Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
Undergradua te Educator Ne twork Webinar
Undergraduate Educator Network Webinar Series
(c) SOT2015
Sponsored by Undergraduate Education Subcommittee
SOT Education Committee December 15, 2015
1:00 PM ET
Undergradua te Educator Ne twork Webinar
Welcome
(c) SOT2015
Joshua Gray, PhD Chair, Undergraduate Subcommittee US Coast Guard Academy
Kristine Willett, PhD Co-Chair, Undergraduate Subcommittee UEN Webinar Moderator University of Mississippi
Undergradua te Educator Ne twork Webinar
Objectives Viewers will be able to: 1. Adopt up to three examples of the use of fish
(zebrafish and other types of fish) as model systems for undergraduate laboratory exercises focusing on toxicology.
2. Examine three examples of laboratory exercises that apply the process of science, quantitative reasoning (through dose-response relationships), evolution, and structure and function (through embryological development).
Undergradua te Educator Ne twork Webinar
Use of a Behavioral Assay to Determine the Chronic Effects of Chlorpyrifos on Developing
Zebrafish Larissa M. Williams, PhD
Assistant Professor Bates College Lewiston, ME
Extended protocols available in SOT Undergraduate Resource Curriculum
Undergradua te Educator Ne twork Webinar
(Zebra)Fish as Models in Developmental Toxicology
• Vertebrate animals • External development; small, transparent embryos • High fecundity; short life cycle • Genetic and genomic tools • Well-developed transgenic technologies • Paralogous genes from ancestral genome
duplication
Undergradua te Educator Ne twork Webinar
Behavioral Assays can be used as a Short Term Lab Project
• Illustrates principles of development, neurobiology, and toxicology
• Enables discussion and implementation of experimental design and data analysis
• Limited preparation necessary • Can be a stand alone lab and completed in
~3 hours
Undergradua te Educator Ne twork Webinar
Neurodevelopment in Zebrafish
http://sivelab.wi.mit.edu/Ongoing%20Projects2.htm
Undergradua te Educator Ne twork Webinar
Zebrafish Development and Behavior
http://journal.frontiersin.org/article/10.3389/fnbeh.2010.00036/full
Undergradua te Educator Ne twork Webinar
Do Widely used Environmental Chemicals Affect Development?
USGS.gov
Undergradua te Educator Ne twork Webinar
Organophosphate Mechanism of Action
http://depts.washington.edu/opchild/acute.html
Undergradua te Educator Ne twork Webinar
Supplies for the Lab • Adult zebrafish and IACUC approval • Danieau’s or E2 medium • Petri dishes, transfer pipets, and pipets • Chlorpyrifos • Dissecting scopes (and video capable
cameras) • 16-mm diameter cylinder • Computers for data analysis
Undergradua te Educator Ne twork Webinar
Day 1: Spawn zebrafish, collect embryos, start chronic dosing at 10 hpf Dosing regimes can be at single dose or multiple doses
Pre-Lab Protocol
Undergradua te Educator Ne twork Webinar
1. Stage embryos at 2, 3, 4, or 5 days post fertilization 2. Test at least five fish per treatment for five minutes 3. Count or videotape the number of crossings
Behavioral Assay
Figures from: Levin et al., 2004
Undergradua te Educator Ne twork Webinar
Data Analysis
• Graph number of segment crossings per: Age Dose Age x Dose
• Carry out statistical analysis
Figure from: Levin et al., 2004
Undergradua te Educator Ne twork Webinar
Student Deliverables
• Full lab report • Short summary • Results section • Oral presentation
Undergradua te Educator Ne twork Webinar
Questions….
Send to “All Panelists” via Q&A panel.
Undergradua te Educator Ne twork Webinar
A Multi-Week Toxicological Study using Zebrafish
(Danio rerio) as a Model Mindy Reynolds, PhD
Associate Professor Washington College
Chestertown, MD
Extended protocols available in SOT Undergraduate Resource Curriculum and The Journal of Toxicological Education. Reynolds, M. (2013) A Toxicological Study using Zebrafish (Danio rerio) as a model. http://darchive.mblwhoilibrary.org/handle/1912/6314
Undergradua te Educator Ne twork Webinar
Lab Activity Objectives • Introduce toxicological concepts
• Understand normal zebrafish development
from fertilization through 5 dpf
• Develop skills to formulate an independent hypothesis and design an experiment
• To write a scientific research proposal
Undergradua te Educator Ne twork Webinar
Zebrafish (Danio rerio)
http://pharyngula.org/~pzmyers/MyersLab/research/stages.jpg
Development is exceedingly fast!
