Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction

© Julien Chaillot, 2019

Étude de l'homéostasie de la taille chez la levure opportuniste Candida albicans

Thèse

Julien Chaillot

Doctorat en biologie cellulaire et moléculaire

Philosophiæ doctor (Ph. D.)

Québec, Canada

III

Résumé

L’homéostasie de la taille est un processus important de la prolifération

cellulaire mais les mécanismes moléculaires sont mal compris. Les cellules

eucaryotes doivent atteindre une taille seuil avant la division, ce qui

permet de maintenir une taille constante sur le long terme. Ce processus

est régulé à un point de contrôle, à la fin de la phase G1, appelé START

chez les levures. Le contrôle de la taille cellulaire a été étudié chez la levure

modèle Saccharomyces cerevisiae mais n’a jamais été étudié chez les

levures pathogènes. Dans cette thèse, nous avons utilisé Candida albicans

comme organisme modèle pour étudier la régulation de la taille chez les

levures opportunistes. Nous avons criblé des collections de mutants de

délétions hétérozygotes et homozygotes de C. albicans afin d’identifier des

gènes régulateurs de la taille.

Nous avons analysé la distribution de taille de 279 mutants homozygotes

et 4 348 mutants hétérozygotes (recouvrant 90% du génome). Nous avons

comparé nos résultats à différents criblages effectués sur la levure modèle

S. cerevisiae. Ces comparaisons montrent que peu de régulateurs sont

conservés entre C. albicans et S. cerevisiae et que la régulation de la taille

est processus très plastique.

Par exemple, le mutant dot6 a un phénotype petit chez C. albicans mais

n’a pas de phénotype de taille chez S. cerevisiae. Nous avons montré que

Dot6 est un facteur de transcription nécessaire pour l’activation des gènes

de la biogénèse des ribosomes. Dot6 est également un régulateur de

START et joue un rôle dans l’adaptation de la taille suivant les sources de

carbone disponibles.

Nous avons également mis en évidence un nouveau rôle pour la protéine

kinase Hog1/p38 dans la régulation de la taille chez C. albicans en

IV

absence de stress. Ce rôle n’a jamais été démontré chez S. cerevisiae. Nous

avons montré que Hog1, ainsi que toute la voie HOG, sont des régulateurs

négatifs de START. Nous avons mis en évidence que Hog1 régule à la fois

la croissance cellulaire via Sfp1, un régulateur majeur de la biogénèse des

ribosomes et des protéines ribosomales, et le cycle cellulaire via le

complexe SBF (Swi4/Swi6), des facteurs de transcription nécessaires pour

la transition G1/S.

Nous avons également découvert qu’Ahr1, un facteur de transcription

n’ayant pas d’orthologue chez S. cerevisiae, est nécessaire pour la

régulation de la taille et aussi requis pour l’adaptation de la taille en

fonction des acides aminés disponibles. Nous avons montré qu’Ahr1 agit

dans la voie Tor1-Sch9 et régule négativement START.

En conclusion, notre travail a permis de découvrir de nouveaux

régulateurs de START, de caractériser leur fonction et de les placer dans

différentes voies. Comme la dérégulation de la voie Hog1/p38 est associée

à des pathologies humaines, nous proposons C. albicans comme

organisme modèle pour l’étude de cette voie et son implication dans

l’homéostasie de la taille chez les organismes eucaryotes.

V

Abstract

Cell size homeostasis is an important process of cell proliferation but the

molecular mechanisms are poorly understood. Eukaryotic cells must reach

a threshold size before entering the cell cycle, which helps to maintain a

constant size over the long term. This process is regulated at the end of the

G1 phase, a check point called START. Cell size control has been studied

in the model yeast Saccharomyces cerevisiae but has never been studied in

pathogenic fungi. In this thesis, we used Candida albicans as a model

organism to study the regulation of size in pathogenic yeasts. We have

screened heterozygous and homozygous deletion collections of C. albicans

to identify genes that control cell size.

We analyzed the size distribution of 279 homozygous mutants and 4,348

heterozygous mutants (covering 90% of the genome). We compared our

results with different screens performed on the model yeast S. cerevisiae.

These comparisons showed that few regulators were conserved between S.

cerevisiae and C. albicans and suggesting that the cell size regulation is

evolutionary plastic.

For example, dot6 mutant has a small phenotype in C. albicans but has no

size phenotype in S. cerevisiae. We have shown that Dot6 is a

transcriptional factor necessary for the activation of ribosome biogenesis

genes. Dot6 is also a regulator of START and plays a critical role in

adapting size according to the carbon sources available in the medium.

We also uncovered a novel stress-independent role of the Hog1/p38 MAPK

in size regulation in C. albicans a role that has never been demonstrated in

S. cerevisiae. We have shown that Hog1, as well as the entire HOG

pathway, are negative regulators of START. We have shown that Hog1

regulates both growth via Sfp1, a major transcriptional regulator of

VI

ribosomal biogenesis and ribosomal proteins, and the cell cycle via the

SBF complex (Swi4/Swi6), transcriptional factors necessary for the G1/S

transition.

We also found that Ahr1, a transcription factor with no obvious ortholog in

S. cerevisiae, has a role for the adaptation of the size according to the

amino acids available in the medium. We have shown that Ahr1 is a

negative START regulator and is controlled by the Tor1-Sch9 pathway.

In conclusion, our work has permitted to discover new regulators of

START, to characterise their function and to map them in different

pathways. As the Hog1/p38 pathway is linked to many human

pathologies, we think that C. albicans is a useful model to study of this

pathway and dissect its role in size control in eukaryotes.

VII

Table des matières

Résumé .................................................................................................. III

Abstract .................................................................................................. V

Table des matières ................................................................................. VII

Liste des figures ....................................................................................... X

Liste des tableaux ................................................................................... XI

Liste des abréviations et des sigles ......................................................... XII

Remerciements ..................................................................................... XVI

Avant-propos ...................................................................................... XVIII

Introduction ............................................................................................. 1

Chapitre 1 - Genome-wide screen for haploinsufficient cell size genes in the opportunistic yeast Candida albicans. ............................................... 40

1.1 - Résumé .................................................................................... 40

1.2 - Article ....................................................................................... 41

1.2.1 - Abstract ........................................................................... 42

1.2.2 - Introduction ..................................................................... 43

1.2.3 - Materials and methods ..................................................... 45

1.2.4 - Results and discussion ..................................................... 50

1.2.5 - Acknowledgments ............................................................ 56

1.2.6 - References ........................................................................ 57

1.2.7 - Figures ............................................................................. 61

Chapitre 2 - The p38/HOG stress-activated protein kinase network couples growth to division in Candida albicans. ...................................... 63

2.1 - Résumé .................................................................................... 63

2.2 - Article ....................................................................................... 64

2.2.1 - Abstract ........................................................................... 65

2.2.2 - Introduction ..................................................................... 66

2.2.3 - Results ............................................................................. 70

2.2.4 - Discussion ....................................................................... 80

2.2.5 - Methods ........................................................................... 86

2.2.6 - Acknowledgments ............................................................ 90

2.2.7 - References ........................................................................ 91

2.2.8 - Figures ........................................................................... 102

VIII

Chapitre 3 - Integration of growth and cell size via the TOR pathway and the Dot6 transcription factor in Candida albicans. ................................ 114

3.1 - Résumé .................................................................................. 114

3.2 - Article ..................................................................................... 115

3.2.1 - Abstract ......................................................................... 116

3.2.2 - Introduction ................................................................... 117

3.2.3 - Materials and Methods ................................................... 120

3.2.4 - Results ........................................................................... 126

3.2.5 - Discussion ..................................................................... 133

3.2.6 - Acknowledgments .......................................................... 137

3.2.7 - References ...................................................................... 138

3.2.8 - Figures ........................................................................... 143

Chapitre 4 - Caractérisation d’un nouveau régulateur de la taille : Ahr1 .. ..................................................................................... 155

4.1 - Le mutant ahr1 présente un phénotype de petite taille ............ 155

4.2 - Ahr1 est un régulateur négatif de START ................................ 158

4.3 - Ahr1 interagit génétiquement et physiquement avec Sch9 ....... 160

4.4 - Ahr1 régule la croissance suivant les acides aminés disponibles....

................................................................................................. 162

4.5 - La localisation d’Ahr1 est régulée par la voie TOR.................... 165

4.6 - Discussion .............................................................................. 168

4.7 - Matériels et Méthodes ............................................................. 171

Chapitre 5 - Discussion générale et perspectives ............................... 175

5.1 - Conservation des mécanismes du contrôle de la taille cellulaire .... ................................................................................................. 177

5.2 - La régulation de la taille cellulaire est un processus évolutif plastique ........................................................................................... 179

5.2.1 - Rôle de Hog1 dans le contrôle de la taille cellulaire ......... 180

5.2.2 - Rôle de Dot6 dans le contrôle de la taille cellulaire .......... 182

5.2.3 - Rôle de Ahr1 dans le contrôle de la taille cellulaire ......... 185

5.3 - Lien entre nutriments et taille cellulaire .................................. 186

5.4 - Lien entre virulence et taille cellulaire ..................................... 187

5.5 - C. albicans – Organisme modèle .............................................. 189

Conclusion ........................................................................................... 191

Bibliographie ........................................................................................ 193

IX

Annexe 1 - The monoterpene carvacrol generates endoplasmic reticulum stress in the pathogenic fungus Candida albicans ................................. 212

Résumé ............................................................................................. 212

Article ................................................................................................ 213

Abstract ........................................................................................ 214

Introduction .................................................................................... 215

Materials and methods.................................................................... 217

Results ........................................................................................ 221

Discussion ...................................................................................... 227

Acknowledgments ........................................................................... 229

References ...................................................................................... 230

Figures ........................................................................................ 236

Annexe 2 - pH-dependant antifungal activity of valproic acid against the Human fungal pathogen Candida albicans ............................................ 244

Résumé ............................................................................................. 244

Article ................................................................................................ 245

Abstract ........................................................................................ 246

Introduction .................................................................................... 247

Materials and methods.................................................................... 250

Results ........................................................................................ 255

Discussion ...................................................................................... 261

References ...................................................................................... 265

Figures ........................................................................................ 270

X

Liste des figures

Figure 1 - Modèles de régulation de la taille cellulaire 3 Figure 2 - Principe du Coulter Counter 4 Figure 3 - Modèle de régulation de la taille bactérienne par DnaA 6 Figure 4 - Régulation des gènes RiBi et RP 10 Figure 5 - Cycle cellulaire de S. cerevisiae 11 Figure 6 - Processus de la transition G1/S 12 Figure 7 - Corrélation négative entre la taille et le temps passé en G1 13 Figure 8 - Régulation de la taille chez S. pombe 17 Figure 9 - Diversité de la taille de Cryptococcus neoformans 21 Figure 10 - Phylogénie des clades Candida et Saccharomyces 24 Figure 11 - Formes morphologiques de C. albicans 28

Figure 12 - C. albicans en forme pseudohyphe, levure et hyphe 30 Figure 13 - Formes phénotypiques de C. albicans 32 Figure 14 - Distribution de la taille du mutant ahr1 156 Figure 15 - Courbes de croissance du mutant ahr1 et du WT 157 Figure 16 - Taille des hyphes du mutant ahr1 et du révertant 158 Figure 17 - Budding index du mutant ahr1 et du WT 159 Figure 18 - Expression de RNR1 et PCL2 en fonction de la taille 159 Figure 19 - Intéraction génétique entre SCH9 et AHR1 161 Figure 20 - Coimmunoprécipitation entre Ahr1 et Sch9 162 Figure 21 - Analyse transcriptionnelle du mutant ahr1 163 Figure 22 - Temps de doublement des mutants ahr1 et sch9 164 Figure 23 - Taille cellulaire en fonction du temps de doublement 165 Figure 24 - Photos de microscopie d’une souche exprimant Ahr1-GFP 166 Figure 25 - Modèle de la régulation de START 169 Figure 26 - Interaction génétique entre Nrm1 et le complexe SBF 178 Figure 27 - Effet de la doxycycline sur la taille du mutant dot6 185

XI

Liste des tableaux

Tableau 1 - Oligonucléotides utilisées dans cette étude 173 Tableau 2 - Souches utilisées dans cette étude 174

XII

Liste des abréviations et des sigles

ADN Acide désoxyribonucléique

Ahr1 Adhesion and Hyphal Regulator

AmB Amphotéricine B

ARN Pol Acide Ribonucléique Polymerase

ARNm Acide Ribonucléique messager

ATP Adenosine Triphosphate

bp base pair

Ca Candida albicans

CDK Cyclin-Dependant Kinase

CFU Colony-Forming Unit

CGD Candida Genome Database

CHI Complex happloinsuffisiency

ChIP Chromatin immunoprecipitation

CRISPR Clustered Regularly Interspaced Short Palindromic Repeats

CSP Caspofungine

CTZ Clotrimazole

CWI Cell Wall Integrity

DAPI 4',6-diamidino-2-phénylindole

DBC Double Barcode

DMSO diméthylsulfoxyde

DNA Deoxyribose Nucleic Acid

ds Double Strand

dNTP DeoxyNucleotide TriPhosphate

DO Densité Optique

Dot6 Disruptor Of Telomeric silencing

DTT Dithiothréitol

ER Endoplasmic Reticulum

F Forward

FACS Fluorescence-activated cell sorting

XIII

FCZ Fluconazole

FDR False Discovery Rate

FIC Fractional Inhibitory Concentration

FISH Fluorescence In Situ Hybridization

FITC Fluorescein isothiocyanate

fL femtolitre

G1 Gap 1

G2 Gap 2

G3 Genes, Genomes, Genetics

GFP Green Fluorescent Protein

GRACE Gene Replacement And Conditional Expression

GO Gene Ontology

GSEA Gene Set Enrichment Analysis

GTP Guanosine Triphosphate

GUT Gastrointestinally induced Transition

HA human influenza hemagglutinin

HCGP Haploid deletion Chemical-Genetic Profiling

HDAC Histone Deacetylase

HIV Human Immunodeficiency Virus

Hog1 High Osmolarity Glycerol response

IGF Insulin-like Growth Factor

ITZ Itraconazole

Kog1 Kontroller Of Growth

Lge Désigne un phénotype de grande taille

LDH Lactate Deshydrogénase

M Mitosis

MAPK Mitogen-activated protein kinases

Mb Megabase

MBF MCB-binding factor

MCF Micafungine

MCZ Miconazole

XIV

mg milligramme

MIC Minimum Inhibitory Concentration

Min minutes

mL millilitre

mM millimolaire

MM Milieu Minimum

MoA Mechanism of Action

mTOR mechanistic Target Of Rapamycin

ND Non determined

ng nanogramme

NS Non Significatif

ORF Open Reading Frame

OriC Origine de réplication d’E. coli

PAC Polymerase A and C

PalmC palmitoylcarnitine

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

pg picogramme

pH Potentiel Hydrogène

PKA Protein Kinase A

PI Propidium Iodide

PI3K phosphatidylinositol 3-kinase

PMSF Fluorure de phénylméthylsulfonyle

PVDF PolyVinyliDene Fluoride

R Reverse

Rb Retinoblastoma protein

RiBi Ribosome Biogenesis

RNA Ribonucleic acid

RP Ribosomal Protein

RPMI Roswell Park Memorial Institute medium

S Synthesis

XV

SARM Staphylococcus aureus Résistant à la Méticilline

SBF SCB-binding factor

Sc Saccharomyces cerevisiae

SC Synthetic Complete

SCB SBF cell-cycle box

SD Standard deviation

SDS dodécylsulfate de sodium

Sec Seconde

SGD Saccharomyces Genome Database

SIDA Syndrome d'Immuno Déficience Acquise

SILAC Stable Isotope Labeling by Amino acids in Cell culture

Tco89 Tor Complex One

TCZ Teroconazole

TGF Transforming Growth Factor

Tod6 Twin Of Dot6

TOR Target Of Rapamycin

TRB Terbinafine

µg microgramme

µM micromollaire

UPR Unfolded Protein Response

VPA Valproic Acid (Acide valproïque)

VVC Vulvovaginal Candidiasis

WGD Whole Genome Duplication

Whi Désigne un phénotype de petite taille

WT Wild Type

XTT tetrazolium salt

YPD Yeast Peptone Dextrose

XVI

Remerciements

Je tiens à remercier mon directeur de thèse, Dr Adnane Sellam, de m’avoir

accueilli dans son laboratoire et pour son soutien tout au long de mon

doctorat.

Je remercie également tous les membres de l’équipe avec qui j’ai travaillé

pendant toutes ces années : Anaïs Burgain, Faiza Tebbji, Carlos Garcia,

Emilie Pic et Inès Khemiri.

Merci à Julie-Christine Lévesque pour son aide en microscopie et en

cytométrie.

Je remercie les coauteurs qui ont participé aux projets publiés dans cette

thèse : Mike Tyers (Université de Montréal), Jaideep Mallick (Université de

Montréal), Michael A. Cook (Samuel Lunenfeld Research Institute) et

Jacques Corbeil (Université Laval) ; ainsi que tous les collaborateurs qui

nous ont fourni des souches et des plasmides : Catherine Bachewich

(Université Concordia), Joachim Ernst (Université de Düsseldorf), Joseph

Heitman (Université de Duke), Julia Köhler (Boston Children's Hospital),

Daniel Kornitzer (Technion), Christian Landry (Université Laval), Robbie

Loewith (Université de Genève), Aaron Mitchell (Université Carnegie

Mellon), André Nantel (National Research Council Canada), Suzanne Noble

(Université de Californie à San Francisco), Janet Quinn (Université de

Newcastle), Dominique Sanglard (Université de Lausanne), Ana Traven

(Université Monash), Jonathan Thorner (Université de Californie Riverside)

et Malcolm Whiteway (Université Concordia).

Je remercie également les membres du jury, Christian Landry, Hugo

Wurtele et Yves Bourbonnais d’avoir accepté d’évaluer mon manuscrit et

ma soutenance de thèse.

XVII

Enfin, je remercie mes parents, Jean-Yves et Marie Dominique, mon frère

David ainsi que ma conjointe Carolina d’être présents pour moi.

XVIII

Avant-propos

L’article du chapitre 1 est intitulé “Genome-Wide Screen for

Haploinsufficient Cell Size Genes in the Opportunistic Yeast Candida

albicans”. Il a été publié le 9 février 2017 dans le journal G3 (Genes,

Genomes, Genetics). Je suis le premier auteur de cet article. J’ai effectué

les vérifications de taille pour valider le criblage et j’ai participé à l’analyse

des résultats. Michael Cook et Jacques Corbeil ont participé aux analyses

bioinformatiques du séquençage. Adnane Sellam a déterminé le « Budding

Index », a participé à l’analyse des résultats, a rédigé l’article et a supervisé

le projet.

L’article du chapitre 2 est intitulé “The p38/HOG stress-activated protein

kinase network couples growth to division in Candida albicans. Cet article

a été publié en mars 2019 dans le journal Plos Genetics. J’ai effectué une

partie du criblage et les tests d’interaction génétique. Adnane Sellam et

Julien Richard Albert ont réalisé le criblage. Jaideep Malick a réalisé les

co-immunoprécipitations. Michael A Cook a réalisé les analyses bio-

informatiques. Faiza Tebbji a réalisé les ChIP-chip. Adnane Sellam est le

premier auteur de cet article. Il a réalisé les puces à ADN, les ChIP-chip,

les ChIP-qPCR, a rédigé l’article et a supervisé le projet avec Mike Tyers.

L’article du chapitre 3 est intitulé “Integration of Growth and Cell Size via

the TOR Pathway and the Dot6 Transcription Factor in Candida albicans”.

Il a été publié en février 2019 dans le journal Genetics. Je suis le premier

auteur de cet article. J’ai créé les souches nécessaires pour l’étude, j’ai fait

les tests d’interactions génétiques, les expériences de microscopie, les

courbes de croissance, déterminer la distribution de taille des souches et

j’ai participé à la rédaction de l’article. Jaideep Malick et Faiza Tebbji ont

réalisé les Western-Blot. Adnane Sellam a réalisé les puces à ADN, les RT-

XIX

qPCR et la détermination des « Budding Index ». Il a également rédigé

l’article et supervisé le projet.

Le chapitre 4 est intitulé « Caractérisation d’un nouveau régulateur de la

taille : Ahr1 ». Ce chapitre présente des résultats non publiés. Adnane

Sellam a réalisé les puces ADN et la détermination du « Budding Index ».

Jaideep Malick a réalisé l’expérience de co-immunoprécipitation. J’ai créé

les mutants utilisés dans l’étude, fait les analyses de cytométrie en flux, de

microscopie ainsi que les courbes de croissance et déterminé la

distribution de taille des souches.

L’article de l’annexe 1 est intitulé « The Monoterpene Carvacrol Generates

Endoplasmic Reticulum Stress in the Pathogenic Fungus Candida

albicans ». Il a été publié le 26 mai 2015 dans le journal Antimicrobial

Agents & Chemotherapy. Je suis co-premier auteur de l’article avec Faiza

Tebbji. J’ai réalisé les expériences de microscopie, les RT-PCR et les tests

de synergisme. Faiza Tebbji a réalisé les tests de sensibilité au carvacrol.

Charles Boone, Mohamed Bellaoui et Grant Brown ont réalisé les essais

chemogénétiques sur les souches haploïdes de Saccharomyces cerevisiae.

Mohamed Bellaoui et Adnane Remmal sont les premiers à avoir observé

l’effet du carvacrol sur S. cerevisiae et C. albicans. Adnane Sellam a

supervisé le projet et a rédigé l’article.

L’article de l’annexe 2 est intitulé « pH-Dependant Antifungal Activity of

Valproic Acid against the Human Fungal Pathogen Candida albicans ». Il a

été publié le 9 octobre 2017 dans le journal Frontiers in Microbiology. Je

suis le premier auteur de cet article. J’ai réalisé les tests de sensibilité à

l’acide valproïque, les tests de synergismes et la microscopie confocale.

Faiza Tebbji a réalisé les expériences testant l’effet protecteur du VPA sur

des cellules épithéliales humaines. Carlos Garcia a évalué l’efficacité du

VPA sur les souches cliniques résistantes et sur les biofilms. René Pelletier

XX

a fourni les souches cliniques. Adnane Sellam a supervisé le projet et a

rédigé l’article.

J’ai également participé à l’article « A phenotypic small-molecule screen

identifies halogenated salicylanilides as inhibitors of fungal

morphogenesis, biofilm formation and host cell invasion.” Les auteurs sont

Carlos Garcia, Anaïs Burgain, Émilie Pic, Inès Khemiri et Adnane Sellam.

L’article a été publié le 1er aout 2018 dans le journal Scientific Reports. Cet

article ne sera pas discuté dans cette thèse (Garcia et al. 2018).

1

Introduction

L’homéostasie de la taille

Généralités

Les organismes vivants ont une différence de masse allant de moins de

0,1pg (par exemple les mycoplasmes) à plus de 1 000 tonnes (par exemple

les séquoias). Il y a donc une différence de l’ordre de 1022. Parmi les

espèces unicellulaires, la différence de masse est de l’ordre de 109, les plus

petites étant les mycoplasmes et les plus grandes les amibes. Dans un

même organisme, la taille de différents types de cellules varient

grandement, de quelques micromètres pour les cellules sanguines chez

l’Homme, jusqu’à un mètre pour les neurones, par exemple.

La taille d’une cellule est limitée par sa surface. Plus une cellule est

grande, plus le rapport surface/volume diminue, ce qui est un

désavantage pour les échanges entre la cellule et le milieu extérieur. La

taille est également limitée par la diffusion passive. En effet, la diffusion

passive (des nutriments ou de l’oxygène), est inefficace sur des longues

distances (Schulz and Jorgensen 2001), une taille optimale semble donc

être nécessaire pour assurer les échanges entre la cellule et le milieu

extérieur ainsi que pour le transport intracellulaire. Par exemple, certains

processus comme la transcription ou la traduction se réalisent

généralement proche du centre de la cellule, ce qui peut créer un gradient

de métabolites ou de nutriments dans les cellules de grande taille.

Dans une population de cellules en division, il y a habituellement peu de

variation de taille. Si la distribution de la taille est modifiée, par exemple

par un changement de nutriment, la distribution de taille revient à celle

précédent le changement. Ces observations indiquent que les cellules en

division contrôlent leurs tailles de façon active et en réponse à

2

l’environnement. Ces observations montrent aussi que les cellules

adaptent leurs tailles suivant l’environnement, probablement pour

optimiser le rapport surface/volume afin de favoriser les échanges avec le

milieu extérieur. De plus, ceci suggère qu’il y a une coordination entre les

processus contrôlant la croissance (biomasse) et la division afin de

maintenir la taille.

La taille cellulaire dépend également de la ploïdie. Par exemple la levure

Saccharomyces cerevisiae est plus petite en phase haploïde qu’en phase

diploïde. Ce phénomène pourrait être expliqué par le fait que

l’augmentation de la ploïdie augmente également le taux de transcription,

puis le taux de traduction et ainsi la cellule produit plus de masse.

L’augmentation de la ploïdie est une stratégie utilisée chez l’Homme pour

former des cellules géantes. Par exemples, les mégacaryocytes augmentent

la ploïdie pour former des cellules de 100µm de diamètre. Ensuite, ces

cellules se fragmentent pour former des thrombocytes (Mazzi et al. 2018).

Conceptuellement, l’homéostasie de la taille peut être régulée de

différentes façons (Figure 1) :

-par un mécanisme « Timer » dans lequel la division se produit après un

temps fixe depuis la naissance de la cellule fille.

-par un mécanisme « Adder » dans lequel la cellule ajoute un volume

constant après chaque division (Taheri-Araghi et al. 2015).

-par un mécanisme « Sizer » dans lequel la cellule fille doit atteindre une

taille seuil pour se diviser.

3

Figure 1 – Modèles de régulation de la taille cellulaire. Dans le modèle « Timer », la

cellule grossit pendant un temps fixe avant de se diviser. Dans le modèle « Adder », la

cellule ajoute un volume constant avant de se diviser, indépendamment de la taille à la

naissance. Dans le modèle « Sizer », la cellule doit atteindre une taille seuil avant de se

diviser, indépendamment de la taille de la cellule à la naissance (Varsano, Wang, and Wu

2017).

Techniques pour l’analyse de la taille cellulaire

Coulter Counter

Le Coulter Counter est un appareil inventé par Wallace H. Coulter dans les

années 1940 et breveté en 1953. Il permet de quantifier des particules ou

des cellules et de mesurer leur volume. L’appareil est utilisé pour la

quantification de microbes et de cellules mammifères. Il est

4

particulièrement utilisé en biologie médicale pour réaliser des

hémogrammes. Pour mesurer le volume des cellules, elles sont mises en

suspension dans un électrolyte et sont aspirées par une pompe. Les

cellules passent entre des électrodes et n’étant pas conductrices, elles

génèrent une variation de l’impédance qui est proportionnelle au volume

de la cellule (Figure 2).

Figure 2 - Principe du Coulter Counter. Les cellules sont en suspension dans un électrolyte.

La solution est aspirée par une pompe et des électrodes mesurent l’impédance provoquée

par les cellules. L’impédance est proportionnelle au volume des cellules. L’ordinateur

produit un graphique avec la fréquence en fonction du volume, en femtolitre (fL). Ici, par

exemple le WT a un volume médian d’environ 50 fL et le mutant de délétion sfp1 a un

volume médian d’environ 25 fL.

Microscopie

La taille cellulaire peut être quantifiée par microscopie optique. Cette

méthode a été utilisée par Navarro et Nurse pour mesurer la longueur et la

5

largeur de S. pombe (Navarro and Nurse 2012). Cependant, cette méthode a

le désavantage d’être fastidieuse.

Calcul de la biomasse

Certains auteurs estiment la taille en mesurant la quantité de protéines ou

d’ARN dans la cellule. Par exemple, la quantité de protéines peut être

déterminée par marquage au FITC. Le marquage par le FITC peut être

analysé par cytométrie de flux (Cipollina et al. 2005).

Régulation de la taille des organismes procaryotes

La taille des bactéries varie énormément, elle va de 10-4 fL pour les

bactéries marines du genre Candidatus (ce volume représente environ 1%

d’une bactérie E. coli) à 108 fL pour Thiomargarita namibiensis (8 fois plus

volumineuse qu’E. coli) (Young 2006). Cette bactérie est plus grande que

l’œil d’une drosophile et peut être visible à l’œil nu (Schulz et al. 1999).

Régulation de la taille des Bacilles – Division symétrique

La taille des cellules bactériennes est influencée par le milieu (Schaechter,

Maaloe, and Kjeldgaard 1958; Trueba and Woldringh 1980) et elle est

corrélée au taux de croissance (Monds et al. 2014). Dans un milieu riche,

le temps de génération est moins élevé qu’en milieu pauvre, alors que la

taille des cellules est plus élevée en milieu riche qu’en milieu pauvre.

L’existence d’une molécule capable de mesurer la taille de la cellule est

débattue (Robert 2015). DnaA, une molécule activatrice de la réplication de

l’ADN, a été proposée comme une protéine contrôlant la taille cellulaire

(Lobner-Olesen et al. 1989) : l’augmentation de son expression réduit la

taille cellulaire, suggérant que la concentration en DnaA influence la taille

cellulaire. Dans ce modèle, les cellules grossissent et il y a accumulation

de la molécule DnaA à un niveau suffisant pour initier la réplication de

l’ADN (Figure 3). Donc, les cellules de petites tailles devraient grossir plus

6

longtemps afin d’accumuler assez de DnaA, ce qui permet de maintenir

l’homéostasie de la taille.

Figure 3 – Accumulation de DnaA, dépendamment de la taille, sur l’origine de réplication

du chromosome jusqu’à ce qu’un seuil soit atteint pour initier la réplication de l’ADN.

(Amodeo and Skotheim 2016)

Une autre protéine candidate est FtsZ, une GTPase essentielle dans la

formation du septum et permettant la cytocinèse. La réduction de

l’expression de cette protéine engendre des cellules de grande taille

(Palacios, Vicente, and Sanchez 1996). FtsZ contrôle la division de façon

spatiale et temporelle. Cette protéine est inhibée par MinC, qui se situe

aux extrémités de la cellule et crée un gradient jusqu’au centre. Pendant

l’élongation, la concentration en MinC devient plus faible au centre de la

cellule, ce qui permet l’activation de FtsZ (Rothfield, Taghbalout, and Shih

2005; Lutkenhaus 2008).

Des études sur B. subtilis, P. aeruginosa et E. coli ont montré que la taille

ajoutée entre la cellule fille (sb) et la division (sd) est constante : Δ= sd- sb

7

(Taheri-Araghi et al. 2015; Deforet, van Ditmarsch, and Xavier 2015). Le

volume ajouté varie suivant les conditions de cultures. Ceci signifie que les

bactéries régulent la taille en ajoutant un volume constant à chaque

génération, donc il s’agit d’un mécanisme « Adder ». Du fait que ces bacilles

se divisent de façon symétrique, ce mécanisme permet de maintenir la

taille sur le long terme.

Archéobactéries

Les archéobactéries ont une taille comparable aux bactéries. Les

mécanismes contrôlant le cycle cellulaire partagent des similarités avec les

procaryotes et avec les eucaryotes. Par exemple, la protéine FtsZ est

conservée chez les bactéries et les archéobactéries. Comme chez les

eucaryotes, le cycle cellulaire est divisé en quatre phases : G1, S, G2 et M

(Lindås and Bernander 2013).

Halobacterium salinarum, une archéobactérie halophile, maintient sa taille

en ajoutant un volume constant entre chaque division. Le modèle « Adder »

semble donc être partagé entre les bactéries et les archéobactéries (Eun et

al. 2018).

Régulation de la taille des eucaryotes unicellulaires

Parmi les eucaryotes unicellulaires, S. cerevisiae et S. pombe ont été

utilisés pour l’étude du cycle cellulaire et la régulation de la taille (Sveiczer

and Horvath 2017; Wood and Nurse 2015; Jorgensen et al. 2002). S.

cerevisiae est une levure qui se divise par bourgeonnement alors que S.

pombe se divise de façon symétrique. Due à cette différence

morphologique, la taille semble être régulée à la transition G1/S pour S.

cerevisiae et à la transition G2/M pour S. pombe.

Saccharomyces cerevisiae

Croissance cellulaire

8

La croissance, c’est-à-dire la production de biomasse, est importante dans

le contrôle de la taille cellulaire. La croissance est assurée par

l’accumulation de masse cellulaire via les macromolécules : protéines,

acides nucléiques, sucres et lipides. La synthèse des protéines est un

processus indispensable pour la croissance cellulaire. Ce processus est

réalisé par les ribosomes. En phase de croissance, la cellule doit assurer

une synthèse abondante des ribosomes d’environ 2 000 par minute (Warner

1999). La biogénèse des ribosomes est corrélée aux conditions

environnementales et est régulée essentiellement par la voie TOR (Target

Of Rapamycin).

De nombreuses expériences indiquent que la traduction joue un rôle

fondamental dans la régulation de la taille cellulaire. Premièrement, le

traitement des cellules avec des inhibiteurs de la traduction, comme la

cycloheximide, provoque un défaut de taille (Popolo, Vanoni, and

Alberghina 1982). Ensuite, il a été montré que les souches déficientes en

gènes de la biogénèse des ribosomes et de protéines ribosomales ont un

phénotype de petite taille (Jorgensen et al. 2002; Soifer and Barkai 2014).

Les plus petites souches identifiées sont des mutants de délétions de Sfp1

et Sch9, qui sont deux régulateurs de la biogénèse des ribosomes,

suggérant que ce processus est important pour la croissance et le contrôle

de la taille. De plus, il a été montré que muter des gènes codants la petite

sous unité des ribosomes provoque un phénotype de grande taille, alors

que les mutants de la grande sous unité présentent un phénotype de petite

taille. Ces observations suggèrent que l’initiation de la traduction ainsi que

l’élongation ont un rôle dans la régulation de la taille cellulaire (Soifer and

Barkai 2014). Enfin, les souches déficientes en facteurs d’élongation de la

traduction ainsi qu’en facteurs d’initiation ont également un défaut de

taille (Jorgensen et al. 2002).

9

TOR est un complexe protéique situé au niveau des vacuoles (Urban et al.

2007; Sturgill et al. 2008). Chez S. cerevisiae, il existe deux complexes

TOR : TORC1 et TORC2. TORC1 est composée des protéines Tor1 ou Tor2,

Kog1, Tco89 et Lst8. TORC2 est composé de Tor2, Lst8, Avo1, Avo2, Avo3,

Bit2 et Bit61 (Loewith et al. 2002; Wedaman et al. 2003; Reinke et al.

2004). TOR permet de percevoir les nutriments dans le milieu extérieur

(azote, carbone) et aussi les facteurs de stress (De Virgilio and Loewith

2006). TOR favorise la croissance via l’augmentation de la traduction, la

transcription des gènes nécessaires pour la biogénèse des ribosomes et de

la glycolyse (Averous and Proud 2006; Ma and Blenis 2009; Laplante and

Sabatini 2012). TOR contrôle la biogénèse des ribosomes via Sch9, Sfp1,

Rrn3 et Maf1 (Rohde et al. 2008).

Sch9 est une kinase qui contrôle la biogénèse des ribosomes en régulant

les ARN polymérases I, II et III (Lee, Moir, and Willis 2009; Huber et al.

2011). La régulation de la biogénèse des ribosomes se fait également via les

facteurs de transcriptions Dot6 et Tod6 (Figure 4) (Huber et al. 2011).

Sch9 régule aussi l’initiation de la traduction en phosphorylant la protéine

ribosomale Rps6 et le facteur d’initiation eIF2 (Urban et al. 2007).

Sfp1, un facteur de transcription, régule la transcription des protéines

ribosomales et des protéines nécessaire à la biogénèse des ribosomes

(Figure 4) (Marion et al. 2004; Blumberg and Silver 1991; Jorgensen et al.

2002).

Rrn3 est un facteur de transcription requis pour la transcription de l’ADN

ribosomal, régulé par l’ARN Pol I (Claypool et al. 2004).

TOR régule l’ARN Pol III via Sch9 et Maf1 (Pluta et al. 2001).

10

Figure 4 Régulation des gènes de la biogénèse des ribosomes (RiBi) et les protéines

ribosomales (RP). Sfp1 se fixe sur les séquences RRPE pour activer les gènes RiBi et RP.

Dot6 et Tod6 se fixent sur les séquences PAC pour inhiber les gènes RiBi. (Loewith and

Hall 2011).

Cycle cellulaire

Le cycle cellulaire eucaryote est une succession de processus qui permet à

une cellule de donner naissance à deux cellules filles identiques. Il est

composé de la phase G1, dans laquelle la cellule grossit et prépare la

phase S, qui est la phase dans laquelle la cellule duplique son génome.

Ensuite, il y a la phase G2 et enfin la phase M, phase dans laquelle la

cellule se divise.

Le cycle cellulaire est régulé par des CDK (Cyclin Dependant Kinase) dont

l’activité est régulée par des cyclines. Chez S. cerevisiae, neuf cyclines sont

connues : Cln1, Cln2, Cln3 qui contrôlent la transition G1/S ; Clb5 et

Clb6 qui contrôlent la phase S et Clb1, Clb2, Clb3 et Clb4 qui contrôlent

11

les phases G2 et M (Figure 5). Cdc28 (ou CDK1) est la seule CDK qui

contrôle le cycle cellulaire chez S. cerevisiae, ainsi que chez C. albicans.

Figure 5 – Cycle cellulaire de S. cerevisiae. La Cdk1 est la seule Cdk qui contrôle le cycle

cellulaire. Les Cln1, 2 et 3 régulent la transition G1/S. Clb5 et 6 régulent la synthèse de

l’ADN (phase S). Les cyclines B 1 à 4 régulent la transition G2/M. Schéma adapté de

https://studentreader.com/KF645/mitosis-factors-cyclin-cdks/

Les cyclines contrôlent l’activité kinase de la protéine Cdc28 et permettent

l’activation de facteurs de transcriptions dans l’ordre nécessaire pour la

progression du cycle cellulaire (Haase and Wittenberg 2014).

Les complexes Cln3/Cdc28 et Cln1-2/Cdc28 permettent l’activation des

complexes SBF (Swi4/Swi6) et MBF (Mbf1/Swi6) en inhibant les

inhibiteurs Whi5 et Nrm1 (Figure 6). SBF et MBF sont positionnés sur les

promoteurs des gènes permettant l’entrée en phase S (Ferrezuelo et al.

2010; Simon et al. 2001; de Bruin et al. 2006) .

Clb5-6/Cdc28 initient la synthèse de l’ADN (Schwob et al. 1994) et

inhibent l’activité des complexes Cln1-3/Cdc28 (Basco, Segal, and Reed

1995).

12

Clb1-2/Cdc28 activent Mcm1 et Fkh2 qui régulent la transition G2/M.

Ceci permet l’expression d’environ 35 gènes, dont Ace2, Swi5 et Cdc5, afin

d’activer la mitose (Cho et al. 1998).

La transition M/G1 est régulée par Mcm1 qui est lui-même réprimé par

Yox1 et Yhp1. Mcm1 permet la synthèse de Swi4 et Cln3 et des gènes de

pré-réplication de l’ADN (Cdc6, Mcm2-7).

Figure 6 - Processus de la transition G1/S (Haase and Wittenberg 2014). Le complexe SBF

est inhibé par Whi5. Cln3/Cdk1 inhibe Whi5, ce qui permet au complexe SBF de transcrire

les cyclines 1 et 2. Cln3/Cdk1 active également le complexe MBF. Cln1-2/Cdk1 activent à

leurs tours les complexes SBF et MBF. Le complexe MBF transcrit Nrm1, qui est un

inhibiteur de MBF et permet la sortie de la phase G1. Clb2/Cdk1 inhibe les complexes SBF

et MBF.

START : modèle « Sizer »

En 1974, Leland Hartwell a proposé que la croissance et la division soient

couplées à START, un point de contrôle situé en fin de phase G1 (Hartwell

et al. 1974). À START, les cellules arrêtent le cycle cellulaire en réponse

aux hormones, à des stress ou à une carence nutritionnelle. De plus, les

cellules doivent atteindre une taille seuil pour pouvoir passer START et se

13

diviser. Comme S. cerevisiae se divise de façon asymétrique, la cellule fille

est plus petite que la cellule mère et doit passer plus de temps en phase

G1 pour passer START (Figure 7). Ce point de contrôle permet d’assurer le

maintien de la taille cellulaire sur le long terme. START est également

modulé par le milieu extracellulaire : les cellules cultivées en milieu riche

ont une plus grande taille qu’en milieu pauvre.

Figure 7 – Corrélation négative entre la taille cellulaire à la naissance et le temps passé en

G1. Figure adaptée de (Turner, Ewald, and Skotheim 2012).

La cycline 3 (Cln3) est une protéine importante de START. Cln3 est

nécessaire pour la régulation temporelle du cycle cellulaire, mais n’est pas

nécessaire à la viabilité chez S. cerevisiae, contrairement à l’homologue

Cln3 chez C. albicans (Chapa y Lazo, Bates, and Sudbery 2005). Cette

14

observation suggère qu’il existe une autre voie chez S. cerevisiae qui

permet de passer START. Cette fonction redondante serait controlée par

Bck2 (Wijnen and Futcher 1999).

La concentration de Cln3 augmente pendant la phase G1 et se fixe à la

CDK Cdc28. Ce complexe permet la phosphorylation de Whi5 (Tyers,

Tokiwa, and Futcher 1993; Dirick, Bohm, and Nasmyth 1995; Stuart and

Wittenberg 1995). Cette phosphorylation lève l’inhibition de Whi5 sur le

complexe SBF (Figure 6) (facteurs de transcription Swi4/Swi6) (Costanzo

et al. 2004; de Bruin et al. 2004; Schaefer and Breeden 2004). Whi5 est

par conséquent délocalisé du noyau vers le cytoplasme par la protéine

Msn5 (Taberner, Quilis, and Igual 2009). Cln3/Cdc28 phosphoryle

également le complexe SBF, mais cette phosphorylation ne semble pas être

nécessaire pour l’activation de SBF (Geymonat et al. 2004).

L’activation de SBF et MBF permet la synthèse d’environ 200 gènes

nécessaire pour la synthèse de l’ADN et pour le bourgeonnement. Parmi

ces gènes, les cyclines CLN1 et CLN2 sont transcrites afin d’assurer la

poursuite du cycle cellulaire en s’associant avec Cdc28 et en continuant

l’inactivation de Whi5 (Eser et al. 2011; de Bruin et al. 2004), ce qui forme

une boucle d’activation. Cette boucle d’activation permet l’engagement

irréversible du cycle cellulaire (Skotheim et al. 2008; Charvin et al. 2010;

Doncic and Skotheim 2013). Cln1-Cln2/Cdc28 phosphorylent également

Sic1, un inhibiteur des complexes Clb/Cdc28 (Verma, Feldman, and

Deshaies 1997; Feldman et al. 1997). La phosphorylation de Sic1 permet

son ubiquitination et sa dégradation, permettant l’activation de Clb5-

6/Cdc28 et activant la réplication de l’ADN (Nash et al. 2001; Schneider,

Yang, and Futcher 1996; Tyers 1996). Clb5 a également un rôle dans la

phosphorylation de Sic1, ce qui permet encore d’amplifier la boucle

d’activation (Yang et al. 2013).

15

Comme les levures sont capables de contrôler activement leurs tailles, ceci

suggère qu’il existe un ou plusieurs senseurs. Le senseur qui permet

d’indiquer à la cellule la taille n’est pas encore connu. Néanmoins, Cln3 et

Whi5 sont les deux principaux candidats.

Cln3 est séquestrée dans le réticulum endoplasmique par la protéine Ydj1

(Verges et al. 2007). En fin de la phase G1, la quantité d’Ydj1 devient

limitante et Cln3 est libéré et s’accumule par la suite dans le noyau pour

enclencher la phase S. D’autres auteurs ont émis l’hypothèse que c’est

l’accumulation de l’activité de Cln3/Cdc28 qui permet d’activer la

transition G1/S (Schneider et al. 2004).

Whi5 joue également un rôle essentiel dans la régulation de START. La

concentration nucléaire en Whi5 diminue pendant la phase G1. La

protéine étant diluée, elle ne joue plus son rôle d’inhibition de SBF et MBF

(Schmoller et al. 2015). Il a également été montré que la concentration en

Swi4 augmente pendant la phase G1, ce qui fait diminuer le ratio

Whi5/Swi4 (Dorsey et al. 2018). Donc, la quantité de Swi4 augmente au

cours de la phase G1 et permet le passage de START.

Modèle « Adder »

Le couplage entre la croissance et la division à START permet de contrôler

la taille sur le long terme. Cependant, une cellule fille née à une taille plus

petite passera plus de temps en G1 mais bourgeonnera tout de même à

une taille plus petite. START semble donc être un mécanisme imparfait et

suggère qu’un ou plusieurs autres mécanismes permettent de contrôler la

taille sur le long terme. Soifer et al ont montré que les levures ajoutent un

volume constant entre deux bourgeonnements (Soifer, Robert, and Amir

2016; Chandler-Brown et al. 2017). Au niveau moléculaire, l’hypothèse de

dilution de Whi5 au cours de la phase G1 est cohérent avec le modèle

« Adder » (Soifer, Robert, and Amir 2016; Schmoller et al. 2015).

16

Le mécanisme « Adder » serait donc conservé chez les bactéries, les

archéobactéries et les eucaryotes.

Schizosaccharomyces pombe

S. pombe se divise de façon symétrique. La progression du cycle cellulaire

est régulée par Cdc2, la seule Cdk retrouvée chez cette levure. Cdc2

contrôle l’entrée en mitose et contrôle la longueur de la phase G2 (Nurse

1990). Contrairement à S. cerevisiae, la régulation de la taille se fait

majoritairement en phase G2/M (Jorgensen and Tyers 2004).

La taille serait contrôlée par la protéine Pom1, qui est localisée aux

extrémités de la cellule. Pom1 est un inhibiteur des kinases Cdr1 et Cdr2,

qui sont eux-mêmes des inhibiteurs de Wee1. Ce dernier inhibe la Cdk

Cdc2 par phosphorylation sur la Tyrosine 15 (Figure 8a) (Gould and Nurse

1989). Cdr1 et Cdr2 localisent au centre de la cellule (Deng and Moseley

2013). Pendant la croissance, la concentration de la protéine Pom1

diminue au centre de la cellule. L’inhibition de Cdr1 et Cdr2 est par

conséquent levée et Wee1 est inhibé, ce qui permet l’activation de Cdc2

(Figure 8b) (Martin and Berthelot-Grosjean 2009; Moseley et al. 2009).

Cependant, une mutation de la Tyrosine 15 de Cdc2 par un acide aminé

non phosphorylable ne perturbe pas la taille cellulaire des levures,

suggérant que d’autres mécanismes contrôlent la taille cellulaire

(Coudreuse and Nurse 2010).

Une autre hypothèse est que la concentration de Cdr2 augmente

proportionnellement à la croissance de la cellule et permet l’inhibition de

Wee1 (Pan et al. 2014; Russell and Nurse 1987).

17

Figure 8 - Régulation de la taille chez S. pombe. (Marshall et al. 2012). a) Pom1 inhibe

l’activité de Cdr1 et Cdr2. Wee1 inhibe Cdc2. b) Pendant la croissance cellulaire, la

concentration de Pom1 diminue au centre de la cellule et Pom1 ne peut plus inhiber Cdr1 et

Cdr2. Cdr1 et Cdr2 inhibent Wee1, ce qui permet l’activation de Cdc2.

Métazoaires

La taille des cellules au sein d’un même tissu est homogène (Ginzberg,

Kafri, and Kirschner 2015; Lloyd 2013). La régulation cellulaire est un

processus extrêmement important pour former des organes et des

organismes de taille physiologique. La taille d’un animal dépend à la fois

du nombre de cellules et de la taille des cellules. La différence de taille des

organismes selon les espèces animales est principalement une différence

de nombre de cellules plutôt que de la taille des cellules. Par exemple,

l’Homme possède 3 000 fois plus de cellules qu’une souris (Conlon and

Raff 1999). Nous avons vu que la régulation de la taille est influencée par

l’environnement extérieur. Chez les métazoaires, l’environnement physique

peut également contrôler la taille cellulaire. Par exemple, les neurones

arrêtent de grandir quand ils touchent leurs cibles (Guthrie 2007). La

croissance et la prolifération sont différentiellement contrôlées selon le

18

type de cellule et de tissus, plusieurs niveaux de contrôles sont donc

nécessaires. De plus, la croissance et la division ne sont pas toujours

couplées. Par exemple, les neurones peuvent grossir sans se diviser. Au

contraire, les ovocytes fécondés peuvent se diviser sans grossir.

L’équivalent de START est appelé le « Restriction Point » chez les

métazoaires (Wells 2002; Blagosklonny and Pardee 2002; Zetterberg,

Larsson, and Wiman 1995). Cependant, cette coordination semble être

principalement régulée par des facteurs extracellulaires plutôt que des

facteurs intracellulaires (Conlon et al. 2001; Conlon and Raff 2003). La

croissance et la division nécessitent des signaux distincts. Des molécules

mitogènes sont nécessaires pour favoriser la division cellulaire et des

facteurs de croissances sont nécessaires pour la croissance (Conlon et al.

2001; Rathmell et al. 2000).

La voie de régulation contrôlant la croissance la mieux caractérisée est la

voie IGF/PI3K/AKT/mTORC1 (Laplante and Sabatini 2012; Tumaneng,

Russell, and Guan 2012).

Mammifères

Chez les mammifères, la croissance est contrôlée par la voie TOR, qui

contrôle principalement la traduction via le facteur de transcription C-Myc

et la protéine kinase S6K. C-Myc augmente la production des ARN

ribosomiques et la taille du nucléole afin de favoriser la synthèse des

protéines (Grewal et al. 2005; Saucedo and Edgar 2002; Wang, Dillon, et

al. 2011). Myc est considéré comme l’analogue fonctionnel de Sfp1 (Cook

and Tyers 2007). Les facteurs extracellulaires, comme les facteurs de

croissances et les molécules mitogènes semblent être importants pour la

régulation de la taille (Conlon and Raff 2003). Des criblages chez l’Homme

ont permis d’identifier différents régulateurs de la taille, comme le gène

PRR16/Largen, qui est un activateur de la traduction et contrôle l’activité

mitochondriale (Yamamoto et al. 2014). Un autre criblage a permis

19

d’identifier la p38 comme un régulateur de la taille chez l’Homme (Liu et

al. 2018).

Drosophile

Chez la drosophile, l’inactivation de mTOR par la rapamycine provoque un

délai du cycle cellulaire et une diminution de la taille cellulaire (Zhang et

al. 2000). S6K (l’analogue fonctionnel de Sch9) est un substrat de mTOR

dont l’inactivation génétique ou l’inactivation par traitement à la

rapamycine provoque des ailes de petites tailles (Montagne et al. 1999;

Chung et al. 1992). mTOR contrôle la croissance cellulaire via la

traduction et la biogénèse des ribosomes et augmente également la

production de nucléotides afin de favoriser la production d’ARN

(ribosomiques et messagers) ainsi que la traduction et produire des dNTP

nécessaire à la réplication de l’ADN.

Les nutriments sont également importants pour la régulation de la taille.

Une carence nutritive peut provoquer une diminution de la taille des ailes

de 15% (Edgar 2006) alors que des nutriments en excès n’influence par la

taille des drosophiles.

Nématodes

Les nématodes Caenorhabditis elegans et Ascaris lumbricoides ont été

longuement étudiés. Ces deux espèces ont la même taille après l’éclosion,

mais à la taille adulte, A. lumbricoides est 109 fois plus gros que C.

elegans. La différence entre C. elegans et A. lumbricoides est que ce dernier

produit des cellules de plus grande taille afin de produire un organisme

allant jusqu’à 40 cm de long.

La taille cellulaire peut influencer la taille des organes ainsi que la taille de

l’organisme. Par exemple, le nombre de cellules de C. elegans est fixe, mais

des perturbations peuvent modifier la taille des cellules et ainsi modifier la

20

taille de l’organisme adulte (Irle and Schierenberg 2002; Cook and Tyers

2007). Différents criblages pour identifier les gènes régulant la taille ont

permis d’identifier les voies TGF-β et MAPK sma-5 (Small Body Size). Les

mutations dans ces voies peuvent produire des vers 10 fois plus petits

qu’un ver sauvage (Savage-Dunn et al. 2003; Watanabe, Ishihara, and

Ohshima 2007). La voie TGF-β semble également avoir un rôle dans la

croissance des cellules en favorisant l’augmentation de la ploïdie et a pour

conséquence d’augmenter la taille de l’organisme (Lozano et al. 2006).

Régulation de la taille et virulence fongique

De nombreux champignons sont pathogènes pour l’Homme. Les plus

importants sont Candida, Aspergillus, Cryptococcus et Histoplasma. Il n’est

pas encore établi s’il y a un lien direct entre la régulation de la taille des

champignons et la virulence. Cependant, plusieurs études suggèrent que

la taille d’un pathogène fongique est un déterminant important de la

virulence.

Cryptococcus neoformans

En 2009, une forme « géante » de C. neoformans a été mise en évidence

dans un modèle d’infection de souris (Figure 9) (Zaragoza et al. 2010). Ces

cellules géantes possèdent une capsule et la cellule elle-même (sans la

capsule) a aussi une grande taille. Ces cellules sont plus résistantes au

stress osmotique et aux radiations gamma et les macrophages ne peuvent

pas les phagocyter (Okagaki et al. 2010). La grande taille et la capsulation

sont favorisées par l’environnement de l’hôte, notamment la température à

37°C (Garcia-Rodas et al. 2011). La diversité des cellules (avec et sans

capsule) permet l’invasion de l’hôte et l’échappement au système

immunitaire. Ces cellules ont également une ploïdie élevée, indiquant

qu’elles dupliquent leur génome sans se diviser.

21

Figure 9 - Diversité de la taille de Cryptococcus neoformans. A. Cellules sans capsule. B.

Cellules avec capsule. (Zaragoza et al. 2010)

Histoplasma capsulatum

H. capsulatum est une levure pathogène dimorphique, mais contrairement

à C. albicans, cette levure produit des hyphes à 25°C et elle se propage

sous forme levure à 37°C à l’intérieure de l’Homme (Wang and Lin 2012). À

37°C, ce champignon produit deux types de propagules, des microconidies

et des macroconidies. Les microconidies, qui sont les formes infectieuses,

ont une petite taille qui leur confère l’avantage de se loger dans les alvéoles

pulmonaires et de persister dans les cellules phagocytaires (Seider et al.

2010). Ce champignon produit donc des cellules de différentes formes et

taille suivant l’environnement.

Paracoccidioides brasiliensis

Cette levure est caractéristique par sa diversité de forme et de taille au sein

d’une population. Une mutation du gène CDC42 provoque une diminution

de la taille et de sa variabilité. Ce mutant est plus facilement phagocyté

par les macrophages et il est non virulent dans des modèles d’infection de

souris. Ceci suggère que la diversité de la taille, ainsi que la grande taille

de cette levure sont des attributs importants pour le pouvoir pathogène de

ce champignon (Almeida et al. 2009). Cependant, il n’est pas exclu que

CDC42 régule d’autres processus nécessaire pour la virulence pendant

l’infection.

22

Mucor circinelloides

Mucor circinelloides présente une diversité de taille qui dépend du groupe

de compatibilité sexuelle de la cellule (+ ou -). Les cellules produites par

des souches (–) sont plus grandes et peuvent provoquer la lyse des cellules

de l’hôte à l’inverse des cellules (+) qui ont une petite taille et sont non-

pathogènes (Li et al. 2011).

23

C. albicans et les candidoses

C. albicans est une levure de la division des Ascomycètes et de l’ordre des

Saccharomycetales. Le nom de classification a été proposé par Christine

Marie Berkhout dans sa thèse de doctorat de l’Université d’Utrecht, aux

Pays-Bas, en 1923 (Barnett 2004). Candida provient du mot latin

« candidus », signifiant « blanc ». Albicans est le participe présent du mot

latin « albicō », signifiant « blanc » également.

C. albicans est une levure opportuniste retrouvée chez l’Homme et

différents animaux comme les oiseaux, les bovins, les chevaux, les chats

(Edelmann, Kruger, and Schmid 2005)… La levure fait partie de la flore

commensale humaine de la bouche, du tractus digestif et du vagin. C.

albicans est maintenu sous sa forme commensale par d’autres

microorganismes et par le système immunitaire de l’hôte. En cas de

perturbation de la flore commensale, par prise d’antibiotiques ou

d’immunosuppresseurs, à cause du tabagisme (Akram et al. 2018), ou

suite à une immunodéficience (SIDA, chimiothérapie), la levure peut

devenir virulente et provoquer une candidose. C. albicans est un

pathogène très polyvalent et est devenu un agent pathogène majeur. En

Amérique du Nord, 10% des septicémies sont causées par des levures du

genre Candida, généralement par l’espèce C. albicans (C. albicans

représente 90% des septicémies à levure) (Marchetti et al. 2004; Edmond

et al. 1999; Bille, Marchetti, and Calandra 2005). Les Candida sont la

troisième cause d’infection nosocomiale aux États-Unis (Wisplinghoff et al.

2004), après Escherichia coli et Staphylococcus aureus.

Quelques espèces de Candida, dont C. albicans, utilisent un code

génétique non standard. En effet, le codon CUG code généralement pour

une leucine mais code pour une sérine chez certaines espèces de Candida

24

(Santos et al. 1997), d’où le nom du clade CTG de C. albicans et les

espèces proches (Figure 10).

Figure 10 - Phylogénie des clades Candida et Saccharomyces. Le Clade Candida est

caractérisé par l’utilisation du codon CTG qui code pour une sérine. S. cerevisiae se trouve

dans le clade WGD = Whole Genome Duplication. (Butler et al. 2009)

Épidémiologie et manifestations cliniques des candidoses

Parmi les 200 espèces du genre Candida, 14 sont pathogènes pour

l’Homme : C. albicans, C. auris, C. dubliensis, C. glabrata, C. kefyr, C.

krusei, C. lusitaniae, C. parapsilosis, C. tropicalis, C. guilliermondii, C.

famata, C. lipolytica, C norvengensis, C. rugosa (Lopez-Martinez 2010;

Satoh et al. 2009; Pfaller et al. 2006). C. albicans est l’espèce la plus

fréquemment isolée.

25

Les candidoses sont en augmentation partout dans le monde. Elles sont

favorisées par l’âge, la prise d’antibiotiques, de stéroïdes et

d’antidépresseurs, par les transplantations d’organe et de moelle osseuse,

par le diabète, divers cancers, le SIDA et la malnutrition (Lopez-Martinez

2010).

Les candidoses peuvent avoir différentes formes :

-Candidose buccale, ou muguet, caractérisée par des plaques blanchâtres

sur la langue, le palais, les joues et le pharynx. Cette infection touche

jusqu’à 90% des patients atteints du SIDA, dans ce cas, l’infection peut se

propager dans le système digestif. C’est la forme la plus fréquente de

candidose et peut être très agressive pour les prématurés, les femmes

allaitantes et les personnes âgées. (Lalla, Patton, and Dongari-Bagtzoglou

2013). Les autres facteurs de risque sont le cancer, l’utilisation d’une

prothèse dentaire ou la prise d’antibiotiques.

-Candidose vulvovaginal, caractérisée par une leucorrhée et des

démangeaisons. 50 à 75% des femmes ont au moins une candidose

vaginale au cours de leur vie, à tout âge (Sobel 2007). Ce type d’infection

est favorisé par la prise de contraceptifs ou d’antibiotiques, par l’obésité,

chez les femmes enceintes et par les thérapies hormonales (Fidel 2004).

-Candidose balano-préputial, caractérisée par une douleur, des pustules,

une irritation, parfois par un ulcère et une sécrétion sur le gland du pénis

et sur le prépuce. Ce type d’infection est favorisé par le manque d’hygiène,

le diabète et l’immunodéficience.

-Onychomycose, caractérisée par une décoloration de l’ongle, ou au

contraire une couleur verte-jaune, une séparation à l’extrémité de l’ongle,

l’apparition d’un œdème et une douleur. C’est une infection fréquente chez

les diabétiques.

-Candidose mucocutanée, caractérisée par une douleur sur la surface

infectée, une hyperkératose et des ulcères de la peau. Cette infection peut

26

se propager dans les tissus profonds puis provoquer une septicémie et le

décès.

-Candidose invasive, caractérisée par une septicémie, une endocardite,

une méningite ou une endophtalmie (Pappas 2006). La septicémie à

Candida est la 4ème infection du sang la plus courante. Elle est responsable

de 50 000 décès par an dans le monde. Les Candidoses invasives sont

favorisées par la prise d’antibiotique, la chirurgie et l’immunodéficience.

Traitements des candidoses

Le traitement d’une candidose dépend de la zone d’infection. Un guide est

publié pour aider les cliniciens à choisir le traitement approprié. (Pappas et

al. 2016; Lopez-Martinez 2010). Dans un premier temps, il est nécessaire

d’éliminer les facteurs de prédisposition : arrêter la prise d’antibiotiques,

de stéroïdes ou d’immunosuppresseurs ; traiter l’humidité localement ou

ajuster le pH vaginal. La prise de probiotiques peut également être efficace

dans le cas d’une infection vaginale (Jurden et al. 2012; Abad and Safdar

2009). En revanche, quand le facteur de prédisposition est une pathologie,

comme le SIDA, le diabète ou bien un cancer, la prise d’antifongique est

nécessaire.

Il existe trois principales classes d’antifongiques utilisées contre les

candidoses : les polyènes, les azoles et les échinochandines.

Les polyènes et les azoles sont utilisés pour les traitements oraux,

vaginaux, cutanés et en intraveineuse pour les infections systémiques

(Moosa et al. 2004; Silverman, Pories, and Caro 1989).

Les échinochandines sont utilisées en intraveineuses et sont

recommandées pour le traitement des candidoses systémiques (Bassetti et

al. 2018; Pappas et al. 2016).

Ces antifongiques ont plusieurs limitations. Ils peuvent provoquer des

effets secondaires, comme des allergies, des insuffisances rénales, des

nausées et des maux de tête (Sawant and Khan 2017). De plus, des

27

résistances à ces antifongiques apparaissent. Il est donc nécessaire de

trouver de nouvelles molécules pour traiter les candidoses (Perfect 2017).

Génome

C. albicans est un diploïde et possède 8 chromosomes allant de 3,3 à 0,95

Mb (chromosomes 1 à 7 et le chromosome R) (Olaiya and Sogin 1979). Un

premier séquençage a été achevé en 2004 (Jones et al. 2004). Un haut

niveau d’hétérozygotie, de recombinaison intrachromosomique et

d’aneuploïdie a été observé dans différentes souches. Cette plasticité

génomique a un effet sur l’adaptation de la levure à différents stress, sur la

résistance aux antifongiques (Wertheimer, Stone, and Berman 2016) et

génère de la variation phénotypique (Holmes et al. 2006). La fréquence de

perte d’hétérozygotie et d’aneuploïdie est 1 000 fois plus élevée in vivo qu’in

vitro et l’instabilité génomique a un impact sur la virulence de cette levure

(Satpati et al. 2017; Forche et al. 2018). En effet, l’instabilité génétique

influence le taux de croissance de la levure, sa morphologie, la résistance

aux stress ou aux antifongiques (Braunsdorf and LeibundGut-Landmann

2018; Schonherr et al. 2017).

La taille du génome est d’environ 29Mb (forme diploïde) et le génome

possède environ 6 200 ORF (6 600 ORF pour S. cerevisiae), dont 4 400

(70%) ne sont pas caractérisés (http://www.candidagenome.org ; consulté

en novembre 2018). S. cerevisiae et C. albicans ont environ 75 % de gènes

orthologues et 20% des gènes de C albicans n’ont pas d’homologue chez S.

cerevisiae, C. albicans et l’Homme (Odds, Brown, and Gow 2004; Jones et

al. 2004). Bien que la levure ait été considérée comme asexuée, le génome

contient les gènes permettant une reproduction sexuée (Hull and Johnson

1999). Les levures peuvent former des formes tétraploïdes et revenir sous

forme diploïde par perte aléatoire de chromosomes excédentaires (Miller

28

and Johnson 2002; Wu et al. 2005). La méiose n’a jamais été observée

chez cette levure (Bennett and Johnson 2005).

Morphologie

C. albicans est une levure pléomorphique, c’est-à-dire qu’elle présente

différentes morphologies selon l’environnement dans laquelle elle se trouve

(Figure 11). C. albicans a la possibilité de passer d’une forme levure à une

forme hyphe ou pseudohyphe. De plus, la levure peut faire des

« transitions phénotypiques » nommées White, Opaque, GUT

(Gastrointestinally induced Transition) et Gray. Récemment, la forme

Goliath a été décrite, cette forme est observée dans des milieux carencés

en zinc (Malavia et al. 2017).

Figure 11 - Représentation des différentes formes morphologiques de C. albicans (Gow

and Yadav 2017).

Transition levure-hyphe

29

C. albicans est capable de se diviser sous forme levure ou bien sous forme

filamenteuse (hyphe ou pseudohyphe) (Figures 11 et 12). La forme levure

prolifère par bourgeonnement avec une forme ellipsoïdale. La forme

filamenteuse croît par élongation, la cellule fille ne se sépare pas de la

cellule mère et forme des filaments. Dans le cas d’un pseudo-hyphe, il y a

formation d’une paroi transversale appelée septum. La croissance des

hyphes est assurée par le Spitzenkörper (Berman 2006), un complexe dans

la région apicale de l’hyphe qui est riche en vésicules sécrétoires et

permettant la polymérisation des constituants de la paroi. La forme levure

est favorisée par un pH acide et une température inférieure à 25°C. La

forme hyphe est favorisée par un pH alcalin, une température de 37°C,

une haute concentration en CO2, une carence nutritive, l’hypoxie, la

croissance sur une surface solide et la présence de sérum dans le milieu.

La forme pseudo-hyphe est favorisée à 35°C, pH=6 et en carence azotée. Le

dimorphisme levure/hyphe semble nécessaire pour la virulence. De

nombreux mutants incapables de faire la transition entre les formes

levures et hyphes perdent leur capacité à coloniser et envahir l’hôte,

suggérant que les deux formes sont nécessaires pour la virulence (Lo et al.

1997; Saville et al. 2003). La forme levure serait nécessaire pour la

colonisation et la dissémination (Saville et al. 2003) alors que la forme

hyphe serait nécessaire pour l’invasion des tissus et l’échappement au

système immunitaire (Berman and Sudbery 2002; Malinverni et al. 1985).

30

Figure 12 - Photos de C. albicans en forme pseudohyphe (Pseudohyphae), levure (Yeast)

et hyphe (Hyphae). La barre d’échelle représente 5 µm (Sudbery 2011).

Transitions phénotypiques

C. albicans est capable d’exprimer des phénotypes différents suivant les

conditions environnementales. La transition phénotypique est définie

comme la capacité de subir spontanément et de manière réversible des

transitions de morphologie (Soll 1992). Certains phénotypes semblent être

les formes commensales et d’autres les formes pathogènes. Quatre formes

phénotypiques ont été décrites chez C. albicans : White, Gray, Opaque et

GUT (Gastrointestinally-IndUced Transition).

Dans les conditions de laboratoire, la forme la plus commune est la forme

White. Les colonies White sont blanches, lisses et rondes. La transition

White-Opaque a été décrite en 1985 (Slutsky et al. 1987). Les colonies

Opaques sont plus grosses, plus rugueuses et plus grises que les formes

White. Les cellules Opaques sont compétentes pour la reproduction

31

parasexuée (Miller and Johnson 2002) contrairement aux cellules White.

La forme White est plus virulente dans les candidoses systémiques alors

que la forme Opaque est plus virulente dans les infections cutanées. La

transition White/Opaque est favorisée par la présence de 5% de CO2, une

température de 25°C et la présence de N-acetylglusosamine (Tao et al.

2014).

La forme Gray a été décrite en 2014 (Tao et al. 2014). Les colonies sont

lisses et grises. La forme Gray diffère des formes White et Opaque par la

morphologie et la signature transcriptionnelle (Figure 13A). Cette forme

permet la colonisation de la langue. C’est une forme plus efficace pour la

reproduction parasexuée que la forme White, mais moins efficace que la

forme Opaque. La forme Gray est stabilisée à 37°C en présence de N-

acetylglucosamine (Tao et al. 2014).

En 2013, la forme GUT (gastrointestinally induced transition) est décrite

comme une forme commensale de l’intestin (Pande, Chen, and Noble

2013). Cette forme ressemble morphologiquement à la forme Opaque, mais

avec des vacuoles plus proéminentes (Figure 13B). Les gènes du

catabolisme des acides gras sont surexprimés dans la forme GUT, ce qui

explique pourquoi elle est bien adaptée au système digestif des

mammifères, qui est enrichi en acide gras (Wong and Jenkins 2007).

32

Figure 13 - Photos de différentes formes phénotypiques de C. albicans. (A) Formes White,

Gray et Opaque (Tao et al. 2014). La barre d’échelle représente 10 µm. (B) Formes White

et GUT (Pande, Chen, and Noble 2013).

Biofilms

Les biofilms sont des communautés microbiennes organisées. Ils peuvent

se former sur des surfaces abiotiques (cathéter, matériel chirurgical…) et

biotiques (dents).

La formation de biofilm se fait en plusieurs étapes. Premièrement, les

cellules libres se fixent sur une surface. Cette étape permet la synthèse

d’une famille de gènes codante pour des adhésines (Green et al. 2004) et

des gènes régulants la formation des hyphes (Nobile and Mitchell 2005).

Ensuite, elles forment des hyphes et sécrètent une matrice extracellulaire

composé de glycoprotéines et d’ADN (Pierce et al. 2017). Cette matrice

extracellulaire permettrait aux cellules de se défendre contre les

phagocytes et les antifongiques car ces derniers diffusent mal dans les

biofilms (Alonso et al. 2017; Sellam et al. 2009).

33

C. albicans en forme de biofilm est plus résistant qu’en forme planctonique

aux antifongiques et au système immunitaire. In vivo, des formes levures

peuvent s’échapper du biofilm, ce qui favorise la dissémination. Les

biofilms sont donc des réservoirs pour des infections persistantes (Ramage

et al. 2005).

Plasticité évolutive de la régulation transcriptionelle chez les

ascomycetes : « transcriptional rewiring »

S. cerevisiae et C. albicans ont un génome similaire et se divisent tous les

deux par bourgeonnement, mais ces deux levures ont aussi des

différences :

-S. cerevisiae est saprophyte alors que C. albicans est un opportuniste, ce

qui signifie que ces espèces ne vivent pas dans les mêmes environnements

et donc n’ont pas les mêmes besoins nutritifs.

-C. albicans a un cycle parasexuel (reproduction sans méiose) alors que S.

cerevisiae est capable de se diviser par méiose.

Chez ces espèces, des différences dans les voies de régulation peuvent

modifier l’expression des gènes (dans le temps et le niveau d’expression) et

ainsi modifier les phénotypes et créer une diversité phénotypique. Même

pour des processus très conservés, comme la synthèse des ribosomes, les

voies de régulation peuvent différer. Par exemple, les deux principaux

facteurs de transcriptions régulant l’expression des protéines ribosomales

sont Rap1 et Hmo1 chez S. cerevisiae (Gadal et al. 2002), alors que ces

deux gènes n’ont aucun rôle dans ce processus chez C. albicans. Ce rôle

est assuré par Tbf1 et Cbf1 chez C. albicans (Lavoie et al. 2010).

Un exemple documenté de « rewiring » transcriptionnel provient du facteur

de transcription Gal4. Chez S. cerevisiae, cette protéine induit la

transcription des gènes GAL1, GAL7 et GAL10, qui codent pour les

enzymes de la galactolyse, quand le glucose est absent et le galactose

34

présent (Holden et al. 2004). C. albicans possède des orthologues de toutes

ces enzymes (Brown, Sabina, and Johnston 2009; Fitzpatrick et al. 2010;

Martchenko et al. 2007) ainsi que de Gal4 (Holden et al. 2004; Sellam,

Hogues, et al. 2010). Cependant, chez C. albicans, Gal4 ne joue aucun rôle

dans la transcription des gènes GAL1-7-10 (Martchenko et al. 2007) et est

impliqué dans la glycolyse (Askew et al. 2009). Quant aux enzymes, elles

restent impliquer dans le métabolisme du galactose. Rtg1 et Rtg3 ont été

identifiés comme les facteurs de transcription permettant l’expression des

gènes GAL1, GAL7 et GAL10 chez C. albicans (Dalal et al. 2016). Chez S.

cerevisiae, Rtg1 et Rtg3 interviennent dans une voie de signalisation entre

la mitochondrie et le noyau (Jia et al. 1997). Les enzymes de la galactolyse

sont donc exprimées en présence de galactose dans les deux espèces sous

le contrôle de facteurs de transcription différents. Cependant, le taux

d’expression de GAL1 en présence de galactose est plus élevé chez S.

cerevisiae (900 fois) que C. albicans (12 fois) et le gène est induit plus

rapidement chez C. albicans. Enfin, C. albicans répond à une

concentration en galactose plus faible par rapport à S. cerevisiae (Dalal et

al. 2016). Cet exemple de « rewiring » montre que le changement de

régulateur à un impact temporel et sur le niveau d’expression des gènes

cible, ce qui induit une diversité phénotypique.

En conclusion, même si les génomes de S. cerevisiae et C. albicans sont

proches (75% de similarité), des gènes orthologues entre les deux espèces

peuvent avoir des fonctions différentes. L’analyse de séquence n’est donc

pas suffisante pour déduire la fonction d’un gène.

Cycle cellulaire

Morphologiquement, le cycle cellulaire de C. albicans ressemble à celui de

la levure modèle S. cerevisiae : en forme levure, les deux espèces se

divisent de façon asymétrique par bourgeonnement. Le cycle cellulaire est

35

régulé par des cyclines et par la Cdk Cdc28 chez les deux espèces.

L’analyse du génome et l’expérience ont montré des différences dans la

régulation du cycle cellulaire entre les deux espèces. Par exemple, la

cycline 3 (Cln3) est essentielle chez C. albicans mais pas chez S. cerevisiae,

ce qui suggère que Cln3 a un rôle plus déterminant chez C. albicans

(Chapa y Lazo, Bates, and Sudbery 2005). De plus, S. cerevisiae possède

quatre cyclines B : Clb1, 2, 3 et 4 alors que C. albicans possède deux

cyclines B : Clb2 et 4 (Bensen et al. 2005).

Le cycle cellulaire de C. albicans est caractérisé par quatre vagues de

transcriptions successives régulées par le complexe SBF (Swi4/Swi6) et les

facteurs de transcription Fkh2, Mcm1 et Ace2 (Cote, Hogues, and

Whiteway 2009). Ces vagues de transcription correspondent aux

transitions G1/S, S/G2, G2/M et M/G1.

Pendant la transition G1/S, les gènes exprimés sont enrichis en gènes de

la réplication de l’ADN, du cycle cellulaire et de la cohésion des

chromatines. Ces gènes sont régulés par le complexe MBF, constitué des

facteurs de transcriptions Swi4 et Swi6 (Hussein et al. 2011). Le complexe

MBF est lui-même régulé par Nrm1 et par le complexe Cln3/Cdc28.

Les gènes exprimés pendant la transition S/G2 sont impliqués dans

l’organisation des chromosomes et le cycle cellulaire. Ces gènes sont

régulés par le facteur de transcription Fkh2.

Les gènes de la transition G2/M sont impliqués dans la cytokinèse, la

séparation de la cellule mère et de la cellule fille, ces gènes sont régulés

par Mcm1.

36

Les gènes de la transition M/G1 sont impliqués dans le complexe de pré-

réplication, le bourgeonnement et de la biogenèse de la paroi et ils sont

régulés par Ace2.

Croissance

Comme chez S. cerevisiae, la croissance est régulée par le complexe TOR

chez C. albicans. Cependant, il n’existe qu’un seul homologue de TOR1

chez C. albicans, alors qu’il y a deux homologues de TOR chez S. cerevisiae

(TOR1 et TOR2). Le rôle de la voie TOR dans la réponse aux nutriments et

dans la régulation de la biogénèse des ribosomes est conservé entre les

deux espèces (Bastidas, Heitman, and Cardenas 2009).

Sch9 et Sfp1 sont également conservés entre les deux espèces (Kastora et

al. 2017). La kinase Sch9 est nécessaire pour la croissance en forme levure

et en forme hyphe en activant la traduction via la phosphorylation de la

protéine ribosomale S6 (Liu et al. 2010; Chowdhury and Kohler 2015).

Régulation de la taille et virulence de C. albicans

Comme nous avons vu précédemment, C. albicans présente de nombreux

phénotypes suivant son environnement (levure, hyphe, White, Opaque,

GUT, Gray Goliath). Ces formes phénotypiques ont une influence sur le

commensalisme et la virulence. Les cellules Gray sont plus petites que les

Opaques, qui sont plus petites que les formes White. Les plus grosses

cellules sont les GUT dues à la grande taille des vacuoles. Les cellules

présentants ces phénotypes diffèrent en taille mais aussi en structure de la

paroi ainsi que dans leur signature transcriptionnelle. Il est donc difficile

de mettre en évidence un rôle direct de la taille sur la virulence. En

revanche, la forme hyphe semble être nécessaire pour échapper aux

cellules phagocytaires en provoquant des forces mécaniques qui font

éclater les phagocytes. De plus, il a été montré que les polynucléaires

37

neutrophiles peuvent discriminer les pathogènes, comme C. albicans, en

fonction de leur taille afin d’adapter la réponse du système immunitaire

(Branzk et al. 2014). Ces études suggèrent que la grande taille est un

facteur de virulence alors que la petite taille est une forme commensale.

38

Problématique, hypothèse et objectifs

Problématique

L’homéostasie de la taille cellulaire est un processus indispensable pour

assurer le bon fonctionnement des processus physiologiques. Maintenir

une taille cellulaire homogène sur le long terme permet d’assurer les

transports intracellulaires, d’optimiser les échanges avec le milieu

extérieur et d’optimiser les réactions métaboliques. Chez l’Homme, la

dérégulation de la taille cellulaire caractérise certaines pathologies, comme

les cancers (Jorgensen and Tyers 2004). Chez certaines levures

pathogènes, comme C. neoformans ou H. capsulatum, l’adaptation de la

taille semble être un facteur de virulence. En effet, ces espèces présentent

une taille hétérogène pendant l’infection de l’hôte, ce qui permettrait de

favoriser l’invasion de l’hôte (pour les cellules de petites tailles) et

d’échapper au système immunitaire (pour les cellules de grandes tailles).

Les mécanismes de la régulation de l’homéostasie de la taille n’ont jamais

été étudiés chez les champignons pathogènes. Afin d’étudier la taille

cellulaire chez ces organismes, nous avons choisi C. albicans comme

modèle d’étude. Cette espèce est la levure la plus souvent rencontrée

parmi les infections fongiques chez l’Homme. De plus, de nombreux outils

de biologie moléculaire et cellulaire ont été développés ces dernières

décennies pour cette levure modèle.

Hypothèse

Les études de l’homéostasie de la taille réalisées chez S. cerevisiae ont

montré que c’est un phénomène complexe, faisant intervenir différents

processus comme la traduction, le transport intracellulaire, le métabolisme

ou encore la transcription. S. cerevisiae et C. albicans ont une morphologie

similaire : elles ont une forme ellipsoïdale et se divisent par

39

bourgeonnement. Elles vivent dans des niches différentes : S. cerevisiae est

un saprophytes et C. albicans est un opportuniste. Ceci signifie qu’elles

doivent s’adapter à des environnements et des stress différents. De plus,

elles ont divergé et de nombreux cas de « rewiring » évolutifs ont été

rapportés. En étudiant la régulation de la taille chez C. albicans, on

s’attend à identifier de nombreux nouveaux régulateurs de la taille, dû à

leur différence de niches et au « rewiring ». Ce travail permettra de mettre

en évidence les différences entre les champignons saprophytes et

opportunistes, permettra de mieux comprendre la régulation de la taille

cellulaire chez les eucaryotes et pourrait mener à la découverte de cibles

thérapeutiques.

Objectifs

Le premier objectif de mes travaux est d’effectuer un criblage sur des

mutants de délétions hétérozygotes et homozygotes de C. albicans afin

d’identifier des gènes nécessaires pour la régulation de la taille cellulaire.

Le deuxième objectif est de caractériser des nouveaux régulateurs de la

taille identifiés dans les criblages. Pour cela, nous utilisons des techniques

de génétiques afin d’identifier de potentiels interactions entre les nouveaux

régulateurs de START, des techniques de biologie moléculaire et de

génomique fonctionnelle pour étudier la fonction de ces régulateurs.

40

Chapitre 1 - Genome-wide screen for

haploinsufficient cell size genes in the

opportunistic yeast Candida albicans.

1.1 - Résumé

Le point de contrôle START, appelé le « Restriction Point » chez les

métazoaires, est la phase du cycle cellulaire où les cellules s’engagent dans

la division de façon irréversible. Ce point de contrôle est un processus peu

compris de la prolifération cellulaire. Chez toutes les espèces eucaryotes,

une taille seuil doit être atteinte avant de passer START afin de coordonner

la croissance et la division cellulaire, ce qui permet d’assurer l’homéostasie

de la taille sur le long terme. Alors que des études ont été effectuées sur

les levures saprophytes S. cerevisiae et S. pombe pour étudier le

déterminisme génétique de la taille, nous avons peu de connaissance sur

les levures pathogènes. Puisque de nombreux régulateurs de START sont

happloinsuffisants pour la régulation de la taille cellulaire chez S.

cerevisiae, nous avons effectué une analyse de la taille sur des mutants

hétérozygotes. Pour cela, nous avons séquencé une banque de 5 639

mutants hétérozygotes possédant un « code-barre » triée en fonction de la

taille des cellules par élutriation. Notre étude a permis d’identifier des

régulateurs et des processus biologiques connus de l’homéostasie de la

taille. Nous avons également identifié des gènes spécifiques de C. albicans.

Une fraction des gènes identifiés sont également requis pour la virulence,

ce qui suggère que la régulation de la taille est un processus élémentaire

pour la virulence et l’adaptation de C. albicans dans l’hôte.

41

1.2 - Article

Genome-wide screen for haploinsufficient cell size genes in the

opportunistic yeast Candida albicans.

Julien Chaillot,* Michael A. Cook,† Jacques Corbeil,*,‡ and Adnane

Sellam*,§,1

G3: Genes, Genomes, Genetics February 1, 2017 vol. 7 no. 2 355-360;

https://doi.org/10.1534/g3.116.037986

*Infectious Diseases Research Centre, Centre Hospitalier Universitaire

(CHU) de Québec Research Center,‡Department of Molecular Medicine,

§ Department of Microbiology, Infectious Disease and Immunology, Faculty

of Medicine, Université Laval, Quebec City, Quebec, G1V 4G2 Canada,

† Centre for Systems Biology, Samuel Lunenfeld Research Institute, Mount

Sinai Hospital, Toronto, G1V 4G2 Canada

1 Corresponding author: CHU de Québec Research Center, RC-0709, 2705

Laurier Blvd., Quebec City, QC G1V 4G2, Canada. E-mail: adnane.sellam@

crchudequebec.ulaval.ca

42

1.2.1 - Abstract

One of the most critical but still poorly understood aspects of eukaryotic

cell proliferation is the basis for commitment to cell division in late G1

phase, called Start in yeast and the Restriction Point in metazoans. In all

species, a critical cell size threshold coordinates cell growth with cell

division and thereby establishes a homeostatic cell size. While a

comprehensive survey of cell size genetic determinism has been performed

in the saprophytic yeasts Saccharomyces cerevisiae and

Schizosaccharomyces pombe, very little is known in pathogenic fungi. As a

number of critical Start regulators are haploinsufficient for cell size, we

applied a quantitative analysis of the size phenome, using elutriation-

barcode sequencing methodology, to 5639 barcoded heterozygous deletion

strains of the opportunistic yeast Candida albicans. Our screen identified

conserved known regulators and biological processes required to maintain

size homeostasis in the opportunistic yeast C. albicans. We also identified

novel C. albicans-specific size genes and provided a conceptual framework

for future mechanistic studies. Interestingly, some of the size genes

identified were required for fungal pathogenicity suggesting that cell size

homeostasis may be elemental to C. albicans fitness or virulence inside the

host.

Keywords: Candida albicans, cell size, haploinsufficiency, Start control

43

1.2.2 - Introduction

In eukaryotic species, growth and division are coupled at Start (Restriction

Point in metazoans), the point in late G1 at which the cell commits to the

next round of division (Jorgensen and Tyers 2004). Cells must grow to

reach a critical size threshold at Start and thereby establish a homeostatic

cell size. Pioneering studies in the eukaryotic model Saccharomyces

cerevisiae revealed that a large proportion of the genome (>10%) and of

cellular functions impact on the size of cells, in processes ranging from

ribosome biogenesis (Ribi) and mitochondrial function, to signal

transduction and cell cycle control (Jorgensen et al. 2002; Zhang et al.

2002; Soifer and Barkai 2014). While follow-on studies revealed many

crucial players in size regulation, such as the G1 repressor Whi5 and the

Ribi master regulators Sch9 and Sfp1, both the central mechanism by

which cells sense their size and the means by which they alter their size

set-point to meet environmental demands remain elusive (Turner et al.

2012).

Candida albicans is a diploid ascomycete yeast that is an important

commensal and opportunistic pathogen in humans colonizing primarily

mucosal surfaces, gastrointestinal and genitourinary tracts, and skin

(Berman and Sudbery 2002). Interest in C. albicans is not limited to

understanding its function as a pathogenic organism, as it has an

ecological niche that is obviously distinct from the classic model

ascomycete S. cerevisiae. C. albicans has served as an important

evolutionary milepost with which to assess conservation of biological

mechanisms. Recent investigations uncovered an extensive degree of

rewiring of fundamental signaling and transcriptional regulatory networks

as compared to S. cerevisiae and other fungi (Lavoie et al. 2009; Sellam et

al. 2009; Blankenship et al. 2010; Homann et al. 2009; Sandai et al.

2012).

44

Haploinsufficiency is a phenotypic feature wherein a deletion of one allele

in a diploid genome leads to a discernable phenotype. In eukaryotes, a

number of critical size regulators, such as the G1 cyclin Cln3 and the AGC

kinase Sch9 in S. cerevisiae, and the Myc oncogene in Drosophila

melanogaster are haploinsufficient (Jorgensen et al. 2002; Barna et al.

2008; Sudbery et al. 1980). Here, we exploited gene haploinsufficiency to

identify genes and biological process that influence size control in C.

albicans. Given the importance of C. albicans as an emerging eukaryotic

model, very little is known regarding the genetic networks that control size

homeostasis in this opportunistic yeast. A systematic screen using

elutriation-based size fractioning (Cook et al. 2008) coupled to barcode

sequencing (Bar-seq) identified 685 genes (10% of the genome) that

influenced size control under optimal growth conditions. While C. albicans

and S. cerevisiae share the morphological trait of budding, and core cell

cycle and growth regulatory mechanisms (Berman 2006; Cote et al. 2009),

a limited overlap was obtained when comparing the size phenome of both

yeasts. This genome-wide survey will serve as a primary entry point into

the global cellular network that couples cell growth and division in C.

albicans.

45

1.2.3 - Materials and methods

Strains and growth conditions

C. albicans SC5314 and CAI4 (ura3::imm434/ura3::imm434

iro1/iro1::imm434) (Fonzi and Irwin 1993) wild-type (WT) strains, and

mutants of the Merck DBC (Double BarCoded) heterozygous diploid

collection (Xu et al. 2007) were routinely maintained at 30° on YPD (1%

yeast extract, 2% peptone, 2% dextrose, and 50 mg/ml uridine) or

synthetic complete (0.67% yeast nitrogen base with ammonium sulfate,

2.0% glucose, and 0.079% complete supplement mixture) media. The

Merck DBC collection is available for public distribution through the NRC’s

Royalmount Avenue Research Facility (Montreal, Canada).

Combination of C. albicans mutants into a single pool

A sterilized 384-well pin tool was used to transfer DBC mutant cells into

Nunc Omni Trays containing YPD-agar, and colonies were grown for 48 hr

at 30°. Missing or slow growing colonies were grown separately by

repinning 3.5 µl from the initial liquid cultures. Each plate was overlaid

with 5 ml of YPD, and cells were resuspended using Lazy-L spreader and

harvested by centrifugation for 5 min at 1800 × g. The obtained cell pellet

was resuspended in 20 ml fresh YPD and DMSO was added to 7% (v/v).

Mutant pools were aliquoted and stored at −80°.

Cell size selection by centrifugal elutriation

The mutant pool was size-fractioned using centrifugal elutriation with the

Beckman JE-5.0 elutriation system. This technique separates cells on the

basis of size. A tube of pooled mutant population was thawed on ice and

used to inoculate 2 L of YPD at an OD595 of 0.05. Mutant cells were grown

46

for four generations at 30°C under agitation to reach ∼5 × 1010 cells. Cells

were then pelleted by centrifugation and resuspended in 50 ml fresh YPD.

To disrupt potential cell clumps and separate weakly attached mother and

daughter cells, the 50 mL pooled cells were gently sonicated twice for 30

sec. The resuspended cells were directly loaded into the elutriator chamber

of the Beckman JE-5.0 elutriation rotor. A 1 mL sample of cells was

retained separately as a pre-elutriated cell fraction. The flow rate of the

pump was set to 8 mL/min to ensure the loading of cells. To elute small

cell size mutant fractions, the pump flow rate was increased in a step-wise

fashion (in 2–4 mL/min increments). For each flow rate, a volume of 250

mL was collected from the output line of the rotor.

Bar-seq

Bar-seq was performed using Illumina HiSeq2500 platform. Genomic DNA

was extracted from each cell fraction using YeaStar kit (Zymo Research).

The 20-bp UpTag barcode of each strain were amplified by PCR (Xu et al.

2007). Primers used for PCR recognize the common region of each barcode

and contain the multiplexing tag and sequences required for hybridization

to the Illumina flow cell. PCR products were purified from an agarose gel

using the QIAquick Gel Extraction kit (Qiagen) and quantified by

QuantiFluor dsDNA System (Promega). Bar-seq data were processed as

following: after filtering out low frequency barcode counts, the complete set

of replicate barcode reads were normalized using a cyclic loess algorithm

(R package “limma”). Reads from individual elutriation fractions, relative to

the pre-elutriation population, were further M-A loess normalized and

converted to Z scores.

Confirmation of cell size phenotypes

47

Cell size determination was performed using a Z2-Coulter Counter

channelizer (Beckman Coulter). The Coulter principal is based on electrical

impedance measurement, which is proportional to cell volume (Coulter

1953). C. albicans cells were grown overnight in YPD at 30°, diluted 1000-

fold into fresh YPD and grown for 5 hr at 30° to reach a final density of 5 ×

106–107 cells/ml, a range in which size distributions of the different WT

strain used in this study do not change. A total of 100 µl of exponentially

growing cells was diluted in 10 ml of Isoton II electrolyte solution,

sonicated three times for 10 sec and the distribution measured at least

three times on a Z2-Coulter Counter. Size distribution data were

normalized to cell counts in each of 256 size bins and size reported as the

peak median value for the distribution. Data analysis and size distribution

visualization were performed using the Z2-Coulter Counter AccuComp

software.

Determination of critical cell size

Critical sizes of cln3/CLN3, cdc28/CDC28 and sch9/SCH9 mutants were

determined using budding index as a function of size. G1 daughter cells

were obtained using the JE-5.0 centrifugal elutriation system (Beckman

Coulter) as described previously (Tyers et al. 1993). C. albicans G1-cells

were released in fresh YPD medium and fractions were harvested at an

interval of 10 min to monitor bud index. Additional fractions were collected

to assess transcript levels of the RNR1 and ACT1 as cells progressed along

the G1 phase.

Real-time quantitative PCR

A total of 108 G1 phase cells were harvested, released into fresh YPD

medium, grown for 10 min prior to harvesting by centrifugation and stored

at −80°. Total RNA was extracted using the RNAeasy purification kit

48

(Qiagen) and glass bead lysis in a Biospec Mini 24 bead-beater, as

previously described (Sellam et al. 2009). cDNA was synthesized from 2 µg

of total RNA using the SuperScript III Reverse Transcription system [50

mm Tris-HCl, 75 mm KCl, 10 mm dithiothreitol, 3 mm MgCl2, 400 nm

oligo(dT)15, 1 m random octamers, 0.5 mm dNTPs, and 200 U Superscript

III reverse transcriptase]. The total volume was adjusted to 20 µl, and the

mixture was then incubated for 60 min at 42°. Aliquots of the resulting

first-strand cDNA were used for real-time quantitative PCR (qPCR)

amplification experiments. qPCR was performed using the iQ 96-well PCR

system for 40 amplification cycles and QuantiTect SYBR Green PCR

master mix (Qiagen). Transcript levels of RNR1 were estimated using the

comparative Ct method, as described by Guillemette et al. (2004), and the

C. albicans ACT1 open reading frame as a reference. The primer sequences

were as follows: RNR1-forward: 5′-GACTATCTACCATGCTGCTGTTG-3′;

RNR1-reverse: 5′-GGTGCAACCAACAAGGAGTT-3′; ACT1-forward: 5′-

GAAGCCCAATCCAAAAGA-3′; and ACT1-reverse: 5′-

CTTCTGGAGCAACTCTCAATTC-3′.

Gene ontology analysis

Gene ontology (GO) term enrichment of size mutants was determined using

the Generic GO Term Finder tool (http://go.princeton.edu/cgi-

bin/GOTermFinder), with multiple hypothesis correction (Boyle et al.

2004). Descriptions related to gene function in Supplemental Material,

Table S2 were extracted from the Candida Genome Database (CGD)

database (Inglis et al. 2012). Information related to gene

essentiality/dispensability was taken from O’Meara et al. (2015) and the

CGD database.

Data availability

49

The authors state that all data necessary for confirming the conclusions

presented in the article are represented fully within the article.

50

1.2.4 - Results and discussion

The Cln3-Cdc28 kinase complex and Sch9 are haploinsufficient for

cell size

In S. cerevisiae, a number of critical Start regulators are haploinsufficient

for cell size, including the rate-limiting G1 cyclin Cln3 and a number of

essential ribosome biogenesis factors, such as the AGC kinase Sch9

(Sudbery et al. 1980; Jorgensen et al. 2002). To test whether size

haploinsufficiency exists in C. albicans homologs, size distributions of the

heterozygous mutants of AGC kinase Sch9, the cyclin Cln3 G1, and its

associated cyclin-dependent kinase Cdc28 were examined. Both

cln3/CLN3 and cdc28/CDC28 showed an increase of size as compared to

their congenic parental strain, with median sizes 13% (59 fl) and 19% (62

fl) larger than the WT strain (52 fl), respectively (Figure 1A). As in S.

cerevisiae, sch9/SCH9 exhibited a reduced size of ∼23% (40 fl) as

compared to WT.

Two hallmarks of Start, namely SBF-dependent transcription and bud

emergence, were delayed in both cln3/CLN3 and cdc28/CDC28 and

accelerated in sch9/SCH9, demonstrating that the Cln3-Cdc28 complex

and Sch9 regulate the cell size threshold at Start. The cln3/CLN3 mutant

passed Start after growing to 92 fl, 24% higher than the parental WT cells,

which budded at 74 fl (Figure 1B). Similarly, cdc28/CDC28 reached Start

at 105 fl, which is 41% higher than WT. The onset of G1/S transcription

was delayed in both mutants, as judged by the expression peak of the G1-

transcript RNR1 (Figure 1C). The small mutant sch9/SCH9 passed Start

at 30 fl, a size 60% smaller than the WT, and displayed accelerated G1/S

transcription (Figure 1, B and C). These data demonstrate that, as in S.

cerevisiae, size haploinsufficiency in C. albicans can be used to screen for

dosage-dependent regulators of growth and division at Start.

51

A high-throughput screen for cell size haploinsufficiency

To identify all dosage-sensitive regulators of size in C. albicans, a genome-

wide screen was performed where pooled mutants were separated based on

their size by centrifugal elutriation and their abundance determined by

Bar-seq. This method has been previously validated in S. cerevisiae (Cook

et al. 2008), yielding a high degree of overlap when compared to a strain-

by-strain analyses (Jorgensen et al. 2002) (Figure 2A). In the current

study, we screened a comprehensive set of 5470 heterozygous deletion

diploid strains from the Merck DBC collection (Xu et al. 2007) for cell size

defects. This collection covers 90% of the 6046 protein-coding open

reading frames based on the current CGD annotation (Binkley et al. 2014).

Two small cell size fractions were obtained by centrifugal elutriation and

were used for these experiments (Figure 2B). Small cells and

corresponding small deletion mutants are enriched in these fractions,

while large cells strains are depleted. To determine mutant abundance in

each fraction, genomic DNA of each pool was extracted and barcodes were

PCR-amplified and sequenced. Abundance of each mutant in each fraction

was appreciated by calculating the ratio of elutriated cells counts over

counts of pre-elutriated cells.

To identify mutants with size defects, a two-step filter was applied. First, a

size cut-off value was determined based on a benchmark set of conserved

small (sch9/SCH9) and large (cln3/CLN3 and cdc28/CDC28) size mutants

for which size was reduced or increased at least 12% as compared to the

parental WT strain. Second, a normalized Z-score of 1.5 and −1.5 was used

to identify both small (whi) and large (lge) size mutants, respectively. A

total of 12 size mutants were excluded from our analysis, since they were

found in both whi and lge datasets (Table S1). Microscopic examination

revealed that these mutants had a remarkable size heterogeneity and grew

predominantly as pseudohyphae. Based on these criteria, we identified 685

mutants that exhibited a size defect in both elutriated fractions. This

52

includes 382 whi and 303 lge mutants (Table S2). As expected, cln3/CLN3

and cdc28/CDC28 mutants were identified as lge mutants, while

sch9/SCH9 was found among the smallest mutant in the elutriated pools.

A total of 15 whi and 15 lge mutants were randomly selected and their size

was measured by electrolyte displacement on a Coulter Z2 channelizer.

The obtained data confirmed size defect in all 30 mutants examined (Table

S3). Size phenotype of two heterozygous mutants, including the

rac1/RAC1 (Bassilana and Arkowitz 2006) and sec15/SEC15 (Guo et al.

2016) previously shown as lge mutants, were confirmed by our analysis.

However, the protein kinase C pkc1/PKC1 mutant exhibited a whi

phenotype in our investigation, while it was previously identified as large

size (Paravicini et al. 1996). To clear up this contradiction, we have created

new pkc1/PKC1 mutants. At least five independent transformants were

sized and the whi phenotype was confirmed for all of them (data not

shown).

Synthesis of ribosome and cell cycle are required for cell size

homeostasis

GO enrichment analysis revealed that mutation in genes related to rRNA

processing and ribosome biogenesis confer small cell size, while mutations

of cell cycle genes result in lge phenotype (Figure 2, C and D and Table

S2). Heterozygous deletion of genes of different functional categories

related to protein translation, including rRNA processing (CSL4, UTP7,

DIS3, NOP53, FCF2, UTP23, DIP2, UTP15, SAS10), ribosome exports (RIX7,

RRS1, NUP84, NUP42, RPS5, NOG1), translation elongation (RIA1, EFT2,

CEF3), and transcription of RNA Pol I and III promoters (CDC73, RPB8,

RPA49, RPB10, SPT5, RPA12, RPC25), exhibited a whi phenotype.

Heterozygous deletion mutation of structural components of both

cytoplasmic (RPL18, RPL20B, RPL21A, RPS5, UBI3) and mitochondrial

(RSM24, RSM26, NAM9, MRPL20) ribosomes decreased cell size. As in S.

53

cerevisiae, mutants of the ribosome biogenesis regulator Sch9 and the

transcription factor Sfp1 had a small size. Overall, as shown in other

eukaryotic organisms, these data lead to the hypothesis that the rate of

ribosome biogenesis or translation is a critical element underlying cell size

control (Jorgensen et al. 2004). Haploinsufficient whi mutants also

corresponded to catabolic processes associated mainly with ubiquitin-

dependent proteolysis (DOA1, GRR1, UBP1, UBP2, UFD2, SSH4, UBX7,

RPN2, TIP120, TUL1, RPT2, PRE1, GID7).

Lge mutants were predominantly defective in functions related to the

mitotic cell cycle (Figure 2D and Table S2). These mutants include genes

required for G1/S transition (G1 cyclin Cln3 and Ccn1, Cdc28 and Met30)

suggesting that delay in G1 phase is the primary cause of their increased

size. We also found that mutations in processes related to DNA replication

(ORC3, ORC4, MCM3, CDC54, RFC3, PIF1, SMC4, ELG1), G2/M transitions

(HSL1, CDC34) and cytoskeleton-dependent cytokinesis (MYO5, INN1,

SEC15, CDC5, CHS1) conferred an increase of cell size. A similar

observation was reported in S. cerevisiae, where a recent genome-wide

microscopic quantitative size survey uncovered that mutants of the G2/M

transition and mitotic exit fail to properly control their size. The large size

of cell cycle mutants support the fact that cell growth and cell cycle are

separate processes and cells continue to grow and increase their size

without commitment to divide. Other investigations propose a model

where, in addition to the G1-phase, size is sensed and controlled at G2/M

checkpoint (Anastasia et al. 2012; King et al. 2013; Harvey and Kellogg

2003; Soifer and Barkai 2014). However, further analysis will be necessary

to provide further insights into the presumptive linkage of each phase of

the cell cycle and size homeostasis in C. albicans.

While a large proportion of whi mutants in C. albicans were related to

ribosome biogenesis, inactivation of genes controlling translation initiation

54

(ASC1, SCD6, PAB1, GCD6, GCD2, SUI1, EIF4E, GCD11) resulted in lge

phenotype. A similar finding was reported in different genome-scale

surveys of size phenome in S. cerevisiae (Jorgensen et al. 2002; Soifer and

Barkai 2014). This large size phenotype in these mutants could be

explained by the fact that regulators of Start onset, such as G1 cyclin Cln3

(Barbet et al. 1996; Polymenis and Schmidt 1997), are sensitive to the rate

of translation initiation.

Plasticity of size phenome and C. albicans fitness

Recent evidence has uncovered an extensive degree of rewiring of both cis-

transcriptional regulatory circuits and signaling pathways across many

cellular and metabolic processes between the two budding yeasts, C.

albicans and S. cerevisiae (Lavoie et al. 2010; Li and Johnson 2010;

Blankenship et al. 2010; Lavoie et al. 2009; Sellam and Whiteway 2016).

In S. cerevisiae, a similar size haploinsufficiency screen was performed in

heterozygous diploid strains of essential genes (Jorgensen et al. 2002). To

assess the extent of conservation and plasticity of the size phenome, genes

that were haploinsufficient for cell size in C. albicans were compared to

their corresponding orthologs in S. cerevisiae. This analysis revealed a

limited overlap between the two species with five whi (rpl18a, sch9, rlp24,

nop2, nog1) and two lge (rpt4, cln3) mutants in common. In fact, genes

with reciprocal size phenotypes were similar in frequency (the whi mutants

rpt2/RPT2 and pkc1\PKC1 in C. albicans had lge phenotype in S.

cerevisiae).

Interestingly, the corresponding homozygous deletion mutants of many C.

albicans haploinsufficient size genes were shown to be required for

virulence. A total of 69 size genes (representing ∼10%), including 47 small

and 22 large size mutants, in our dataset were linked to C. albicans

virulence or adaptation in the human host (Figure 2E). This suggests that

55

cell size is an important virulence trait that can be targeted by antifungal

therapy. Hypothetically, virulence defect in small size mutant could be

linked to the reduced surface of the contact interface between C. albicans,

with either host cells or medical devices in case of biofilm infections.

Indeed, we have previously shown that the whi transcription factor mutant

ahr1 had attenuated virulence and exhibited a decreased attachment

ability to abiotic surface such polystyrene, which consequently impaired

biofilm formation (Askew et al. 2011). On the other hand, virulence defect

in lge mutant could be associated with the fact that cells with large

surfaces had a decreased lifespan which might impact their fitness and

their viability inside the host (Yang et al. 2011; Mortimer and Johnston

1959).

While the link between C. albicans size and virulence remains

uncharacterized, many investigations reported that many other fungal

pathogens such as Cryptococcus neoformans and Mucor circinelloides

adjust their cell size to access to specific niche in the host or to escape

from immune cells (Wang and Lin 2012). In C. albicans, recent

investigations have shown that large gastrointestinally induced transition

cells, as compared to the standard yeast form, define the commensal form

of this fungus (Pande et al. 2013). Furthermore, Tao et al. (2014) recently

uncovered a novel intermediate phase between the White and C. albicans

mating competent opaque phenotypes, called the Gray phenotype. The

Gray cells are similar to opaque cells in general shape, however, they

exhibit a small size and low mating efficiency. The Gray cell type has

unique virulence characteristics, with a high ability to cause cutaneous

infections and a reduced capacity in colonizing internal organs such as

kidney, lung, and brain. Taken together, these lines of evidence emphasize

the possible link between cell size and C. albicans fitness.

56

In summary, we provided the first comprehensive genome-wide survey of

haploinsufficient cell size in a eukaryotic organism. In contrast to S.

cerevisiae, where a similar screen was limited to essential genes

(Jorgensen et al. 2002), our screen spanned the genome. A total of 300

(43.8%) dispensable genes and only 87 (12.7%) essential genes were

haploinsufficient for size. Overall, our screen identified known conserved

regulators (Sch9, Sfp1, Cln3) and biological processes (ribosome biogenesis

and cell cycle control) required to maintain size homeostasis in this

opportunistic yeast. We also identified novel C. albicans size-specific genes

and provided a conceptual framework for future mechanistic studies.

Interestingly, some of the size genes identified were required for fungal

pathogenicity, suggesting that cell size homeostasis may be elemental to C.

albicans fitness or virulence inside the host.

1.2.5 - Acknowledgments

We thank Lynda Robitaille for technical assistance and National Research

Council (NRC) Canada for providing the Merck DBC mutants used in this

work. Work in A.S.’s laboratory is supported by Fonds de Recherche du

Québec-Santé (FRQS) (Établissement de jeunes chercheurs) and the

Natural Sciences and Engineering Research Council of Canada discovery

grant (no. 06625). A.S. is a recipient of the FRQS J1 salary award. Julien

Chaillot was supported by Université Laval Faculty of Medicine and Centre

Hospitalier Universitaire de Québec (CHUQ) foundation Ph.D.

scholarships.

57

1.2.6 - References

Anastasia S. D., Nguyen D. L., Thai V., Meloy M., MacDonough T., et al. ,

2012. A link between mitotic entry and membrane growth suggests a novel model for cell size control. J. Cell Biol. 197(1): 89–104.

Askew C., Sellam A., Epp E., Mallick J., Hogues H., et al. , 2011. The zinc cluster transcription factor Ahr1p directs Mcm1p regulation of Candida albicans adhesion. Mol. Microbiol. 79: 940–953.

Barbet N. C., Schneider U., Helliwell S. B., Stansfield I., Tuite M. F., et al. ,

1996. TOR controls translation initiation and early G1 progression in yeast. Mol. Biol. Cell 7(1): 25–42.

Barna M., Pusic A., Zollo O., Costa M., Kondrashov N., et al. , 2008. Suppression of Myc oncogenic activity by ribosomal protein

haploinsufficiency. Nature 456(7224): 971–975.

Bassilana M., Arkowitz R. A., 2006. Rac1 and Cdc42 have different roles in Candida albicans development. Eukaryot. Cell 5(2): 321–329.

Berman J., 2006. Morphogenesis and cell cycle progression in Candida albicans. Curr. Opin. Microbiol. 9(6): 595–601.

Berman J., Sudbery P. E., 2002. Candida albicans: a molecular revolution built on lessons from budding yeast. Nat. Rev. Genet. 3(12):

918–930. Binkley J., Arnaud M. B., Inglis D. O., Skrzypek M. S., Shah P., et al. ,

2014. The Candida genome database: the new homology information page highlights protein similarity and phylogeny. Nucleic Acids Res.

42(Database issue): D711–D716. Blankenship J. R., Fanning S., Hamaker J. J., Mitchell A. P., 2010. An

extensive circuitry for cell wall regulation in Candida albicans. PLoS Pathog. 6(2): e1000752.

Boyle E. I., Weng S., Gollub J., Jin H., Botstein D., et al. , 2004. GO: termfinder–open source software for accessing gene ontology information

and finding significantly enriched gene ontology terms associated with a list of genes. Bioinformatics 20(18): 3710–3715.

58

Cook M. A., Chan C. K., Jorgensen P., Ketela T., So D., et al. , 2008. Systematic validation and atomic force microscopy of non-covalent short

oligonucleotide barcode microarrays. PLoS One 3(2): e1546. Cote P., Hogues H., Whiteway M., 2009. Transcriptional analysis of the

Candida albicans cell cycle. Mol. Biol. Cell 20(14): 3363–3373.

Coulter, H., 1953 Means for Counting Particles Suspended in a Fluid. United States Patent No. 2656508.

Fonzi W. A., Irwin M. Y., 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134(3): 717–728.

Guillemette T., Sellam A., Simoneau P., 2004. Analysis of a nonribosomal peptide synthetase gene from Alternaria brassicae and

flanking genomic sequences. Curr. Genet. 45(4): 214–224. Guo P. P., Yong J. Y., Wang Y. M., Li C. R., 2016. Sec15 links bud site

selection to polarised cell growth and exocytosis in Candida albicans. Sci. Rep. 6: 26464.

Harvey S. L., Kellogg D. R., 2003. Conservation of mechanisms controlling entry into mitosis: budding yeast wee1 delays entry into mitosis

and is required for cell size control. Curr. Biol. 13(4): 264–275. Homann O. R., Dea J., Noble S. M., Johnson A. D., 2009. A phenotypic

profile of the Candida albicans regulatory network. PLoS Genet. 5(12): e1000783.

Inglis D. O., Arnaud M. B., Binkley J., Shah P., Skrzypek M. S., et al. , 2012. The Candida genome database incorporates multiple Candida

species: multispecies search and analysis tools with curated gene and protein information for Candida albicans and Candida glabrata. Nucleic Acids Res. 40(Database issue): D667–D674.

Jorgensen P., Tyers M., 2004. How cells coordinate growth and division.

Curr. Biol. 14(23): R1014–R1027. Jorgensen P., Nishikawa J. L., Breitkreutz B. J., Tyers M., 2002.

Systematic identification of pathways that couple cell growth and division in yeast. Science 297(5580): 395–400.

Jorgensen P., Rupes I., Sharom J. R., Schneper L., Broach J. R., et al. , 2004. A dynamic transcriptional network communicates growth

potential to ribosome synthesis and critical cell size. Genes Dev. 18(20): 2491–2505.

59

King K., Kang H., Jin M., Lew D. J., 2013. Feedback control of Swe1p

degradation in the yeast morphogenesis checkpoint. Mol. Biol. Cell 24(7): 914–922.

Lavoie H., Hogues H., Whiteway M., 2009. Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi. Curr.

Opin. Microbiol. 12(6): 655–663. Lavoie H., Hogues H., Mallick J., Sellam A., Nantel A., et al. , 2010.

Evolutionary tinkering with conserved components of a transcriptional regulatory network. PLoS Biol. 8(3): e1000329.

Li H., Johnson A. D., 2010. Evolution of transcription networks–lessons from yeasts. Curr. Biol. 20(17): R746–R753.

Mortimer R. K., Johnston J. R., 1959. Life span of individual yeast cells. Nature 183(4677): 1751–1752.

O’Meara T. R., Veri A. O., Ketela T., Jiang B., Roemer T., et al. , 2015. Global analysis of fungal morphology exposes mechanisms of host cell

escape. Nat. Commun. 6: 6741.

Pande K., Chen C., Noble S. M., 2013. Passage through the mammalian gut triggers a phenotypic switch that promotes Candida albicans commensalism. Nat. Genet. 45(9): 1088–1091.

Paravicini G., Mendoza A., Antonsson B., Cooper M., Losberger C., et al. ,

1996. The Candida albicans PKC1 gene encodes a protein kinase C homolog necessary for cellular integrity but not dimorphism. Yeast 12(8): 741–756.

Polymenis M., Schmidt E. V., 1997. Coupling of cell division to cell growth by translational control of the G1 cyclin CLN3 in yeast. Genes Dev.

11(19): 2522–2531.

Sandai D., Yin Z., Selway L., Stead D., Walker J., et al. , 2012. The evolutionary rewiring of ubiquitination targets has reprogrammed the regulation of carbon assimilation in the pathogenic yeast Candida

albicans. MBio 3(6): e00495-12.

Sellam A., Whiteway M., 2016. Recent advances on Candida albicans biology and virulence. F1000 Res. 5: 2582.

60

Sellam A., Tebbji F., Nantel A., 2009. Role of Ndt80p in sterol metabolism regulation and azole resistance in Candida albicans. Eukaryot.

Cell 8(8): 1174–1183. Soifer I., Barkai N., 2014. Systematic identification of cell size regulators

in budding yeast. Mol. Syst. Biol. 10: 761.

Sudbery P. E., Goodey A. R., Carter B. L., 1980. Genes which control cell proliferation in the yeast Saccharomyces cerevisiae. Nature 288(5789): 401–404.

Tao L., Du H., Guan G., Dai Y., Nobile C. J., et al. , 2014. Discovery of a “white-gray-opaque” tristable phenotypic switching system in Candida

albicans: roles of non-genetic diversity in host adaptation. PLoS Biol. 12(4): e1001830.

Turner J. J., Ewald J. C., Skotheim J. M., 2012. Cell size control in yeast. Curr. Biol. 22(9): R350–R359.

Tyers M., Tokiwa G., Futcher B., 1993. Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator

of Cln1, Cln2 and other cyclins. EMBO J. 12(5): 1955–1968.

Wang L., Lin X., 2012. Morphogenesis in fungal pathogenicity: shape, size, and surface. PLoS Pathog. 8(12): e1003027.

Xu D., Jiang B., Ketela T., Lemieux S., Veillette K., et al. , 2007. Genome-wide fitness test and mechanism-of-action studies of inhibitory

compounds in Candida albicans. PLoS Pathog. 3(6): e92. Yang J., Dungrawala H., Hua H., Manukyan A., Abraham L., et al. , 2011.

Cell size and growth rate are major determinants of replicative lifespan. Cell Cycle 10(1): 144–155.

Zhang J., Schneider C., Ottmers L., Rodriguez R., Day A., et al. , 2002. Genomic scale mutant hunt identifies cell size homeostasis genes in S. cerevisiae. Curr. Biol. 12(23): 1992–2001.

61

1.2.7 - Figures

Figure 1 - The Cln3-Cdc28 kinase complex and the AGC kinase Sch9

control Start in C. albicans. (A) Size distributions of the WT strain (CAI4)

as compared to lge mutants cln3/CLN3 and cdc28/CDC28, as well as the

whi mutant sch9/SCH9. (B and C) Start is delayed in cln3/CLN3 and

cdc28/CDC28 and accelerated in sch9/SCH9. (B) Elutriated G1 phase

daughter cells were released into fresh media and monitored for bud

emergence as a function of size. (C) G1/S transcription. RNR1 transcript

level was assessed by quantitative real-time PCR and normalized to ACT1

levels.

62

Figure 2 – Systematic cell size screen using molecular barcode elutriation

and Bar-seq. (A) Centrifugal elutriation separates cells on the basis of size.

Progressive increase of the rate of flow of liquid medium counter to the

direction of centrifugal force elutes yeast cells of increasingly larger size

from the chamber. (B) Size distributions of pooled DBC mutants before

(pre-elutriated) and after elutriation of two small cell fractions (28 and 34

ml/min). (C and D) GO terms enrichment of whi (C) and lge (D) mutants (P

> 1e−05). GO analysis was performed using GOTermFinder

(http://go.princeton.edu/cgi-bin/GOTermFinder). (E) Overlap between C.

albicans genes haploinsufficient for cell size and those affecting virulence

phenotypes. Avirulent mutant phenotypes were obtained from CGD based

on decreased competitive fitness in mice and/or reduced invasion and

damage to host cells.

63

Chapitre 2 - The p38/HOG stress-activated protein

kinase network couples growth to division in

Candida albicans.

2.1 - Résumé

La régulation de la taille cellulaire est un processus complexe qui répond

aux signaux environnementaux. L'analyse de la taille chez la levure

pathogène C. albicans a permis de mettre en évidence 66 gènes qui

modifient considérablement la taille cellulaire. Peu de gènes nécessaires

pour la régulation de la taille chez C. albicans sont conservés chez S.

cerevisiae. Un nouveau régulateur de la taille de C. albicans est la voie

MAPK p38/HOG, une voie conservée qui contrôle la réponse au stress

osmotique. L'activité basale de Hog1 inhibe le complexe de facteurs de

transcriptions SBF d'une manière indépendante du stress pour retarder la

transition G1/S. La voie HOG régule également la biogenèse des ribosomes

par l'intermédiaire du régulateur transcriptionnel Sfp1. Hog1 se lie aux

promoteurs des régulateurs de la biogénèse des ribosomes ainsi qu’à des

régulateurs de la transition G1/S, liant ainsi la croissance et la division

cellulaire. Cette étude a mis en évidence la plasticité évolutive du contrôle

de la taille et a identifié le module HOG comme carrefour de signalisation

coordonnant la croissance et la division.

64

2.2 - Article

The p38/HOG stress-activated protein kinase network couples growth

to division in Candida albicans.

Adnane Sellam1,2*, Julien Chaillot1, Jaideep Mallick3, Faiza Tebbji1, Julien

Richard Albert4, Michael A. Cook5, Mike Tyers3,5*

1 Infectious Diseases Research Centre (CRI), CHU de Québec Research Center (CHUQ),

Université Laval, Quebec City, QC, Canada

2 Department of Microbiology, Infectious Disease and Immunology, Faculty of

Medicine, Université Laval, Quebec City, QC, Canada

3 Institute for Research in Immunology and Cancer (IRIC), Department of

Medicine, Université de Montréal, Montréal, Québec, Canada

4 Department of Medical Genetics, University of British Columbia, Vancouver,

British Columbia, Canada

5 Centre for Systems Biology, Samuel Lunenfeld Research Institute, Mount Sinai

Hospital, Toronto, Canada M5G 1X5

* Correspondence: [email protected] and

[email protected]

65

2.2.1 - Abstract

Cell size is a complex trait that responds to developmental and

environmental cues. Quantitative size analysis of mutant strain collections

disrupted for protein kinases and transcriptional regulators in the

pathogenic yeast Candida albicans uncovered 66 genes that altered cell

size, few of which overlapped with known size genes in the budding yeast

Saccharomyces cerevisiae. A potent size regulator specific to C. albicans

was the conserved p38/HOG MAPK module that mediates the osmostress

response. Basal HOG activity inhibited the SBF G1/S transcription factor

complex in a stress-independent fashion to delay the G1/S transition. The

HOG network also governed ribosome biogenesis through the master

transcriptional regulator Sfp1. Hog1 bound to the promoters and cognate

transcription factors for ribosome biogenesis regulons and interacted

genetically with the SBF G1/S machinery, and thereby directly linked cell

growth and division. These results illuminate the evolutionary plasticity of

size control and identify the HOG module as a nexus of cell cycle and

growth regulation.

66


A central and longstanding problem in cell biology is how cells maintain a

uniform cell size, whether in single-celled organisms or in the multitude of

tissues of metazoans [1, 2]. In most eukaryotes, attainment of a critical cell

size is necessary for commitment to cell division in late G1 phase, called

Start in yeast and the Restriction Point in metazoans. This critical cell size

threshold coordinates cell growth with cell division to establish a

homeostatic cell size [1]. The dynamic control of cell size facilitates

adaptation to changing environmental conditions in microorganisms and

therefore is essential to maximize fitness [3, 4]. In the budding yeast

Saccharomyces cerevisiae, the size threshold is dynamically modulated by

nutrients. Pre-Start G1 phase cells grown in the optimal carbon source

glucose pass Start at a smaller size if shifted to glycerol, whereas cells

shifted from a poor to rich nutrient source pass Start at a larger size [1, 5].

Nutrient conditions similarly dictate cell size in the fission yeast

Schizosaccharomyces pombe, although control is primarily exerted at the

G2/M transition [5]. In metazoans, cell size control is important for tissue,

organ and organism size [6], and is dynamically regulated through changes

in growth rate and cell cycle length [7]. Cell size is often perturbed in

human disease, for example in diabetes, tuberous sclerosis, mitochondrial

disorders, aneuploid syndromes, cancer, and aging [1, 8]. Notably, a loss of

cell size homeostasis, termed pleomorphism, correlates with poor cancer

prognosis [9].

Cell size is fundamentally dictated by the balance between cell growth and

division. The analysis of small-sized mutants in yeast led to key insights

into the cell division machinery [10–14]. In all eukaryotes, cell division is

controlled by the cyclin dependent kinases (CDKs), which serve to

coordinate the replication and segregation of the genome [15]. In S.

cerevisiae, the G1 cyclins Cln1, Cln2 and Cln3 trigger Start, whereas the

67

B-type cyclins Clb1-Clb6 catalyze replication and mitosis, all via activation

of the same Cdc28 kinase catalytic subunit. The expression of ~200 genes

at the end of G1 phase, most vitally CLN1/2, is controlled by transcription

factor complexes composed of Swi4 and Swi6 (SBF), and Mbp1 and Swi6

(MBF). Activation of SBF/MBF depends primarily on the Cln3-Cdc28

kinase, the key target of which is Whi5, an inhibitor of SBF/MBF-

dependent transcription [16, 17]. Another transcriptional inhibitor called

Nrm1 specifically inhibits MBF after Start but does not cause a marked

size phenotype under conditions of nutrient sufficiency [17]. Size control in

S. pombe is exerted through inhibition of G2/M phase CDK activity by the

Wee1 kinase, which is encoded by the first size control gene discovered

[10, 12]. Size is also partially regulated at Start in S. pombe through an

SBF/MBF- like G1/S transcription factor complex and the Nrm1 inhibitor

[18]. The CDK-dependent control of G1/S transcription in metazoans is

analogously mediated by the cyclin D-Rb-E2F axis [16, 19, 20].

Cell growth depends on the coordinated synthesis of protein, RNA, DNA

and other macromolecules [1, 21, 22]. The production of ribosomes

consumes a large fraction of cellular resources and depends on an

elaborate ribosome biogenesis machinery [1] that is controlled in part by

the conserved TOR (Target Of Rapamycin) nutrient sensing network [6]. In

budding yeast, the deletion of ribosome biogenesis (Ribi) factors causes a

small cell size, and loss of two master regulators of Ribi gene expression,

the transcription factor Sfp1 and the AGC kinase Sch9, causes cell to

become extremely small [23]. These observations lead to the hypothesis

that the rate of ribosome biogenesis is one metric that dictates cell size

[24]. Sfp1 and Sch9 are critical effectors of the TOR pathway and form part

of a dynamic, nutrient-responsive network that controls the expression of

Ribi and ribosomal protein (RP) genes [24]. Sfp1 activity is controlled

through its TOR-dependent nuclear localization [23–26] and is physically

linked to the secretory system by its interaction with the Rab escort factor

68

Mrs6 [25, 27]. Sch9 is phosphorylated and activated by TOR, and in turn

inactivates a cohort of repressors of RP genes called Dot6, Tod6 and Stb3

[28]. The TOR network also controls size in S. pombe and metazoans [29].

Systematic genetic analyses in various species have uncovered hundreds

of genes that directly or indirectly affect cell size. Direct size analysis of all

strains in the S. cerevisiae gene deletion collection uncovered a number of

potent size regulators, including Whi5, Sfp1 and Sch9 [23, 30, 31], and

revealed inputs into size control from ribosome biogenesis, mitochondrial

function and the secretory system [24–27]. Subsequent analyses of many

of these size mutants at a single cell level have suggested that the critical

cell size at Start may depend on growth rate in G1 phase and/or on cell

size at birth [32, 33]. Visual screens of S. pombe haploid and heterozygous

deletion collections for size phenotypes also revealed dozens of novel size

regulators, many of which altered size in a genetically additive fashion [34,

35]. Many genes also influence size in metazoan species. A large-scale

RNAi screen in Drosophila melanogaster tissue culture cells revealed

hundreds of genes as candidate size regulators, including known cell cycle

regulatory proteins [36]. Despite overall conservation of the central

processes that control cell growth and division, functionally equivalent size

regulators are often not conserved at the sequence level. For example, the

G1/S transcriptional regulators SBF/MBF and Whi5 bear no similarly to

the metazoan counterparts E2F and Rb, respectively [1]. A number of TOR

effectors are also poorly conserved at the sequence level, including the

ribosome biogenesis transcription factors Sfp1 in yeast and Myc in

metazoans [1].

Candida albicans is a diploid ascomycete yeast that is a prevalent

commensal and opportunistic pathogen in humans. C. albicans is a

component of the normal human flora, colonizing primarily mucosal

surfaces, gastrointestinal and genitourinary tracts, and skin [37]. Although

69

most C. albicans infections entail non-life-threatening colonization of

surface mucosal membranes, immunosuppressed patients can fall prey to

serious infections, such as oropharyngeal candidiasis in HIV patients and

newborns, and lethal systemic infections known as candidemia [38].

Interest in C. albicans is not limited to understanding its function as a

disease-causing organism, as it has an ecological niche that is obviously

distinct from the classic model ascomycete S. cerevisiae. In this regard, C.

albicans has served as an important evolutionary milepost with which to

assess conservation of biological mechanisms, and recent evidence

suggests a surprising extent of rewiring of central signalling and

transcriptional networks as compared to S. cerevisiae [39–43].

In this study, we performed a quantitative analysis of gene deletion

mutants from different collections of protein kinases and transcriptional

regulators in C. albicans. Our results revealed a noticeable degree of

divergence between genes that affect size in C. albicans versus S. cerevisiae

and uncovered previously undocumented regulatory circuits that govern

critical cell size at Start in C. albicans. In particular, we delineate a novel

stress-independent function of the p38/HOG MAPK network in coupling

cell growth to cell division. Our genetic and biochemical analysis suggests

that the HOG module directly interacts with central components of both

the cell growth and cell division machineries in C. albicans.

70

2.2.3 - Results

Analysis of the cell size phenome in C. albicans

The diploid asexual lifestyle of C. albicans complicates loss-of-function

screens because both alleles must be inactivated to reveal a phenotype

unless gene function is haploinsufficient [44]. To identify genes required

for cell size homeostasis in C. albicans, we directly screened three

collections of homozygous diploid gene deletion strains that encompassed

202 transcriptional regulators [42, 45] and 77 protein kinases [41]. We

expected transcription factors and kinases to be enriched in cell size

regulatory genes based on previous studies in budding yeast and fission

yeast. We additionally examined selected homozygous deletion strains of C.

albicans orthologs of known size genes in S. cerevisiae (sch9, pop2, ccr4

and nrm1; note that lower case gene names are used to indicate a

homozygous mutant) that were not present in these deletion collections

(S1 Table). In total, 363 viable mutant strains (279 unique mutants) were

individually assessed for their size distribution under conditions of

exponential growth in rich medium. Clustering of size distributions across

the cumulative datasets revealed distinct subsets of both large and small

mutants, relative to the majority of mutants that exhibited size

distributions comparable to those of wild-type (wt) control strains (Fig 1A

and 1B). Mean, median and mode cell size were estimated for each mutant

strain, and mutants were classified as large or small on the basis of a

stringent cut-off of a 20% increase or decrease in median size as compared

to the parental strain background. This empirical cut-off value was

determined based on a benchmark set of conserved small (sch9, sfp1) and

large (swi4, pop2, ccr4) sized mutants for which median size was reduced

or increased at least 20% as compared to parental strains. Based on this

criterion, we identified 66 mutants that exhibited a size defect compared to

their parental strain, comprised of 32 small-sized mutants (which we refer

to as Whi phenotype, after the "Whiskey" designation used for the first

71

known S. cerevisiae size mutants, [46]) and 34 large-sized mutants

(referred to as a Lge phenotype [22]) (S2 and S3 Tables).

Deletion mutants of the HOG MAPK pathway (hog1, pbs2) and the

morphogenesis checkpoint kinase (swe1) resulted in a small cell size

phenotype. Conversely, mutants defective in functions related to the G1/S

phase transition (swi4, ace2), filamentous growth and nitrogen utilization

(gat1, gzf3, dal81, rob1) caused a large cell size phenotype (S1B and S1C

Fig). As in S. cerevisiae, disruption of the central SBF (Swi4-Swi6) G1/S

transcription factor complex increased cell size, whereas mutation of the

ribosome biogenesis regulators Sch9 and Sfp1 reduced cell size, as did

inactivation of Cbf1, the major transcriptional regulator of ribosomal

protein genes in C. albicans and other ascomycetes [48, 49] (S2 Fig).

Interestingly, 21 of the 66 size mutants identified by our screen have been

shown previously to be required for pathogenesis (p-value = 1.07e-10; S1

Fig). This set of genes included those with functions in transcriptional

control of biofilm and invasive filamentation (cyr1, gcn5, ndt80, ace2,

zcf27) as well as known adhesion genes (ahr1, war1). This overlap

suggested that cell size homeostasis may contribute to C. albicans fitness

inside the host (Fig 1C and S6 Table).

Novel Start regulators in C. albicans

Previous work has shown that disruption of cell growth rate is often

accompanied by a small cell size phenotype, for example by mutations in

RP or Ribi genes [23, 50]. To identify bona fide negative Start regulators, as

opposed to mere growth rate-associated effects, doubling times were

determined for the 32 homozygous small size mutants identified in our

screens (S3 Table). Mutants that exhibited a greater than 10% increase in

doubling time as compared to the wt controls were removed from

subsequent consideration for this study. As expected, amongst the 21

72

remaining candidates predicted to more directly couple growth to division

(Table 1), we recovered two known conserved repressors of Start, namely

Sfp1 and Sch9. Candidate Start regulators in C. albicans included many

conserved genes that do not affect size in S. cerevisiae, including

components of the HOG MAPK pathway (Hog1, Pbs2), genes linked to

respiration (Hap2, Hap43), invasive filamentous growth (Cph2), adhesion

(Ahr1, War1) and metabolism (Ino4, Mig2, Gis2). We also found that

inactivation of Nrm1 resulted in whi phenotype, consistent with its role as

a repressor of the G1/S transition [51]. Interestingly, loss of the

transcription factor Hmo1, a main element in the rewired ribosomal gene

regulons in C. albicans [49], caused a small size phenotype. An

unexpectedly potent size regulator that emerged from our screens was

Dot6, a Myb-like HTH transcription factor that binds to the PAC

(Polymerase A and C) motif [52]. The dot6 deletion was among the smallest

mutants identified in our screens. C. albicans Dot6 is the ortholog of two

redundant transcriptional repressors of rRNA and Ribi gene expression

called Dot6 and Tod6 in S. cerevisiae, which cause only a minor large size

phenotype when deleted together [28].

We demonstrated the effect of six C. albicans size regulators on the timing

of Start by assessing the correlation between size and bud emergence in a

synchronous early G1 phase population of cells obtained by centrifugal

elutriation. We used this assay to determine the effect of three potent novel

size control mutants that conferred a small size phenotype (ahr1, hog1,

hmo1) and, as a control, disruption of a conserved known regulator of

Start in S. cerevisiae (sfp1). We also characterized two large size mutants,

namely swi4 and a heterozygous deletion of CLN3, which is an essential

G1 cyclin in C. albicans [53]. The critical cell size of the four small sized

mutants ahr1, hog1, hmo1 and sfp1 was markedly reduced as compared to

the wt parental strain (Fig 1D), whereas Start was delayed in the

CLN3/cln3 and swi4 strains. These results demonstrate that the

transcription factors Ahr1 and Hmo1, and the MAPK Hog1 are novel bona

73

fide repressors of Start in C. albicans, and suggested that aspects of the

Start machinery have diverged between C. albicans and S. cerevisiae.

Basal activity of the HOG MAPK pathway delays Start

We generated a new hog1 homozygous deletion mutant in C. albicans to

confirm the small size phenotype (Fig 2A). The hog1 mutant strain had a

median cell volume that was 20% smaller than its congenic parental

strain, at 44 and 55 fL respectively. To ascertain that this effect was

mediated at Start, we evaluated two hallmarks of Start, namely bud

emergence and the onset of SBF-dependent transcription as a function of

cell size in synchronous G1 phase cells obtained by elutriation. As

assessed by median size of cultures in which 25% of cells had a visible

bud, the hog1 mutant passed Start at 41 fL, whereas the parental wt

control culture passed Start at 55 fL (Fig 2B). Importantly, in the same

experiment, the onset of G1/S transcription was accelerated in the hog1

strain as judged by the peak in expression of the two representative G1

transcripts, RNR1 and PCL2 (Fig 2C and 2D). These results demonstrated

that the Hog1 protein kinase normally acts to delay the onset of Start.

We then tested whether other main elements of the HOG pathway, namely

the MAPKK Pbs2, the phosphorelay proteins Ssk1 and Ypd1, and the two-

component transducer Sln1, were also required for normal cell size

homeostasis (Fig 2E–2G). Disruption of the upstream negative regulators

(Ypd1 and Sln1) caused a large size whereas mutation of the core MAPK

module (Ssk1, Pbs2 and Hog1) caused a small size phenotype. As the

cultures for these experiments were grown in constant normo-osmotic

conditions, we inferred that the effect of the HOG module on cell size was

unrelated to its canonical role in the osmotic stress response. Consistent

with this interpretation, mutation of the known osmotic stress effectors of

the HOG pathway in C. albicans, namely the glycerol biosynthetic genes

GPD1, GPD2 and RHR2 [54, 55], did not cause a cell size defect (S3 Fig).

74

To address whether basal activity of the HOG MAPK module might be

required for size control, we tested the effect of phosphorylation site

mutants known to block signal transmission. Mutation of the activating

phosphorylation sites on either Hog1 (Thr174 and Tyr176) or Pbs2 (Ser355

and Thr359) to non-phosphorylatable residues phenocopied the small size

of hog1 and pbs2 deletion mutants, respectively (Fig 2H). These results

demonstrated that a basal level of Hog1 and Pbs2 activity was required for

Start repression under non-stress conditions.

To examine the possible role of the HOG pathway in communicating

nutrient status to the Start machinery, the effects of different carbon

sources on cell size were assessed in hog1 and wt strains. Cell size was

reduced on poor carbon sources in the hog1 strain to the same extent as

the wt strain, suggesting that the HOG module was not required for carbon

source-mediated regulation of cell size (S4 Fig). These results demonstrate

that the HOG module relays a stress- and carbon source-independent

signal for size control to the Start machinery in C. albicans.

Previous genome-wide screens in S. cerevisiae failed to uncover a role for

the HOG pathway in size control [23, 30–32]. To confirm these results, cell

size distributions of HOG pathway mutants in S. cerevisiae (hog1, pbs2,

ssk1, ssk2, opy2 and sho1 strains) were assessed in rich medium. None of

the S. cerevisiae mutants had any discernable size defect as compared to a

parental wt strain (S5 Fig).

Hog1 acts upstream of the SBF transcription factor complex

Cln3-dependent activation of the Swi4-Swi6 transcriptional complex drives

G1/S progression in both S. cerevisiae and C. albicans [56–59] and we

confirmed that CLN3/cln3, swi6 and swi4 mutants all exhibited large size

and a G1 phase delay (Figs 1D and S2E). To examine the functional

relationship between the HOG pathway and these canonical Start

75

regulators, we characterized their genetic interactions by size epistasis. We

observed that the small size of a hog1 mutant strain was partially epistatic

to the large size of the heterozygous CLN3/cln3 mutant (Fig 3A),

suggesting that the HOG pathway may function in parallel to Cln3. In

contrast, a hog1 swi4 double mutant strain had a large size comparable to

that of a swi4 mutant, suggesting that Hog1 acts genetically upstream of

Swi4 to inhibit Start (Fig 3B). In support of this finding, co-

immunoprecipitation assays revealed that Hog1 physically interacted with

Swi4 in a rapamycin-sensitive manner and that the Hog1-Swi4 interaction

was insensitive to osmotic stress (Fig 3C). In C. albicans, the Nrm1

inhibitor is known to interact with the SBF complex to repress the G1/S

transition [51], and consistently a nrm1 mutant exhibited a reduced cell

size (Fig 3D). We found that a nrm1 hog1 double mutant had a smaller

size than either of the nrm1 or hog1 single mutants, suggesting that Nrm1

and Hog1 act in parallel pathways to inhibit G1/S transcription (Fig 3D).

Collectively, these genetic and biochemical results identified Hog1 as a new

regulator of SBF in C. albicans, and suggested that Hog1 may transmit

signals from the TOR growth control network to the G1/S machinery.

The Ptc1 and Ptc2 phosphatases control Start via Hog1

MAPK activity is antagonized by the action of serine/threonine (Ser/Thr)

phosphatases, tyrosine (Tyr) phosphatases, and dual specificity

phosphatases that are able to dephosphorylate both Ser/Thr and Tyr

residues [60]. In S. cerevisiae, after adaptation to osmotic stress,

components of the HOG pathway are dephosphorylated by Tyr

phosphatases and type 2C Ser/Thr phosphatases [60, 61]. In C. albicans,

recent work has identified the two Tyr phosphatases Ptp2 and Ptp3 as

modulators of the basal activity of Hog1 [62]. A prediction of the HOG-

dependent size control model is that disruption of the phosphatases that

modulate Hog1 basal activity should cause a large cell size. However, none

of the Tyr-phosphatase single mutants ptp1, ptp2 or ptp3, nor a ptp2 ptp3

76

double mutant exhibited a noticeable cell size defect (Fig 4A). In contrast,

deletion of the type 2C Ser/Thr phosphatase Ptc2 conferred a median size

of 84.9 fL, which was 24% larger than the parental wt control size of 68 fL,

while a ptc1 ptc2 double mutant strain had an even larger size of 90.5 fL

(Fig 4B). To confirm that the large size phenotype of the ptc mutants was

mediated directly via effects on Start, we evaluated the critical cell size of

both ptc2 and ptc1 ptc2 mutants in elutriated G1 cells. Whereas wt control

cells passed Start at 49 fL, the critical cell size of the ptc2 and ptc1 ptc2

mutant strains was increased by 59% to 78 fL and 87% to 92 fL,

respectively (Fig 4C). To determine whether Hog1 is an effector of Ptc1 and

Ptc2 at Start, we examined the epistatic relationship between the hog1 and

ptc1 ptc2 mutations. The size of the hog1 ptc1 ptc2 triple mutant was

identical to that of hog1 single mutant, indicating that Hog1 functions

downstream of Ptc1 and Ptc2 for the control of cell size (Fig 4D). These

data suggested that Ptc1 and Ptc2 phosphatases may modulate the

phosphorylation state of Hog1 to govern the timing of Start onset and

critical cell size.

Hog1 activates ribosome biosynthetic gene transcription and inhibits

G1/S transcription

To explore the role of Hog1 at Start, we assessed genome-wide

transcriptional profiles using custom microarrays. G1 phase cells for hog1

mutant and wt strains were collected by centrifugal elutriation, followed by

microarray analysis of extracted total RNA. Gene set enrichment analysis

(GSEA) of transcriptional profiles [63, 64] revealed that the hog1 strain was

defective in expression of genes that function in protein translation,

including members of the 48S/43S translation initiation complex,

structural components of the small and large subunits of the ribosome,

and tRNA-charging components (Fig 5A and S4 Table). Transcription of

genes that function in mitochondrial transport, the tricarboxylic acid cycle,

protein degradation by the 26S proteasome and respiration were also

77

downregulated in a hog1 deletion. Conversely, the G1/S transcriptional

program [56] was hyperactivated in a hog1 mutant, consistent with the

above results for RNR1 and PCL2. These results suggested that Hog1

activates multiple processes that underpin cellular growth in addition to

its role as a negative regulator of the G1/S transcriptional program.

It has been previously reported that Hog1 in S. cerevisiae and its ortholog

p38 in humans directly bind and activate downstream transcriptional

target genes [65–70]. In S. cerevisiae, Hog1 thus associates with DNA at

stress-responsive genes and is required for recruitment of general

transcription factors, chromatin modifying activities and RNA Pol II [66,

69, 71, 72]. However, although mechanisms of Hog1-dependent

transcription have been investigated under osmotic stress conditions in C.

albicans, the function of this kinase in normal growth conditions in the

absence of stress has not been explored. In order to assess whether Hog1

might directly regulate gene expression relevant to cell size control in C.

albicans, we profiled the genome-wide localization of Hog1 in G1 phase

cells obtained by centrifugal elutriation from TAP-tagged Hog1 and

untagged control strains. Hog1 binding sites in the genome were

determined in duplicate by chromatin immunoprecipitation and

microarray analysis (ChIP-chip). These experiments revealed that Hog1TAP

was significantly enriched at 276 intergenic regions and 300 ORFs when

compared to the untagged control (S5 Table). The ORF and promoter

targets of Hog1 were strongly represented for translation and Ribi genes

(Fig 5B), in accord with the above expression profiles. These data

suggested that Hog1 may directly activate expression of the Ribi regulon

and other translation-associated genes. The strong enrichment for Hog1 at

translation and Ribi loci suggested that Hog1 may be required for maximal

translational capacity as G1 phase cells approach Start. Consistently, we

observed that a hog1 mutant exhibited increased sensitivity to the protein

translation inhibitor cycloheximide as compared to a wt strain (Fig 5C).

78

These results suggested that Hog1 may directly activate ribosome

biogenesis and protein translation as cells approach Start.

Hog1 is required for Sfp1-dependent gene expression and recruitment

to target promoters

Based on the conserved role of the Sfp1 transcription factor and the kinase

Sch9 in ribosome biogenesis and cell size control in C. albicans, we

examined genetic interactions between these factors and the HOG

pathway. To identify potential epistatic interactions, we overexpressed

SCH9 or SFP1 in a hog1 strain. The overexpression of SFP1 but not SCH9

restored the hog1 strain to a near wt cell size distribution (Fig 6A). These

results suggested that Sfp1 might act downstream of Hog1. Consistent

with this interpretation, we found that the gene expression defects of six

Ribi and translation genes (RPS12, RPS28B, RPS32, EIF4E and TIF6) in a

hog1 strain were rescued by the overexpression of SFP1 (Fig 6B).

Given the apparent genetic relationship between Hog1 and Sfp1, we

examined whether the two proteins might physically interact. We evaluated

the interaction at endogenous levels using a chromosomal HA-tagged Sfp1

allele and polyclonal antibodies that recognize Pbs2 and Hog1. Capture of

Sfp1HA from cell lysates followed by antibody detection revealed that Sfp1

interacted with both Pbs2 and Hog1 (Fig 6C). Notably, the Sfp1 interaction

with both Hog1 and Pbs2 was abolished by either osmotic stress or

rapamycin (Fig 6C). These results suggested that the timing of Start may

be governed in part by modulation of the Hog1-Sfp1 interaction by stress

and nutrient signals.

We then examined whether Sfp1 might play an analogous role in Start

control in C. albicans as in S. cerevisiae. As described above, an sfp1

deletion strain was extremely small and passed Start at only 42% of wt

size (Figs 1D and S2A). Consistently, transcriptional profiles of a strain

79

bearing a tetracycline-regulated allele of SFP1 demonstrated that

expression of the Ribi regulon was partially Sfp1-dependent (S6A Fig). We

also found that an sfp1 strain was as sensitive to the protein translation

inhibitor cycloheximide as a hog1 strain (S6B Fig). These data

demonstrated that Sfp1 is a transcriptional activator of Ribi genes and a

negative regulator of Start in C. albicans.

The finding that both Hog1 and Sfp1 controlled the expression of Ribi

genes, together with the finding that Hog1 acted upstream of Sfp1, led us

to hypothesize that Hog1 might be required for the recruitment of Sfp1 to

its target genes. To test this hypothesis, we used ChIP-qPCR to measure in

vivo promoter occupancy of Sfp1HA at eight representative Ribi and RP

genes that were also bound by Hog1. While Sfp1 was detected at each of

these promoters in a wt strain the ChIP signals were abrogated in the hog1

mutant strain (Fig 6D). From these data, we concluded that Sfp1 regulates

the Ribi regulon in a Hog1-dependent manner, and that the HOG module

lies at the interface of the G1/S transcriptional and growth control

machineries in C. albicans

80

2.2.4 - Discussion

This genetic analysis of size control in C. albicans represents the first

detailed characterization of the mechanisms underlying regulation of

growth and division in a pathogenic fungus. As is the case for other

species that have been examined to date, cell size in C. albicans is a

complex trait that depends on diverse biological processes and many genes

[23, 30–32, 34, 36]. Of particular note, our screen and subsequent

molecular genetic analysis uncovered a novel function for Hog1 as a

critical nexus of the growth and division machineries. The HOG module

thus represents a direct linkage between cell growth and division (Fig 7).

Conservation and divergence of cell size control mechanisms

Inactivation of genes that control ribosome biogenesis and protein

translation in C. albicans resulted in a small cell size, consistent with the

notion that the rate of ribosome biogenesis is a component of the critical

size threshold [1, 24]. In particular, mutation of the key conserved Ribi

regulators Sch9 and Sfp1 dramatically reduced cell size in C. albicans.

Previous studies have shown that several RP and Ribi trans-regulatory

factors have been evolutionarily rewired in C. albicans compared to S.

cerevisiae [48]. Consistently, we found that deletion of CBF1, which

encodes a master transcriptional regulator of RP genes in C. albicans but

not S. cerevisiae, also caused a small size phenotype. Our analysis also

unexpectedly revealed that size regulators may switch between positive

and negative functions between the two yeasts. For example, mutation of

the conserved transcription factor Dot6 that controls rRNA and Ribi

expression caused a strong Whi phenotype in C. albicans, in contrast to

the Lge phenotype conferred in S. cerevisiae [28]. These results illustrate

the evolutionary plasticity of size control mechanisms at the

transcriptional level.

81

In C. albicans, the G1/S phase cell cycle machinery remains only partially

characterized but nevertheless appears to exhibit disparities compared to

S. cerevisiae. For instance, despite conservation of SBF and Cln3 function

[59, 73], the G1/S repressor Whi5 [16, 19] and the G1/S activator Bck2

[74] appear to have been lost in C. albicans. In S. cerevisiae, cells lacking

cln3 are viable and able to pass Start due to the redundant role of Bck2

[74], whereas in C. albicans Cln3 is essential, presumably due to the

absence of a Bck2 equivalent [75]. Nrm1 also appears to have replaced

Whi5 as it interacts physically with the SBF complex and acts genetically

as a repressor of the G1/S transition in C. albicans [51]. Consistently, we

observe that nrm1 mutant exhibits a reduced cell size as a consequence of

accelerated passage through Start. In addition, the promoters of genes that

display a peak of expression during the G1/S transition lack the SCB cis-

regulatory element recognized by the SBF complex in S. cerevisiae and are

instead enriched in MCB-like motifs [56].

Control of Start by the HOG network

Our systematic size screen uncovered a new stress-independent role of the

HOG signaling network in coordinating cell growth and division. Hog1 and

its metazoan counterparts, the p38 MAPK family, respond to various

stresses in fungi [76] and metazoans [77]. In contrast to these stress-

dependent functions, our data suggests that the basal level activity of the

module is required to delay the G1/S transition under non-stressed

homeostatic growth conditions. This function of the HOG module appears

specific to C. albicans as compared to S. cerevisiae. However, the p38

MAPK family is implicated in size control in metazoan species. In the fruit

fly D. melanogaster loss of p38β causes small cell and organism size [78],

while in mice inactivation of the two Hog1 paralogs p38γ and p38δ alters

both cell and organ size, including in the heart and the liver [79, 80].

Recent elegant work in human cells has shown that p38 MAPK activity

enforces size homeostasis by controlling the length of G1 phase in

82

proportion to cell size [81]. In S. pombe, there are two critical cell size

thresholds at both G1/S and G2/M phases [1, 5]. Previous studies have

shown that the p38/Hog1 homolog in S. pombe, Sty1, controls mitotic

commitment and cell size in a nutrient-dependent manner [34, 82–84].

Deletion of STY1 resulted in a large cell size phenotype which is in

accordance with its role as a positive regulator of mitotic onset [83]. These

observations suggest the overall role of Hog1 in size control is conserved

and that C. albicans may be a suitable yeast model to dissect the

mechanisms whereby Hog1 links growth to cell cycle commitment. In

particular, we show that the entire HOG module is required for cell size

control in C. albicans, and further demonstrate a unique role for the type

2C phosphatases Ptc1 and Ptc2 in size control. In contrast, modulation of

the basal activity of Hog1 by the tyrosine phosphatases Ptp2 and Ptp3 in

response to a reduction of TOR activity is required for the separate

response of hyphal elongation [62]. The mechanisms whereby the same

MAPK module can specifically respond to stress, nutrient and cell size

remains to be resolved.

A key question raised by our study is the nature of the signal(s) sensed by

the HOG network that mediate the coupling of growth to division. Deletion

of the upstream negative regulators of the HOG module, Ypd1 and Sln1,

caused an increase in cell size, consistent with the negative regulation of

Start by the entire HOG network. Previous studies have suggested that

Sln1 histidine phosphotransferase activity is required for cell wall

biogenesis in both S. cerevisiae and C. albicans [85, 86]. Interestingly, we

also found that disruption of the beta-1,3-glucan synthase subunit Gsc1

also caused a reduced size in C. albicans [53]. We speculate that

accumulation of cell wall materials, such as glucans, and/or cell wall

mechanical proprieties may be sensed through basal activity of the HOG

module in order to link growth rate to division. This model is analogous to

that postulated in bacteria, whereby the enzymes that synthesize cell wall

83

peptidoglycan help establish cell size control by maintaining cell width

[87]. In support of this notion, perturbation of the cell wall leads to a G1

phase cell cycle arrest in S. cerevisiae via the PKC/Slt2 signalling network

[32, 88, 89].

Finally, in addition to its role in size control in C. albicans, other stress-

independent functions have been attributed to the HOG pathway in

different fungi. In Aspergillus fumigatus and A. nidulans, Hog1 controls

growth [90], conidial germination [91] and sexual development [92, 93]. In

Cryptococcus neoformans, Hog1 is required for mating and, together with

the PKA pathway, contributes to the modulation of cellular response to

glucose availability [94, 95]. Future efforts on the mechanisms by which

Hog1 control these processes will lend further insights into how this

central MAPK conduit transmits multiple different signals.

The HOG network lies at the nexus of growth and cell cycle control

The nature of the linkage between growth to division represents a

longstanding general problem in cell biology. The complex genetics of size

control, reflected in the 66 genes identified in this study that directly or

indirectly affect size, confounds the notion of a simple model of size control

[2]. Our analysis of Hog1 interactions with the known growth and division

machineries nevertheless suggests that the HOG module may directly link

growth and division to establish the size threshold at Start. We

demonstrated that the HOG module acts genetically upstream of Sfp1 to

activate Ribi and translation-related genes, and specifically that Hog1 is

required for the expression of many genes implicated in ribosome

biogenesis and the recruitment of Sfp1 to the relevant promoters. We also

demonstrated that Hog1 and its upstream kinase Pbs2 both physically

interact with Sfp1, and that Hog1 localizes to many ribosome biogenesis

promoters, consistent with a direct regulatory mechanism. These data

suggest that basal activity of the HOG module help set ribosome

84

biogenesis and protein synthesis rates. The HOG module also exhibits

strong genetic interactions with the SBF transcriptional machinery since

the loss of SBF function is epistatic to HOG module mutations and Hog1

physically interacts with SBF. The HOG module is therefore ideally

positioned to communicate the activity of the growth machinery to the cell

cycle machinery. We speculate that under conditions of rapid growth,

Hog1 and/or other components of the HOG module may be sequestered

away from SBF, thereby delaying the onset of G1/S transcription. In the

absence of Hog1 basal activity, this balance is set to a default state, in

which SBF is activated prematurely for a given rate of growth. Taken

together, these observations suggest a model whereby the HOG module

directly links growth to cell cycle commitment (Fig 7). The control of SBF

by the HOG module appears to operate in parallel to Cln3, Nrm1 and

nutrient conditions, suggesting that multiple signals are integrated at the

level of SBF, perhaps to optimize adaptation to different conditions [2].

Further analysis of the functional relationships between the HOG module

and the numerous other genes that affect size in C. albicans should

provide further insights into the linkage between growth and division.

Plasticity of the global size control network and organism fitness

It has been argued that optimization of organism size is a dominant

evolutionary force because fitness depends exquisitely on adaptation to a

particular size niche [96]. The strong link between size and fitness has

been elegantly demonstrated through the artificial evolution of E. coli

strains adapted to different growth rates [3]. Comparison of the size

phenomes of the opportunistic pathogen C. albicans and the saprophytic

yeasts S. cerevisiae and S. pombe reveals many variations in the growth

and cell cycle machineries that presumably reflect the different lifestyles of

these yeasts. Intriguingly, one third of the size regulators identified in our

focused C. albicans reverse-genetic screens have been previously identified

as virulence determinants for this pathogen, similar to our previous study

85

of genes that are haploinsufficient for cell size in C. albicans [53]. We

speculate that cell size may be an important virulence trait. Other fungal

pathogens such as Histoplasma capsulatum, Paracoccidioides brasiliensis,

C. neoformans and Mucor circinelloides also exploit cell size as a virulence

determinant [97] to access specific niches in the host and/or to escape

from host immune cells. In C. albicans, the recently discovered gray cell

type is characterized by a small size, a propensity to cause cutaneous

infections, and reduced colonization of internal organs [98, 99].

Conversely, the response of the host immune system appears to sense C.

albicans size to mitigate tissue damage at the site of infection [100]. The

evident scope and plasticity of the global size control network provides

fertile ground for adaptive mechanisms to optimize organism size and

fitness.

86

2.2.5 - Methods

Strains, mutant collections and growth conditions

C. albicans strains were cultured at 30°C in yeast-peptone-dextrose (YPD)

medium supplemented with uridine (2% Bacto peptone, 1% yeast extract,

2% w/v dextrose, and 50 mg/ml uridine). Alternative carbon sources

(glycerol and ethanol) were used at 2% w/v. Wt and mutant strains used in

this study together with diagnostic PCR primers are listed in S7 Table. The

kinase [41] and the transcriptional factor [42] mutant collections used for

cell size screens were acquired from the genetic stock center

(http://www.fgsc.net). The transcriptional regulator [45] mutant collection

was kindly provided by Dr. Dominique Sanglard (University of Lausanne).

Growth assay curves were performed in triplicate in 96-well plate format

using a Sunrise plate-reader (Tecan) at 30°C under constant agitation with

OD595 readings taken every 10 min for 24h. TAP and HA tags were

introduced into genomic loci as previously described [101]. Overexpression

constructs were generated with the CIp-Act-cyc plasmid which was

linearized with the StuI restriction enzyme for integrative transformation

[102].

Cell size determination

Cell volume distributions, referred to as cell size, were analyzed on a Z2-

Coulter Counter (Beckman). C. albicans cells were grown overnight in YPD

at 30°C, diluted 1000-fold into fresh YPD and grown for 5h at 30°C to an

early log phase density of 5x106–107 cells/ml. For the tetracycline

repressible mutants, all strains and the wt parental strain CAI-4 were

grown overnight in YPD supplemented with the antibiotic doxycycline

(40μg/ml) to achieve transcriptional repression. We note that high

concentration of doxycycline (100 μg/ml) cause a modest small size

87

phenotype in C. albicans but the screen concentration of 40 μg/ml

doxycycline did not cause an alteration in cell size. 100 μl of log phase (or

10 μl of stationary phase) culture was diluted in 10 ml of Isoton II

electrolyte solution, sonicated three times for 10s and the distribution

measured at least 3 times in 3 different independent experiments on a Z2-

Coulter Counter. Size distributions were normalized to cell counts in each

of 256 size bins and size reported as the peak mode value for the

distribution. Data analysis and clustering of size distributions were

performed using custom R scripts (S1 File).

Centrifugal elutriation

The critical cell size at Start was determined by plotting budding index as

a function of size in synchronous G1 phase fractions obtained using a JE-

5.0 elutriation rotor with 40 ml chamber in a J6-Mi centrifuge (Beckman,

Fullerton, CA) as described previously [103]. C. albicans G1 phase cells

were released in fresh YPD medium and fractions were harvested at an

interval of 10 min to monitor bud index. For the hog1 mutant strain,

additional size fractions were collected to assess transcript levels of the

RNR1, PCL2 and ACT1 as cells progressed through G1 phase at

progressively larger sizes.

Gene expression profiles and quantitative real-time PCR

Overnight cultures of hog1 mutant and wt strains were diluted to an

OD595 of 0.1 in 1 L fresh YPD-uridine media, grown at 30°C to an OD595

of 0.8 and separated into size fractions by elutriation at 16°C. A total of

108 G1 phase cells were harvested, released into fresh YPD medium and

grown for 15 min prior to harvesting by centrifugation and stored at -80°C.

Total RNA was extracted using an RNAeasy purification kit (Qiagen) and

glass bead lysis in a Biospec Mini 24 bead-beater. Total RNA was eluted,

88

assessed for integrity on an Agilent 2100 Bioanalyzer prior to cDNA

labeling, microarray hybridization and analysis [104]. The GSEA Pre-

Ranked tool (http://www.broadinstitute.org/gsea/) was used to determine

statistical significance of correlations between the transcriptome of the

hog1 mutant with a ranked gene list [105] or GO biological process terms

as described by Sellam et al. [105]. Data were visualized using the

Cytoscape [106] and EnrichmentMap plugin [107]. Gene expression data

are available at GEO with the accession number GSE126732. For

quantitative real-time PCR (qPCR), cells were grown as for the microarray

experiment. cDNA synthesis and qPCR procedure were performed as

previously described [108].

Promoter localization by ChIP-chip and ChIP-qPCR

ChIP analyses were performed as described using a custom Agilent

microarray containing 14400 (8300 intergenic and 6100 intragenic) 60-

mer oligonucleotides that covered all intergenic regions, ORFs and different

categories of non-coding RNAs (tRNAs, snoRNAs, snRNAs and rRNA [101].

A total of 107 G1 phase cells were harvested from log phase cultures by

centrifugal elutriation and released into fresh YPD medium for 15 min.

Arrays were scanned with a GenePix 4000B Axon scanner, and GenePix

Pro software 4.1 was used for quantification of spot intensities and

normalization. Hog1 genomic occupancy was determined in duplicate

ChIP-chip experiments, which were averaged and thresholded using a

cutoff of two standard deviations (SDs) above the mean of log ratios (giving

a 2-fold enrichment cutoff). ChIP-chip data are available at GEO with the

accession number GSE126732. For ChIP analysis of HA-tagged Sfp1, qPCR

was performed using an iQ 96-well PCR system for 40 amplification cycles

and QuantiTect SYBR Green PCR master mix (Qiagen) using 1 ng of

captured DNA and total genomic DNA extracted from the whole cell

extract. The coding sequence of the C. albicans ACT1 gene was used as a

89

reference for background in all experiments. Values were calculated as the

mean of triplicate experiments.

Protein immunoprecipitation and immunoblot

Cultures of epitope-tagged strains were grown to OD595 of 1.0–1.5 in YPD

and either treated or not with rapamycin (0.2 μg/ml) or NaCl (0.5 M) for 30

min. Cells were harvested by centrifugation and lysed by glass beads in

IP150 buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM MgCl2, 0.1%

Nonidet P-40) supplemented with Complete Mini protease inhibitor cocktail

tablet (Roche Applied Science) and 1 mM phenylmethylsulfonyl fluoride

(PMSF). 1 mg of total protein from clarified lysates was incubated with 50

μl of monoclonal mouse anti-HA (12CA5) antibody (Roche Applied Science),

or 20 μl anti-Pbs2 rabbit polyclonal antibody or 20μl anti-Hog1 rabbit

polyclonal antibody (Santa Cruz) and captured on 40 μl Protein A-

Sepharose beads (GE) at 4°C overnight. Beads were washed three times

with IP150 buffer, boiled in SDS-PAGE buffer, and resolved by 4–20%

gradient SDS-PAGE. Proteins were transferred onto activated

polyvinylidene difluoride (PVDF) membrane and detected by rabbit anti-HA

(1:1000) antibody (QED Biosciences) and IRDye680 secondary antibody

(LI-COR).

90


We are grateful to the Fungal Genetics Stock Center (FGSC), Dominique

Sanglard (University of Lausanne), Catherine Bachewich (Concordia

University), Ana Traven (Monash University), Joachim Ernst (Heinrich-

Heine-Universität), Janet Quinn (Newcastle University), Haoping Liu

(University of California) and Daniel Kornitzer (Technion) for providing

strains.

91

2.2.7 - References

1. Jorgensen P, Tyers M. How cells coordinate growth and division. Curr

Biol. 2004;14(23):R1014–27. pmid:15589139. 2. Kafri M, Metzl-Raz E, Jonas F, Barkai N. Rethinking cell growth

models. FEMS Yeast Res. 2016;16(7). pmid:27650704. 3. Lenski RE, Travisano M. Dynamics of adaptation and diversification:

a 10,000-generation experiment with bacterial populations. Proc Natl Acad Sci U S A. 1994;91(15):6808–14. pmid:8041701; PubMed Central PMCID:

PMCPMC44287. 4. Kafri M, Metzl-Raz E, Jona G, Barkai N. The Cost of Protein

Production. Cell Rep. 2016;14(1):22–31. pmid:26725116; PubMed Central PMCID: PMCPMC4709330.

5. Turner JJ, Ewald JC, Skotheim JM. Cell size control in yeast. Curr Biol. 2012;22(9):R350–9. pmid:22575477; PubMed Central PMCID:

PMCPMC3350643. 6. Cook M, Tyers M. Size control goes global. Curr Opin Biotechnol. 2007;18(4):341–50. pmid:17768045.

7. Ginzberg MB, Chang N, D'Souza H, Patel N, Kafri R, Kirschner MW.

Cell size sensing in animal cells coordinates anabolic growth rates and cell cycle progression to maintain cell size uniformity. Elife. 2018;7. pmid:29889021; PubMed Central PMCID: PMCPMC6031432.

8. Guertin DA, Sabatini DM. Cell Size Control. eLS: John Wiley & Sons, Ltd; 2001.

9. Zhao ZL, Song N, Huang QY, Liu YP, Zhao HR. [Clinicopathologic

features of lung pleomorphic (spindle/giant cell) carcinoma—a report of 17 cases]. Ai Zheng. 2007;26(2):183–8. pmid:17298750.

10. Russell P, Nurse P. Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog. Cell. 1987;49(4):559–67.

pmid:3032459. 11. Sudbery PE, Goodey AR, Carter BL. Genes which control cell

proliferation in the yeast Saccharomyces cerevisiae. Nature. 1980;288(5789):401–4. pmid:7001255.

12. Nurse P. Genetic control of cell size at cell division in yeast. Nature. 1975;256(5518):547–51. Epub 1975/08/14. pmid:1165770.

92

13. Nash R, Tokiwa G, Anand S, Erickson K, Futcher AB. The WHI1+

gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog. EMBO J. 1988;7(13):4335–46. pmid:2907481; PubMed Central PMCID: PMC455150.

14. Cross FR. DAF1, a mutant gene affecting size control, pheromone

arrest, and cell cycle kinetics of Saccharomyces cerevisiae. Mol Cell Biol. 1988;8(11):4675–84. pmid:3062366; PubMed Central PMCID: PMCPMC365557.

15. Tyers M. Cell cycle goes global. Curr Opin Cell Biol. 2004;16(6):602–13. pmid:15530770.

16. Costanzo M, Nishikawa JL, Tang X, Millman JS, Schub O,

Breitkreuz K, et al. CDK activity antagonizes Whi5, an inhibitor of G1/S transcription in yeast. Cell. 2004;117(7):899–913. pmid:15210111.

17. de Bruin RA, Kalashnikova TI, Chahwan C, McDonald WH, Wohlschlegel J, Yates J 3rd, et al. Constraining G1-specific transcription to late G1 phase: the MBF-associated corepressor Nrm1 acts via negative

feedback. Mol Cell. 2006;23(4):483–96. pmid:16916637.

18. Travesa A, Kalashnikova TI, de Bruin RA, Cass SR, Chahwan C, Lee DE, et al. Repression of G1/S transcription is mediated via interaction of the GTB motifs of Nrm1 and Whi5 with Swi6. Mol Cell Biol.

2013;33(8):1476–86. pmid:23382076; PubMed Central PMCID: PMCPMC3624247.

19. de Bruin RA, McDonald WH, Kalashnikova TI, Yates J 3rd, Wittenberg C. Cln3 activates G1-specific transcription via phosphorylation

of the SBF bound repressor Whi5. Cell. 2004;117(7):887–98. pmid:15210110.

20. Schaefer JB, Breeden LL. RB from a bud's eye view. Cell. 2004;117(7):849–50. pmid:15210104.

21. Ginzberg MB, Kafri R, Kirschner M. Cell biology. On being the right (cell) size. Science. 2015;348(6236):1245075. pmid:25977557; PubMed

Central PMCID: PMCPMC4533982.

22. Schmoller KM, Skotheim JM. The Biosynthetic Basis of Cell Size Control. Trends Cell Biol. 2015;25(12):793–802. Epub 2015/11/18. pmid:26573465.

93

23. Jorgensen P, Nishikawa JL, Breitkreutz BJ, Tyers M. Systematic identification of pathways that couple cell growth and division in yeast.

Science. 2002;297(5580):395–400. pmid:12089449. 24. Jorgensen P, Rupes I, Sharom JR, Schneper L, Broach JR, Tyers M.

A dynamic transcriptional network communicates growth potential to ribosome synthesis and critical cell size. Genes Dev. 2004;18(20):2491–

505. pmid:15466158; PubMed Central PMCID: PMC529537. 25. Lempiainen H, Uotila A, Urban J, Dohnal I, Ammerer G, Loewith R,

et al. Sfp1 interaction with TORC1 and Mrs6 reveals feedback regulation on TOR signaling. Mol Cell. 2009;33(6):704–16. pmid:19328065.

26. Marion RM, Regev A, Segal E, Barash Y, Koller D, Friedman N, et al. Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene

expression. Proc Natl Acad Sci U S A. 2004;101(40):14315–22. pmid:15353587; PubMed Central PMCID: PMCPMC521938.

27. Singh J, Tyers M. A Rab escort protein integrates the secretion system with TOR signaling and ribosome biogenesis. Genes Dev. 2009;23(16):1944–58. pmid:19684114; PubMed Central PMCID:

PMC2725937.

28. Huber A, French SL, Tekotte H, Yerlikaya S, Stahl M, Perepelkina MP, et al. Sch9 regulates ribosome biogenesis via Stb3, Dot6 and Tod6 and the histone deacetylase complex RPD3L. EMBO J. 2011;30(15):3052–64.

pmid:21730963; PubMed Central PMCID: PMCPMC3160192.

29. Davie E, Petersen J. Environmental control of cell size at division. Curr Opin Cell Biol. 2012;24(6):838–44. pmid:22947494.

30. Zhang J, Schneider C, Ottmers L, Rodriguez R, Day A, Markwardt J, et al. Genomic scale mutant hunt identifies cell size homeostasis genes in S. cerevisiae. Curr Biol. 2002;12(23):1992–2001. pmid:12477387.

31. Dungrawala H, Hua H, Wright J, Abraham L, Kasemsri T, McDowell

A, et al. Identification of new cell size control genes in S. cerevisiae. Cell Div. 2012;7(1):24. pmid:23234503; PubMed Central PMCID: PMC3541103.

32. Soifer I, Barkai N. Systematic identification of cell size regulators in budding yeast. Mol Syst Biol. 2014;10:761. pmid:25411401; PubMed

Central PMCID: PMC4299602. 33. Ferrezuelo F, Colomina N, Palmisano A, Gari E, Gallego C, Csikasz-

Nagy A, et al. The critical size is set at a single-cell level by growth rate to

94

attain homeostasis and adaptation. Nat Commun. 2012;3:1012. pmid:22910358.

34. Navarro FJ, Nurse P. A systematic screen reveals new elements acting at the G2/M cell cycle control. Genome Biol. 2012;13(5):R36.

pmid:22624651; PubMed Central PMCID: PMC3446289.

35. Moris N, Shrivastava J, Jeffery L, Li JJ, Hayles J, Nurse P. A genome-wide screen to identify genes controlling the rate of entry into mitosis in fission yeast. Cell Cycle. 2016;15(22):3121–30. pmid:27736299;

PubMed Central PMCID: PMCPMC5134717. 36. Bjorklund M, Taipale M, Varjosalo M, Saharinen J, Lahdenpera J,

Taipale J. Identification of pathways regulating cell size and cell-cycle progression by RNAi. Nature. 2006;439(7079):1009–13. pmid:16496002.

37. Berman J, Sudbery PE. Candida Albicans: a molecular revolution built on lessons from budding yeast. Nat Rev Genet. 2002;3(12):918–30.

pmid:12459722. 38. Odds FC. Candida infections: an overview. Crit Rev Microbiol.

1987;15(1):1–5. pmid:3319417.

39. Lavoie H, Hogues H, Whiteway M. Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi. Curr Opin Microbiol. 2009;12(6):655–63. pmid:19875326; PubMed Central

PMCID: PMCPMC3838361.

40. Sellam A, Askew C, Epp E, Lavoie H, Whiteway M, Nantel A. Genome-wide mapping of the coactivator Ada2p yields insight into the functional roles of SAGA/ADA complex in Candida albicans. Mol Biol Cell.

2009;20(9):2389–400. Epub 2009/03/13. pmid:19279142; PubMed Central PMCID: PMC2675619.

41. Blankenship JR, Fanning S, Hamaker JJ, Mitchell AP. An extensive circuitry for cell wall regulation in Candida albicans. PLoS Pathog.

2010;6(2):e1000752. Epub 2010/02/09. pmid:20140194. 42. Homann OR, Dea J, Noble SM, Johnson AD. A phenotypic profile of

the Candida albicans regulatory network. PLoS Genet. 2009;5(12):e1000783. Epub 2009/12/31. pmid:20041210.

43. Sandai D, Yin Z, Selway L, Stead D, Walker J, Leach MD, et al. The evolutionary rewiring of ubiquitination targets has reprogrammed the

regulation of carbon assimilation in the pathogenic yeast Candida

95

albicans. MBio. 2012;3(6). pmid:23232717; PubMed Central PMCID: PMC3520108.

44. Noble SM, Johnson AD. Genetics of Candida albicans, a diploid human fungal pathogen. Annu Rev Genet. 2007;41:193–211.

pmid:17614788.

45. Vandeputte P, Pradervand S, Ischer F, Coste AT, Ferrari S, Harshman K, et al. Identification and functional characterization of Rca1, a transcription factor involved in both antifungal susceptibility and host

response in Candida albicans. Eukaryot Cell. 2012;11(7):916–31. Epub 2012/05/15. pmid:22581526; PubMed Central PMCID: PMC3416494.

46. Sudbery P. Cell biology. When wee meets whi. Science. 2002;297(5580):351–2. pmid:12130772.

47. Noble SM, French S, Kohn LA, Chen V, Johnson AD. Systematic screens of a Candida albicans homozygous deletion library decouple

morphogenetic switching and pathogenicity. Nat Genet. 2010;42(7):590–8. Epub 2010/06/15. pmid:20543849; PubMed Central PMCID: PMCPMC2893244.

48. Hogues H, Lavoie H, Sellam A, Mangos M, Roemer T, Purisima E, et

al. Transcription factor substitution during the evolution of fungal ribosome regulation. Mol Cell. 2008;29(5):552–62. Epub 2008/03/18. pmid:18342603; PubMed Central PMCID: PMC3838363.

49. Lavoie H, Hogues H, Mallick J, Sellam A, Nantel A, Whiteway M.

Evolutionary tinkering with conserved components of a transcriptional regulatory network. PLoS Biol. 2010;8(3):e1000329. pmid:20231876; PubMed Central PMCID: PMC2834713.

50. Tyson CB, Lord PG, Wheals AE. Dependency of size of Saccharomyces cerevisiae cells on growth rate. J Bacteriol.

1979;138(1):92–8. pmid:374379; PubMed Central PMCID: PMC218242.

51. Ofir A, Hofmann K, Weindling E, Gildor T, Barker KS, Rogers PD, et al. Role of a Candida albicans Nrm1/Whi5 homologue in cell cycle gene expression and DNA replication stress response. Mol Microbiol.


52. Zhu C, Byers KJ, McCord RP, Shi Z, Berger MF, Newburger DE, et al. High-resolution DNA-binding specificity analysis of yeast transcription

factors. Genome Res. 2009;19(4):556–66. Epub 2009/01/23. pmid:19158363; PubMed Central PMCID: PMCPMC2665775.

96

53. Chaillot J, Cook MA, Corbeil J, Sellam A. Genome-Wide Screen for

Haploinsufficient Cell Size Genes in the Opportunistic Yeast Candida albicans. G3 (Bethesda). 2017;7(2):355–60. Epub 2017/01/04. pmid:28040776; PubMed Central PMCID: PMCPMC5295585.

54. Kayingo G, Wong B. The MAP kinase Hog1p differentially regulates

stress-induced production and accumulation of glycerol and D-arabitol in Candida albicans. Microbiology. 2005;151(Pt 9):2987–99. pmid:16151209.

55. San Jose C, Monge RA, Perez-Diaz R, Pla J, Nombela C. The mitogen-activated protein kinase homolog HOG1 gene controls glycerol accumulation in the pathogenic fungus Candida albicans. J Bacteriol.


56. Cote P, Hogues H, Whiteway M. Transcriptional analysis of the Candida albicans cell cycle. Mol Biol Cell. 2009;20(14):3363–73.

pmid:19477921; PubMed Central PMCID: PMC2710843. 57. Hussein B, Huang H, Glory A, Osmani A, Kaminskyj S, Nantel A, et

al. G1/S transcription factor orthologues Swi4p and Swi6p are important but not essential for cell proliferation and influence hyphal development in

the fungal pathogen Candida albicans. Eukaryot Cell. 2011;10(3):384–97. pmid:21257795; PubMed Central PMCID: PMC3067467.

58. Wittenberg C, Reed SI. Cell cycle-dependent transcription in yeast: promoters, transcription factors, and transcriptomes. Oncogene.

2005;24(17):2746–55. pmid:15838511. 59. Bachewich C, Whiteway M. Cyclin Cln3p links G1 progression to

hyphal and pseudohyphal development in Candida albicans. Eukaryot Cell. 2005;4(1):95–102. pmid:15643065; PubMed Central PMCID: PMC544164.

60. Saito H, Tatebayashi K. Regulation of the osmoregulatory HOG

MAPK cascade in yeast. J Biochem. 2004;136(3):267–72. pmid:15598881. 61. Brewster JL, Gustin MC. Hog1: 20 years of discovery and impact.

Sci Signal. 2014;7(343):re7. pmid:25227612.

62. Su C, Lu Y, Liu H. Reduced TOR signaling sustains hyphal development in Candida albicans by lowering Hog1 basal activity. Mol Biol Cell. 2013;24(3):385–97. pmid:23171549; PubMed Central PMCID:

PMC3564525.

97

63. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based

approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545–50. pmid:16199517; PubMed Central PMCID: PMC1239896.

64. Sellam A, Tebbji F, Whiteway M, Nantel A. A novel role for the

transcription factor Cwt1p as a negative regulator of nitrosative stress in Candida albicans. PLoS One. 2012;7(8):e43956. pmid:22952822; PubMed Central PMCID: PMC3430608.

65. Proft M, Mas G, de Nadal E, Vendrell A, Noriega N, Struhl K, et al. The stress-activated Hog1 kinase is a selective transcriptional elongation

factor for genes responding to osmotic stress. Mol Cell. 2006;23(2):241–50. pmid:16857590.

66. Proft M, Struhl K. Hog1 kinase converts the Sko1-Cyc8-Tup1 repressor complex into an activator that recruits SAGA and SWI/SNF in

response to osmotic stress. Mol Cell. 2002;9(6):1307–17. pmid:12086627. 67. Pokholok DK, Zeitlinger J, Hannett NM, Reynolds DB, Young RA.

Activated signal transduction kinases frequently occupy target genes. Science. 2006;313(5786):533–6. pmid:16873666.

68. Alepuz PM, Jovanovic A, Reiser V, Ammerer G. Stress-induced map kinase Hog1 is part of transcription activation complexes. Mol Cell.

2001;7(4):767–77. pmid:11336700.

69. Alepuz PM, de Nadal E, Zapater M, Ammerer G, Posas F. Osmostress-induced transcription by Hot1 depends on a Hog1-mediated recruitment of the RNA Pol II. EMBO J. 2003;22(10):2433–42.

pmid:12743037; PubMed Central PMCID: PMC156001. 70. Simone C, Forcales SV, Hill DA, Imbalzano AN, Latella L, Puri PL.

p38 pathway targets SWI-SNF chromatin-remodeling complex to muscle-specific loci. Nat Genet. 2004;36(7):738–43. pmid:15208625.

71. Zapater M, Sohrmann M, Peter M, Posas F, de Nadal E. Selective requirement for SAGA in Hog1-mediated gene expression depending on the

severity of the external osmostress conditions. Mol Cell Biol. 2007;27(11):3900–10. pmid:17403898; PubMed Central PMCID:

PMC1900016. 72. Nadal-Ribelles M, Conde N, Flores O, Gonzalez-Vallinas J, Eyras E,

Orozco M, et al. Hog1 bypasses stress-mediated down-regulation of transcription by RNA polymerase II redistribution and chromatin

98

remodeling. Genome Biol. 2012;13(11):R106. pmid:23158682; PubMed Central PMCID: PMC3580498.

73. Chapa y Lazo B, Bates S, Sudbery P. The G1 cyclin Cln3 regulates morphogenesis in Candida albicans. Eukaryot Cell. 2005;4(1):90–4.

pmid:15643064; PubMed Central PMCID: PMC544163.

74. Wijnen H, Futcher B. Genetic analysis of the shared role of CLN3 and BCK2 at the G(1)-S transition in Saccharomyces cerevisiae. Genetics. 1999;153(3):1131–43. pmid:10545447; PubMed Central PMCID:

PMC1460821. 75. O'Meara TR, Veri AO, Ketela T, Jiang B, Roemer T, Cowen LE.

Global analysis of fungal morphology exposes mechanisms of host cell escape. Nat Commun. 2015;6:6741. pmid:25824284; PubMed Central

PMCID: PMCPMC4382923. 76. Krantz M, Becit E, Hohmann S. Comparative genomics of the HOG-

signalling system in fungi. Curr Genet. 2006;49(3):137–51. pmid:16468042.

77. Saito H, Posas F. Response to hyperosmotic stress. Genetics. 2012;192(2):289–318. pmid:23028184; PubMed Central PMCID:

PMC3454867. 78. Cully M, Genevet A, Warne P, Treins C, Liu T, Bastien J, et al. A role

for p38 stress-activated protein kinase in regulation of cell growth via TORC1. Mol Cell Biol. 2010;30(2):481–95. pmid:19917724; PubMed

Central PMCID: PMC2798466. 79. Gonzalez-Teran B, Lopez JA, Rodriguez E, Leiva L, Martinez-

Martinez S, Bernal JA, et al. p38gamma and delta promote heart hypertrophy by targeting the mTOR-inhibitory protein DEPTOR for degradation. Nat Commun. 2016;7:10477. pmid:26795633.

80. Tormos AM, Arduini A, Talens-Visconti R, del Barco Barrantes I,

Nebreda AR, Sastre J. Liver-specific p38alpha deficiency causes reduced cell growth and cytokinesis failure during chronic biliary cirrhosis in mice. Hepatology. 2013;57(5):1950–61. pmid:23354775.

81. Liu S, Ginzberg MB, Patel N, Hild M, Leung B, Li Z, et al. Size

uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length. Elife. 2018;7. pmid:29595474; PubMed Central PMCID: PMCPMC5876018.

99

82. Shiozaki K, Russell P. Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature.

1995;378(6558):739–43. pmid:7501024. 83. Petersen J, Nurse P. TOR signalling regulates mitotic commitment

through the stress MAP kinase pathway and the Polo and Cdc2 kinases. Nat Cell Biol. 2007;9(11):1263–72. pmid:17952063.

84. Millar JB, Buck V, Wilkinson MG. Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAP kinase controlling cell size at

division in fission yeast. Genes Dev. 1995;9(17):2117–30. pmid:7657164. 85. Kruppa M, Jabra-Rizk MA, Meiller TF, Calderone R. The histidine

kinases of Candida albicans: regulation of cell wall mannan biosynthesis. FEMS Yeast Res. 2004;4(4–5):409–16. pmid:14734021.

86. Rauceo JM, Blankenship JR, Fanning S, Hamaker JJ, Deneault JS, Smith FJ, et al. Regulation of the Candida albicans cell wall damage

response by transcription factor Sko1 and PAS kinase Psk1. Mol Biol Cell. 2008;19(7):2741–51. pmid:18434592; PubMed Central PMCID: PMCPMC2441657.

87. Chien AC, Hill NS, Levin PA. Cell size control in bacteria. Current

Biology. 2012;22(9):R340–9. pmid:22575476; PubMed Central PMCID: PMCPMC3350639.

88. Kono K, Al-Zain A, Schroeder L, Nakanishi M, Ikui AE. Plasma membrane/cell wall perturbation activates a novel cell cycle checkpoint

during G1 in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A. 2016;113(25):6910–5. pmid:27274080; PubMed Central PMCID: PMCPMC4922162.

89. Levin DE. Regulation of cell wall biogenesis in Saccharomyces cerevisiae: the cell wall integrity signaling pathway. Genetics.

2011;189(4):1145–75. pmid:22174182; PubMed Central PMCID: PMCPMC3241422.

90. Du C, Sarfati J, Latge JP, Calderone R. The role of the sakA (Hog1) and tcsB (sln1) genes in the oxidant adaptation of Aspergillus fumigatus.

Med Mycol. 2006;44(3):211–8. Epub 2006/05/17. pmid:16702099.

91. Xue T, Nguyen CK, Romans A, May GS. A mitogen-activated protein kinase that senses nitrogen regulates conidial germination and growth in Aspergillus fumigatus. Eukaryot Cell. 2004;3(2):557–60. Epub

2004/04/13. pmid:15075285; PubMed Central PMCID: PMCPMC387654.

100

92. Kawasaki L, Sanchez O, Shiozaki K, Aguirre J. SakA MAP kinase is involved in stress signal transduction, sexual development and spore

viability in Aspergillus nidulans. Mol Microbiol. 2002;45(4):1153–63. Epub 2002/08/16. pmid:12180932.

93. Jaimes-Arroyo R, Lara-Rojas F, Bayram O, Valerius O, Braus GH, Aguirre J. The SrkA Kinase Is Part of the SakA Mitogen-Activated Protein

Kinase Interactome and Regulates Stress Responses and Development in Aspergillus nidulans. Eukaryot Cell. 2015;14(5):495–510. Epub 2015/03/31. pmid:25820520; PubMed Central PMCID: PMCPMC4421008.

94. Bahn YS, Kojima K, Cox GM, Heitman J. Specialization of the HOG pathway and its impact on differentiation and virulence of Cryptococcus

neoformans. Mol Biol Cell. 2005;16(5):2285–300. Epub 2005/02/25. pmid:15728721; PubMed Central PMCID: PMCPMC1087235.

95. Banerjee D, Bloom AL, Panepinto JC. Opposing PKA and Hog1 signals control the post-transcriptional response to glucose availability in

Cryptococcus neoformans. Mol Microbiol. 2016;102(2):306–20. Epub 2016/07/09. pmid:27387858; PubMed Central PMCID: PMCPMC5055444.

96. Bonner J. Why Size Matters: From Bacteria to Blue Whales. Princeton University Press ed2006.

97. Wang L, Lin X. Morphogenesis in fungal pathogenicity: shape, size, and surface. PLoS Pathog. 2012;8(12):e1003027. Epub 2012/12/14. pmid:23236274 PubMed Central PMCID: PMC3516537.

98. Tao L, Du H, Guan G, Dai Y, Nobile CJ, Liang W, et al. Discovery of

a "white-gray-opaque" tristable phenotypic switching system in candida albicans: roles of non-genetic diversity in host adaptation. PLoS Biol. 2014;12(4):e1001830. pmid:24691005; PubMed Central PMCID:

PMCPMC3972085. 99. Sellam A, Whiteway M. Recent advances on Candida albicans

biology and virulence [version 1; referees: 2 approved]. 2016;5(2582). pmid:27853524

100. Branzk N, Lubojemska A, Hardison SE, Wang Q, Gutierrez MG, Brown GD, et al. Neutrophils sense microbe size and selectively release

neutrophil extracellular traps in response to large pathogens. Nat Immunol. 2014;15(11):1017–25. pmid:25217981; PubMed Central PMCID:

PMC4236687. 101. Lavoie H, Sellam A, Askew C, Nantel A, Whiteway M. A toolbox for

epitope-tagging and genome-wide location analysis in Candida albicans.

101

BMC Genomics. 2008;9:578. Epub 2008/12/06. pmid:19055720; PubMed Central PMCID: PMC2607300.

102. Blackwell C, Russell CL, Argimon S, Brown AJ, Brown JD. Protein A-tagging for purification of native macromolecular complexes from

Candida albicans. Yeast. 2003;20(15):1235–41. pmid:14618561.

103. Tyers M, Tokiwa G, Futcher B. Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins. EMBO J. 1993;12(5):1955–68. pmid:8387915; PubMed

Central PMCID: PMC413417. 104. Sellam A, Tebbji F, Nantel A. Role of Ndt80p in sterol metabolism

regulation and azole resistance in Candida albicans. Eukaryot Cell. 2009;8(8):1174–83. Epub 2009/06/23. doi: EC.00074-09 [pii]

pmid:19542309. 105. Sellam A, van het Hoog M, Tebbji F, Beaurepaire C, Whiteway M,

Nantel A. Modeling the transcriptional regulatory network that controls the early hypoxic response in Candida albicans. Eukaryot Cell. 2014;13(5):675–90. pmid:24681685; PubMed Central PMCID:

PMC4060469.

106. Saito R, Smoot ME, Ono K, Ruscheinski J, Wang PL, Lotia S, et al. A travel guide to Cytoscape plugins. Nat Methods. 2012;9(11):1069–76. pmid:23132118; PubMed Central PMCID: PMC3649846.

107. Merico D, Isserlin R, Stueker O, Emili A, Bader GD. Enrichment

map: a network-based method for gene-set enrichment visualization and interpretation. PLoS One. 2010;5(11):e13984. pmid:21085593; PubMed Central PMCID: PMC2981572.

108. Garcia C, Tebbji F, Daigneault M, Liu NN, Kohler JR, Allen-Vercoe E, et al. The Human Gut Microbial Metabolome Modulates Fungal Growth

via the TOR Signaling Pathway. mSphere. 2017;2(6). pmid:29242837; PubMed Central PMCID: PMCPMC5729221.

102

2.2.8 - Figures

Fig 1. The cell size phenome of C. albicans.

Clustergrams of size profiles of two different systematic mutant collections

of C. albicans. (A) a set of 81 kinases [41] and (B) a set of 166 transcription

factors [42]. For each strain, the cell volume distribution in femtoliters (fL)

was measured over 256 size bins with a Beckman Coulter Z2 Channelizer.

Hierarchical clustering was used to self-organize the datasets. Red asterisk

in the clustergrams indicates size distribution of wt strains. Sections of the

clusters corresponding to small and large size mutants are magnified. (C)

Overlap between C. albicans size and virulence phenotypes. Avirulent

mutant phenotypes were obtained from CGD based on decreased

competitive fitness in mice and/or reduced invasion and damage to host

cells. (D) Size regulators in C. albicans act at Start. Early G1-phase cells of

103

different size mutant and wt (SN250 [47]) strains were isolated by

centrifugal elutriation, released into fresh YPD medium and monitored for

bud emergence and cell size at 10 min intervals until the entire population

was composed of budded cells. Budding index was determined as the

percentage of budded cells in each sample for at least 200 cells.

104

Table 1. Candidate Start regulators in C. albicans.

105

Fig 2. Basal activity of HOG pathway is required for normal Start

onset and cell size homeostasis.

(A) Confirmation of the Whi phenotype in a newly generated hog1 deletion

mutant. Size distributions (i.e., % of cells in each size bin of the Coulter Z2

Channelizer) of a wt (SN148), hog1 and hog1 strain complemented with

wild type HOG1 (hog1-pHOG1 are shown. (B-D) Acceleration of Start in a

hog1 strain. (B) Elutriated G1 phase daughter cells were released into

106

fresh media and fractions were collected at intervals of 10 min. Bud

emergence was assessed in each size fraction. (C-D) Expression of G1/S

transcripts. RNR1 and PCL2 transcript levels in elutriated cell fractions

relative to pre-elutriated asynchronous cells were assessed by quantitative

real-time PCR and normalized to ACT1 levels. (E-F) Size distributions of

different mutant strains for the HOG pathway in C. albicans. (G) Schematic

of the canonical HOG pathway in C. albicans and summary of size for each

mutant strain expressed as mean percentage of reduction or increase of

size as compared to the paternal wt strain of each mutant ± standard

deviation (four biological replicates). The ssk2 strain exhibited constitutive

filamentation that precluded size determination (ND = not determined). (H)

Mutation of the two activating phosphorylation sites on Hog1 (T174A and

Y176F, termed AF) and Pbs2 (S355D and T359D, termed DD) confers a

small size phenotype.

107

Fig 3. Genetic interactions between the HOG pathway and the G1/S

transcriptional machinery.

(A) Additive effect of hog1 and Cln3/cln3 mutations on cell size. The wt

strain was in the SN148-Arg+ parental background. (B) A swi4 mutation is

epistatic to a hog1 mutation for cell size. The wt strain was in the SN250

background. (C) Co-immunoprecipitation assays for Hog1 and Swi4.

Cultures were treated or not as indicated with rapamycin (0.5 μg/ml or

108

NaCl (0.5 M) for 30 min. (D) Additive effect of hog1 and nrm1 mutations on

cell size. The wt strain was in the SN250 background.

109

Fig 4. Ptc1 and Ptc2 control Start via Hog1.

(A) Size distributions of a wt strain and ptc1, ptc2 and ptc1 ptc2 deletion

mutants. (B) Size distributions of a wt strain, a ptp2 single mutant, and a

ptp2 ptp3 double mutant. (C) Start is delayed in ptc mutants. Elutriated

G1 phase daughter cells were released into fresh media and monitored for

bud emergence as a function of size. (D) The small cell size of a hog1

mutant is epistatic to the large size of a ptc1 ptc2 double mutant.

110

Fig 5. A Hog1-dependent transcriptional program in G1 phase cells.

(A) GSEA analysis of differentially expressed genes in a hog1 mutant

relative to a congenic wt strain. Cells were synchronized in G1 phase by

centrifugal elutriation and released in fresh YPD medium for 15 min and

analyzed for gene expression profiles by DNA microarrays. Up-regulated

(red circles) and down-regulated (blue circles) transcripts are shown for the

indicated processes. The diameter of the circle reflects the number of

111

modulated gene transcripts in each gene set. Known functional

connections between related processes are indicated (green lines). Images

were generated in Cytoscape with the Enrichment Map plug-in. (B)

Genome-wide promoter occupancy of Hog1 in G1 phase cells. Gene

categories bound by Hog1 were determined by GO term enrichment. p-

values were calculated using hypergeometric distribution. (C) Growth rate

and cycloheximide (CHX; 200 μg/ml) sensitivity of wt and hog1 mutant

strains. Relative growth rate was calculated as time to reach half maximal

OD600 for each culture normalized to the value for the untreated WT

control strain, which was 24 h of growth in SC medium at 30°C. Doubling

times were calculated during the exponential phase of each strain treated

or not with cycloheximide (200 μg/ml) and represented as a percentage

relative to the value of the untreated WT control strain. Results are the

mean of three replicates. Bars show the means +/- standard errors of the

means.

112

Fig 6. Hog1-dependent recruitment of Sfp1 to promoter DNA.

(A) Size distributions of wt (wt-pAct), hog1 (hog1/hog1), SFP1-

overexpression (wt/pAct-SFP1) and hog1 SFP1-overexpression

(hog1/hog1/pAct-SFP1) strains. (B) Increased SFP1 dosage restores

expression of representative Ribi and RP transcripts in a hog1 mutant

strain. Relative expression levels of the six transcripts were assessed by

real-time qPCR as normalized to ACT1. Values are the mean from two

independent experiments. (C) Sfp1 interactions with Pbs2 and Hog1. Anti-

HA immunoprecipitates from a strain bearing an integrated SFP1HA allele

grown in the absence or presence of NaCl (0.5 M) or rapamycin (0.5 μg/ml)

were probed with anti-HA, anti-Hog1 or anti-Pbs2 antibodies. (D) Reduced

Sfp1 localization to Ribi gene promoters in a hog1 mutant strain. Values

are the mean from three independent ChIP-qPCR experiments for each

indicated promoter.

113

Fig 7. Architecture of the Start machinery in C. albicans. Hog1

inhibits the SBF G1/S transcription factor complex and in parallel controls

Sfp1 occupancy of Ribi gene promoters, and thereby directly links growth

and division. The activity of Hog1 is modulated by the phosphatases Ptc1

and Ptc2 to govern the timing of Start onset. Parallel Start pathways

revealed by genetic interactions with Hog1, as well as other prominent size

control genes in C. albicans revealed by size screens, are also indicated.

Other potential size regulators for which gene inactivation led to small and

large size phenotypes are indicated in red and green, respectively.

114

Chapitre 3 - Integration of growth and cell size via

the TOR pathway and the Dot6 transcription

factor in Candida albicans.

3.1 - Résumé

Chez les espèces eucaryotes, l'homéostasie de la taille semble être exercée

à un point de contrôle en fin de phase G1 appelée START chez les levures

et le Point de Restriction chez les métazoaires. L’atteinte d’une taille seuil à

START permet d’associer la croissance cellulaire à la division et établit

ainsi l'homéostasie de la taille sur le long terme. Nos recherches

précédentes ont montré que des centaines de gènes modifient fortement la

taille cellulaire chez la levure opportuniste Candida albicans, mais

étonnamment, peu de gènes nécessaires pour la régulation de la taille chez

C. albicans sont conservés chez S. cerevisiae. Ici, nous avons étudié l’un

des nouveaux régulateurs de la taille chez C. albicans, le facteur de

transcription Dot6. Nos données ont démontré que Dot6 est un régulateur

négatif de START et agit également comme activateur de la transcription

des gènes de la biogenèse des ribosomes (Ribi). L'épistasie génétique a

révélé que Dot6 interagit avec le régulateur de transcription principal de la

machinerie G1, le complexe SBF, mais pas avec les régulateurs de la taille

cellulaire et les régulateurs de Ribi Sch9, Sfp1 et p38/Hog1. Dot6 est

nécessaire pour la modulation de la taille de la cellule suivant la source de

carbone disponible et il est régulé au niveau de la localisation nucléaire

par la voie TOR. Nos résultats soutiennent un modèle dans lequel Dot6

agit comme une plaque tournante intégrant directement les signaux de

croissance via la voie TOR afin de contrôler l'engagement du cycle

cellulaire.

115

3.2 - Article

Integration of growth and cell size via the TOR pathway and the Dot6

transcription factor in Candida albicans

Julien Chaillot*, Faiza Tebbji*, Jaideep Malick†,1 and Adnane Sellam*,‡,2

Genetics February 1, 2019 vol. 211 no. 2 637-650;

https://doi.org/10.1534/genetics.118.301872

* CHU de Québec Research Center (CHUQ), Université Laval, Quebec City,

QC, Canada

† Department of Biology, Concordia University, Montréal, Quebec, Canada

‡ Department of Microbiology, Infectious Disease and Immunology,

Faculty of Medicine, Université Laval, Quebec City, QC, Canada

1 Present address: Department of Molecular Genetics, University of

Toronto, Toronto, Ontario, Canada.

2 Corresponding author: Université Laval, CHU de Québec Research Center

(CHUL), RC-0709, 2705 Laurier Blvd, Quebec, QC, Canada G1V 4G2. Tel:

(1) 418 525 4444 ext. 46259. E-mails: [email protected].

Running title: Cell size control by Dot6

Keywords: Cell size, Ribosome biogenesis, Cell growth, Cell division,

Transcriptional rewiring

116

3.2.1 - Abstract

In most species, size homeostasis appears to be exerted in late G1 phase

as cells commit to division, called Start in yeast and the Restriction Point

in metazoans. This size threshold couples cell growth to division, and,

thereby, establishes long-term size homeostasis. Our former investigations

have shown that hundreds of genes markedly altered cell size under

homeostatic growth conditions in the opportunistic yeast Candida

albicans, but surprisingly only few of these overlapped with size control

genes in the budding yeast Saccharomyces cerevisiae Here, we investigated

one of the divergent potent size regulators in C. albicans, the Myb-like HTH

transcription factor Dot6. Our data demonstrated that Dot6 is a negative

regulator of Start, and also acts as a transcriptional activator of ribosome

biogenesis (Ribi) genes. Genetic epistasis uncovered that Dot6 interacted

with the master transcriptional regulator of the G1 machinery, SBF

complex, but not with the Ribi and cell size regulators Sch9, Sfp1, and

p38/Hog1. Dot6 was required for carbon-source modulation of cell size,

and it is regulated at the level of nuclear localization by the TOR pathway.

Our findings support a model where Dot6 acts as a hub that integrates

growth cues directly via the TOR pathway to control the commitment to

mitotic division at G1.

117


In a eukaryotic organism, cell size homeostasis is maintained through a

balanced coordination between cell growth and division. In the last half

century, a major focus of cell biology has been the study of cell division,

but how eukaryotic cells couple growth to division to maintain a

homeostatic size remains poorly understood. In most eukaryotic

organisms, reaching a critical cell size appears to be crucial for

commitment to cell division in late G1 phase, called Start in yeast and the

Restriction Point in metazoans (Turner et al. 2012). Start is dynamically

regulated by nutrient status, pheromones, and stress, and facilitates

adaptation to changing environmental conditions in microorganisms to

maximize their fitness (Lenski and Travisano 1994; Kafri et al. 2016).

Different genome-wide genetic analyses have been accomplished in

different model organisms to uncover the genetic determinism of Start and

cell size control in eukaryotes. Screens of Saccharomyces cerevisiae

mutants has identified many ribosome biogenesis (Ribi) genes as small size

mutants (whi) (Jorgensen et al. 2002; Dungrawala et al. 2012; Soifer and

Barkai 2014), and revealed two master regulators of Ribi gene expression—

the transcription factor Sfp1 and the AGC family kinase Sch9—as the

smallest mutants (Jorgensen et al. 2004). These observations lead to the

hypothesis that the rate of ribosome biogenesis is a critical element of the

metric that dictates cell size (Jorgensen and Tyers 2004; Schmoller and

Skotheim 2015). Sfp1 and Sch9 are critical effectors of the TOR pathway

and form part of a dynamic, nutrient-responsive network that controls the

expression of Ribi genes and ribosomal protein genes (Jorgensen et al.

2004; Marion et al. 2004; Urban et al. 2007; Lempiäinen et al. 2009). Sch9

is phosphorylated and activated by TOR, and, in turn, inactivates a cohort

of transcriptional repressors of RP genes called Dot6, Tod6, and Stb3

(Huber et al. 2011).

118

Candida albicans is a diploid ascomycete yeast that is an important

commensal and opportunistic pathogen in humans. While C. albicans and

S. cerevisiae colonize different niches, common biological features are

shared between the two yeasts, including the morphological trait of

budding, and core cell cycle and growth regulatory mechanisms (Berman

2006; Côte et al. 2009). C. albicans has served as an important

evolutionary milestone with which to assess evolutionary conservation of

biological mechanism, and recent evidence suggests a surprising extent of

rewiring of central signaling, transcriptional, and metabolic networks as

compared to S. cerevisiae (Lavoie et al. 2009; Blankenship et al. 2010; Li

and Johnson 2010; Sandai et al. 2012). To assess the conservation of the

size control network, we performed recently a quantitative genome-wide

analysis of a systematic collection of gene deletion strains in C. albicans

(Sellam et al. 2016; Chaillot et al. 2017). Our screens uncovered that cell

size in C. albicans is a complex trait that depends on diverse biological

processes such as ribosome biogenesis, mitochondrial functions, cell cycle

control, and metabolism. In addition to conserved mechanisms and

regulators previously identified in S. cerevisiae and metazoans, we

uncovered many novel regulatory circuits that govern critical cell size at

Start specifically in C. albicans. In particular, we delineated a novel stress-

independent function of the p38/HOG MAPK pathway as a critical

regulator of both growth and division, and poised to exert these functions

in a nutrient-sensitive manner (Sellam et al. 2016). Interestingly, some of

the size genes identified were required for fungal virulence, suggesting that

cell size homeostasis may be elemental to C. albicans fitness inside the

host.

An unexpectedly potent negative Start regulator that emerges from our

systematic screen was Dot6, which encodes a Myb-like HTH transcription

factor that binds to the PAC (Polymerase A and C) motif GATGAG (Enfert

119

and Hube 2007; Zhu et al. 2009; Sellam et al. 2016; Chaillot et al. 2017).

dot6 was among the smallest mutant identified by our screen. C. albicans

Dot6 is the ortholog of two redundant transcriptional repressors of rRNA

and Ribi gene expression called Dot6 and Tod6 in S. cerevisiae, which are

antagonized by Sch9, and which cause only a minor large-size phenotype

when deleted together (Huber et al. 2011). Here, we show that the C.

albicans Dot6 is a potent size regulator that governs critical cell size at

Start, and, in an opposite role to that in S. cerevisiae, Dot6 acts as a

transcriptional activator of Ribi genes. We also showed that the TOR

pathway relays nutrient-dependent signal for size control to the Start

machinery via Dot6. Genetic interactions with deletions of different known

Start regulators revealed epistatic interaction with the master

transcriptional regulator of the G1-S transition, SBF complex (Swi4-Swi6),

but not with SCH9, SFP1, or HOG1. These data emphasize the

evolutionary divergence between C. albicans and S. cerevisiae, and

consolidate the role of Tor1-Dot6 network as a key cell size control

mechanism in C. albicans.

120

3.2.3 - Materials and Methods

Growth conditions and strains

The strains used in this study are listed in Supplemental Material, Table

S1. C. albicans strains were generated and propagated using standard

yeast genetics methods. For general propagation and maintenance

conditions, the strains were cultured at 30°C in yeast-peptone-dextrose

(YPD) medium supplemented with uridine (2% Bacto-peptone, 1% yeast

extract, 2% dextrose, and 50 µg/ml uridine) or in Synthetic Complete

medium (SC; 0.67% yeast nitrogen base with ammonium sulfate, 2%

glucose, and 0.079% complete supplement mixture). To assess the size of

hyphal cells, both wild type (WT) (SFY87) and dot6 mutant cells were

grown at 37°C in YPD supplemented with 10% fetal bovine serum (FBS) for

3 hr.

The DOT6-Δ[1555–1803] truncated mutant was generated by inserting a

STOP codon using CRISPR-Cas9 mutagenesis system (Vyas et al. 2015).

Guide RNA (gRNA) was generated by annealing the Dot6-gRNA-Top and

Dot6-gRNA-Bottom primers. Repair template was created using Dot6-

STOP-Top and Dot6-STOP-Bottom primers (Table S2). The C. albicans

SC5314 strain was cotransformed with the linearized plasmid pV1093

containing Dot6-gRNA with the repair template using lithium acetate

transformation procedure and selected in Nourseothricin (Jena

Bioscience). DOT6 truncation was confirmed by sequencing.

For the complementation assay in S. cerevisiae, the complete ORF of C.

albicans DOT6 was amplified using XbaI-Dot6Ca-F and HindIII-Dot6Ca-R

primers, and the resulting PCR fragments were cloned into the yeast

pAG415GPD-ccdB plasmid (Susan Lindquist laboratory). The S. cerevisiae

WT (Y2092) and dot6 tod6 (Y3707) strains were then transformed with

121

either the empty pAG415GPD-ccdB or pAG415GPD-CaDOT6-ccdB

plasmids using a standard lithium-acetate-based procedure (Chen et al.

1992).

Cell size assessment

Cell size distributions were obtained using the Z2-Coulter Counter

(Beckman, Fullerton, CA). C. albicans cells were grown overnight in YPD at

30°C, diluted 1000-fold into fresh YPD or SC media and grown for 4 hr at

30°C to an early log phase density of 5 × 106–107 cells/ml. A fraction of

100 µl of log phase culture was diluted in 10 ml of Isoton II electrolyte

solution, sonicated three times for 10 sec, and the distribution measured

at least three times on a Z2-Coulter Counter. Size distributions were

normalized to cell counts in each of 256 size bins, and size is reported as

the peak median value for the distribution. Data analysis and clustering of

size distributions were performed using custom R scripts (Sellam et al.

2016).

Start characterization

The critical cell size at Start was determined by plotting budding index as

a function of size in synchronous G1 phase fractions obtained using a JE-

5.0 elutriation rotor with a 40 ml chamber in a J6-Mi centrifuge (Beckman)

as described previously (Tyers et al. 1993). C. albicans G1 phase cells were

released in fresh YPD medium, and fractions were harvested at intervals of

10 mins to monitor bud index. For the dot6 mutant and the WT strains,

additional size fractions were collected to assess transcript levels of the

RNR1, PCL2, and ACT1 using qPCR (quantitative real time PCR) as cells

progressed through G1 phase at progressively larger sizes.

Growth assays

122

C. albicans cells were resuspended in fresh SC at an OD600 of 0.05. A

total volume of 99 μl cells was added to each well of a flat-bottom 96-well

plate in addition to 1 μl of the corresponding stock solution of either

rapamycin or cycloheximide (Sigma). Growth assay curves were performed

in triplicate in 96-well plate format using a Sunrise plate-reader (Tecan) at

30° under constant agitation.

In vivo GFP reporter assays

The GFP reporter assay was performed by replacing the ORF of PNO1

(Orf19.7618) by GFP coding sequence (Schaub et al. 2006) in its actual

chromatin environment. pPNO1-GFP-F1/PNO1-GFP-R1 and pPNO1mut-

GFP-F1/PNO1-GFP-R1 primer pairs were used to generate pPNO1-GFP

and pPNO1-mut-GFP PCR cassettes that contains an intact (GATGAG) and

a shuffled (ATGGAG) PAC motif, respectively. These cassettes were

integrated into the WT (SN152) strain and isogenic strain deleted for DOT6

(DSY4169-B). GFP fluorescence was quantitatively assessed by flow

cytometry (BD FACSCanto) using 106 exponentially growing cells. Each

sample was measured three times.

Cellular localization of Dot6

A DOT6/dot6 heterozygous strain was GFP-tagged in vivo at the C-terminal

region with a GFP-Arg4 PCR product as previously described (Gola et al.

2003). Transformants were selected on SC minus Arginine plates, and

correct integration of the GFP tag was checked by PCR and sequencing

(Table S2). Live-cell microscopy of Dot6-GFP was performed with a Leica

DMI6000B inverted confocal microscope (Leica) and a C9100-13 camera

CCD camera (Hamamatsu). The effect of TOR activity on Dot6-GFP

localization was assessed as following: cells grown on SC medium were

123

exposed to rapamycin (100 ng/ml) for 30 min, washed once with PBS

buffer, and immediately visualized. C. albicans vacuoles were stained using

the CellTracker Blue CMAC dye (ThermoFisher) following the

manufacturer’s recommended procedure.

Size genetic epistasis

dot6 mutant was subjected to epistatic analysis with deletions of known

Start regulators (Sellam et al. 2016) (Table S1). Gene deletion was

performed as previously described (Gola et al. 2003). The complete set of

primers used to generate deletion cassettes and to confirm gene deletions

are listed in Table S2. Size distribution of at least, two independent double

mutants were determined. Epistasis was noted only if size distributions of

a single and double mutant overlapped.

Microarray transcriptional profiling

Overnight cultures of dot6 mutant and WT strains were diluted to an

OD600 of 0.1 in 1 liter fresh YPD-uridine medium, grown at 30° to an

OD600 of 0.8, and separated into size fractions using the Beckman JE-5.0

elutriation system at 16°C. A total of 108 unbudded G1 phase cells were

harvested, released into fresh YPD medium, and grown for 10 min prior to

harvesting by centrifugation and storage at −80°. Total RNA was extracted

using an RNAeasy purification kit (Qiagen) and glass bead lysis in a

Biospec Mini 24 bead-beater. Total RNA was eluted, and assessed for

integrity on an Agilent 2100 Bioanalyzer prior to cDNA labeling, microarray

hybridization, and analysis (Sellam et al. 2009). The GSEA PreRanked tool

(http://www.broadinstitute.org/gsea/) was used to determine statistical

significance of correlations between the transcriptome of the dot6 mutant

with a ranked gene list or GO biological process terms as described by

124

Sellam et al. (2014). Data were visualized using the Cytoscape (Saito et al.

2012) and EnrichmentMap plugin (Merico et al. 2010).

Expression analysis by qPCR

For qPCR experiments, cell cultures and RNA extractions were performed

as described for the microarray experiment. cDNA was synthesized from 1

µg of total RNA using the SuperScipt III Reverse Transcription kit

(ThermoFisher). The mixture was incubated at 25°C for 10 min, 37°C for

120 min, and 85°C for 5 min; 2 U/µl of RNAse H (NEB) was then added to

remove RNA and samples were incubated at 37°C for 20 min. qPCR was

performed using an iQ5 96-well PCR system (Bio-Rad) for 40 amplification

cycles with QuantiTect SYBR Green PCR master mix (Qiagen). The

reactions were incubated at 50°C for 2 min, 95°C for 2 min, and cycled 40

times at 95°C, 15 sec; 56°C, 30 sec; 72°C, 1 min. Fold-enrichment of each

tested transcript was estimated using the comparative ΔΔCt method as

described by Guillemette et al. (2004). To evaluate the gene expression

level, the results were normalized using Ct values obtained from Actin

(ACT1, C1_13700W_A). Primer sequences used for this analysis are

summarized in Table S2.

Western blot analysis

A DOT6/dot6 heterozygous strain was Myc-tagged in vivo at the C-terminal

region with a Myc-Arg4 PCR product as previously described (Lavoie et al.

2008). Transformants were selected on SC minus Arginine plates, and

correct integration of the Myc-tag was checked by PCR and sequencing.

The C. albicans Dot6-Myc strain was grown to midlog phase in SC

medium. Cells at a final OD600 of 1 were treated with 100 ng/ml

rapamycin and incubated for 15, 30, 60, or 120 min at 30°C. Cells were

harvested by centrifugation and lysed by bead beating in IP150 buffer [50

125

mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM Mg, 0.1% Nonidet P-40]

supplemented with Complete Mini protease inhibitor mixture tablet (Roche

Applied Science) and 1 mM phenylmethyl-sulfonyl fluoride (PMSF). The

lysates were then cleared by centrifugation, and protein concentration was

estimated using the DC protein quantification assay (Bio-Rad); 60 μg of

total protein was boiled with SDS-PAGE loading buffer and resolved by 4–

20% gradient SDS-PAGE. Proteins were transferred onto a nitrocellulose

membrane and analyzed by Western blotting using either 910E mouse c-

Myc (1:200; Santa Cruz) or beta actin (1:5000; GenScript) antibodies.

Data availability

Strains and plasmids are available upon request. Supplemental files

contain two figures (Figures S1 and S2) and five tables (Tables S1–S5)

and are available at FigShare (DOI: 10.6084/m9.figshare.7008170). Gene

expression data are available at GEO with the accession number

GSE119089. Supplemental material available at Figshare:

https://doi.org/10.6084/m9.figshare.7008170.v3.

126

3.2.4 - Results

Dot6 is a negative regulator of START in C. albicans

We have previously shown that the transcription factor Dot6 was required

for cell size control in C. albicans (Sellam et al. 2016). A dot6 mutant had a

median size that was 21% (41 fL) smaller than its congenic parental (52 fL)

or the complemented strains (51 fL) (Figure 1A). Inactivation of DOT6

resulted in only a minor growth defect with a doubling time comparable to

the WT and the complemented strains during the log phase, suggesting

that the size reduction of dot6 is not a growth rate-associated phenotype

(Figure 1B). To ascertain that this effect was mediated at Start, we

evaluated two hallmarks of Start, namely bud emergence and the onset of

SBF-dependent transcription, as a function of cell size in synchronous G1

phase cells obtained by elutriation. As assessed by median size of cultures

for which 90% of cells had a visible bud, the dot6 mutant passed Start

after growth to 26 fL, whereas a parental WT control culture became 90%

budded at a much larger size of 61 fL (Figure 1C). Importantly, in the

same experiment, the onset G1/S transcription was accelerated in the dot6

strain as judged by the peak in expression of the two representative G1-

transcripts, the ribonucleotide reductase large subunit, RNR1, and the

cyclin PCL2 (Figure 1D). These results unequivocally demonstrated that

Dot6 regulates the cell size threshold at Start in C. albicans.

The effect of DOT6 inactivation was also assessed on the size of C. albicans

cells growing as invasive hyphae. While dot6 mutant was able to undergo

the yeast-to-hyphae transition, the size of hyphal cells was significantly

reduced as compared to the WT strain (Figure 1, E and F).

Opposite to C. albicans, inactivation of both DOT6 and its paralog TOD6 in

S. cerevisiae resulted in a slight size increase (Huber et al. 2011). To test if

the C. albicans Dot6 was functional in S. cerevisiae, we expressed CaDOT6

127

in the double mutant dot6 tod6 of the budding yeast. The obtained

transformants had a large size distribution comparable to dot6 tod6,

suggesting that the C. albicans Dot6 is not functional in S. cerevisiae

(Figure 1G). These data, together with the contrasting size phenotype of

mutants in both yeasts, suggest that S. cerevisiae Dot6/Tod6 and C.

albicans Dot6 are functionally divergent.

Dot6 interacts genetically with the SBF transcription factor complex

As cell size is a quantitative value, absolute changes in size between single

and double mutants can be used to reveal genetic interactions between

different genes to construct a cell size genetic interaction network

(Jorgensen et al. 2002; Costanzo et al. 2004; de Bruin et al. 2004). To

elucidate connections between Dot6 and previously identified Start

regulators in C. albicans (Sellam et al. 2016), both DOT6 alleles were

deleted in different small size mutants including sch9, sfp1, and hog1, as

well as the SBF large size mutant, swi4. Inactivating DOT6 in either sch9,

sfp1, or hog1 resulted in cells with smaller size as compared to their

congenic strains suggesting that Dot6, Sfp1, Sch9, and the p38 kinase

Hog1 act in different Start pathways (Figure 2, A–C). Furthermore,

inactivation of DOT6 in the swi4 mutant resulted in a large size

comparable to that of swi4 mutant, indicating that Dot6 acts via SBF

complex to control Start (Figure 2D). SWI4 deletion is also epistatic to

DOT6 regarding the growth rate in liquid YPD medium, confirming that

both Dot6 and Swi4 act in a common pathway (Figure 2E). Given the

absence of epistatic interaction between Dot6 and the known conserved

Ribi and size regulators Sch9, Sfp1, and Hog1, our data uncovered a novel

uncharacterized pathway that control the critical cell size threshold in C.

albicans (Figure 2F).

Dot6 is a positive regulator of ribosome biogenesis genes

128

Dot6 and its paralog Tod6 are both Myb-like transcription factors that

repress Ribi genes in the budding yeast (Lippman and Broach 2009; Huber

et al. 2011). To investigate the role of Dot6 in Start control in C. albicans,

we performed genome-wide transcriptional profiling by microarray. G1-

cells of both dot6 mutants and the parental WT strain were collected by

centrifugal elutriation and their transcriptomes were characterized. Gene

Set Enrichment Analysis (GSEA) was used to correlate the dot6 transcript

profile with C. albicans genome annotations and gene lists from other

transcriptional profiles experiments (Subramanian et al. 2005; Sellam et

al. 2012) (Table S3). dot6 mutant was unable to activate properly genes

with functions mainly associated with protein translation, including

ribosome biogenesis and structural constituents of the ribosome (Figure

3A). This suggest that, in contrast to the role of its ortholog in S.

cerevisiae, Dot6 in C. albicans is an activator of Ribi. Analysis of the

promoter region of the transcript downregulated in dot6 (transcript with

1.5-fold reduction using 5% FDR—Tables S4 and S5) showed the

occurrence of the PAC motif bound by Dot6 in all promoters of genes

related to Ribi (Figure 3B). Furthermore, transcripts downregulated in

dot6 exhibited correlation with the set of genes downregulated in the

presence of the TOR complex inhibitor, rapamycin (Bastidas et al. 2009).

This suggest that the evolutionary conserved Ribi transcription control by

TOR is mediated fully or partially through Dot6. In support of the role of

Dot6 in transcriptional control of Ribi genes, and, thus, translation, a dot6

mutant exhibited an increased sensitivity to the protein translation

inhibitor cycloheximide as compared to WT and revertant strains (Figure

3C).

The transcriptional programs characterizing the cell cycle G1/S transition

in C. albicans (Côte et al. 2009) were hyperactivated in a dot6 mutant,

which further supports the role of Dot6 as a negative regulator of G1/S

transcription and Start (Figure 3A). Interestingly, dot6-upregulated

transcripts showed a significant correlation with those activated in the

129

deletion mutant of the negative regulator of Start in C. albicans, Nrm1 (Ofir

et al. 2012; Sellam et al. 2016).

We used a GFP reporter assay to validate the role of the Dot6-binding PAC

elements in Ribi transcriptional regulation. We mutated the PAC motif of

the PNO1 genes encoding an essential protein required for rRNA

processing (Tone and Toh 2002), and replaced the PNO1 ORF by GFP. GFP

activity was reduced by 70% when the PAC motif was mutated (pPNO1-

mut) as compared to the intact WT pPNO1-GFP construct (Figure 3D). A

similar trend was observed when pPNO1-GFP was expressed in the dot6

mutant, reinforcing the fact that Dot6 recognize the PAC motif in C.

albicans.

Dot6 localization is regulated by the TOR signalling pathway

TOR is a central signaling circuit that controls cellular growth in response

to environmental nutrient status and stress in eukaryotes. In S. cerevisiae,

the transcription factor Sfp1 and the AGC kinase Sch9 are critical effectors

of the TOR pathway and form part of a dynamic, nutrient-responsive

network that controls the expression of Ribi genes, ribosomal protein

genes and cell size (Jorgensen et al. 2004; Urban et al. 2007; Lempiäinen

et al. 2009). In S. cerevisiae, both sch9 and sfp1 mutants are impervious to

carbon source effects on Start (Jorgensen et al. 2004). In C. albicans, while

sfp1 and sch9 mutants have the expected small size phenotype (Sellam et

al. 2016), they still retain the ability to respond to carbon source shifts,

unlike their S. cerevisiae counterparts (Figure S1). This suggests that the

Sfp1-Sch9 regulatory circuit had rewired, and is unlikely to rely on the

nutrient status of the cell to Start control in C. albicans.

To assess whether the nutrient-sensitive TOR pathway communicates the

nutrient status to Dot6, we first tested whether altering TOR activity by

rapamycin could alter the subcellular localization of the Dot6-GFP fusion.

130

In the absence of rapamycin, Dot6-GFP was localized exclusively in the

nucleus, in agreement with its role as a transcriptional activator under a

nutrient-rich environment (Figure 4, A–C). A weak GFP signal was also

observed in the nucleolus and the vacuole. When cells were treated with

rapamycin, Dot6-GFP was rapidly relocalized to the vacuole, and only a

small fraction remain in the nucleus (Figure 4, D–F). The vacuolar

localization of the Dot6-GFP was confirmed by its colocalization with the

CellTracker Blue-stained vacuoles (Figure S2). These data suggest that the

TOR pathway regulates the transcriptional function of Dot6. We also

exanimated the effect of modulating TOR activity on the protein level of

Dot6 using western blot. The level of Dot6 was significantly reduced in

cells exposed to rapamycin, suggesting that, in addition to the control of

Dot6 cellular localization, the TOR pathway also modulates the stability of

Dot6 (Figure 4G).

To assess whether the control of Dot6 activity by TOR impacts the cell size

of C. albicans, we examined genetic interactions between TOR1 and DOT6

by size epistasis. As TOR1 is an essential gene in C. albicans, we first tried

to delete one allele in dot6 homozygous mutant. However, all attempts to

generate such mutant were unsuccessful, suggesting a haplo-essentiality

of TOR1 in dot6 mutant background. Subsequently, we analyzed genetic

interaction of TOR1 and DOT6 using the complex haploinsufficiency (CHI)

concept by deleting one allele of each gene, and measured the size

distribution of the obtained mutant. While both DOT6/dot6 and

TOR1/Tor1 mutants had no discernable size defect, the TOR1/tor1

DOT6/dot6 strain exhibited a cell size distribution similar to that of

dot6/dot6, suggesting that DOT6 is epistatic to TOR1 (Figure 4H).

Similarly, DOT6 was also epistatic to TOR1 with respect to their sensitivity

toward rapamycin (Figure 4I). These data demonstrate that the TOR

pathway controls cell size through Dot6.

131

Dot6 is required for carbon-source modulation of cell size

The effect of different carbon sources on the size distribution of WT and

the dot6 mutant was assessed. While the cell size of WT and the revertant

strains was reduced by 12% (47.6 ± 0.5 fL) when grown under the poor

carbon source, glycerol, as compared to glucose (54.2 ± 0.5 fL), dot6 size

remain unchanged regardless of carbon source (Figure 4, J and K). A

similar finding was obtained when comparing cells growing on the

nonfermentable carbon source, ethanol (data not shown). These results

demonstrate that the transcription factor Dot6 is required for nutrient

modulation of cell size.

To check whether Dot6 localization is modulated by carbon sources, the

subcellular localization of the Dot6-GFP fusion was tested in cells that

grew in poor (glycerol), or in the absence of, carbon sources. Neither the

absence nor the quality of the carbon source altered the nuclear

localization of Dot6 (data not shown). This suggests that Dot6 governs the

carbon-source modulation of cell size through a mechanism that is

independent of its cellular relocalization.

The CTG-clade specific acidic domain of Dot6 is required for size

control in response to nonfermentable carbon sources

Our analysis unexpectedly reveals that Dot6 switched between activator

and repressor transcriptional regulator of Ribi between C. albicans and S.

cerevisiae, respectively. Sequence examination of C. albicans Dot6 protein

revealed a C-terminal aspartate-rich domain that is similar to acidic

activation domains of transcriptional activators. This Dot6 D-rich domain

was found specifically in C. albicans and other related species of the CTG

clade, and was absent in Dot6 orthologs in S. cerevisiae and other

ascomycetes (Figure 5A). To check whether the presence of this acidic

domain correlates with its function as transcriptional activator in C.

albicans, we deleted this D-rich domain using the CRISPR-Cas9

132

mutagenesis tool. Size distribution of the truncated DOT6-Δ[1555–1803]

strain was indistinguishable from that of the WT parental strain when cells

grew on YP with glucose (YPD) (Figure 5B) or other fermentable sugars

(YP-fructose, YP-galactose, YP-sucrose, and YP-mannose; data not shown).

The ability of DOT6-Δ[1555–1803] to activate two Ribi transcripts (DBP7

and KRE33) in YP-glucose was preserved, which suggests that this domain

is dispensable for the size control and gene expression activation functions

in response to fermentable carbon sources (Figure 5C). When C. albicans

cells were grown on nonfermentable carbon sources such as glycerol,

ethanol, or lactate, the DOT6-Δ[1555–1803] mutant exhibited a reduced

size as compared to the WT strain (Figure 5D). The two Ribi transcripts

DBP7 and KRE33 were downregulated in the DOT6-Δ[1555–1803] mutant

as compared to WT when cells utilized either glycerol or lactate as carbon

sources (Figure 5E). This suggest that the D-rich domain of Dot6 is

required to activate Ribi genes and adjust cell size under conditions of

respiratory growth.

133

3.2.5 - Discussion

Although both C. albicans and S. cerevisiae share the core cell cycle and

growth regulatory machineries, our previous investigations uncovered a

limited overlap of the cell size phenome between the two fungi (Sellam et

al. 2016; Chaillot et al. 2017). This finding is corroborated by recent

evidence showing an extensive degree of rewiring and plasticity of both

transcriptional regulatory circuits and signaling pathways across many

cellular and metabolic processes between the two yeasts (Homann et al.

2009; Lavoie et al. 2009, 2010; Blankenship et al. 2010; Li and Johnson

2010; Childers et al. 2016). The plasticity of the global size network

underscores the evolutionary impact of cell size as an adaptive mechanism

to optimize fitness. Indeed, many size genes in C. albicans were linked to

virulence, which suggests that cell size is an important biological trait that

contributes to the adaptation of fungal pathogens to their different niches

(Sellam et al. 2016; Chaillot et al. 2017). So far, the requirement of Dot6

for the fitness of C. albicans inside its host has not yet been tested;

however, inactivation of DOT6 led to the alteration of sensitivity toward

antifungals (Vandeputte et al. 2012). Moreover, while dot6 mutant was

able to form invasive filaments, the size of hyphae cells was significantly

reduced, which might impact the invasiveness of host tissues and organs

(Figure 1, E and F). This reinforces the fact that control of cell size

homeostasis is an important attribute for C. albicans to persist inside its

host.

We found that Dot6 is a major regulator of cell size in C. albicans as

compared to S. cerevisiae, emphasizing an evolutionary drift regarding the

contribution of this transcription factor in size modulation. The potency of

the C. albicans Dot6 in size control could be attributed to different facts.

First, and in contrast to its role in S. cerevisiae, Dot6 is an activator of Ribi

genes. This might explain the small size of dot6 in C. albicans given the

134

fact that inactivation of transcriptional activators of Ribi genes such as

Sfp1 and Sch9 in either S. cerevisiae or C. albicans led to the acceleration

of Start, and, consequently, to a whi phenotype (Jorgensen et al. 2002;

Dungrawala et al. 2012; Soifer and Barkai 2014; Sellam et al. 2016;

Chaillot et al. 2017). Second, in C. albicans, Dot6 had an expanded genetic

connectivity with both the critical SBF complex, which controls the G1/S

transition, and also with the TOR growth and Ribi machineries, which

might explain the influential role of Dot6 in size control.

Our findings support a model whereby Dot6 acts as a hub that might

integrate directly growth cues via the TOR pathway to control the

commitment to mitotic division at G1. This regulatory behavior is similar

to the p38/HOG1 pathway that controls the Ribi regulon through the

master transcriptional regulator, Sfp1, and acts upstream of the SBF

transcription factor complex to control division (Sellam et al. 2016).

Meanwhile, our genetic interaction analysis showed that the dot6 hog1

double mutant had an additive small size phenotype, suggesting that both

Dot6 and Hog1 act in parallel. This finding emphasizes that, in C. albicans,

multiple signals are integrated at the level of G1 machinery to optimize

adaptation to different conditions. Contrary to the p38/HOG pathway,

Dot6 was required for size adjustment in response to glycerol, suggesting

that this transcription factor provides a nexus for integrating carbon

nutrient status to the ribosome synthesis and Start machineries (Figure

6).

Compared to other hemi-ascomycetes, Candida species of the CTG-clade

possess a Dot6 with a C-terminal D-rich domain that resembles the acidic

activation domains found in many transcriptional activators. We have

shown that deletion of the D-rich domain had no impact on C. albicans

cells size or the transcription of Ribi genes when cells grew in media with

fermentable carbon sources. However, in the presence of a nonfermentable

135

carbon source, the D-rich domain was required for both size homeostasis

and Ribi transcription. These data suggest that the D-rich domain of Dot6

might function as a transcriptional activation domain of Ribi genes to

promote growth, and, consequently, set a homeostatic cell size when C.

albicans cells undergo respiratory growth. Previous investigations had

shown that D-rich domains play multiple roles in gene transcription

regulation through DNA mimicry to modulate mRNA processing and the

activity of the general transcription machinery (Chou and Wang 2015). For

instance, the D-rich domain of Taf1 exerts an inhibitory effect on

transcription by competing with the TFIIA complex in binding TBP (TATA-

box binding protein). For Dot6, the D-rich domain might behave similarly

by competing with other transcriptional regulators that coordinate the

transcription of Ribi with respiratory metabolism. A plausible

interpretation of the small size of the truncated DOT6-Δ[1555–1803] strain

is that Ribi promoters are modulated by a transcriptional repressor under

respiratory growth, and, in the absence of the D-rich competitor domain,

Ribi are repressed, which, in turn, might lead to Start acceleration and the

whi phenotype.

How Dot6 switches its function from a transcriptional Ribi repressor in S.

cerevisiae to an activator in C. albicans is an intriguing question. Under

respiratory growth conditions, this might be explained by the fact that the

potential D-rich activation domain was lost in S. cerevisiae, as discussed

above. However, under fermentative growth, the D-rich domain was

dispensable for size control and Ribi activation. For their repressive activity

at the Ribi gene promoters in S. cerevisiae, both Dot6 and Tod6 recruit the

histone deacetylase Rpd3L to establish a repressive chromatin state

(Huber et al. 2011). Instead of a repressive chromatin-modifying complex,

C. albicans Dot6 might recruit an activator that might impose its Ribi-

activating function. However, so far, no such chromatin-modifying

activator complex has been identified in C. albicans. Future studies are

136

needed to characterize the contribution of chromatin remodelling and

modification complexes to Ribi transcription in this opportunistic yeast.

137


We are grateful to James Broach (Princeton University), Robbie Loewith

(Université de Genève), Julia Köhler (Harvard Medical School), and

Dominique Sanglard [Le Centre Hospitalier Universitaire Vaudois (CHUV)-

Université Lausanne] for providing strains. We would like to thank

Christian Landry and Aléxandre Dubé [Université Laval-L’Institut de

biologie intégrative et des systèmes (IBIS)] for sharing the pAG415GPD-

ccdB plasmids. This work was supported by grants from the Natural

Sciences and Engineering Research Council of Canada (#06625), the

Canadian Foundation for Innovation and the Fonds de Recherche du

Québec-Santé. J.C. was supported by a Université Laval Faculty of

Medicine and Centre Hospitalier Universitaire de Québec (CHUQ)

foundation Ph.D. scholarships. A.S. was supported by a Fonds de

Recherche du Québec-Santé (FRQS) J1 salary award.

138

3.2.7 - References

Bastidas R. J., Heitman J., Cardenas M. E., 2009 The protein kinase

Tor1 regulates adhesin gene expression in Candida albicans. PLoS Pathog.

5: e1000294. doi:10.1371/journal.ppat.1000294

Berman J., 2006 Morphogenesis and cell cycle progression in Candida

albicans. Curr. Opin. Microbiol. 9: 595–601.

doi:10.1016/j.mib.2006.10.007

Blankenship J. R., Fanning S., Hamaker J. J., Mitchell A. P., 2010 An

extensive circuitry for cell wall regulation in Candida albicans. PLoS

Pathog. 6: e1000752. doi:10.1371/journal.ppat.1000752

Chaillot J., Cook M. A., Corbeil J., Sellam A., 2017 Genome-wide screen

for haploinsufficient cell size genes in the opportunistic yeast Candida

albicans. G3 (Bethesda) 7: 355–360. doi:10.1534/g3.116.037986

Chen D. C., Yang B. C., Kuo T. T., 1992 One-step transformation of yeast

in stationary phase. Curr. Genet. 21: 83–84. doi:10.1007/BF00318659

Childers D. S., Raziunaite I., Mol Avelar G., Mackie J., Budge S., et al.,

2016 The rewiring of ubiquitination targets in a pathogenic yeast

promotes metabolic flexibility, host colonization and virulence. PLoS

Pathog. 12: e1005566. doi:10.1371/journal.ppat.1005566

Chou C. C., Wang A. H., 2015 Structural D/E-rich repeats play multiple

roles especially in gene regulation through DNA/RNA mimicry. Mol.

Biosyst. 11: 2144–2151. doi:10.1039/C5MB00206K

Costanzo M., Nishikawa J. L., Tang X., Millman J. S., Schub O., et al.,

2004 CDK activity antagonizes Whi5, an inhibitor of G1/S transcription

in yeast. Cell 117: 899–913. doi:10.1016/j.cell.2004.05.024

Côte P., Hogues H., Whiteway M., 2009 Transcriptional analysis of the

Candida albicans cell cycle. Mol. Biol. Cell 20: 3363–3373.

doi:10.1091/mbc.e09-03-0210

de Bruin R. A., McDonald W. H., Kalashnikova T. I., Yates J. III.,

Wittenberg C., 2004 Cln3 activates G1-specific transcription via

phosphorylation of the SBF bound repressor Whi5. Cell 117: 887–898.

doi:10.1016/j.cell.2004.05.025

139

Dungrawala H., Hua H., Wright J., Abraham L., Kasemsri T., et al., 2012

Identification of new cell size control genes in S. cerevisiae. Cell Div. 7: 24.

doi:10.1186/1747-1028-7-24

Enfert C., Hube B., 2007 Candida: Comparative and Functional

Genomics. Caister Academic Press, Wymondham, Norfolk, UK.

Gola S., Martin R., Walther A., Dunkler A., Wendland J., 2003 New

modules for PCR-based gene targeting in Candida albicans: rapid and

efficient gene targeting using 100 bp of flanking homology region. Yeast 20:

1339–1347. doi:10.1002/yea.1044

Guillemette T., Sellam A., Simoneau P., 2004 Analysis of a nonribosomal

peptide synthetase gene from Alternaria brassicae and flanking genomic

sequences. Curr. Genet. 45: 214–224. doi:10.1007/s00294-003-0479-z

Homann O. R., Dea J., Noble S. M., Johnson A. D., 2009 A phenotypic

profile of the Candida albicans regulatory network. PLoS Genet. 5:

e1000783. doi:10.1371/journal.pgen.1000783

Huber A., French S. L., Tekotte H., Yerlikaya S., Stahl M., et al., 2011

Sch9 regulates ribosome biogenesis via Stb3, Dot6 and Tod6 and the

histone deacetylase complex RPD3L. EMBO J. 30: 3052–3064.

doi:10.1038/emboj.2011.221

Jorgensen P., Tyers M., 2004 How cells coordinate growth and division.

Curr. Biol. 14: R1014–R1027. doi:10.1016/j.cub.2004.11.027

Jorgensen P., Nishikawa J. L., Breitkreutz B. J., Tyers M., 2002

Systematic identification of pathways that couple cell growth and division

in yeast. Science 297: 395–400. doi:10.1126/science.1070850

Jorgensen P., Rupes I., Sharom J. R., Schneper L., Broach J. R., et al.,

2004 A dynamic transcriptional network communicates growth potential

to ribosome synthesis and critical cell size. Genes Dev. 18: 2491–2505.

doi:10.1101/gad.1228804

Kafri M., Metzl-Raz E., Jona G., Barkai N., 2016 The cost of protein

production. Cell Rep. 14: 22–31. doi:10.1016/j.celrep.2015.12.015

Lavoie H., Sellam A., Askew C., Nantel A., Whiteway M., 2008 A toolbox

for epitope-tagging and genome-wide location analysis in Candida

albicans. BMC Genomics 9: 578. doi:10.1186/1471-2164-9-578

140

Lavoie H., Hogues H., Whiteway M., 2009 Rearrangements of the

transcriptional regulatory networks of metabolic pathways in fungi. Curr.

Opin. Microbiol. 12: 655–663. doi:10.1016/j.mib.2009.09.015

Lavoie H., Hogues H., Mallick J., Sellam A., Nantel A., et al., 2010

Evolutionary tinkering with conserved components of a transcriptional

regulatory network. PLoS Biol. 8: e1000329.

doi:10.1371/journal.pbio.1000329

Lempiäinen H., Uotila A., Urban J., Dohnal I., Ammerer G., et al., 2009

Sfp1 interaction with TORC1 and Mrs6 reveals feedback regulation on TOR

signaling. Mol. Cell 33: 704–716. doi:10.1016/j.molcel.2009.01.034

Lenski R. E., Travisano M., 1994 Dynamics of adaptation and

diversification: a 10,000-generation experiment with bacterial populations.

Proc. Natl. Acad. Sci. USA 91: 6808–6814. doi:10.1073/pnas.91.15.6808

Li H., Johnson A. D., 2010 Evolution of transcription networks–lessons

from yeasts. Curr. Biol. 20: R746–R753. doi:10.1016/j.cub.2010.06.056

Lippman S. I., Broach J. R., 2009 Protein kinase A and TORC1 activate

genes for ribosomal biogenesis by inactivating repressors encoded by Dot6

and its homolog Tod6. Proc. Natl. Acad. Sci. USA 106: 19928–19933.

doi:10.1073/pnas.0907027106

Marion R. M., Regev A., Segal E., Barash Y., Koller D., et al., 2004 Sfp1 is

a stress- and nutrient-sensitive regulator of ribosomal protein gene

expression. Proc. Natl. Acad. Sci. USA 101: 14315–14322.

doi:10.1073/pnas.0405353101

Merico D., Isserlin R., Stueker O., Emili A., Bader G. D., 2010

Enrichment map: a network-based method for gene-set enrichment

visualization and interpretation. PLoS One 5: e13984.

doi:10.1371/journal.pone.0013984

Ofir A., Hofmann K., Weindling E., Gildor T., Barker K. S., et al., 2012

Role of a Candida albicans Nrm1/Whi5 homologue in cell cycle gene

expression and DNA replication stress response. Mol. Microbiol. 84: 778–

794. doi:10.1111/j.1365-2958.2012.08056.x

Saito R., Smoot M. E., Ono K., Ruscheinski J., Wang P. L., et al., 2012 A

travel guide to Cytoscape plugins. Nat. Methods 9: 1069–1076.

doi:10.1038/nmeth.2212

141

Sandai D., Yin Z., Selway L., Stead D., Walker J., et al., 2012 The

evolutionary rewiring of ubiquitination targets has reprogrammed the

regulation of carbon assimilation in the pathogenic yeast Candida

albicans. MBio 3: pii: e00495-12. doi:10.1128/mBio.00495-12

Schaub Y., Dunkler A., Walther A., Wendland J., 2006 New pFA-

cassettes for PCR-based gene manipulation in Candida albicans. J. Basic

Microbiol. 46: 416–429. doi:10.1002/jobm.200510133

Schmoller K. M., Skotheim J. M., 2015 The biosynthetic basis of cell size

control. Trends Cell Biol. 25: 793–802. doi:10.1016/j.tcb.2015.10.006

Sellam A., Tebbji F., Nantel A., 2009 Role of Ndt80p in sterol metabolism

regulation and azole resistance in Candida albicans. Eukaryot. Cell 8:

1174–1183. doi:10.1128/EC.00074-09

Sellam A., Tebbji F., Whiteway M., Nantel A., 2012 A novel role for the

transcription factor Cwt1p as a negative regulator of nitrosative stress in

Candida albicans. PLoS One 7: e43956.

doi:10.1371/journal.pone.0043956

Sellam A., van het Hoog M., Tebbji F., Beaurepaire C., Whiteway M., et al.,

2014 Modeling the transcriptional regulatory network that controls the

early hypoxic response in Candida albicans. Eukaryot. Cell 13: 675–690.

doi:10.1128/EC.00292-13

Sellam A., Chaillot J., Mallick J., Tebbji F., Richard Albert J., et al., 2016

A systematic cell size screen uncovers coupling of growth to division by the

p38/HOG network in Candida albicans. bioRxiv.

https://doi.org/10.1101/094144

Soifer I., Barkai N., 2014 Systematic identification of cell size regulators

in budding yeast. Mol. Syst. Biol. 10: 761. doi:10.15252/msb.20145345

Subramanian A., Tamayo P., Mootha V. K., Mukherjee S., Ebert B. L., et

al., 2005 Gene set enrichment analysis: a knowledge-based approach for

interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA

102: 15545–15550. doi:10.1073/pnas.0506580102

Tone Y., Toh E. A., 2002 Nob1p is required for biogenesis of the 26S

proteasome and degraded upon its maturation in Saccharomyces

cerevisiae. Genes Dev. 16: 3142–3157. doi:10.1101/gad.1025602

↵

142

Turner J. J., Ewald J. C., Skotheim J. M., 2012 Cell size control in yeast.

Curr. Biol. 22: R350–R359. doi:10.1016/j.cub.2012.02.041

Tyers M., Tokiwa G., Futcher B., 1993 Comparison of the Saccharomyces

cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2

and other cyclins. EMBO J. 12: 1955–1968. doi:10.1002/j.1460-

2075.1993.tb05845.x

Urban J., Soulard A., Huber A., Lippman S., Mukhopadhyay D., et al.,

2007 Sch9 is a major target of TORC1 in Saccharomyces cerevisiae. Mol.

Cell 26: 663–674. doi:10.1016/j.molcel.2007.04.020

Vandeputte P., Pradervand S., Ischer F., Coste A. T., Ferrari S., et al., 2012

Identification and functional characterization of Rca1, a transcription

factor involved in both antifungal susceptibility and host response in

Candida albicans. Eukaryot. Cell 11: 916–931. doi:10.1128/EC.00134-12

Vyas V. K., Barrasa M. I., Fink G. R., 2015 A Candida albicans CRISPR

system permits genetic engineering of essential genes and gene families.

Sci. Adv. 1: e1500248. doi:10.1126/sciadv.1500248

Zhu C., Byers K. J., McCord R. P., Shi Z., Berger M. F., et al., 2009 High-

resolution DNA-binding specificity analysis of yeast transcription factors.

Genome Res. 19: 556–566. doi:10.1101/gr.090233.108

143

3.2.8 - Figures

Figure 1. Dot6 is required for Start onset and cell size homeostasis.

(A) Size distributions of the WT (SFY87), dot6 mutant, and the revertant

strains. The median sizes of each strain are indicated in parentheses. (B)

Growth of the WT (SFY87), dot6 mutant, and the revertant (dot6 p-DOT6)

strains in YPD medium at 30°C as determined by cell counts using the Z2-

Coulter Counter. Results are the mean of three replicates. Doubling-times

144

during the exponential phase of the growth for each strain are indicated in

parentheses. (C and D) Start characterization of dot6. (C) Elutriated G1

phase daughter cells were released into fresh YPD medium and assessed

for bud emergence as a function of size and G1/S transcription (D). RNR1

and PCL2 transcript levels were assessed by quantitative real-time PCR

and normalized to ACT1 levels. (E and F) Dot6 is required for size

homeostasis of hyphal cells. Fluorescence micrographs of both WT (SFY87)

and dot6 mutant on YPD supplemented with 10% fetal bovine serum (FBS)

at 37°C for 3 hr and stained with calcofluor white (E). Bar, 10 µm. (F)

Length of at least 20 hyphal cells of both WT (SFY87) and dot6 mutant.

Bars represent the means ± SEs of the means. * P < 0.0003 using a two-

tailed t-test. (G) C. albicans DOT6 (CaDOT6) failed to complement size

defect of the S. cerevisiae dot6 tod6 double mutant. Size distributions of

the S. cerevisiae WT (Y2092) and dot6 tod6 (Y3707) strains expressing, or

not, CaDOT6.

145

Figure 2. DOT6 size epistasis. Evaluation of size epistasis between dot6

and different potent Start mutations. DOT6 was inactivated in sch9 (A),

sfp1 (B), hog1 (C), and swi4 (D) mutants, and the resulted double mutant

strains were analyzed for cell size distribution. (E) SWI4 deletion is

epistatic to DOT6 regarding the growth rate. Cells were grown in YPD

medium at 30°C under agitation, and cells were counted using the Z2-

Coulter Counter. Results are the mean of three replicates. (F) Summary of

DOT6 genetic interactions with the C. albicans Start machinery.

146

Figure 3. Dot6 is a positive regulator of ribosome biogenesis genes. (A)

GSEA analysis of differentially expressed genes in a dot6 mutant relative to

the WT strain (SFY87). Cells were synchronized in G1 phase by centrifugal

elutriation, released in fresh SC medium for 10 min, and analyzed for gene

expression profiles by DNA microarrays. Correlations of dot6 upregulated

(red circles) and downregulated (blue circles) transcripts are shown for

147

biological processes, gene lists in different C. albicans mutants and

experiments. The diameter of the circle reflects the number of modulated

gene transcripts in each gene set. Known functional connections between

related processes are indicated (green lines). Images were generated in

Cytoscape with the Enrichment Map plug-in. (B) Occurrence of the PAC

motif in the promoters of Dot6-modulated Ribi genes. The 400 bp sequence

upstream the start codon of downregulated genes in dot6 (transcript with

1.5-fold reduction using 5% FDR) were scanned for the GATGAG motif. (C)

Effect of the translation inhibitor cycloheximide on the growth of the WT

(SFY87), dot6 mutant, and the revertant (dot6 p-DOT6) strains. Strains

were grown on in SC medium at 30°C for 24 hr. Relative growth was

calculated as fraction of OD600 of cycloheximide-treated cells relatively to

the nontreated controls. Results are the mean of three replicates. (D) GFP

reporter assay to confirm that the transcription at the PNO1 (Orf19.7618)

locus is driven by the Dot6 PAC-binding element. The pPNO1-GFP reporter

strain was constructed by replacing one copy of the PNO1 ORF by the GFP

ORF. Mutation in the PAC motif of the pPNO1-mut strain was introduced

by PCR using the forward primer pPNO1mut-GFP-F. GFP fluorescence was

measured by flow cytometry, and results are presented as relative mean

GFP fluorescence as compared to pPNO1-GFP construct in the WT strain.

Bars show the means ± SEM. NS, not significant (P > 0.15).

148

Figure 4. Dot6 localization is regulated by the TOR signaling pathway.

(A–F) Dot6-GFP fluorescence was visualized using confocal microscopy in

cells treated (D–F) or not (A–C) with the TOR pathway inhibitor,

rapamycin. Exponentially grown cells in SC medium were treated with 100

ng/ml rapamycin for 1 hr. Nuclear and mitochondrial DNA were

demarcated by DAPI staining (B and E). Red arrows indicate Dot6-GFP

florescence in nucleolar regions. Bar, 5 µm. (G) Level of Dot6 in

149

exponentially grown cells in SC medium treated or not with 100 ng/ml

rapamycin for 15, 30, 60, and 120 min. Vector control corresponds to the

untagged strain. (H and I) DOT6 and TOR1 genetic interaction for cell size

and growth in the presence of rapamycin based on complex

haploinsufficiency concept. (H) Size distributions of the WT (SN250), the

heterozygous (DOT6/dot6), and homozygous (dot6/dot6) dot6 mutants, the

heterozygous TOR1/tor1 strain and the double heterozygous mutant

TOR1/tor1 DOT6/dot6. (I) DOT6 is epistatic to TOR1 with respect to their

sensitivity toward rapamycin. Strains were grown on in SC medium at

30°C for 24 hr. Relative growth was calculated as fraction of OD600 of

rapamycin-treated cells relatively to the nontreated controls. Results are

the mean of three replicates. (J and K) Dot6 is required for carbon-source

modulation of cell size. (J) Cell size distribution of the WT and dot6 mutant

strains grown in medium with either glucose or glycerol as the sole source

of carbon. (K) Median size of the WT (SFY87), dot6 mutant and the

revertant strains growing in synthetic glucose or glycerol medium. Results

are the mean of three independent replicates.

150

Figure 5. The CTG-clade specific acidic domain of Dot6 is required for

size control in response to nonfermentable carbon sources. (A) The C-

terminal D-rich domain of Dot6 is conserved in the CTG clade species C.

albicans (Ca), C. parapsilosis (Cp) and C. dubliniensis (Cd), but not in S.

cerevisiae (Sc) and C. glabrata (Cg). Identical residues are indicated with

asterisks. Conserved and semiconserved substitutions are denoted by

colons and periods, respectively. (B) Cell size distribution of the WT

(SC5314) and the truncated DOT6-Δ[1555–1803] strains. (C) Transcript

levels of Ribi genes, including DBP7 and KRE33, were evaluated in both

WT (SC5314) and the truncated DOT6-Δ[1555–1803] strains. Transcript

levels were calculated using the comparative CT method using the ACT1

151

gene as a reference. Results are the mean of three replicates. For each

transcript, fold changes in the WT and the truncated strains were not

statistically significant (t-test). NS, not significant. (D) Median size of the

WT (SC5314), dot6, and the truncated DOT6-Δ[1555–1803] strains growing

in YP-glucose, YP-glycerol, YP-ethanol, and YP-lactate media. Results are

the mean of three independent replicates. * P < 0.02; ** P < 0.01; (E)

Transcript levels of Ribi genes, DBP7, and KRE33 in both WT (SC5314) and

the truncated DOT6-Δ[1555–1803] strains growing in fermentable (glucose)

and nonfermentable carbon sources (glycerol and lactate). Values

represent transcript levels of DBP7 and KRE33 in cells growing in glycerol

or lactate normalized to that of cells growing in glucose. Results are the

mean of three replicates.

152

Figure 6. Schematic model of connections between Dot6 and Start

control machinery in C. albicans.

153

Figure S1

154

Figure S2

155

Chapitre 4 - Caractérisation d’un nouveau

régulateur de la taille : Ahr1

4.1 - Le mutant ahr1 présente un phénotype de petite taille

Dans nos criblages présentés dans les Chapitres 1 et 2, nous avons

identifié le mutant ahr1 comme un mutant de petite taille. Ahr1 est un

facteur de transcription à doigt de zinc. Ce facteur de transcription a un

rôle dans dans la transition phénotypique (White/Opaque), dans le

métabolisme des acides aminés et dans l’activation des gènes codants pour

des adhésines, qui ont un rôle critique dans la formation des biofilms et

l’attachement aux cellules de l’hôte (Askew et al. 2011; Wang, Song, et al.

2011; Vylkova and Lorenz 2017). Le mutant de délétion ahr1 présente une

virulence atténuée (Askew et al. 2011). L’analyse de séquence suggère

qu’Ahr1 est un gène spécifique du clade CTG.

Cultivé en milieu riche et en phase exponentielle, le mutant ahr1 a un

volume d’environ 40 fL, alors que la souche de référence a un volume de

50 fL, il y a donc une diminution de la taille cellulaire de 20% (Figure 14).

Nous avons créé une souche dans laquelle nous avons intégré le gène

sauvage AHR1 dans le mutant de délétion ahr1 (ahr1 p-AHR1). Cette

souche a une taille comparable à la souche sauvage, ce qui prouve que le

phénotype de petite taille du mutant ahr1 est bien une conséquence de la

délétion du gène ahr1 suggérant que Ahr1 est un régulateur de la taille

cellulaire (Figure 14).

156

Figure 14 - Distribution de la taille du mutant ahr1, du révertant et de la souche sauvage.

Nous avons réalisé une courbe de croissance afin de tester si le défaut de

taille est dû à un défaut de croissance qui pourrait provoquer une

accumulation de cellules en G1 et donc une population de plus petite

taille. Le mutant ahr1 n’a pas de défaut de croissance comparé à la souche

sauvage (Figure 15), donc le phénotype de petite taille n’est pas la

conséquence d’un défaut de croissance.

157

Figure 15 - Courbes de croissance du mutant ahr1 et du WT.

Enfin, nous avons testé si le mutant ahr1 a un défaut de taille en forme

hyphe. Pour cela, nous avons mesuré la distance entre deux septums. La

distance entre deux septums est plus petite dans le mutant ahr1 par

rapport à la souche sauvage (Figure 16). Ahr1 est donc un régulateur de

la taille cellulaire sous forme levuriforme et filamenteuse.

158

Figure 16 - Taille des hyphes du mutant ahr1 et du révertant.

4.2 - Ahr1 est un régulateur négatif de START

Nous avons testé si le défaut de taille du mutant ahr1 résulte d’une

dérégulation de START. Pour cela nous avons isolé des cellules en phase

G1 par élutriation et nous les avons relâchées dans un milieu frais. Nous

avons déterminé le pourcentage de cellules avec un bourgeon, marqueur

d’entrée en phase S, en fonction de la taille. Pour la souche sauvage, 50%

des cellules ont un bourgeon à une taille de 50 fL. Pour le mutant ahr1,

50% des cellules ont un bourgeon à une taille de 20 fL (Figure 17). Ceci

suggère que START est accéléré dans le mutant, par rapport à la souche

sauvage, ce qui est cohérant avec le phénotype de petite taille du mutant

ahr1.

159

Figure 17 - Budding index du mutant ahr1 et du WT

Pour appuyer ce résultat, nous avons également réalisé une RT-qPCR sur

des cellules synchronisées en phase G1 pour quantifier l’expression des

gènes RNR1 et PCL2, des gènes marqueurs de la transition G1/S, en

fonction de la taille. Ces deux gènes ont un pic d’expression à une taille

plus petite chez le mutant ahr1 (25 fL) par rapport au WT (50 fL) (Figure

18).

Figure 18 - Expression de RNR1 et PCL2 en fonction de la taille

160

Le bourgeonnement ainsi que l’expression des gènes RNR1 et PCL2

montrent que START est accéléré dans le mutant. Ceci suggère qu’Ahr1 est

un régulateur négatif de START.

4.3 - Ahr1 interagit génétiquement et physiquement avec

Sch9

Pour savoir dans quelle voie de régulation se trouve Ahr1, nous avons

étudié les interactions génétiques entre Ahr1 et différents régulateurs de

START. Nous avons surexprimé Ahr1 dans différents mutants de délétion

de START (hog1, sch9, dot6, nrm1 et sfp1) afin de rechercher de l’épistasie.

Sch9 est une AGC kinase ayant un rôle dans la traduction, la virulence et

la filamentation (Liu et al. 2010). Le mutant sch9 a un phénotype de petite

taille (phénotype conservé avec S. cerevisiae) et quand nous surexprimons

AHR1 dans ce mutant de délétion, le phénotype sauvage de taille est

restauré (Figure 19). La surexpression d’AHR1 dans la souche sauvage n’a

aucun effet sur la taille. Ces résultats suggèrent qu’Ahr1 agit en aval de

Sch9.

161

Figure 19 – Intéraction génétique entre SCH9 et AHR1. Distribution de la taille des

mutants ahr1, sch9 et le mutant de surexpression de Ahr1 dans le mutant sch9.

Comme nous avons mis en évidence une interaction génétique entre SCH9

et AHR1, nous avons testé s’il y a une interaction physique par Co-

immunoprécipitation. Sch9 et Ahr1 interagissent physiquement et cette

interaction n’est pas perdue en présence de la rapamycine, un inhibiteur

de la voie TOR. Ceci suggère que l’interaction est indépendante de TOR

(Figure 20). Cependant, l’intéraction détectée peut être indirecte, une

confirmation par une autre technique est nécessaire. Les interactions

génétiques et physiques suggèrent que Sch9 contrôle la fonction d’Ahr1.

162

Figure 20 – Coimmunoprécipitation entre Ahr1 et Sch9. Les cellules ont été traitées avec

0,5µg/mL de rapamycine.

4.4 - Ahr1 régule la croissance suivant les acides aminés

disponibles

Afin de comprendre le rôle d’Ahr1 dans la régulation de START, nous

avons analysé le profil transcriptionnel du mutant ahr1 et de la souche

sauvage synchronisés. Pour cela, les cellules en phase G1 ont été

collectées par élutriation, relâchées dans un milieu frais, cultivées pendant

15 minutes et le transcriptome a été analysé. Nous avons utilisé la

méthode GSEA (Gene Set Enrichment Analysis) pour identifier les

processus biologiques enrichis dans les gènes réprimés et surexprimés.

Les gènes régulant le métabolisme des acides aminés, de la protéolyse, de

la glycolyse et de la traduction sont réprimés dans le mutant ahr1

(représentés en bleu) (Figure 21).

163

Figure 21 - Analyse transcriptionnelle du mutant ahr1 synchronisée en phase G1/S. Les

points bleus représentent les gènes réprimés dans le mutant ahr1.

Des liens entre Ahr1 et le métabolisme ont été précédemment observés

(Askew et al. 2011; Vylkova and Lorenz 2017). Pour comprendre le lien

entre Ahr1, le métabolisme des acides aminés et la régulation de la taille,

nous avons testé la croissance du mutant ahr1 dans un milieu minimum

(MM) en faisant varier l’acide aminé disponible dans le milieu (Figure 22).

164

Figure 22 - Temps de doublement des mutants ahr1 et sch9 cultivés sur différents acides

aminés. * p-value < 0.05 ; ** p-value < 0.01 ; NS = Non significatif. Trois réplicats ont été

réalisés.

Le mutant ahr1 a des défauts de croissance, comparé à la souche sauvage,

quand le seul acide aminé disponible est l’arginine, la glutamine, la serine

l’alanine, ou la proline (Figure 22).

Nous avons déterminé la taille cellulaire des souches cultivées sur les

différents acides aminés et nous avons tracés une courbe de la taille

cellulaire en fonction du temps de doublement (Figure 23). Pour la souche

WT, on observe une corrélation entre la taille cellulaire et le temps de

doublement : la taille cellulaire est plus grande quand le taux de

doublement est faible. Pour le mutant ahr1, la corrélation entre la taille et

le temps de doublement est partiellement perdue. Cultivé sur l’asparagine,

165

la sérine et la proline, le mutant a une plus grande taille que la souche

sauvage. Sur les autres acides aminés testés (glutamine, alanine, valine,

proline et sulfate d’ammonium), le mutant ahr1 a une petite taille comparé

à la souche sauvage (Figure 23). Ces résultats suggèrent qu’Ahr1 est

nécessaire pour le contrôle de la croissance et de la régulation de la taille

cellulaire dépendamment des acides aminés disponibles dans le milieu.

Figure 23 - Taille cellulaire en fonction du temps de doublement du mutant ahr1.

Nous avons également analysé la distribution de la taille du mutant ahr1

en faisant varier les sources de carbone dans le milieu (glucose, glycérol,

maltose). Nous n’avons observé aucun défaut de croissance pour le mutant

ahr1. Ceci indique qu’Ahr1 a un rôle dans la régulation de la croissance et

de la taille en réponse aux sources d’azote disponible dans le milieu, et

non les sources de carbone.

4.5 - La localisation d’Ahr1 est régulée par la voie TOR

166

Nous avons montré que Sch9 est un effecteur d’Ahr1. Il est connu que

Sch9 est régulé par la voie TOR chez S. cerevisiae et C. albicans

(Chowdhury and Kohler 2015). Pour tester s’il existe un lien fonctionnel

entre la voie TOR et Ahr1, nous avons analysé la localisation cellulaire

d’Ahr1 fusionné à la GFP, en absence et en présence d’un inhibiteur de la

voie TOR, la rapamycine (Figure 24). Nos résultats montrent que la

protéine Ahr1 est localisée dans le noyau en conditions de croissance

optimale. En présence de rapamycine, Ahr1 est délocalisé dans le

cytoplasme. Ceci suggère que la voie TOR contrôle la fonction d’Ahr1 en

relocalisant Ahr1 dans le cytoplasme, ce qui permettrait d’inhiber son

activité de facteur de transcription.

167

Figure 24 – A) Photos de microscopie d’une souche exprimant Ahr1-GFP sans et avec

Rapamycine (100ng/mL). B) Quantification du signal de la GFP dans le noyau (N) et le

cytoplasme (C). Le ratio N/C diminue suite au traitement à la rapamycine.

168

4.6 - Discussion

Malgré les ressemblances physiologiques entre S. cerevisiae et C. albicans,

de nombreux gènes orthologues ont des fonctions différentes entre les

deux espèces. Précédemment, nous avons mis en évidence que la

régulation de la taille cellulaire est un processus plastique au cours de

l’évolution et nous avons identifié des nouveaux régulateurs de la taille

cellulaire (Chapitres 1 et 2). Parmi les nouveaux régulateurs, nous avons

identifié le facteur de transcription à doigt de zinc Ahr1 comme un

régulateur de la taille. Nous avons montré qu’Ahr1 régule la taille en

modulant START.

La voie TOR est un régulateur important de la croissance cellulaire

(Loewith and Hall 2011) et de nombreux régulateurs de START sont dans

la voie TOR, comme Sfp1, Sch9 et Dot6 (Jorgensen and Tyers 2004; Huber

et al. 2011). Ici, nous avons trouvé des interactions génétiques et

physiques entre Ahr1 et Sch9. De plus, nous avons montré que l’inhibition

de l’activité de la voie TOR par la rapamycine permet la délocalisation la

protéine Ahr1. Ces résultats suggèrent que la voie TOR régule la taille

cellulaire via Ahr1 (Figure 25).

169

Figure 25 – Modèle de la régulation de START chez C.albicans. La voie TOR-Sch9

contrôle START via Ahr1. Ahr1 est dans une voie parallèle des régulateurs de la

transcription des gènes RiBi Dot6 et Sfp1.

La voie TOR est également nécessaire pour contrôler la croissance en

réponse aux acides aminés disponibles dans le milieu (Kim and Guan

2011). Nous avons montré qu’Ahr1 est nécessaire pour la croissance et la

régulation de la taille quand les cellules sont cultivées sur certains acides

aminés. En effet, le mutant ahr1 a une petite taille quand il est cultivé en

milieu riche mais il a une grande taille quand il est cultivé en présence de

sérine, de proline ou d’asparagine comme seule source d’acide aminé. Le

défaut de croissance du mutant ahr1 pourrait être expliqué par les défauts

du métabolisme des acides aminés (Figure 22) (Askew et al. 2011; Vylkova

and Lorenz 2017). Ceci pourrait provoquer une diminution d’acides aminés

disponibles pour la traduction et donc provoquer des défauts de synthèse

des protéines. Nous n’avons pas trouvé de défaut de croissance en faisant

varier les sources de carbones, ce qui montre qu’Ahr1 contrôle la

croissance suivant les sources d’azotes disponibles dans le milieu et non

les sources de carbones. Pris ensemble, ces résultats suggèrent qu’Ahr1

170

régule START en réponse aux acides aminés disponibles dans le milieu de

culture.

Plusieurs traits de virulences sont altérés dans le mutant ahr1.

Premièrement, le mutant ahr1 a un phénotype de petite taille. Il semble

qu’il y ait une taille cellulaire optimale dans laquelle les processus

métaboliques et les échanges avec le milieu extérieur sont optimaux

(Miettinen et al. 2017). La petite taille du mutant pourrait être un

désavantage pour la survie dans l’hôte. Deuxièmement, les mutants

auxotrophes pour certains acides aminés ne sont pas virulents, ce qui

suggère que la levure utilise des acides aminés disponibles dans l’hôte

pendant l’infection (Kingsbury and McCusker 2010; Miramon and Lorenz

2017). Les défauts de croissance du mutant ahr1 sur certains acides

aminés pourraient expliquer l’atténuation de la virulence du mutant

(Askew et al. 2011). Troisièmement, la filamentation est un processus

important dans la virulence de C. albicans (Lo et al. 1997; Saville et al.

2003). Le mutant ahr1 a la capacité de former des hyphes mais la taille des

hyphes est significativement réduite. Enfin, Ahr1 a un rôle dans

l’activation des gènes codants pour des adhésines, qui ont un rôle critique

dans la formation des biofilms et l’attachement aux cellules de l’hôte

(Askew et al. 2011).

171

4.7 - Matériels et Méthodes

Conditions de culture

Les cellules ont été cultivées en milieu YPD (2% de peptones, 1% d’extrait

de levure, 2% de glucose et 50 µg/mL d’uridine) ou en milieu Synthetic

Complex (0.67% « yeast nitrogen base » avec du sulfate d’ammonium, 2%

de glucose et 0.079% de mix d’acides aminés).

L’effet des acides aminés sur la croissance et la taille a été testé sur un

milieu minimum (MM) contenant 2% de glucose, 0,17% de « yeast nitrogen

base » et 10 mM de l’acide aminé testé.

Courbes de croissance

Les cellules ont été mis en suspension à une DO600 de 0,1 puis 100 µL

ont été déposés dans une plaque 96 puits. La croissance a été mesurée par

un lecteur de plaque Sunrise™ (Tecan) à une DO600, à 30°C toutes les 10

minutes.

Interactions génétiques

L’ORF d’Ahr1 (orf19.7381) a été cloné dans le plasmide CIp-Act-cyc

(Tableau 2) (Blackwell et al. 2003). Le plasmide a été linéarisé par l’enzyme

de restriction StuI pour la transfection intégrative dans le mutant ahr1 et

les différents mutants de délétion de START pour étudier l’épistasie.

Microscopie

Ahr1 a été étiqueté dans sa région C-Terminale par la GFP (Gola et al.

2003). La visualisation de la localisation d’Ahr1-GFP a été réalisée par un

microscope confocal inversé Leica DMI6000B et une caméra CCD C9100

(Hamamatsu).

Les cellules ont été traitées à la rapamycine (100ng/mL) pendant 60

minutes et lavées une fois avec du tampon PBS. Le noyau a été marqué au

DAPI.

172

Détermination de la taille critique

La taille cellulaire à START a été déterminée en traçant le pourcentage de

cellule en bourgeonnement en fonction de la taille sur des cellules

synchronisées en phase G1 obtenues en utilisant un rotor d'élutriation JE-

5.0. Des cellules en phase G1 ont été libérées dans du milieu YPD et les

fractions ont été récoltées à intervalle de 10 minutes pour surveiller le

bourgeonnement. Les niveaux de transcription des gènes RNR1, PCL2 et

ACT1 ont été évalués par qPCR.

Puces à ADN

Des cultures sur la nuit des souches ahr1 et WT ont été diluées à une

DO600 de 0,1 dans 1 L de milieu YPD, cultivées à 30°C à une DO600 de

0,8 et séparées en fonction de la taille en utilisant le système d’élutriation

Beckman JE-5.0 à 16°C. Un total de 108 cellules en phase G1 ont été

récoltées, libérées dans un milieu YPD frais et cultivées pendant 10min

avant la récolte par centrifugation et stockées à -80 ° C. L'ARN total a été

extrait à l'aide d'un kit de purification RNAeasy (Qiagen). L’ARN total a été

élué, son intégrité a été évaluée sur un bioanalyseur Agilent 2100 avant le

marquage à l’ADNc, l’hybridation de puces à ADN et l’analyse comme

décrit précédemment (Sellam, Askew, et al. 2010).

Co-Immunoprécipitation

Les cultures de souches étiquetées par un épitope ont été cultivées à une

DO600 de 1,0 à 1,5 dans du YPD et ont été traitées ou non avec la

rapamycine (0,2 µg / ml) pendant 30 min. Les cellules ont été récoltées par

centrifugation et lysées par des billes de verre dans un tampon IP150 (Tris-

HCl 50 mM (pH 7,4), NaCl 150 mM, MgCl2 2 mM, Nonidet P-40 à 0,1%)

complété par des inhibiteurs de protéases Complète Mini (Roche Applied

Science) et 1 mM le fluorure de phénylméthylsulfonyle (PMSF).

173

1 mg de protéine totale provenant de lysats a été incubé avec des anticorps

monoclonal anti-HA ou des anticorps monoclonals anti-Myc et capturé sur

des billes de 40 μl de protéine A-Sepharose à 4°C pendant une nuit. Les

billes ont été lavées trois fois avec du tampon IP150, bouilli dans du

tampon SDS-PAGE, et séparé sur un gradient 4–20% de SDS-PAGE. Les

protéines ont été transférées sur une membrane de polyvinylidène

difluorure (PVDF) activée et détectées par anticorps anti-HA.

Tableau 1 – Oligonucléotides utilisées dans cette étude

Clonage Ahr1 dans

CIp-Act1-F

CGAAGCTTATGGCAAAGAAGAAACTAAATTCAAC

Clonage Ahr1 dans

CIp-Act1-R

CGACGCGTTTAATCACTTACTGGGTGAATGTAG

qRnr1F GACTATCTACCATGCTGCTGTTG

qRnR1R GGTGCAACCAACAAGGAGTT

qPcl2F CCACTGAAGAGAAACCAGCA

qPcl2R TGGCATTGGCAGGTAATAGA

qAct1F GAAGCCCAATCCAAAAGA

qAct1R CTTCTGGAGCAACTCTCAATTC

Ahr1-GFP-F GCTATATGGACCCAGAACTAAAATCACAATTTCATCATTGCTTTAC

CTGGACTGTACGCTACATTCACCCAGTAAGTGATGGTGCTGGCG

CAGGTGCTTC

Ahr1-GFP-R ACGTCAAAGCTAACGGTAGTAAAAATATATCTATATCTCAAAGCG

TGGAAATATATTCCCACTCGTCCAAAGTATATAGATCTGATATCA

TCGATGAATTCGAG

Tableau 2 – Souches utilisées dans cette étude

Souche Génotype Référence

DAY286 ura3::imm434/ura3::imm434 (Vandeputte et al.

174

iro1/iro1::imm434

his1::hisG/his1::hisG arg4/arg4

ARG4:URA3:arg4::hisG/arg4::hisG

his1::hisG

/his1::hisG

2012)

ahr1/ahr1 ura3::imm434/ura3::imm434

iro1/iro1::imm434 his1::hisG/his1::hisG

arg4/arg4 ahr1∆::URA3/ahr1∆::ARG4

(Vandeputte et al.

2012)

SN148 arg4/arg4 leu2/leu2 his1/his1

ura3::1 imm434/ura3::1 imm434

(Noble and

Johnson 2005)

JC230(AHR1-GFP) arg4/arg4 leu2/leu2 his1/his1

ura3::1 imm434/ura3::1 imm434

AHR1-GFP ::URA3

Cette étude

CAS4 (sch9/sch9) ura3::imm434/ura3::imm434

iro1/iro1::imm434

sch9::hisG/sch9::hisG

(Stichternoth et

al. 2011)

JC74 SN148 CIpAct1-AHR1-URA3 Cette étude

JC148

(sch9/CIpAct1-

AHR1)

ura3::imm434/ura3::imm434

iro1/iro1::imm434

sch9::hisG/sch9::hisG CIpAct1-

AHR1-URA3

Cette étude

175

Chapitre 5 - Discussion générale et perspectives

La régulation de la taille cellulaire est un processus très étudié chez les

levures (S. pombe, S. cerevisiae), les bactéries (E. coli, Salmonella, Bacillus),

les métazoaires (Mus musculus, Drosophila melanogaster, l’Homme) et les

archéobactéries (Jorgensen et al. 2002; Navarro and Nurse 2012;

Yamamoto et al. 2014; Lobner-Olesen et al. 1989; Chien, Hill, and Levin

2012; Logsdon et al. 2017). Cependant, les mécanismes régulant

l’homéostasie de la taille restent mal connus.

Plusieurs modèles permettant d’expliquer la régulation de la taille ont été

proposés, comme le modèle de senseur (« Sizer »), dans lequel la cellule doit

atteindre une taille seuil avant de se diviser. Chez les levures comme S.

cerevisiae et C. albicans, c’est le point de contrôle START qui permettrait à

la cellule de contrôler la taille sur le long terme. En effet, la cellule doit

atteindre une taille seuil, à START en fin de phase G1, avant d’engager la

phase S et le reste du cycle cellulaire.

Chez d’autres levures, comme S. pombe, la régulation de la taille semble se

faire en phase G2/M par un mécanisme d’incrémentation (« Adder »)

(Keifenheim et al. 2017). Chez les bactéries et les archéobactéries, il

semble également qu’une régulation par incrémentation permette de

réguler la taille (Taheri-Araghi et al. 2015). Cette stratégie consiste à

ajouter le même volume entre chaque division cellulaire. Certaines études

suggèrent que cette stratégie est également utilisée par S. cerevisiae. Cette

levure pourrait donc utiliser les mécanismes d’incrémentation et de START

afin d’assurer l’homéostasie de la taille sur le long terme (Soifer, Robert,

and Amir 2016).

La régulation de la taille n’a jamais été étudiée chez des levures

pathogènes, mais seulement chez des saprophytes comme S. cerevisiae et

S. pombe. Des études suggèrent que la régulation de la taille pourrait jouer

176

un rôle dans la virulence, le commensalisme, la dissémination et

l’échappement du système immunitaire chez les champignons pathogènes

(Wang and Lin 2012). Comprendre la régulation de la taille chez les levures

pathogènes pourrait permettre de trouver des stratégies pour lutter contre

ces levures. De plus, malgré la ressemblance physiologique et génotypique

entre S. cerevisiae et C. albicans, de nombreuses études montrent que des

gènes orthologues ont des rôles différents dans les deux espèces, ce qui

suggèrent que des processus comme la croissance, le cycle cellulaire et la

régulation de la taille peuvent être différents entre les deux espèces.

L’étude de la taille chez C. albicans pourrait donc apporter de nouvelles

informations sur le cycle cellulaire, la croissance eucaryote et de mettre en

évidence un lien entre la virulence fongique et la régulation de la taille

cellulaire.

Afin d’identifier des régulateurs de la taille cellulaire, nous avons effectué

deux criblages. Le premier criblage consistait à identifier des mutants de

délétions hétérozygotes avec un défaut de taille cellulaire (Chapitre 1).

L’utilisation de mutants hétérozygotes a permis de couvrir environ 90% du

génome de C. albicans et a l’avantage d’inclure les gènes essentiels. Ceci

est le premier criblage réalisé pour identifier des régulateurs de la taille

happloinsuffisants sur un génome complet.

Le second criblage consistait à identifier des mutants de délétions

homozygotes (Chapitre 2). Nous avons couvert environ 40% du génome de

C. albicans. Avec cette méthode, nous avons pu étudier seulement les

gènes non-essentiels et les mutants filamenteux ont été retirés de l’étude.

Les collections de mutants homozygotes utilisées sont enrichies en gènes

codants pour des facteurs de transcription et des kinases (Homann et al.

2009; Vandeputte et al. 2012; Blankenship et al. 2010; Noble et al. 2010;

Roemer et al. 2003). Des études supplémentaires sont nécessaires pour

177

mieux couvrir le génome de C. albicans et pour comparer les résultats avec

S. cerevisiae de façon plus exhaustive.

5.1 - Conservation des mécanismes du contrôle de la taille

cellulaire

De nombreux mutants de petites tailles identifiés dans nos criblages sont

défectueux en gènes reliés à la traduction (export des ribosomes, protéines

ribosomales, élongation de la traduction). Les régulateurs de la biogénèse

des ribosomes et de la traduction Sfp1 et Sch9, dont la mutation confère

une petite taille chez S. cerevisiae (Jorgensen et al. 2002), ont été retrouvé

dans nos criblages, ce qui indique que la fonction de ces gènes dans la

régulation de la taille est conservée et que ces deux régulateurs ont un rôle

critique dans la traduction (Fingerman et al. 2003; Cipollina et al. 2005;

Urban et al. 2007).

Sfp1 a été décrit comme l’analogue fonctionnel de c-Myc (Cook and Tyers

2007), un facteur de transcription trouvé chez les métazoaires. c-Myc est

un régulateur de la taille cellulaire et de la biogénèse des ribosomes (van

Riggelen, Yetil, and Felsher 2010).

Sch9 est l’analogue fonctionnel de la kinase S6K humaine (Urban et al.

2007). S6K est une cible de mTORC1 chez les métazoaires et contrôle

l’initiation de la traduction (Magnuson, Ekim, and Fingar 2012). S6K est

surexprimé dans certaines formes de cancers et est associés à une

résistance aux traitements anticancéreux (Ismail et al. 2013). Certains

processus fondamentaux de la traduction semblent donc être conservés

chez les eucaryotes, des ascomycètes aux mammifères.

De nombreux mutants de grandes tailles sont défectueux en gènes du

cycle cellulaire, comme Cln3, Cdc28, Swi4 et Swi6. Ces gènes ont aussi un

178

rôle dans la régulation de la taille chez S. cerevisiae (Jorgensen et al. 2002).

Nous avons également trouvé que Nrm1, qui a été proposé comme étant un

orthologue de Whi5/Nrm1 de S. cerevisiae (Ofir et al. 2012), a un

phénotype de petite taille. Nous avons montré que la petite taille du

mutant nrm1 est épistatique sur le complexe SBF (Swi4/Swi6), ce résultat

est cohérant avec les conclusions d’Ofir et al. : Nrm1 est l’homologue de

Whi5 et Nrm1 de S. cerevisiae et l’analogue fonctionnel de la protéine Rb

chez les mammifères (Ofir et al. 2012) (Figure 26).

Figure 26 – Interaction génétique entre Nrm1 et le complexe SBF. Distributions de la taille

des mutants swi4, nrm1, swi6, swi4/swi6 et swi4/swi6/nrm1.

Ces résultats montrent que l’axe Cln3/Cdc28-Whi5/Nrm1-SBF est

conservé entre C. albicans et S. cerevisiae. Cet axe de régulation est

l’analogue de l’axe Cycline D-Rb-E2F chez l’Homme (Schaefer and Breeden

2004). Même s’il y a une faible similarité de séquences entre ces protéines

de levures et humaines, le mécanisme de la transition G1/S semble

conservé chez les eucaryotes.

179

5.2 - La régulation de la taille cellulaire est un processus

évolutif plastique

Nos criblages montrent que certains processus, comme la biogénèse des

ribosomes et la transition G1/S sont conservés entre S. cerevisiae et C.

albicans, ainsi qu’entre les ascomycètes et l’Homme, même si la séquence

des protéines régulatrices n’est pas conservée. Cependant, la comparaison

de nos résultats avec un criblage effectué chez S. cerevisiae révèle une

faible conservation dans les gènes contrôlant la taille cellulaire (Jorgensen

et al. 2002), ce qui indique que la régulation de la taille est un phénomène

plastique au cours de l’évolution.

Comme chez S. cerevisiae, la régulation de la taille de C. albicans fait

intervenir de nombreux processus tels que la transcription, le cycle

cellulaire, la phosphorylation, la régulation du métabolisme etc. Ce qui

montre que la régulation de la taille est un phénomène complexe. De plus,

de nombreux régulateurs de la traduction ont été identifiés dans nos

criblages, que ça soit des régulateurs d’initiation de la traduction (Sui1,

Cdc33), d’élongation de la traduction (Yef3, Ria1), des régulateurs de la

biogénèse des ribosomes (Sfp1, Sch9, Dot6, Cbf1) ou des protéines

ribosomales (Rpl13A, Rpl24) indiquant que la traduction est un processus

essentiel pour la régulation de la taille cellulaire.

Nous nous attendions à trouver des différences entre les deux levures car

de nombreux cas de « rewiring » transcriptionnel ont été décrits chez ces

organismes. S. cerevisiae et C. albicans ne vivent pas dans les mêmes

niches et sont distantes de 300 millions d’années (Hedges et al. 2015). S.

cerevisiae est une levure saprophyte et C. albicans est une levure

opportuniste. Donc ces deux levures ne rencontrent pas les mêmes stress

et n’ont pas les mêmes nutriments disponibles dans leurs milieux. Malgré

leurs ressemblances génotypiques, les levures se sont adaptées à des

180

niches différentes. Ceci peut expliquer pourquoi ces deux levures ont

divergé et pourquoi la régulation de la croissance et de la division est

différente entre les deux espèces. De plus, S. cerevisiae a subi une

duplication du génome, ce qui favorise la néofonctionnalisation (Byrne and

Wolfe 2007). Parmi les nouveaux régulateurs de la taille cellulaire chez C.

albicans, nous avons identifié Hog1, Dot6 et Ahr1.

5.2.1 - Rôle de Hog1 dans le contrôle de la taille cellulaire

Nous avons identifié hog1 comme un mutant de petite taille. Hog1 est

connu pour répondre à différents stress chez les levures ainsi que chez les

métazoaires (Krantz, Becit, and Hohmann 2006; Saito and Posas 2012).

Ici, nous avons montré que Hog1 régule START en absence de stress. Une

phosphorylation basale de Hog1 est nécessaire pour la régulation de

START. Ce phénotype de taille n’a été observé ni chez le mutant hog1 de S.

cerevisiae ni chez le mutant sty1 de S pombe. Le rôle de Hog1 dans le

contrôle de la taille, en absence de stress, n’est donc pas partagé chez

toutes les levures. Hog1 est l’analogue de la p38 chez les métazoaires

(Sheikh-Hamad and Gustin 2004). Des études ont montré un rôle de la

p38 dans la régulation de la taille cellulaire chez la drosophile et l’Homme

(Cully et al. 2010; Liu et al. 2018). La p38 a un rôle dans la régulation du

cycle cellulaire, la croissance et la différenciation (Lavoie et al. 1996;

Mikule et al. 2007; Yee et al. 2004). La dérégulation de l’activité des

protéines p38 est associée à des cancers agressifs avec un faible

pronostique de guérison (Koul, Pal, and Koul 2013).

Nous avons montré que Hog1 régule à la fois la croissance via le facteur de

transcription Sfp1 et le cycle cellulaire via le complexe SBF (Swi4/Swi6).

Nos résultats montrent que Hog1 régule le recrutement de Sfp1 sur les

promoteurs des gènes de la biogénèse des ribosomes et des gènes des

protéines ribosomales afin d’activer la transcription. Hog1 se fixe

181

également sur les promoteurs des gènes de la biogénèse des ribosomes,

suggérant que cette kinase régule directement la transcription de ces

gènes. De plus, nous avons montré que toute la voie HOG (Pbs2, Ssk1,

Ssk2, Ypd1 et Sln1) a un rôle dans la régulation de la taille, ainsi que les

phosphatases Ptc1 et Ptc2, qui permettent la désactivation de Hog1 par

déphosphorylation suite à un stress.

Le signal détecté par la voie HOG qui permet de contrôler la taille cellulaire

n’est pas connue. Hog1 et Sln1 (une histidine phosphotransérase

régulatrice de la voie HOG) sont nécessaires pour la biogénèse de la paroi

cellulaire (Blankenship et al. 2010; Ene et al. 2015). Nous avons identifié

le mutant gsc1 comme un mutant de petite taille. Gsc1 est nécessaire pour

la synthèse β-1,3-glucane et pour la biogénèse de la paroi cellulaire (Mio et

al. 1997). Récemment, Mancuso et al. ont découvert que Dfg5 et Dcw1, des

protéines de la paroi cellulaire, régulent le niveau basal de

phosphorylation de Hog1 en absence de stress (Mancuso et al. 2018). Ces

observations suggèrent un lien entre la synthèse de la paroi et la taille

cellulaire comme déjà observé chez les bactéries (Tropini et al. 2014;

Chien, Hill, and Levin 2012). Pour explorer le lien entre la paroi et la taille

cellulaire, il faudrait tester si les mutants dfg5 et dcw1 ont un phénotype

de taille. Une carte génétique pourrait être réalisée entre la voie HOG et les

gènes de la biogénèse de la paroi (CHS1, MNN1, GSC1). De plus, le lien

entre la paroi et la taille cellulaire pourrait être étudié en utilisant PalmC,

une molécule capable de modifier la tension membranaire (Riggi et al.

2018). La phosphorylation basale de Hog1 pourrait être étudiée dans les

mutants des gènes de la biogénèse des ribosomes et en réponse à PalmC.

La molécule PalmC pourrait être testée sur des mutants de la paroi et des

mutants de la voie HOG afin d’étudier l’impact sur START.

Les cibles de Hog1 ne sont pas connues. Pour les identifier, une approche

protéomique, comme la méthode SILAC (Stable Isotope Labelling by Amino

182

Acids in Cell culture), pourrait être utilisée. Cette technique a déjà été

utilisée chez S. cerevisiae pour l’étude de Hog1 (Romanov et al. 2017). Une

analyse comparative pourrait mettre en évidence les différences de cibles

entre S. cerevisiae et C. albicans et pourrait révéler pourquoi Hog1 est un

régulateur de START chez C albicans mais pas chez S. cerevisiae. Il est

intéressant de constater que Romanov et al. ont identifié Tod6, le

paralogue de Dot6, comme substrat de Hog1 (Romanov et al. 2017).

Nous avons mis en évidence des interactions génétiques et physiques entre

Hog1 et Sfp1, ainsi qu’entre Hog1 et Swi4. Des études mécanistiques

seraient nécessaires pour savoir si Hog1 phosphoryle Sfp1 et le complexe

SBF. Si oui, il serait intéressant d’identifier les acides aminés

phosphorylés et le rôle de ces phosphorylations sur START. Des analyses

de ChIP pourraient également être effectuées sur Swi4 et Swi6 dans une

souche sauvage et un mutant hog1 afin de tester si Hog1 a un rôle dans la

localisation ou le recrutement du complexe MBF sur les promoteurs.

La voie HOG étant peu conservée entre C. albicans et l’Homme, elle est

considérée comme une cible thérapeutique potentielle pour lutter contre

les infections à levures (McCarthy et al. 2017; Perfect 2017). L’antifongique

fludioxonil a été identifié comme un modulateur de la voie HOG chez

certains champignons (Knauth and Reichenbach 2000; Shubitz et al.

2006; Kojima, Bahn, and Heitman 2006). De plus, nous avons montré que

Hog1 régule la taille cellulaire, comme la p38 chez l’Homme (Liu et al.

2018). C. albicans pourrait être utilisé comme organisme modèle pour

étudier le rôle de la voie HOG dans le contrôle de la taille cellulaire et pour

étudier les mécanismes d’action d’antifongiques ciblant la voie HOG.

5.2.2 - Rôle de Dot6 dans le contrôle de la taille cellulaire

183

Nous avons identifié Dot6 comme un régulateur de la taille. Les

orthologues Dot6 et Tod6 de S. cerevisiae n’ont pas de rôle dans la

régulation de la taille (Huber et al. 2011). Nous avons montré que Dot6 est

un régulateur négatif de START. Le profil transcriptionel du mutant dot6

montre que Dot6 est un régulateur positif de la biogénèse des ribosomes,

alors que c’est un répresseur chez S. cerevisiae (Huber et al. 2011). Ceci

permet d’expliquer le phénotype de petite taille car le mutant n’est pas

capable de produire des ribosomes et provoque une accélération de START,

comme déjà observé pour les mutants sfp1 et sch9 (Jorgensen et al. 2004;

Cipollina et al. 2005). Pour comprendre les modifications qui ont fait que

Dot6 est un répresseur chez S. cerevisiae et un activateur chez C. albicans,

une étude sur les ascomycètes pourraient être réalisée. Nous avons trouvé

une séquence riche en acide aspartique dans les orthologues de Dot6 du

clade CTG (C. parapsilosis, C. dubliensis), mais absente chez S. cerevisiae

et C. glabrata. La délétion de cette séquence ne provoque pas de phénotype

de taille chez C. albicans. Il n’est pas connu si Dot6 est un répresseur ou

un activateur chez d’autres espèces comme C. glabrata, C. tropicalis, C

parapsilosis ou C. dubliensis. Créé des mutants de délétion dot6 et analysé

la taille ainsi qu’étudier le rôle de Dot6 dans le contrôle la biogénèse des

ribosomes chez ces espèces donneraient des indications sur la transition

entre activateur et répresseur. Cela permettra de voir si le changement de

fonction coïncide avec la duplication du génome subit par les espèces du

clade WGD.

Chez S. cerevisiae, quand la voie TOR est inhibée, Dot6 réprime la

transcription des gènes RiBi en recrutant le complexe RPDL3, qui est une

histone désacétylase (Huber et al. 2011; Shevchenko et al. 2008). Chez C.

albicans, il n’est pas connu par quel mécanisme Dot6 active la

transcription des gènes RiBi. Il serait intéressant d’identifier les protéines

qui interagissent avec Dot6 par chromatographie d’affinité suivie d’analyse

par spectrométrie de masse.

184

Chez S. cerevisiae, Dot6 est phosphorylé par Sch9 (Huber et al. 2011).

Nous avons recherché des interactions génétiques entre Dot6 et Sch9 et

nos résultats suggèrent que les protéines sont dans des voies parallèles.

De plus, nous n’avons pas trouvé d’interaction physique entre Dot6 et

Sch9 par co-immunoprécipitation (non publié). En revanche, nous avons

mis en évidence une interaction génétique entre Tor1 et Dot6, ce qui

suggère que Dot6 est toujours dans la voie TOR comme chez S. cerevisiae.

Des tests de phosphorylation de Tor1 sur Dot6 pourraient être réalisés afin

de confirmer ou non que Dot6 est un substrat de Tor1.

Chez S. cerevisiae, les promoteurs des gènes de la biogénèse des ribosomes

sont enrichis en séquences PAC et RRPE (Hughes et al. 2000; Jorgensen

and Tyers 2004; Wade, Umbarger, and McAlear 2006) et Dot6 régule les

gènes de la biogénèse des ribosomes en se fixant sur la séquence PAC

(Huber et al. 2011). Dans les gènes de la biogénèse des ribosomes réprimés

dans le mutant dot6, la séquence PAC est présente dans les promoteurs de

ces gènes, ce qui suggère que Dot6 active ces gènes via la séquence PAC. Il

est nécessaire de confirmer que Dot6 se fixe aux promoteurs via la

séquence PAC en réalisant une expérience de retard sur gel ou en utilisant

un gène rapporteur fusionné à un promoteur contenant la séquence PAC.

Chez les mammifères et chez les champignons, des perturbations des

mitochondries provoquent des défauts de la taille cellulaire (Miettinen and

Bjorklund 2016). Comme Dot6 est un régulateur de la biogenèse des

ribosomes et que nous avons mis en évidence que des gènes de la

traduction mitochondriale sont surexprimés dans le mutant dot6, nous

avons testé si la traduction mitochondriale est perturbée chez le mutant de

dot6. Nous avons testé la doxycyline, un antibiotique de la famille des

tétracyclines qui inhibe la traduction bactérienne et la traduction

mitochondriale eucaryote (Moullan et al. 2015). La souche sauvage

diminue sa taille en réponse à la doxycycline, suggérant que l'inhibition de

185

la traduction mitochondriale réduit la taille des cellules (Figure 27). La

taille du mutant dot6 ne diminue pas en présence de doxycycline, ce qui

suggère que Dot6 régule également la traduction mitochondriale. Ce

résultat préliminaire suggère que la traduction mitochondriale est

nécessaire pour la régulation de la taille cellulaire et que Dot6 est un

régulateur de la traduction mitochondriale.

Figure 27 – Effet de la doxycycline sur la taille cellulaire. ** p-value < 0,01. Trois

réplicats ont été réalisés.

5.2.3 - Rôle de Ahr1 dans le contrôle de la taille cellulaire

Nous avons identifié Ahr1, un facteur de transcription spécifique du clade

CTG, comme régulateur négatif de START. Nous avons montré des

interactions génétique et physique entre la kinase Sch9 et Ahr1. Il est

nécessaire de tester si Sch9 phosphoryle Ahr1. De plus, nos résultats

suggèrent que la voie TOR-Sch9 contrôle la fonction d’Ahr1 en régulant sa

localisation cellulaire. Des mutants non-phosphorylables d’Ahr1

186

pourraient être créés pour observer la localisation cellulaire d’Ahr1 pour

tester si la localisation d’Ahr1 est régulée par phosphorylation.

Le profil transcriptionnel du mutant ahr1 montre que des gènes

nécessaires à l’élongation de la traduction sont réprimés. De plus, il a été

montré précédemment qu’Ahr1 se fixe sur les promoteurs de Cam1 et Tef4,

des facteurs d’élongation de la traduction (Askew et al. 2011). Enfin, Ahr1

se fixe à des promoteurs de gènes nécessaires au transport des acides

aminés (Askew et al. 2011). Ces observations suggèrent que le mutant

ahr1 a des défauts de synthèse des protéines. Une expérience de polysome

profiling (Chasse et al. 2017), une technique permettant d’étudier le niveau

global de traduction en analysant l’association entre les ARN messagers et

les ribosomes, pourrait être réalisée pour tester s’il y a un défaut de

traduction dans le mutant ahr1. La traduction étant un processus

important pour la régulation de START (Cook and Tyers 2007), cette

expérience permettrait de comprendre pourquoi le mutant ahr1 a un

phénotype de petite taille et a un défaut de START.

5.3 - Lien entre nutriments et taille cellulaire

Nous avons montré que Dot6 et Ahr1 sont nécessaires pour l’adaptation de

la taille cellulaire suivant les nutriments disponibles. Le mutant dot6 a des

défauts de croissance et d’adaptation de la taille quand il est cultivé sur

glycérol, le mutant ahr1 a des défauts de croissance quand il est cultivé

sur certains acides aminés. Pour mieux comprendre le lien entre taille

cellulaire et la perception des nutriments, les mêmes criblages que l’on a

réalisés pourraient être refaits en faisant varier les sources de carbones et

les sources d’azotes. Ces criblages permettraient d’identifier de nouveaux

régulateurs nécessaires pour l’adaptation de la taille suivant les

nutriments disponibles

187

Nous avons montré que Dot6 et Ahr1 sont dans la voie TOR, qui est un

régulateur de la croissance en réponse aux nutriments disponibles dans le

milieu extracellulaire (Loewith and Hall 2011). La voie Ras-PKA est

également une voie importante pour la croissance et la signalisation en

réponse aux sources de carbones (Dechant and Peter 2008). Chez S.

cerevisiae, Dot6 et Tod6 sont nécessaires pour faire le lien entre la

croissance cellulaire et les nutriments disponibles (Lippman and Broach

2009). Des interactions physiques ont été mise en évidence entre Dot6 et

Tpk1 chez S. cerevisiae (Deminoff et al. 2006), une sous unité de PKA. Ceci

suggère un lien entre Dot6 et la voie Ras-PKA chez C albicans. Il serait

intéressant de tester si Dot6 et Tpk1 interagissent génétiquement et

physiquement chez C. albicans.

5.4 - Lien entre virulence et taille cellulaire

Dans nos criblages, nous avons identifié des mutants qui ont un défaut de

taille et un défaut de virulence (sch9, ahr1, hog1, ptc1, nrm1…). Il n’est pas

connu si la taille cellulaire de C. albicans est un facteur de virulence. Nous

avons vu en introduction que la variabilité de la taille chez les levures

permet l’invasion de l’hôte (pour les cellules de petites tailles) et

l’échappement au système immunitaire (pour les cellules de grandes

tailles). Concernant C. albicans, il a été montré que les neutrophiles

peuvent discriminer les pathogènes suivant leurs tailles (Branzk et al.

2014). Il a également été montré que les cellules épithéliales buccales

discriminent la forme levure et la forme hyphe de C. albicans (Moyes et al.

2010).

Quel pourrait être le lien entre la taille cellulaire et la virulence chez C.

albicans ? Il a été montré qu’il existe une taille optimale chez les cellules

de mammifères (Miettinen and Bjorklund 2016; Miettinen et al. 2017). Les

cellules de petites tailles sont plus sensibles à l’apoptose et les capacités

188

de biosynthèses sont limitées. Pour les cellules de grandes tailles, le

rapport surface/volume est diminué, ce qui limite les échanges avec le

milieu extérieur et les distances intracellulaires sont plus grandes, ce qui

limite les transports moléculaires (Harris and Theriot 2018). Une mauvaise

régulation de la taille serait défavorable pour le métabolisme et donc pour

la survie de la levure.

Des études ont montré que le niveau de ploïdie de C. albicans (diploïde ou

tétraploïde) affecte la virulence (Ibrahim et al. 2005). Or, pour former des

cellules tétraploïdes, les cellules doivent fusionner. Il a été montré, chez S.

cerevisiae, que les cellules happloïdes de petites tailles sont désavantagées

pour former des cellules (Smith, Pomiankowski, and Greig 2014). Ces

études suggèrent que la régulation de la taille a un impact sur le niveau de

ploïdie de C. albicans pendant l’infection et donc sur la virulence.

Nous avons étudié deux régulateurs de la taille qui sont nécessaires pour

la virulence : Ahr1 et Hog1 (Alonso-Monge et al. 1999; Askew et al. 2011;

Cheetham et al. 2011).

Hog1 est nécessaire pour la réponse à différents stress (Smith et al. 2004;

Cheetham et al. 2007; San Jose et al. 1996; Kayingo and Wong 2005;

Arana et al. 2005). La réponse à ces stress est indispensable pour la

virulence (Walker et al. 2009; Thewes et al. 2007). De plus, le mutant hog1

est légèrement hyperfilamenteux, ce qui est également un désavantage

pour la virulence (Enjalbert et al. 2006). Ces observations expliquent

pourquoi le mutant hog1 est non-virulent dans des modèles de souris.

Le mutant ahr1 a un phénotype de petite taille. De plus, il a des défauts

d’adhésion et de formation de biofilms, ce qui peut expliquer l’atténuation

de sa virulence car la levure n’est pas capable d’adhérer aux cellules de

l’hôte. De plus, nous avons montré que cette souche n’a pas la capacité

189

d’adapter sa taille quand elle est cultivée sur certains acides aminés. Ceci

est un désavantage pour la levure car elle ne peut pas optimiser sa taille

suivant l’environnement. Nous avons également montré que la taille des

hyphes du mutant ahr1 est petite. Les hyphes jouent un rôle dans

l’échappement au système immunitaire. Les levures phagocytées

produisent des hyphes ce qui mène à l’éclatement du phagocyte (Brand

2012). Ici, la petite taille des hyphes pourraient être un désavantage pour

échapper aux phagocytes ou pour envahir les tissus de l’hôte.

Il n’est pas encore connu si Dot6 est un gène nécessaire pour la virulence

dans des modèles de souris. La virulence a seulement été testée dans un

modèle d’insecte, Galleria Mellonella (Amorim-Vaz et al. 2015). On peut

émettre l’hypothèse que Dot6 est nécessaire pour le pouvoir pathogène de

C. albicans car des traits de virulence sont altérés chez le mutant dot6. En

effet, le mutant a un défaut de taille cellulaire, ce qui est défavorable pour

la survie de la cellule dans un environnement changeant, comme pendant

l’infection de l’hôte. Il forme également des hyphes de petites tailles et a

des défauts de croissance et d’adaptation de la taille suivant les sources de

carbone disponibles, ce qui est un désavantage pour la survie de la levure.

De plus, pendant l’infection de l’hôte par C. albicans des gènes permettant

l’utilisation d’un sucre alternatif sont surexprimés (Walker et al. 2009), ce

qui montre que l’adaptabilité métabolique est indispensable pour la

virulence. Pour confirmer que Dot6 est nécessaire pour la virulence, le

mutant dot6 pourrait être injecté dans des souris et observer la mortalité

des souris.

5.5 - C. albicans – Organisme modèle

Nous avons montré un rôle de Hog1 dans le contrôle de la taille cellulaire.

Les homologues de Hog1 ont également un rôle dans la régulation de la

taille chez l’Homme et la drosophile (Cully et al. 2010; Liu et al. 2018). C.

190

albicans pourrait donc être un bon modèle d’étude pour comprendre le rôle

de Hog1/p38 dans la régulation de la taille.

La voie Hog/p38, ne contrôle pas seulement la taille cellulaire, mais

contrôle aussi la réponse aux stress. C. albicans pourrait être utilisée pour

comprendre comment une même voie de régulation régule différents

processus.

Nous avons trouvé d’autres gènes qui ont des homologues chez l’Homme,

comme CKB1 et CKB2 (codants pour des kinases ayant un rôle dans la

croissance). Nous avons également trouvé plusieurs gènes régulant la

transcription conservés entre C. albicans et l’Homme : MBF1, STO1, HAP1,

POP2 et CCR4. Enfin, nous avons trouvé des gènes ayant un rôle dans le

métabolisme mitochondrial conservés chez l’Homme : SUV3, SOD2, TIM23.

Il n’est pas encore connu si ces gènes ont un rôle dans la régulation de la

taille chez l’Homme. Ces gènes pourraient être ciblés chez l’Homme afin de

voir si ce sont des régulateurs de la taille chez les deux espèces.

191

Conclusion

Afin d’étudier la régulation de la taille chez les champignons pathogènes,

nous avons identifié des régulateurs de la taille cellulaire chez C. albicans.

Nous avons identifié 66 mutants homozygotes ayant un défaut de taille sur

279 mutants testés. Nous avons également identifié 685 mutants

hétérozygotes ayant un défaut de taille sur 5 470 mutants testés. Nous

avons comparé nos résultats avec ceux obtenus chez S. cerevisiae et nous

avons mis en évidence que peu de gènes sont conservés et que la

régulation de la taille est un processus plastique.

Parmi les régulateurs de la taille identifiés dans nos criblages, nous avons

cherché à identifier les régulateurs de START, un point de control en fin de

phase G1 permettant l’homéostasie de la taille. Nous avons retrouvé des

régulateurs de START déjà identifié chez S. cerevisiae, comme Sfp1, Sch9,

Swi4, Swi6 et Cln3. Nous avons également identifié des nouveaux

régulateurs de START, comme Hog1, Ahr1 et Dot6.

Hog1 est connu pour réguler la réponse à différents stress. Ici, nous avons

montré que Hog1 régule la taille cellulaire en contrôlant la croissance et la

division cellulaire. Ce rôle n’a jamais été mis en évidence chez S. cerevisiae

mais semble être conservé chez les eucaryotes supérieurs. C. albicans

pourrait donc être un bon modèle d’étude de la voie HOG.

Nous avons identifié Dot6 comme un régulateur de START. Dot6 est un

activateur des gènes de la biogénèse des ribosomes. Chez S. cerevisiae,

l’homologue Dot6 est un inhibiteur des gènes de la biogénèse des

ribosomes. Nous avons donc mis en évidence deux gènes homologues dans

deux espèces mais qui ont un rôle différent dans la régulation de la

transcription.

192

Enfin, nous avons identifié Ahr1, un facteur de transcription, comme un

régulateur négatif de START. Ahr1 est un gène spécifique du clade CTG et

est nécessaire pour l’utilisation des acides aminés disponibles dans le

milieu.

Parmi les nouveaux régulateurs de la taille, nous avons également identifié

des régulateurs de la réplication de l’ADN (ORC3, ORC4, MCM3, CDC54,

RFC3, PIF1, SMC4, ELG1), des régulateurs de la transition G2/M (HSL1,

CDC34), de la traduction (ASC1, SCD6, PAB1, RIA1, EFT2, CEF3) et de la

transcription des ARN Pol I et III (CDC73, RPB8, RPA49, RPB10, SPT5,

RPA12, RPC25). Certains de ces gènes sont conservés chez l’Homme.

Nos résultats ont montré que C. albicans est un organisme modèle

pertinent pour l’étude de la taille cellulaire et ont fournis de nombreuses

perspectives d’études.

193

Bibliographie

Abad, C. L., and N. Safdar. 2009. 'The role of lactobacillus probiotics in the treatment or prevention of urogenital infections--a systematic review', J Chemother, 21: 243-52.

Akram, Z., A. A. Al-Kheraif, S. V. Kellesarian, F. Vohra, and F. Javed. 2018. 'Comparison of oral Candida carriage in waterpipe smokers,

cigarette smokers, and non-smokers', J Oral Sci, 60: 115-20. Almeida, A. J., C. Cunha, J. A. Carmona, B. Sampaio-Marques, A.

Carvalho, I. Malavazi, H. Y. Steensma, D. I. Johnson, C. Leao, E.

Logarinho, G. H. Goldman, A. G. Castro, P. Ludovico, and F. Rodrigues. 2009. 'Cdc42p controls yeast-cell shape and virulence of

Paracoccidioides brasiliensis', Fungal Genet Biol, 46: 919-26. Alonso-Monge, R., F. Navarro-Garcia, G. Molero, R. Diez-Orejas, M.

Gustin, J. Pla, M. Sanchez, and C. Nombela. 1999. 'Role of the

mitogen-activated protein kinase Hog1p in morphogenesis and virulence of Candida albicans', J Bacteriol, 181: 3058-68.

Alonso, M. F., N. A. R. Gow, L. P. Erwig, and J. M. Bain. 2017. 'Macrophage Migration Is Impaired within Candida albicans Biofilms', J Fungi (Basel), 3.

Amodeo, A. A., and J. M. Skotheim. 2016. 'Cell-Size Control', Cold Spring Harb Perspect Biol, 8: a019083.

Amorim-Vaz, S., E. Delarze, F. Ischer, D. Sanglard, and A. T. Coste. 2015. 'Examining the virulence of Candida albicans transcription factor

mutants using Galleria mellonella and mouse infection models', Front Microbiol, 6: 367.

Arana, D. M., C. Nombela, R. Alonso-Monge, and J. Pla. 2005. 'The Pbs2 MAP kinase kinase is essential for the oxidative-stress response in the fungal pathogen Candida albicans', Microbiology, 151: 1033-49.

Askew, C., A. Sellam, E. Epp, H. Hogues, A. Mullick, A. Nantel, and M. Whiteway. 2009. 'Transcriptional regulation of carbohydrate

metabolism in the human pathogen Candida albicans', PLoS Pathog, 5: e1000612.

Askew, C., A. Sellam, E. Epp, J. Mallick, H. Hogues, A. Mullick, A. Nantel,

and M. Whiteway. 2011. 'The zinc cluster transcription factor Ahr1p directs Mcm1p regulation of Candida albicans adhesion', Mol Microbiol, 79: 940-53.

Averous, J., and C. G. Proud. 2006. 'When translation meets

transformation: the mTOR story', Oncogene, 25: 6423-35. Barnett, J. A. 2004. 'A history of research on yeasts 8: taxonomy', Yeast,

21: 1141-93. Basco, R. D., M. D. Segal, and S. I. Reed. 1995. 'Negative regulation of G1

and G2 by S-phase cyclins of Saccharomyces cerevisiae', Mol Cell Biol, 15: 5030-42.

194

Bassetti, M., E. Righi, P. Montravers, and O. A. Cornely. 2018. 'What has changed in the treatment of invasive candidiasis? A look at the past

10 years and ahead', J Antimicrob Chemother, 73: i14-i25. Bastidas, R. J., J. Heitman, and M. E. Cardenas. 2009. 'The protein kinase

Tor1 regulates adhesin gene expression in Candida albicans', PLoS Pathog, 5: e1000294.

Bennett, R. J., and A. D. Johnson. 2005. 'Mating in Candida albicans and

the search for a sexual cycle', Annu Rev Microbiol, 59: 233-55. Bensen, E. S., A. Clemente-Blanco, K. R. Finley, J. Correa-Bordes, and J.

Berman. 2005. 'The mitotic cyclins Clb2p and Clb4p affect morphogenesis in Candida albicans', Mol Biol Cell, 16: 3387-400.

Berman, J. 2006. 'Morphogenesis and cell cycle progression in Candida albicans', Curr Opin Microbiol, 9: 595-601.

Berman, J., and P. E. Sudbery. 2002. 'Candida Albicans: a molecular

revolution built on lessons from budding yeast', Nat Rev Genet, 3: 918-30.

Bille, J., O. Marchetti, and T. Calandra. 2005. 'Changing face of health-care associated fungal infections', Curr Opin Infect Dis, 18: 314-9.

Blackwell, C., C. L. Russell, S. Argimon, A. J. Brown, and J. D. Brown. 2003. 'Protein A-tagging for purification of native macromolecular complexes from Candida albicans', Yeast, 20: 1235-41.

Blagosklonny, M. V., and A. B. Pardee. 2002. 'The restriction point of the cell cycle', Cell Cycle, 1: 103-10.

Blankenship, J. R., S. Fanning, J. J. Hamaker, and A. P. Mitchell. 2010. 'An extensive circuitry for cell wall regulation in Candida albicans', PLoS Pathog, 6: e1000752.

Blumberg, H., and P. Silver. 1991. 'A split zinc-finger protein is required for normal yeast growth', Gene, 107: 101-10.

Brand, A. 2012. 'Hyphal growth in human fungal pathogens and its role in virulence', Int J Microbiol, 2012: 517529.

Branzk, N., A. Lubojemska, S. E. Hardison, Q. Wang, M. G. Gutierrez, G. D. Brown, and V. Papayannopoulos. 2014. 'Neutrophils sense microbe size and selectively release neutrophil extracellular traps in

response to large pathogens', Nat Immunol, 15: 1017-25. Braunsdorf, C., and S. LeibundGut-Landmann. 2018. 'Modulation of the

Fungal-Host Interaction by the Intra-Species Diversity of C. albicans', Pathogens, 7.

Brown, V., J. Sabina, and M. Johnston. 2009. 'Specialized sugar sensing in diverse fungi', Curr Biol, 19: 436-41.

Butler, G., M. D. Rasmussen, M. F. Lin, M. A. Santos, S. Sakthikumar, C.

A. Munro, E. Rheinbay, M. Grabherr, A. Forche, J. L. Reedy, I. Agrafioti, M. B. Arnaud, S. Bates, A. J. Brown, S. Brunke, M. C.

Costanzo, D. A. Fitzpatrick, P. W. de Groot, D. Harris, L. L. Hoyer, B. Hube, F. M. Klis, C. Kodira, N. Lennard, M. E. Logue, R. Martin, A. M. Neiman, E. Nikolaou, M. A. Quail, J. Quinn, M. C. Santos, F. F.

Schmitzberger, G. Sherlock, P. Shah, K. A. Silverstein, M. S.

195

Skrzypek, D. Soll, R. Staggs, I. Stansfield, M. P. Stumpf, P. E. Sudbery, T. Srikantha, Q. Zeng, J. Berman, M. Berriman, J.

Heitman, N. A. Gow, M. C. Lorenz, B. W. Birren, M. Kellis, and C. A. Cuomo. 2009. 'Evolution of pathogenicity and sexual reproduction in eight Candida genomes', Nature, 459: 657-62.

Byrne, K. P., and K. H. Wolfe. 2007. 'Consistent patterns of rate asymmetry and gene loss indicate widespread neofunctionalization

of yeast genes after whole-genome duplication', Genetics, 175: 1341-50.

Chandler-Brown, D., K. M. Schmoller, Y. Winetraub, and J. M. Skotheim.

2017. 'The Adder Phenomenon Emerges from Independent Control of Pre- and Post-Start Phases of the Budding Yeast Cell Cycle', Curr Biol, 27: 2774-83 e3.

Chapa y Lazo, B., S. Bates, and P. Sudbery. 2005. 'The G1 cyclin Cln3

regulates morphogenesis in Candida albicans', Eukaryot Cell, 4: 90-4.

Charvin, G., C. Oikonomou, E. D. Siggia, and F. R. Cross. 2010. 'Origin of

irreversibility of cell cycle start in budding yeast', PLoS Biol, 8: e1000284.

Chasse, H., S. Boulben, V. Costache, P. Cormier, and J. Morales. 2017. 'Analysis of translation using polysome profiling', Nucleic Acids Res,

45: e15. Cheetham, J., D. M. MacCallum, K. S. Doris, A. da Silva Dantas, S.

Scorfield, F. Odds, D. A. Smith, and J. Quinn. 2011. 'MAPKKK-

independent regulation of the Hog1 stress-activated protein kinase in Candida albicans', J Biol Chem, 286: 42002-16.

Cheetham, J., D. A. Smith, A. da Silva Dantas, K. S. Doris, M. J. Patterson, C. R. Bruce, and J. Quinn. 2007. 'A single MAPKKK regulates the Hog1 MAPK pathway in the pathogenic fungus

Candida albicans', Mol Biol Cell, 18: 4603-14. Chien, A. C., N. S. Hill, and P. A. Levin. 2012. 'Cell size control in bacteria',

Curr Biol, 22: R340-9. Cho, R. J., M. J. Campbell, E. A. Winzeler, L. Steinmetz, A. Conway, L.

Wodicka, T. G. Wolfsberg, A. E. Gabrielian, D. Landsman, D. J.

Lockhart, and R. W. Davis. 1998. 'A genome-wide transcriptional analysis of the mitotic cell cycle', Mol Cell, 2: 65-73.

Chowdhury, T., and J. R. Kohler. 2015. 'Ribosomal protein S6 phosphorylation is controlled by TOR and modulated by PKA in Candida albicans', Mol Microbiol, 98: 384-402.

Chung, J., C. J. Kuo, G. R. Crabtree, and J. Blenis. 1992. 'Rapamycin-FKBP specifically blocks growth-dependent activation of and

signaling by the 70 kd S6 protein kinases', Cell, 69: 1227-36. Cipollina, C., L. Alberghina, D. Porro, and M. Vai. 2005. 'SFP1 is involved

in cell size modulation in respiro-fermentative growth conditions', Yeast, 22: 385-99.

196

Claypool, J. A., S. L. French, K. Johzuka, K. Eliason, L. Vu, J. A. Dodd, A. L. Beyer, and M. Nomura. 2004. 'Tor pathway regulates Rrn3p-

dependent recruitment of yeast RNA polymerase I to the promoter but does not participate in alteration of the number of active genes', Mol Biol Cell, 15: 946-56.

Conlon, I. J., G. A. Dunn, A. W. Mudge, and M. C. Raff. 2001. 'Extracellular control of cell size', Nat Cell Biol, 3: 918-21.

Conlon, I., and M. Raff. 1999. 'Size control in animal development', Cell, 96: 235-44.

———. 2003. 'Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression', J Biol, 2: 7.

Cook, M., and M. Tyers. 2007. 'Size control goes global', Curr Opin Biotechnol, 18: 341-50.

Costanzo, M., J. L. Nishikawa, X. Tang, J. S. Millman, O. Schub, K.

Breitkreuz, D. Dewar, I. Rupes, B. Andrews, and M. Tyers. 2004. 'CDK activity antagonizes Whi5, an inhibitor of G1/S transcription

in yeast', Cell, 117: 899-913. Cote, P., H. Hogues, and M. Whiteway. 2009. 'Transcriptional analysis of

the Candida albicans cell cycle', Mol Biol Cell, 20: 3363-73.

Coudreuse, D., and P. Nurse. 2010. 'Driving the cell cycle with a minimal CDK control network', Nature, 468: 1074-9.

Cully, M., A. Genevet, P. Warne, C. Treins, T. Liu, J. Bastien, B. Baum, N. Tapon, S. J. Leevers, and J. Downward. 2010. 'A role for p38 stress-

activated protein kinase in regulation of cell growth via TORC1', Mol Cell Biol, 30: 481-95.

Dalal, C. K., I. A. Zuleta, K. F. Mitchell, D. R. Andes, H. El-Samad, and A.

D. Johnson. 2016. 'Transcriptional rewiring over evolutionary timescales changes quantitative and qualitative properties of gene

expression', Elife, 5. de Bruin, R. A., T. I. Kalashnikova, C. Chahwan, W. H. McDonald, J.

Wohlschlegel, J. Yates, 3rd, P. Russell, and C. Wittenberg. 2006.

'Constraining G1-specific transcription to late G1 phase: the MBF-associated corepressor Nrm1 acts via negative feedback', Mol Cell, 23: 483-96.

de Bruin, R. A., W. H. McDonald, T. I. Kalashnikova, J. Yates, 3rd, and C.

Wittenberg. 2004. 'Cln3 activates G1-specific transcription via phosphorylation of the SBF bound repressor Whi5', Cell, 117: 887-98.

De Virgilio, C., and R. Loewith. 2006. 'The TOR signalling network from yeast to man', Int J Biochem Cell Biol, 38: 1476-81.

Dechant, R., and M. Peter. 2008. 'Nutrient signals driving cell growth', Curr Opin Cell Biol, 20: 678-87.

Deforet, M., D. van Ditmarsch, and J. B. Xavier. 2015. 'Cell-Size Homeostasis and the Incremental Rule in a Bacterial Pathogen', Biophys J, 109: 521-8.

197

Deminoff, S. J., S. C. Howard, A. Hester, S. Warner, and P. K. Herman. 2006. 'Using substrate-binding variants of the cAMP-dependent

protein kinase to identify novel targets and a kinase domain important for substrate interactions in Saccharomyces cerevisiae', Genetics, 173: 1909-17.

Deng, L., and J. B. Moseley. 2013. 'Compartmentalized nodes control mitotic entry signaling in fission yeast', Mol Biol Cell, 24: 1872-81.

Dirick, L., T. Bohm, and K. Nasmyth. 1995. 'Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae', EMBO J, 14: 4803-13.

Doncic, A., and J. M. Skotheim. 2013. 'Feedforward regulation ensures stability and rapid reversibility of a cellular state', Mol Cell, 50: 856-

68. Dorsey, S., S. Tollis, J. Cheng, L. Black, S. Notley, M. Tyers, and C. A.

Royer. 2018. 'G1/S Transcription Factor Copy Number Is a Growth-Dependent Determinant of Cell Cycle Commitment in Yeast', Cell Syst, 6: 539-54 e11.

Edelmann, A., M. Kruger, and J. Schmid. 2005. 'Genetic relationship between human and animal isolates of Candida albicans', J Clin Microbiol, 43: 6164-6.

Edgar, B. A. 2006. 'How flies get their size: genetics meets physiology', Nat Rev Genet, 7: 907-16.

Edmond, M. B., S. E. Wallace, D. K. McClish, M. A. Pfaller, R. N. Jones,

and R. P. Wenzel. 1999. 'Nosocomial bloodstream infections in United States hospitals: a three-year analysis', Clin Infect Dis, 29: 239-44.

Ene, I. V., L. A. Walker, M. Schiavone, K. K. Lee, H. Martin-Yken, E. Dague, N. A. Gow, C. A. Munro, and A. J. Brown. 2015. 'Cell Wall

Remodeling Enzymes Modulate Fungal Cell Wall Elasticity and Osmotic Stress Resistance', MBio, 6: e00986.

Enjalbert, B., D. A. Smith, M. J. Cornell, I. Alam, S. Nicholls, A. J. Brown,

and J. Quinn. 2006. 'Role of the Hog1 stress-activated protein kinase in the global transcriptional response to stress in the fungal

pathogen Candida albicans', Mol Biol Cell, 17: 1018-32. Eser, U., M. Falleur-Fettig, A. Johnson, and J. M. Skotheim. 2011.

'Commitment to a cellular transition precedes genome-wide transcriptional change', Mol Cell, 43: 515-27.

Eun, Y. J., P. Y. Ho, M. Kim, S. LaRussa, L. Robert, L. D. Renner, A.

Schmid, E. Garner, and A. Amir. 2018. 'Archaeal cells share common size control with bacteria despite noisier growth and

division', Nat Microbiol, 3: 148-54. Feldman, R. M., C. C. Correll, K. B. Kaplan, and R. J. Deshaies. 1997. 'A

complex of Cdc4p, Skp1p, and Cdc53p/cullin catalyzes

ubiquitination of the phosphorylated CDK inhibitor Sic1p', Cell, 91: 221-30.

198

Ferrezuelo, F., N. Colomina, B. Futcher, and M. Aldea. 2010. 'The transcriptional network activated by Cln3 cyclin at the G1-to-S

transition of the yeast cell cycle', Genome Biol, 11: R67. Fidel, P. L., Jr. 2004. 'History and new insights into host defense against

vaginal candidiasis', Trends Microbiol, 12: 220-7.

Fingerman, I., V. Nagaraj, D. Norris, and A. K. Vershon. 2003. 'Sfp1 plays a key role in yeast ribosome biogenesis', Eukaryot Cell, 2: 1061-8.

Fitzpatrick, D. A., P. O'Gaora, K. P. Byrne, and G. Butler. 2010. 'Analysis of gene evolution and metabolic pathways using the Candida Gene

Order Browser', BMC Genomics, 11: 290. Forche, A., G. Cromie, A. C. Gerstein, N. V. Solis, T. Pisithkul, W. Srifa, E.

Jeffery, D. Abbey, S. G. Filler, A. M. Dudley, and J. Berman. 2018.

'Rapid Phenotypic and Genotypic Diversification After Exposure to the Oral Host Niche in Candida albicans', Genetics, 209: 725-41.

Gadal, O., S. Labarre, C. Boschiero, and P. Thuriaux. 2002. 'Hmo1, an HMG-box protein, belongs to the yeast ribosomal DNA transcription system', EMBO J, 21: 5498-507.

Garcia-Rodas, R., A. Casadevall, J. L. Rodriguez-Tudela, M. Cuenca-Estrella, and O. Zaragoza. 2011. 'Cryptococcus neoformans capsular

enlargement and cellular gigantism during Galleria mellonella infection', PLoS One, 6: e24485.

Garcia, C., A. Burgain, J. Chaillot, E. Pic, I. Khemiri, and A. Sellam. 2018. 'A phenotypic small-molecule screen identifies halogenated salicylanilides as inhibitors of fungal morphogenesis, biofilm

formation and host cell invasion', Sci Rep, 8: 11559. Geymonat, M., A. Spanos, G. P. Wells, S. J. Smerdon, and S. G. Sedgwick.

2004. 'Clb6/Cdc28 and Cdc14 regulate phosphorylation status and cellular localization of Swi6', Mol Cell Biol, 24: 2277-85.

Ginzberg, M. B., R. Kafri, and M. Kirschner. 2015. 'Cell biology. On being

the right (cell) size', Science, 348: 1245075. Gola, S., R. Martin, A. Walther, A. Dunkler, and J. Wendland. 2003. 'New

modules for PCR-based gene targeting in Candida albicans: rapid and efficient gene targeting using 100 bp of flanking homology region', Yeast, 20: 1339-47.

Gould, K. L., and P. Nurse. 1989. 'Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis', Nature, 342:

39-45. Gow, N. A. R., and B. Yadav. 2017. 'Microbe Profile: Candida albicans: a

shape-changing, opportunistic pathogenic fungus of humans', Microbiology, 163: 1145-47.

Green, C. B., G. Cheng, J. Chandra, P. Mukherjee, M. A. Ghannoum, and

L. L. Hoyer. 2004. 'RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of

oral candidiasis and in model biofilms', Microbiology, 150: 267-75.

199

Grewal, S. S., L. Li, A. Orian, R. N. Eisenman, and B. A. Edgar. 2005. 'Myc-dependent regulation of ribosomal RNA synthesis during

Drosophila development', Nat Cell Biol, 7: 295-302. Guthrie, S. 2007. 'Patterning and axon guidance of cranial motor neurons',

Nat Rev Neurosci, 8: 859-71.

Haase, S. B., and C. Wittenberg. 2014. 'Topology and control of the cell-cycle-regulated transcriptional circuitry', Genetics, 196: 65-90.

Harris, L. K., and J. A. Theriot. 2018. 'Surface Area to Volume Ratio: A Natural Variable for Bacterial Morphogenesis', Trends Microbiol, 26:

815-32. Hartwell, L. H., J. Culotti, J. R. Pringle, and B. J. Reid. 1974. 'Genetic

control of the cell division cycle in yeast', Science, 183: 46-51.

Hedges, S. B., J. Marin, M. Suleski, M. Paymer, and S. Kumar. 2015. 'Tree of life reveals clock-like speciation and diversification', Mol Biol Evol, 32: 835-45.

Holden, H. M., J. B. Thoden, D. J. Timson, and R. J. Reece. 2004.

'Galactokinase: structure, function and role in type II galactosemia', Cell Mol Life Sci, 61: 2471-84.

Holmes, A. R., S. Tsao, S. W. Ong, E. Lamping, K. Niimi, B. C. Monk, M.

Niimi, A. Kaneko, B. R. Holland, J. Schmid, and R. D. Cannon. 2006. 'Heterozygosity and functional allelic variation in the Candida

albicans efflux pump genes CDR1 and CDR2', Mol Microbiol, 62: 170-86.

Homann, O. R., J. Dea, S. M. Noble, and A. D. Johnson. 2009. 'A

phenotypic profile of the Candida albicans regulatory network', PLoS Genet, 5: e1000783.

Huber, A., S. L. French, H. Tekotte, S. Yerlikaya, M. Stahl, M. P. Perepelkina, M. Tyers, J. Rougemont, A. L. Beyer, and R. Loewith.

2011. 'Sch9 regulates ribosome biogenesis via Stb3, Dot6 and Tod6 and the histone deacetylase complex RPD3L', EMBO J, 30: 3052-64.

Hughes, J. D., P. W. Estep, S. Tavazoie, and G. M. Church. 2000.

'Computational identification of cis-regulatory elements associated with groups of functionally related genes in Saccharomyces

cerevisiae', J Mol Biol, 296: 1205-14. Hull, C. M., and A. D. Johnson. 1999. 'Identification of a mating type-like

locus in the asexual pathogenic yeast Candida albicans', Science,

285: 1271-5. Hussein, B., H. Huang, A. Glory, A. Osmani, S. Kaminskyj, A. Nantel, and

C. Bachewich. 2011. 'G1/S transcription factor orthologues Swi4p and Swi6p are important but not essential for cell proliferation and influence hyphal development in the fungal pathogen Candida

albicans', Eukaryot Cell, 10: 384-97. Ibrahim, A. S., B. B. Magee, D. C. Sheppard, M. Yang, S. Kauffman, J.

Becker, J. E. Edwards, Jr., and P. T. Magee. 2005. 'Effects of ploidy and mating type on virulence of Candida albicans', Infect Immun, 73:

7366-74.

200

Irle, T., and E. Schierenberg. 2002. 'Developmental potential of fused Caenorhabditis elegans oocytes: generation of giant and twin

embryos', Dev Genes Evol, 212: 257-66. Ismail, H. M., O. Myronova, Y. Tsuchiya, A. Niewiarowski, I. Tsaneva, and

I. Gout. 2013. 'Identification of the general transcription factor Yin

Yang 1 as a novel and specific binding partner for S6 kinase 2', Cell Signal, 25: 1054-63.

Jia, Y., B. Rothermel, J. Thornton, and R. A. Butow. 1997. 'A basic helix-loop-helix-leucine zipper transcription complex in yeast functions in

a signaling pathway from mitochondria to the nucleus', Mol Cell Biol, 17: 1110-7.

Jones, T., N. A. Federspiel, H. Chibana, J. Dungan, S. Kalman, B. B.

Magee, G. Newport, Y. R. Thorstenson, N. Agabian, P. T. Magee, R. W. Davis, and S. Scherer. 2004. 'The diploid genome sequence of

Candida albicans', Proc Natl Acad Sci U S A, 101: 7329-34. Jorgensen, P., J. L. Nishikawa, B. J. Breitkreutz, and M. Tyers. 2002.

'Systematic identification of pathways that couple cell growth and

division in yeast', Science, 297: 395-400. Jorgensen, P., I. Rupes, J. R. Sharom, L. Schneper, J. R. Broach, and M.

Tyers. 2004. 'A dynamic transcriptional network communicates growth potential to ribosome synthesis and critical cell size', Genes Dev, 18: 2491-505.

Jorgensen, P., and M. Tyers. 2004. 'How cells coordinate growth and division', Curr Biol, 14: R1014-27.

Jurden, L., M. Buchanan, G. Kelsberg, and S. Safranek. 2012. 'Clinical inquiries. Can probiotics safely prevent recurrent vaginitis?', J Fam Pract, 61: 357, 68.

Kastora, S. L., C. Herrero-de-Dios, G. M. Avelar, C. A. Munro, and A. J. P.

Brown. 2017. 'Sfp1 and Rtg3 reciprocally modulate carbon source-conditional stress adaptation in the pathogenic yeast Candida albicans', Mol Microbiol, 105: 620-36.

Kayingo, G., and B. Wong. 2005. 'The MAP kinase Hog1p differentially regulates stress-induced production and accumulation of glycerol

and D-arabitol in Candida albicans', Microbiology, 151: 2987-99. Keifenheim, D., X. M. Sun, E. D'Souza, M. J. Ohira, M. Magner, M. B.

Mayhew, S. Marguerat, and N. Rhind. 2017. 'Size-Dependent Expression of the Mitotic Activator Cdc25 Suggests a Mechanism of Size Control in Fission Yeast', Curr Biol, 27: 1491-97 e4.

Kim, J., and K. L. Guan. 2011. 'Amino acid signaling in TOR activation', Annu Rev Biochem, 80: 1001-32.

Kingsbury, J. M., and J. H. McCusker. 2010. 'Cytocidal amino acid starvation of Saccharomyces cerevisiae and Candida albicans acetolactate synthase (ilv2{Delta}) mutants is influenced by the

carbon source and rapamycin', Microbiology, 156: 929-39. Knauth, P., and H. Reichenbach. 2000. 'On the mechanism of action of the

myxobacterial fungicide ambruticin', J Antibiot (Tokyo), 53: 1182-90.

201

Kojima, K., Y. S. Bahn, and J. Heitman. 2006. 'Calcineurin, Mpk1 and Hog1 MAPK pathways independently control fludioxonil antifungal

sensitivity in Cryptococcus neoformans', Microbiology, 152: 591-604. Koul, H. K., M. Pal, and S. Koul. 2013. 'Role of p38 MAP Kinase Signal

Transduction in Solid Tumors', Genes Cancer, 4: 342-59.

Krantz, M., E. Becit, and S. Hohmann. 2006. 'Comparative genomics of the HOG-signalling system in fungi', Curr Genet, 49: 137-51.

Lalla, R. V., L. L. Patton, and A. Dongari-Bagtzoglou. 2013. 'Oral candidiasis: pathogenesis, clinical presentation, diagnosis and

treatment strategies', J Calif Dent Assoc, 41: 263-8. Laplante, M., and D. M. Sabatini. 2012. 'mTOR signaling in growth control

and disease', Cell, 149: 274-93.

Lavoie, H., H. Hogues, J. Mallick, A. Sellam, A. Nantel, and M. Whiteway. 2010. 'Evolutionary tinkering with conserved components of a

transcriptional regulatory network', PLoS Biol, 8: e1000329. Lavoie, J. N., G. L'Allemain, A. Brunet, R. Muller, and J. Pouyssegur.

1996. 'Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by the p38/HOGMAPK pathway', J Biol Chem, 271: 20608-16.

Lee, J., R. D. Moir, and I. M. Willis. 2009. 'Regulation of RNA polymerase III transcription involves SCH9-dependent and SCH9-independent

branches of the target of rapamycin (TOR) pathway', J Biol Chem, 284: 12604-8.

Li, C. H., M. Cervantes, D. J. Springer, T. Boekhout, R. M. Ruiz-Vazquez, S. R. Torres-Martinez, J. Heitman, and S. C. Lee. 2011. 'Sporangiospore size dimorphism is linked to virulence of Mucor

circinelloides', PLoS Pathog, 7: e1002086. Lindås, Ann-Christin, and Rolf Bernander. 2013. 'The cell cycle of

archaea', Nature Reviews Microbiology, 11: 627. Lippman, S. I., and J. R. Broach. 2009. 'Protein kinase A and TORC1

activate genes for ribosomal biogenesis by inactivating repressors

encoded by Dot6 and its homolog Tod6', Proc Natl Acad Sci U S A, 106: 19928-33.

Liu, S., M. B. Ginzberg, N. Patel, M. Hild, B. Leung, Z. Li, Y. C. Chen, N. Chang, Y. Wang, C. Tan, S. Diena, W. Trimble, L. Wasserman, J. L. Jenkins, M. W. Kirschner, and R. Kafri. 2018. 'Size uniformity of

animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length', Elife, 7.

Liu, W., J. Zhao, X. Li, Y. Li, and L. Jiang. 2010. 'The protein kinase CaSch9p is required for the cell growth, filamentation and virulence in the human fungal pathogen Candida albicans', FEMS Yeast Res,

10: 462-70. Lloyd, A. C. 2013. 'The regulation of cell size', Cell, 154: 1194-205.

Lo, H. J., J. R. Kohler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti, and G. R. Fink. 1997. 'Nonfilamentous C. albicans mutants are

avirulent', Cell, 90: 939-49.

202

Lobner-Olesen, A., K. Skarstad, F. G. Hansen, K. von Meyenburg, and E. Boye. 1989. 'The DnaA protein determines the initiation mass of

Escherichia coli K-12', Cell, 57: 881-9. Loewith, R., and M. N. Hall. 2011. 'Target of rapamycin (TOR) in nutrient

signaling and growth control', Genetics, 189: 1177-201.

Loewith, R., E. Jacinto, S. