” Applied and

Environmental Microbiology 77, no. 18 (September 2011): 6687–6690.

Chapter 6

154

Abstract

Lactococcus lactis is an industrially important microorganism and a model for the family of

Lactic Acid Bacteria (LAB). Catering to the ever increasing need to constantly update the

genetic toolkit of L. lactis, we constructed plasmid pSEUDO and derivatives and used them to

show that llmg_pseudo_10 in Lactococcus lactis MG1363, and its homologous locus in L.lactis

IL1403, are suitable for chromosomal integrations. L.lactis MG1363 and IL1403 NICE-

system-derivatives (JP9000 and IL9000) and two general stress reporter-strains

(NZ9000::PhrcA-GFP; NZ9000::PgroES-GFP) enabling in-vivo non-invasive monitoring of

cellular fitness were constructed. We additionally established a protocol to easily screen and

characterize randomly produced mutants of this organism. We successfully implemented

and validated a protocol for Genomic Array Footprinting (GAF), using SuperAmine glass

slides spotted with duplicates of around 2500 ORF amplicons of L. lactis subsp. cremoris

MG1363. We additionally constructed pGh8T7:ISS1, a plasmid with a tetracycline resistance

marker rather than the often used erythromycin resistance that is present in pGh9T7:ISS1.

This unlocks experimental setup and screening strategies on strains that are already

erythromycin resistant, e.g. from carrying a genetic construct used in the selection

procedure.

Upgrading the Toolkit of Lactococcus lactis

155

Introduction

Lactococcus lactis is an industrially important microorganism which is widely used in dairy

fermentation. Glancing into the future, this bacterium could also play a role in other, novel,

biotechnological applications, for instance as a possible membrane protein overproduction

host, as is explored in the work described in this thesis.

L. lactis has also been a model organism for the Lactic Acid Bacteria (LAB) for the past

several decades and the current knowledge regarding the molecular biology of this family of

bacteria derives in great part from evidence initially collected from L. lactis. With the public

availability of eight genome sequences of this bacterium (1–8), L. lactis also leads the way

with respect to post-genomics experimental approaches such as transcriptomics, proteomics

and metabolomics and using these for in-depth systems biology studies (see for example

(9)).

The ever increasing pace of scientific research on the LAB demands continuously updating

the genetics and genomics toolkit of L. lactis so that it remains a valid model organism in

which experimental questions can be readily addressed and answered. Here we document

the construction a standard for chromosomal integrations and the set up a protocol in L.

lactis for the easy screening and characterization of randomly produced mutants.

A standard locus in the chromosome of L. lactis for integration of DNA fragments, whether

for genetic complementation (single-copy or merodiploid-like situations) or cloning of a

reporter gene or -promoter, is lacking. Contrary to e.g. Bacillus subtilis, where the amyE locus

is often used for these purposes (22), in L. lactis various chromosonal loci in the

chromosome have been chosen as targets for integration. Unfortunately, and to the best of

our knowledge, none of the proposed strategies exclude the possibility of phenotypic

consequences. The leuA locus was shown to suffer from active read-through from the native

leuA promoter (11), whereas the choice of the sex factor locus might interfere with the

biology of L. lactis and, in addition, may have consequences with respect to possible

conjugational transfer of the inserted DNA. Also, bacteriophage sequences have been used to

drive site-specific integration of plasmids in the chromosome of L. lactis (3, 9). However,

these methods do not allow making strains without resistance markers while some require

the use of a second plasmid to provide the bacteriophage integrase in trans. Furthermore, the

localization in the chromosome of L. lactis MG1363 of sequences with high similarity to a

given attB, e.g. in the comGC gene for TP901-1 attB and in rex for TUC2009 attB (data not

shown), implies that the integration process might lead to the simultaneous disruption of

potentially relevant processes.

Here it was examined whether the llmg_pseudo_10 locus of L. lactis MG1363, or its

corresponding region in L. lactis IL1403, is a suitable neutral region for chromosomal

Chapter 6

156

integrations (Figure 4). In L. lactis IL1403, this locus contains yfjF, a gene of 1506 bp of which

the product exhibits homology to transport proteins from the major facilitator superfamily.

In L. lactis MG1363, translation is halted prematurely due to the presence of a stop codon at

position 303, hence its annotation as a pseudo gene (24). By cloning and re-sequencing, the

nucleotide sequence of this region in L. lactis MG1363, originally described by Wegmann et

al. (24), was confirmed. The loss of function of the locus in L. lactis MG1363 suggests that yfjF

is non-essential. The llmg_pseudo_10 locus has been shown to be silent throughout the

growth of L. lactis MG1363 in batch cultures in M17 medium (4) and milk (Anne de Jong,

personal communication). In addition, llmg_pseudo_10 and yfjF display low nucleotide

sequence similarity with other regions in the L. lactis genome, minimizing the possibility of

illegitimate recombination.

Figure 1 – Genomic context of llmg_pseudo_10 of L. lactis MG1363 and its relation to the homologous regions (hr’s) present in pSEUDO and pSEUDO-GFP. The multiple cloning site (MCS) contains, in clockwise order, EcoRI, XmaI/SmaI, SphI, ScaII, SalI, HindIII, BglII, XhoI and BamHI restriction enzyme sites. The gfp gene for super-folder GFP (19) was cloned in pSEUDO using the XhoI and BamHI sites, yielding pSEUDO-GFP. Terminators are indicated by ‘lollipop’ structures. The vertical line on llmg_pseudo_10 depicts the stop codon that prematurely halts translation of the gene in L. lactis MG1363. eryR: erythromycin resistance gene; oroP encodes the L. lactis orotate transporter (5).

Upgrading the Toolkit of Lactococcus lactis

157

Part I: pSEUDO, a genetic integration standard for

Lactococcus lactis

Construction and applicability of pSEUDO and pSEUDO-GFP

To be able to perform unmarked integrations in the chromosome of L. lactis the

chromosomal integration vector pCS1966 was employed, allowing to positively select cells in

which the plasmid has been excised from the genome (16). Two DNA fragments were

amplified from L. lactis MG1363 chromosomal DNA by PCR, one of 529 bp obtained with the

primer pair P1_pseudo10/P2_pseudo10 and another of 804 bp using

P3_pseudo10/P4_pseudo10, and sequentially inserted into pCS1966 using the restriction

enzymes indicated in Table 1, and E. coli DH5α as the cloning host. Selection was performed

on TY agar plates with 150 µg/ml erythromycin. The custom-made multiple cloning site

GAATTCCCCGGGCATGCCGCGGTCGACAAGCTTAGATCTCGAGGATCC was introduced between

the BamHI and EcoRI sites, thus producing the plasmid pSEUDO (Figure 4). This vector can

be used to insert DNA fragments into the llmg_pseudo_10 locus of L. lactis MG1363 using

positive selection for resistance to the toxic pyrimidine analog 5-fluoroorotate, as described

before (16), with minor modifications (17). Although it is not possible to screen for

integrants via loss of function through gene disruption, pSEUDO allows for a quick and

efficient positive survival strategy to monitor both integration (erythromycin resistance) and

excision of the vector backbone from the chromosome (5-fluoroorotate resistance), thus

enabling the production of unmarked strains in an easy and fast manner.

As a proof of principle, the applicability of pSEUDO is illustrated through the integration of

the genes of the two-component nisin sensor, NisRK (12), in the chromosome of L. lactis

MG1363, internal and in opposite orientation to llmg_pseudo_10. A fragment containing the

nisRK genes with their own promoter was amplified by PCR from chromosomal DNA of L.

lactis NZ9000 (20) using the primers nisRK_Forw and nisRK_Rev. The PCR product and

pSEUDO were digested with BamHI and ligated after dephosphorylation of the digested

vector, producing pSEUDO::nisRK. The presence and orientation of the insert were checked

with PCR and restriction endonuclease digestions. The integration of nisRK into L. lactis

MG1363 using pSEUDO::nisRK generated the L. lactis strain JP9000. Expression of nisRK and

the applicability of the nisin-induced controlled expression (NICE) system (18, 19) using L.

lactis JP9000 are the same as for L. lactis NZ9000. As an example, the NICE system was used

for the overproduction of a GFP- and hexa-histidine-tagged membrane protein of L. lactis,

BcaP-GFP-H6, using pNZbcaP-GFP-H6, a pNZ8048 derivative in which the bcaP-gfp-H6 gene

is driven by the nisin-inducible PnisA promoter (11). L. lactis strains NZ9000 and JP9000

carrying this plasmid produced equivalent levels of the tagged protein since a similar

fluorescent signal from the overproduced BcaP-GFP-H6 was obtained using either strain

Chapter 6

158

(Figure 2). Contrary to previous observations (20), the native nisRK promoter (21) was

sufficient to yield significant amounts of NisRK and read-through from the neighboring genes

was not required for a functional NICE system. In addition to pSEUDO::nisRK, a similar vector

was constructed for nisRK integration in the yfjF locus of L. lactis IL1403. The llmg_pseudo_10

homologous regions of pSEUDO were replaced by homologous regions of the yfjF locus,

amplified from chromosomal DNA of IL1403 using primers P1_yfjF, P2_yfjF, P3_yfjF and

P4_yfjF (Table 1). The nisRK genes were inserted in the BamHI site in opposite direction to

the yfjF gene, resulting in plasmid pSEUDO-IL::nisRK. The integration of nisRK into L. lactis

IL1403 resulted in strain IL9000. To test functionality, IL9000 was transformed with a

pNZ8048-derived plasmid in which gfp was inserted downstream the nisin-inducible PnisA

promoter (H. Trip, unpublished results). GFP fluorescence levels upon induction with nisin

were similar to those obtained with L. lactis NZ9000 harboring the same plasmid (data not

shown), demonstrating that the NICE system is identically functional in L. lactis IL9000. The

plasmids pSEUDO::nisRK and pSEUDO-IL::nisRK can be used to introduce the NICE system in

any L. lactis MG1363- or L. lactis IL1403-derived strain, respectively. This is thought to be

very useful for the LAB research community since L. lactis MG1363 and L. lactis IL1403 are

by far the most commonly used strains in the L. lactis applied and fundamental research

fields. The use of pSEUDO::nisRK or pSEUDO-IL::nisRK circumvents the use of combinations

of vectors in strains that do not carry nisRK on the chromosome. In those cases, pNZ9530

(18) is usually required to provide nisRK in trans, for complementation analysis. L. lactis

JP9000 is preferable over the standard strain NZ9000, since pepN is intact in the former

whereas it is disrupted in NZ9000 (pepN::nisRK) (18) (Figure 2). L. lactis IL9000 is the first

IL1403 derivative in which the NICE system for nisin-inducible gene expression can be

employed. The general aminopeptidase N (PepN) (21), while generally assumed not to be

relevant under most conditions, is likely to have an effect on nitrogen metabolism through

the influence of the products of peptide hydrolysis on e.g., the major pleiotropic regulator

CodY (22). Also, the availability of specific peptides in the medium has been correlated with

the ability of L. lactis to overproduce membrane proteins (23).

Upgrading the Toolkit of Lactococcus lactis

159

A)

B)

Figure 2 – Heterologous protein production and activity of aminopeptidase PepN in L. lactis. (A) Expression of the membrane protein BcaP-GFP-His6 was induced in L. lactis strains NZ9000 and JP9000, both carrying plasmid pNZbcaP-GFP-H6 (11). The strains were grown in GM17 until an OD at 600 nm of 0.5 was reached, after which they were induced for one hour with 5 ng/ml of nisin. Mean fluorescence, as measured by flow-cytometry, of the plasmid-carrying strains is plotted, normalized to that of plasmid-free L. lactis NZ9000. The uninduced bar depicts the fluorescence of the non-induced JP9000 (pNZbcaP-GFP-H6) culture. (B) PepN activity in L. lactis strains MG1363 (24), NZ9000 (18), MG1363ΔpepN (25), and JP9000 (this work) was determined in cell-free extracts of cultures grown in GM17 until an OD at 600 nm of 0.5, by monitoring the hydrolysis of the PepN substrate lysyl-p-nitroanilide, as described previously (26). (A) and (B): data are the average of 4 biological replicates and the error bars are the associated standard deviation.

0

20

40

60

80

100

120

140

160

180

200

Uninduced NZ9000 JP9000

Norm

aliz

ed F

luore

scence [

A.U

.]

0

20

40

60

80

100

120

MG1363 NZ9000 MG1363ΔpepN JP9000

Norm

aliz

ed P

epN

Activity [

-]

Chapter 6

160

To facilitate the integration of promoter-gfp reporters in the chromosome of L. lactis,

pSEUDO-GFP was also constructed (Figure 4). This vector was made by cloning the gene of

the superfolder variant of GFP (27) together with the two terminator sequences from the

iGEM Biobrick I746909 (http://partsregistry.org/Part:BBa_I746909) (28) to block read-

through into llmg_0576, a putative transcriptional regulator of the TetR family. The PCR

fragment obtained with primers GFP-SF_Forw and GFP-SF_Rev was inserted in pSEUDO

using BamHI and XhoI. The first primer was used to add 4 well-translated codons and a

strong RBS sequence to the 5’-end of gfp (29).

As an example of the applicability of pSEUDO-GFP, promoter-gfp fusions were constructed

using the upstream regions of two general stress response genes, hrcA and groES. The

promoter region of hrcA was amplified using the primer pair PhrcA_forw/ PhrcA_rev and that

of groES was amplified with the primers PgroES_forw/PgroES_rev. EcoRI and XhoI were used

to digest these DNA fragments and pSEUDO-GFP, in which the two promoter fragments were

separately inserted. Insertion of the promoter-gfp fusions in the llmg_pseudo_10 locus of the

chromosome of L. lactis NZ9000 yielded the strains NZ9000::PhrcA-gfp and NZ9000::PgroES-

gfp. By exposing both strains to high temperatures, and making use of the stress-induced

activity of PhrcA and PgroES, it was demonstrated that they are able to reliably monitor, in a

non-invasive manner (unlike e.g., promoter-lacZ fusions) and in real-time, the effect of

growth and environmental conditions on the general fitness of cells (Figure 3).

The use of pSEUDO-GFP enables applying high-throughput screening strategies (e.g., using

microtiter plates) for conditions in which putative promoters are expected to be active.

Furthermore, the use of flow-cytometry, or other single-cell analysis techniques, allows

characterizing phenomena such as gene expression heterogeneity.

Altogether, pSEUDO, pSEUDO-GFP and the derived plasmids and strains add value to the

lactococcal research community in that they establish an improved working standard for the

effective and efficient integration of DNA fragments into the chromosome of L. lactis.

Upgrading the Toolkit of Lactococcus lactis

161

Figure 3 – Induction of GFP production in L. lactis NZ9000::PgroES-GFP and in L. lactis NZ9000::PhrcA-GFP, grown in GM17 medium at 30oC. Both cultures were shifted to 60°C when they had reached an optical density at 600 nm of 0.5. White: 0 min after the temperature shift; light grey: 15 min after the temperature shift; dark grey: 60 min after the temperature shift. The fluorescence was measured over time using an Epics XL-MCL flow-cytometer (Coulter, Fullerton, CA). Values were normalized to the fluorescence of L. lactis NZ9000 undergoing the same heat treatment. 20.000 cells were measured per experiment and 4 biological replicates obtained per strain and per time point. The error bars are the associated standard deviations.

Part II: Genomic Array Footprinting in Lactococcus lactis

Construction of pGh8T7:ISS1

The ISS1 element from pGh8:ISS1 (30) was removed by digestion of the plasmid with EcoRI

and HindIII and replaced by a HindIII-, EcoRI-digested PCR product of the ISS1 element

generated from pGh8:ISS1 with primers ISS1_T7_up and ISS1_T7_down (12). This resulted in

pGh8T7:ISS1, which, like pGh9T7:ISS1 (12), contains the ISS1 element with the T7 promoters

on either of its sides (Figure 4).

Chapter 6

162

Table 1 – Oligonucleotides used in this study. Restriction enzyme sites are underlined.

Name Nucleotide Sequence; 5’ > 3’ § Restriction

enzyme

P1_pseudo10 GCTCTAGACAATTGCTCCCATGCTTGATTCC BglII

P2_pseudo10 CGCGGATCCTGCTTTTGGATTAAAAGGTTTGAAAG BamHI

P3_pseudo10 CGGAATTCGGCGGCTCTGTTGGATTAATATATGG EcoRI

P4_pseudo10 GCGGTACCCAATTGAAGAGACAAGAAAACC KpnI

P1_yfjF GCGAAATCTAGACTTCAAACATAAGAGACCTCG XbaI

P2_yfjF GCGAAAGGATCCTTTAGCTTTAGGGTTGAAAGG BamHI

P3_yfjF GCGAAAGGATCCTTTGGCTGGCGGTTCTGTGGG BamHI

P4_yfjF GCGAAAGGTACCAATCGAAGAGACAAGAAAGCC KpnI

nisRK_Forw TAAAGGGATCCGCTTAGATACAGATAAAGGTCAGG BamHI

nisRK_Rev AGATTGGATCCCAAAACTGATATCTTGTAGCACCTGC BamHI

GFP-SF_Forw ATAGTCTCGAGTAAGGAGGCAAATATGAAACATCTTCGTAAAGGCGAAGAGCTGTTCACTGG

XhoI

GFP-SF_Rev ACTATGGATCCTATAAACGCAGAAAGGCCCACC BamHI

PhrcA_forw ATCTGGAATTCATCCAAAGATTCTAATCTTTTATAACAG EcoRI

PhrcA_rev GCTCCCTCGAGTATCTCTAAGTTTTTTCTTTTAGCACTC XhoI

PgroES_forw GGAACGAATTCTTGAAGCTGATGAGCTCCCTTTCTG EcoRI

PgroES_rev ATACTCTCGAGCATTTTTTATTTTTAGCACTCTTAATAG XhoI

Figure 4 – Schematic representation of pGh8T7:ISS1 (this work) and pGh9T7:ISS1 (12). Both plasmids carry a repA (ts) gene encoding a temperature sensitive replication protein that is non-functional above 37°C (30, 31). The ISS1 insertion sequence is flanked by two outward-facing T7 promoters (12). pGh8T7:ISS1 contains the tetracycline resistance marker from pT181 (30, 32) while pGh9T7:ISS1 carries the erythromycin resistance marker from pIL253 (15, 30).

Upgrading the Toolkit of Lactococcus lactis

163

The pGh8T7:ISS1 replicon, like that of pGh9T7:ISS1 (12), is a thermosensitive derivative of

pWV01 (33), in which repA contains four mutations compared to that of pVW01 (31, 34). In

L. lactis these plasmids replicate normally up to 28°C but not above 37°C (30, 31). The Ts

plasmids can be used to perform insertional mutagenesis not only in L. lactis but also in

other lactococci, enterococci and streptococci, where ISS1 has been shown to transpose

randomly throughout the genome (30).

The characterization of mutants that are pulled out during a given screening strategy can be

performed by amplifying the chromosomal regions that are adjacent to where the plasmid

has integrated. The transposed structure is flanked by ISS1 on each side (30), so the

outward-facing T7 promoters can be used to produce local RNA fragments which pinpoint

the site of integration and therefore allow identifying the genes that have been disrupted or

transcriptionally affected.

Genomic Array Footprinting in Lactococcus lactis

In GAF, an entire transposon library can be screened, for example, for mutants that

disappeared or became differentially more prevalent under a certain experimental setup by

comparing the obtained mutant bank (target) to the control or original library (12). This is

accomplished by digesting chromosomal DNA from each of the two populations (target and

control), and amplifying RNA from the DNA segments that remain adjacent to the transposon

insertion sites using the T7 RNA polymerase. The RNA is then used as a template to yield

cDNA that is labelled and hybridized onto a DNA microarray (12).

To validate this strategy in L. lactis, we used the method as described before (12), with small

libraries (≈ 100 CFU’s). Following the transformation of L. lactis with pGh9T7:ISS1 and the

subsequent temperature up-shift to select for integrants, 3 small libraries of 32 CFU’s each

were made. From these 3 libraries, one was obtained from a selection of small colonies, the

second from medium sized ones, and the third from colonies larger than the average

wildtype L. lactis colony. Additionally, 10 random colonies (3 small, 4 medium, 3 large ones)

were independently picked. We selected and independently expanded in liquid culture, not

only each of these 10 colonies, but also each library of 32 CFU’s, to dismiss in this validation

stage any artifacts, such as overrepresentation bias, that might derive from growth rate

differences among mutant strains.

Chromosomal DNA from each of the small transposon libraries and from each of the 10

randomly selected strains was independently purified. Then, two chromosomal DNA

mixtures were prepared: DNA pool 1 contained equal amounts of DNA from each of the three

small libraries (thus representing 96 CFU’s); the second preparation (DNA pool 2) contained

this same DNA mixture to which chromosomal DNA from each of the 10 independently

picked colonies was proportionally added (in total about ≈ 30% compared to the DNA from

Chapter 6

164

each of the three small libraries). This setup served to mimic a situation where, during a

selective process, 10 mutants had disappeared from the transposon library pool. We only

used small libraries, of 96 and 96+10 CFU’s, to minimize the probability of a given insertion

locus being represented in both the “96 CFU’s” and the “10 CFU’s” partial libraries of DNA

pool 2.

DNA from each of these two mixtures was digested with AluI, which cuts the L. lactis

chromosome on average every 233 bp. The “MEGAscript® T7 Transcription Kit” (Ambion,

Texas, USA) was used to amplify regions adjacent to the T7 promoters, according to

manufacturer instructions. The obtained RNA was purified with the “High pure RNA isolation

kit” (Roche Molecular Biochemicals, Mannheim, Germany). Synthesis of cDNA and DNA

microarraying were performed as described before using SuperAmine glass slides (ArrayIt,

Sunnyvale, CA) spotted with duplicates of around 2500 ORF amplicons of L. lactis subsp.

cremoris MG1363 (17, 35).

Analysis of the DNA microarray data indicates that, indeed, some spots on the DNA

microarray slide display greater signal intensities, corresponding to the 10 extra mutants in

the 96+10 CFU’s DNA sample, as compared to the 96 CFU’s library (Figure 5).

Figure 5 – DNA microarray output of GAF using an L. lactis transposon library of 96 CFU’s (horizontal axis) versus 96+10 CFU’s (vertical axis). Spots with significantly greater intensities in the channel that corresponds to the 96+10 CFU’s sample are highlighted as red triangles.

Upgrading the Toolkit of Lactococcus lactis

165

As previously observed (30), integration of pGh9T7:ISS1 in the genome of L. lactis appears to

have been random since the DNA microarray spots with greater intensities and those with

greater intensity biases (Figure 5) map onto regions all around the genome (Table 2). Also,

Southern hybridization on the DNA of all 10 independently picked CFU’s using pGh9T7:ISS1

as a probe indicates that integration loci were different in all cases as the samples yielded

different patterns on the blot (data not shown).

Note, however, that the outcome from GAF depends on the restriction enzyme used to digest

the chromosomal DNA. For the transposon insertion site to be identifiable, a DNA microarray

probe has to at least partially match the chromosomal region between the T7 promoter and

the restriction site of the particular restriction enzyme.

Table 2 – DNA microarray probes that are highlighted as red triangles in Figure 5.

Gene Microarray Probe Net Intensity

Ratio 96 CFU’s 96+10 CFU’s

llmg0430_cstA_MG752 431 773 1,8

llmg0724_llmg0724_mg10050s 336 825 2,5

llmg1031_trpG_MG750 352 8.543 24,3

llmg1032_trpD_MG749 322 1.653 5,1

llmg1453_llmg1453_MG150179 319 1.089 3,4

llmg1454_llmg1454_mg6115 253 8.020 31,6

llmg1455_bglA2_mg6114 275 3.149 11,5

llmg1455_bglA2_MG809 150 510 3,4

llmg1668_llmg1668_MG150107 349 2.830 8,1

probe mg5799 (between llmg1668 and llmg1669) 169 16.028 94.6

llmg1669_llmg1669_mg5800 173 6.440 37,2

llmg2100_ps442_MG1927 280 8.503 30,4

llmg2288_ackA2_MG1320 296 1.902 6,4

Further Considerations on GAF

The first step in the implementation of a GAF strategy is the construction a transposon

library in the organism of interest. The choice of either pGh8T7:ISS1 or pGh9T7:ISS1 is

important if the experimental setup requires the use of either erythromycin or tetracycline

to select for a marker, other than that on any of those two plasmids.

The size of the library, that is the number of integrants to be screened, is also a matter of

optimization. Assuming that plasmid integration via ISS1 is entirely random, the probability

of a gene having been disrupted at least once in a given library is given by the formula:

Chapter 6

166

𝑃 = 1 − (1 − 1

𝑁)

𝑛

where N is the number of genes on the chromosome and n is the number of CFU’s that were

collected to make the library. Thus, a transposon library of 5.000 CFU’s of L. lactis MG1363,

which encodes 2.563 genes (8), is likely to have a coverage of 85,8% disrupted genes

represented at least once in that library. Please note however that the formula offers a

simple estimate since 1) some genes are essential and will never be represented in any

library, 2) gene sizes differ considerably and, for example, 3) a gene in an operon can be

indirectly disrupted if transcription is terminated before reaching it.

A library made from a larger number of CFU’s is not necessarily better. Slight variations in

the site of integration, for example of 100 bp, can result in different phenotypes but produce

the same outcome on a DNA microarray slide when GAF is employed. Conversely, the

opposite is also true. Thus, the disappearance of a given mutant under selective pressure

could be masked by the persistence of other mutants, that are phenotypically distinct, but

that yield similar signals using GAF. To minimize this effect, the selection of a proper

restriction enzyme to digest the chromosomal DNAs of target and control cultures is

essential. A non-frequently cutting enzyme produces on average large fragments,

exacerbating the effect, i.e. making it more difficult to distinguish insertion sites using GAF.

Although a more frequently cutting enzyme would enable greater resolution it will also

increase the chance that there will be no probe on the DNA microarray that matches the

region between the T7 promoter and the restriction enzyme site.

We therefore suggest including variations in the size of the transposon libraries and in the

restriction enzymes used, which would also provide the replicates that are required in any

experimental setup. For L. lactis one could consider using the restriction enzymes AluI, TaqI

and DdeI, which on average cut the chromosomal DNA every 233 bp, 531 bp and 448 bp,

respectively. Also, one should keep in mind that in GAF, the probe on the DNA microarray

slide does not match one-to-one to the gene that has been disrupted, but rather to a region

that lies between the transposon insertion site and the enzyme restriction site.

All that is discussed above is not only true for other lactococci, but also for enterococci and

streptococci, where the GAF methodology presented here can be equally implemented since

ISS1 has been shown to transpose randomly throughout the genomes of these organisms

(30).

Upgrading the Toolkit of Lactococcus lactis

167

References

1. Bolotin A, Wincker P, Mauger S, Jaillon O, Malarme K, Weissenbach J, Ehrlich SD, Sorokin A. 2001. The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res 11:731–753.

2. Bolotin A, Quinquis B, Ehrlich SD, Sorokin A. 2012. Complete genome sequence of Lactococcus lactis subsp. cremoris A76. J. Bacteriol. 194:1241–1242.

3. Gao Y, Lu Y, Teng K-L, Chen M-L, Zheng H-J, Zhu Y-Q, Zhong J. 2011. Complete genome sequence of Lactococcus lactis subsp. lactis CV56, a probiotic strain isolated from the vaginas of healthy women. J. Bacteriol. 193:2886–2887.

4. Linares DM, Kok J, Poolman B. 2010. Genome sequences of Lactococcus lactis MG1363 (revised) and NZ9000 and comparative physiological studies. J Bacteriol doi:10.1128/JB.00533–10.

5. Makarova K, Slesarev A, Wolf Y, Sorokin A, Mirkin B, Koonin E, Pavlov A, Pavlova N, Karamychev V, Polouchine N, Shakhova V, Grigoriev I, Lou Y, Rohksar D, Lucas S, Huang K, Goodstein DM, Hawkins T, Plengvidhya V, Welker D, Hughes J, Goh Y, Benson A, Baldwin K, Lee J-H, Díaz-Muñiz I, Dosti B, Smeianov V, Wechter W, Barabote R, Lorca G, Altermann E, Barrangou R, Ganesan B, Xie Y, Rawsthorne H, Tamir D, Parker C, Breidt F, Broadbent J, Hutkins R, O’Sullivan D, Steele J, Unlu G, Saier M, Klaenhammer T, Richardson P, Kozyavkin S, Weimer B, Mills D. 2006. Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. U.S.A 103:15611–15616.

6. McNulty NP, Yatsunenko T, Hsiao A, Faith JJ, Muegge BD, Goodman AL, Henrissat B, Oozeer R, Cools-Portier S, Gobert G, Chervaux C, Knights D, Lozupone CA, Knight R, Duncan AE, Bain JR, Muehlbauer MJ, Newgard CB, Heath AC, Gordon JI. 2011. The impact of a consortium of fermented milk strains on the gut microbiome of gnotobiotic mice and monozygotic twins. Sci Transl Med 3:106ra106.

7. Siezen RJ, Bayjanov J, Renckens B, Wels M, van Hijum SAFT, Molenaar D, van Hylckama Vlieg JET. 2010. Complete genome sequence of Lactococcus lactis subsp. lactis KF147, a plant-associated lactic acid bacterium. J. Bacteriol 192:2649–2650.

8. Wegmann U, O’Connell-Motherway M, Zomer A, Buist G, Shearman C, Canchaya C, Ventura M, Goesmann A, Gasson MJ, Kuipers OP, van Sinderen D, Kok J. 2007. Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256–70.

9. Notebaart RA, van Enckevort FHJ, Francke C, Siezen RJ, Teusink B. 2006. Accelerating the reconstruction of genome-scale metabolic networks. BMC Bioinformatics 7:296.

10. Pinto JPC, Zeyniyev A, Karsens H, Trip H, Lolkema JS, Kuipers OP, Kok J. 2011. pSEUDO, a genetic integration standard for Lactococcus lactis. Appl. Environ. Microbiol. 77:6687–6690.

11. Linares DM, Geertsma ER, Poolman B. 2010. Evolved Lactococcus lactis strains for enhanced expression of recombinant membrane proteins. J. Mol. Biol 401:45–55.

Chapter 6

168

12. Bijlsma JJE, Burghout P, Kloosterman TG, Bootsma HJ, de Jong A, Hermans PWM, Kuipers OP. 2007. Development of genomic array footprinting for identification of conditionally essential genes in Streptococcus pneumoniae. Appl. Environ. Microbiol. 73:1514–1524.

13. Molzen TE, Burghout P, Bootsma HJ, Brandt CT, van der Gaast-de Jongh CE, Eleveld MJ, Verbeek MM, Frimodt-Møller N, Østergaard C, Hermans PWM. 2011. Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis. Infect. Immun. 79:288–297.

14. Burghout P, Bootsma HJ, Kloosterman TG, Bijlsma JJE, de Jongh CE, Kuipers OP, Hermans PWM. 2007. Search for genes essential for pneumococcal transformation: the RADA DNA repair protein plays a role in genomic recombination of donor DNA. J. Bacteriol. 189:6540–6550.

15. Simon D, Chopin A. 1988. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie 70:559–566.

16. Solem C, Defoor E, Jensen PR, Martinussen J. 2008. Plasmid pCS1966, a new selection/counterselection tool for lactic acid bacterium strain construction based on the oroP gene, encoding an orotate transporter from Lactococcus lactis. Appl. Environ. Microbiol 74:4772–4775.

17. Pinto JPC, Kuipers OP, Marreddy RKR, Poolman B, Kok J. 2011. Efficient overproduction of membrane proteins in Lactococcus lactis requires the cell envelope stress sensor/regulator couple CesSR. PLoS ONE 6:e21873.

18. Kuipers OP, de Ruyter PGGA, Kleerebezem M, de Vos WM. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. Journal of Biotechnology 64:15–21.

19. De Ruyter PG, Kuipers OP, de Vos WM. 1996. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl. Environ. Microbiol 62:3662–3667.

20. Henrich B, Klein JR, Weber B, Delorme C, Renault P, Wegmann U. 2002. Food-grade delivery system for controlled gene expression in Lactococcus lactis. Appl. Environ. Microbiol 68:5429–5436.

21. Van Alen-Boerrigter IJ, Baankreis R, de Vos WM. 1991. Characterization and overexpression of the Lactococcus lactis pepN gene and localization of its product, aminopeptidase N. Appl. Environ. Microbiol 57:2555–2561.

22. Den Hengst CD, Curley P, Larsen R, Buist G, Nauta A, van Sinderen D, Kuipers OP, Kok J. 2005. Probing direct interactions between CodY and the oppD promoter of Lactococcus lactis. J. Bacteriol 187:512–521.

23. Marreddy RKR, Geertsma ER, Permentier HP, Pinto JPC, Kok J, Poolman B. 2010. Amino acid accumulation limits the overexpression of proteins in Lactococcus lactis. PLoS ONE 5:e10317.

24. Gasson MJ. 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol 154:1–9.

Upgrading the Toolkit of Lactococcus lactis

169

25. Mierau I, Kunji ER, Leenhouts KJ, Hellendoorn MA, Haandrikman AJ, Poolman B, Konings WN, Venema G, Kok J. 1996. Multiple-peptidase mutants of Lactococcus lactis are severely impaired in their ability to grow in milk. J. Bacteriol 178:2794–2803.

26. Exterkate FA. 1984. Location of Peptidases Outside and Inside the Membrane of Streptococcus cremoris. Appl. Environ. Microbiol 47:177–183.

27. Pédelacq J-D, Cabantous S, Tran T, Terwilliger TC, Waldo GS. 2006. Engineering and characterization of a superfolder green fluorescent protein. Nat. Biotechnol 24:79–88.

28. Lou C, Liu X, Ni M, Huang Y, Huang Q, Huang L, Jiang L, Lu D, Wang M, Liu C, Chen D, Chen C, Chen X, Yang L, Ma H, Chen J, Ouyang Q. 2010. Synthesizing a novel genetic sequential logic circuit: a push-on push-off switch. Mol. Syst. Biol 6:350.

29. Eberhardt A, Wu LJ, Errington J, Vollmer W, Veening J-W. 2009. Cellular localization of choline-utilization proteins in Streptococcus pneumoniae using novel fluorescent reporter systems. Mol. Microbiol 74:395–408.

30. Maguin E, Prévost H, Ehrlich SD, Gruss A. 1996. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931–935.

31. Maguin E, Duwat P, Hege T, Ehrlich D, Gruss A. 1992. New thermosensitive plasmid for gram-positive bacteria. J. Bacteriol 174:5633–5638.

32. Khan SA, Novick RP. 1983. Complete nucleotide sequence of pT181, a tetracycline-resistance plasmid from Staphylococcus aureus. Plasmid 10:251–259.

33. Otto R, Vos WM de, Gavrieli J. 1982. Plasmid DNA in Streptococcus cremoris Wg2: Influence of pH on Selection in Chemostats of a Variant Lacking a Protease Plasmid. Appl. Environ. Microbiol. 43:1272–1277.

34. Leenhouts KJ, Tolner B, Bron S, Kok J, Venema G, Seegers JF. 1991. Nucleotide sequence and characterization of the broad-host-range lactococcal plasmid pWVO1. Plasmid 26:55–66.

35. Kuipers OP, de Jong A, Baerends RJS, van Hijum SAFT, Zomer AL, Karsens HA, den Hengst CD, Kramer NE, Buist G, Kok J. 2002. Transcriptome analysis and related databases of Lactococcus lactis. Antonie Van Leeuwenhoek 82:113–122.

Chapter 6

170