Undergradua te Educator Ne twork Webinar
Getting Started
• Approval • IACUC
• Resources ZFIN: http://zfin.org/cgi-bin/webdriver?MIval=aa-ZDB_home.apg Westerfield, M., Zon, L., and Detrich, W. (2009) Essential Zebrafish Methods: Cell and Developmental Biology. Academic Press.
Undergradua te Educator Ne twork Webinar
Adult Tank Maintenance
• Water temperature: 82 ºF • Light/Dark Cycle:
14 hours light 10 hours dark
• Separate males and females (Zebrafish International Resource Center) • Daily water changes • Monitor ammonium • and nitrate levels • (Carolina Biological) • Feed 2-3 times day
http://www.naturalhistorymag.com/0606/images/zebrafish.jpg
Undergradua te Educator Ne twork Webinar
Breeding • Place 1-2 breeding pairs into breeding tank in early
evening. Separate males and females with divider
• Pull divider when lights turn on in morning
• Collect embryos 1-2 hours later and stage Clean and store in embryo media Maintain in an incubator at 28.6°C
http://www1.umn.edu/umnnews/img/assets/11502/larvae.jpg Carolina Biological
Undergradua te Educator Ne twork Webinar
Week 1 Normal Zebrafish Development
Purpose • Understand breeding, maintenance, and
development • Understand how use digital equipment for
analysis • Appreciate the exceedingly fast developmental
process
Assessment • Figure depicting stages of development
Undergradua te Educator Ne twork Webinar
Week 1 Normal Zebrafish Development Post
fertilization, hr 18 24 36 48
Undergradua te Educator Ne twork Webinar
Week 2 Zebrafish on Drugs
Purpose • To compare how exposure to various toxicants
effects overall development, behavior, notochord length, and dry weight.
• Understand basic statistical analysis
Assessment • Figure comparing control and two different
toxicant concentrations • Two figures examining notochord length, dry
weight, or mortality • Statistical analysis required
Undergradua te Educator Ne twork Webinar
Week 2 Zebrafish on Drugs
Treatments • All-trans retinoic acid (0.01, 0.1, 1, and 10 nM) • Ethanol (1, 2, and 3%) • Nicotine (10, 20, and 40 mM)
Undergradua te Educator Ne twork Webinar
Week 2 Zebrafish on Drugs
Undergradua te Educator Ne twork Webinar
Weeks 3-5 Independent Project
Purpose • Research a toxicant of their choice • Develop and write a formal research
proposal • Execute independent experiment • Present findings to the class
Assessment
• Searching and reading primary literature • Research design • Execution and collection of data • Presentation of findings
Undergradua te Educator Ne twork Webinar
Weeks 3-5 Independent Project
UT 10-10
Dea
d La
rvae
0
4
8
12
16
Accutane, M
*
10-7
* *
Not
ocho
rd L
engt
h, m
m
4
UT 10-10
Accutane, M 10-7
*
*
6
2
0
Undergradua te Educator Ne twork Webinar
Weeks 3-5 Independent Project
UT
Accutane 10-7M
Post fertilization, hr 12 24 48 5
Undergradua te Educator Ne twork Webinar
Overall Conclusion • Lab is designed for instructors with little to
no background experience with zebrafish • Lab introduces basic toxicological concepts
and the use of an in vivo model system
• Students become comfortable with experimental design and data analysis
Undergradua te Educator Ne twork Webinar
Questions….
Send to “All Panelists” via Q&A panel.
Undergradua te Educator Ne twork Webinar
Molecular Biology Lab Class as a Vehicle for Teaching Environmental Toxicology:
Cloning and Expression Analysis of
CYP1A cDNAs from Diverse Fish Species
Wade H. Powell Biology Department Kenyon College Gambier, OH USA
Undergradua te Educator Ne twork Webinar
BIOL 264: Gene Manipulation
• Intermediate lab course focused on skills development
• Weekly, 3-hour class. • Collaborative, semester-long group project. • Course-based research.
A “high-impact practice” Involves many students and makes science
more inclusive (Bangera and Bronwell, CBE Life Sc. Educ 2014. 13:602-606).
Undergradua te Educator Ne twork Webinar
BIOL 264: Gene Manipulation
• A project with toxicological relevance. • Students clone cDNAs encoding Cytochrome
P4501A (CYP1A) enzymes from fish. • They then use the sequences of the cDNA clones to:
1. Construct the phylogenetic history of the protein during vertebrate evolution.
2. Determine the effect of contaminant AHR agonists on the expression of the associated mRNAs.
Undergradua te Educator Ne twork Webinar
Learning Goals • Students gain experience in experimental
design, performance, and data analysis. • Technical experience includes:
Isolation, quantitation, and manipulation of nucleic acids.
Electrophoresis. Polymerase chain reaction. Measurement of mRNA expression. Bioinformatics and use of public sequence databases. Figure construction. Scientific writing.
Undergradua te Educator Ne twork Webinar
Cytochrome P4501A (CYP1A)
• Phase I monooxygenase with xenobiotic and endogenous substrates
• mRNA strongly induced by contaminant agonists of the aryl hydrocarbon receptor (AHR) Polycyclic aromatic hydrocarbons (e.g.,
benzo[a]pyrene, petroleum hydrocarbons) Planar halogenated aromatic hydrocarbons (e.g.,
chlorinated dioxins, PCBs)
Undergradua te Educator Ne twork Webinar
Cytochrome P4501A (CYP1A)
• Common to all vertebrates, including bony fish
• Multiple paralogs in many vertebrate groups e.g., CYP1A1 and CYP1A2 in mice and humans
• Most fish have a single CYP1A gene, but some have multiple paralogs
Undergradua te Educator Ne twork Webinar
CYP1A: A Useful Model for Undergraduate Molecular Biology Labs
• High mRNA expression level Facilitates cDNA cloning by inexperienced students using
RT-PCR
• Environmental Toxicology A useful biomarker of contaminant exposure.
• Molecular Evolution Questions about gene duplication provide an interesting
research question.
Undergradua te Educator Ne twork Webinar
Animal Collection and Exposure*
• Sources: Collected locally with minnow traps Local bait shops Gulf Specimen Marine Laboratories
• Exposures (16-24 h): IP: 10 ng/g TCDD in corn oil (5 ng/μl) Waterborne: (1 nM TCDD, 0.1% corn oil) Less toxic alternatives, e.g. β-NF
• MS-222 anesthesia; dissect and freeze organs
*All protocols approved by Kenyon College IACUC Photos: nanfa.org
Central stoneroller minnow (Campostoma anomalum)
Creek Chub (Semotilus atromaculatus)
Bluegill (Lepomis macrochirus)
Gulf killifish (Fundulus grandis)
Southern Redbelly Dace (Chrosomus erythrogaster)
Undergradua te Educator Ne twork Webinar
Total RNA Isolation and Analysis • RNA STAT-60 (Tel-Test CS-112; a
TRIZOL-type reagent).
• 100-200 mg of tissue allows all centrifugation steps to be performed in a microcentrifuge.
• This is the most hazardous activity of the semester. Training, gloves, coats, face shields are crucial.
• Assess integrity of total by electrophoresis. 5 µg/lane.
• Promega RNA markers (G3191). Package insert provides recipes for
denaturing load buffer and formaldehyde-free gels.
6853 4981 3638 2604
1908 1383 955 623
281
nt
28S
18S
1 2
Undergradua te Educator Ne twork Webinar
RT-PCR with Degenerate Primers • Students design degenerate primers based
on regions of amino acid conservation. Design principles outlined in Wilkie and Simon (1991).
• Additional primers are derived from Iwata and Stegeman (2000; “HI primers”). Based on nucleotide sequences well conserved between all teleosts.
• GeneAmp Gold RNA PCR Reagent Kit (Life Technologies N8080143).
• Reverse transcriptase reactions use 1 µg total RNA and random hexamer primers.
• PCR reactions use 1 µM degenerate primers, 45 cycles, 50˚ annealing temperature.
• HI primers produce a product of ~430 bp. Primers designed in class will produce products of various predictable sizes.
(-RT)
2000 1500 1000 750 500 250
bp
2 3 4 1 5
HI for/rev Student primers
HI-for: 5’-ACAAGGACAACATCCGTGAC-3’ HI-rev: 5’-TCATGGTTGATCTGCCACTG-3’
Undergradua te Educator Ne twork Webinar
Cloning the Amplified cDNA • Gel purify PCR products (QIAquick Gel
Extraction Kit; QIAGEN 28704).
• Clone into pGEM-T Easy (Promega). TA cloning Blue/White Screening
• Transform ligations into chemically competent JM109 cells (Promega).
• Plate on LB agar containing 100 µg/ml ampicillin, 0.1 mM IPTG, and 40 µg/ml X-Gal).
• Grow 8-10 White colonies in 5 ml liquid LB with 100 µg/ml ampicillin. Plasmid minipreps are performed using the QIAprep kit (QIAGEN 27104).
Promega pGEM-T Easy
Colonies resulting from a blue/white cloning screen.
Undergradua te Educator Ne twork Webinar
Cloning the Amplified cDNA • Screen minipreps for insert size
by EcoRI digestion and electro-phoresis on 1% agarose/1X TAE.
• Plasmids containing an insert of predicted size are sequenced.
• A central repository (LIMS) for results can be shared with students for bioinformatic analysis.
• Sequence 2-3 miniprep DNAs per pair of students (15-30 clones per class section).
2000 1500 1000
750 500
250
bp
3000 4000 Vector
(~3000 bp)
Insert (~440 bp)
white colonies
Undergradua te Educator Ne twork Webinar
Sequence Analysis: BLAST, Alignments, and Molecular Phylogenies Important questions students resolve:
Q: Have you cloned a CYP1A cDNA? What is the specific orthology of your cDNA(s)? How will that affect naming?
BLAST search, phylogeny of amino acid sequences
Q: Are your clones identical, or do they differ in nucleotide or amino acidsequence?
Clustal alignments.
Q: Any evidence for multiple CYP1A genes in the species? How much sequence divergence would indicate multiple genes? What other types of evidence would you want to be sure?
Undergradua te Educator Ne twork Webinar
Sequence Analysis: BLAST, Alignments, and Molecular Phylogenies
Bioinformatics Resources Many web-based tools for contig assembly, translation, alignment, and phylogenies are freely available. These change constantly. Encourage students to explore and find what they need!
www.expasy.org ncbi.nlm.nih.gov www.bioinformatics.org www.clustal.org
Amino acid alignment of fish CYP1As
Phylogeny of vertebrate CYP1As. Neighbor-joining tree generated in Clustal X and visualized with TreeView.
Undergradua te Educator Ne twork Webinar
mRNA Expression Analysis • Examine expression of the mRNA encoded by the student-generated CYP1A
clone(s).
• Experiment is built around a story from a contaminated site. • Use CYP1A expression as a biomarker of exposure.
• Oil and fuel spills (local marinas and Deepwater Horizon) have garnered student interest.
• Uses liver or gill from unexposed, TCDD-exposed or field-collected animals. • Actual collections from potentially contaminated sites are preferred, but not
necessary; exposures can also happen behind the scenes in the laboratory.
• cDNA synthesis: TaqMan Reverse Transcription Reagents (LifeTech N8080234). Treat total RNA with DNase (Ambion, DNAfree Turbo) to remove residual genomic DNA.
• PCR: Power SYBR Green PCR Master Mix (LifeTech 4368702). ABI 7500 Real Time PCR instrument.
• Clean, uncontaminated work areas and pipettors are crucial! We use laminar flow hoods and cross-link all pipetmen with a UV Stratalinker (Stratagene) before use.
Undergradua te Educator Ne twork Webinar
mRNA Expression Analysis • PCR primers as designed by students
in advance based on their sequences.
• Universal primers for 18S rRNA are used for the endogenous control.
18Sfor: AAACGGCTACCACATCCAAG 18Srev: CCTCCAATGGATCCTCGTTA
• Threshold cycle (Ct) is determined from amplification plots.
• Relative abundance of CYP1A mRNAs is calculated using the ∆∆Ct method.
Wolf Run +TCDD
-TCDD
CYP1A
Undergradua te Educator Ne twork Webinar
Typical Course Schedule
Insert background info here
Week Activity Week Activity 1 Check-in; introduction 8 Transformations; Writing Workshop II-
peer review of recent assignment. 2 Isolate total RNA 9 Plasmid Minipreps; restriction digest 3 RNA electrophoresis.
Degenerate Primer Design 10 Electrophoresis of digested plasmids;
Prepare for sequencing.
4 Bioinformatics Workshop: Databases and Construction of Phylogenetic Trees
11 Introduction to Real-Time PCR; Primer Design; Sequence analysis
5 RT-PCR 12 cDNA synthesis; organize PCR reactions
6 Electrophoresis of RT-PCR products; Writing Workshop I-published papers.
13 Real Time PCR Reactions
7 Gel purification and ligation 14 Data Analysis and Check-out
Undergradua te Educator Ne twork Webinar
Final Assignment: Scientific Manuscript
Students use cloning, sequence analysis, and expression data to craft a manuscript. Each student can choose the focus:
1. An environmental toxicology paper
• Focuses on CYP1A expression in fish from the contaminated site.
• Cloning and phylogenies are important elements of biomarker development.
2. A molecular evolution paper. • Focuses on the orthology and number of CYP1As. • Expression data provide important evidence that the sequence is
actually a CYP1A.
Undergradua te Educator Ne twork Webinar
Reflections • Molecular biology lab courses offer excellent opportunities to address
topics and techniques of toxicological significance.
• Special value for life sciences programs that lack specific toxicology courses.
• CYP1A, which is strongly induced by exposure to numerous environmental contaminants, is especially well suited for cloning and expression studies.
• Course-based research is a high-impact practice that make science more inclusive.
• Student surveys indicate that they overwhelmingly value a lab class centered on a single research project. They also value the broadly transferable skills developed in this course.
• Approximately 78% of Biochemistry/Molecular Biology majors in this course go on to have significant research experiences at Kenyon College and/or elsewhere (2002-2012).
Undergradua te Educator Ne twork Webinar
References and Additional Resources • Berndtson, A.K., T.T. Chen. 1994. Two unique CYP1 genes
are expressed in response to 3- methylcholanthrene treatment in rainbow trout. Arch Biochem Biophys; 310:187–95.
• Goldstone, Heather M. H., and John J. Stegeman. 2006. A Revised Evolutionary History of the CYP1A Subfamily: Gene Duplication, Gene Conversion, and Positive Selection. J Molec Evol 62.6: 708-17
• Hogg, K. 2014. A primer for designing degerate primers. http://bitesizebio.com/18992/a-primer-for-designing-degenerate-primers/
• Mahata, Shyamal C., Ryoichi Mitsuo, Jun-Ya Aoki, Hironori Kato, and Takao Itakura. 2003. Two Forms of Cytochrome P450 CDNA from 3-methylcholanthrene-treated European Eel Anguilla anguilla. Fisheries Sci 69.3: 615-24.
Undergradua te Educator Ne twork Webinar
References and Additional Resources, cont’d
• Powell, W.H. 2005. "Real Time PCR: Sample Data." http://biology.kenyon.edu/HHMI/Real_Time_PCR/Sample_Data.htm.
• Powell, W.H. 2007. Comparison of Protein Sequences: BLAST Searching and Phylogenetic Tree Construction. Inquiry-based Integrated Instructional Unit, Teaching Genomics at Small Colleges Workshop, Vassar College. http://serc.carleton.edu/genomics/units/19100.html
• Whitehead, A., et al. 2011. Genomic and physiological footprint of the Deepwater Horizon oil spill on resident marsh fishes. PNAS 109:20298-20202.
• Wilkie, TM and MI Simon 1991. Cloning Multigene Families with Degenerate PCR Primers. Methods: A companion to Meth Enzymol 2:32-41
Undergradua te Educator Ne twork Webinar
Questions and Comments
Send to “All Panelists” via Q&A panel.
Undergradua te Educator Ne twork Webinar
SOT Undergraduate Toxicology curriculum Resources
www.toxicology.org/education/edu/resources.asp
Undergradua te Educator Ne twork Webinar
Undergraduate Educator Network Webinars
• Using Open Source Biological Pathway Databases for Education and Discovery
• Evidence-Based Instructional Practices in Undergraduate Science Courses
• The Use of Technology to Teach Toxicology and Related Disciplines
• Education and Enrichment Activities for Educators
• Having It All: Teaching, Research, and Service at a Small Liberal Arts College: A Toxicologist’s Perspective
www.toxicology.org/education/edu/ugWebinars.asp
Undergradua te Educator Ne twork Webinar
Questions and Comments
Send to “All Panelists” via Q&A panel.
Undergradua te Educator Ne twork Webinar
(c) SOT2015
Undergraduate Educator Network Webinar Series Thank you for participating!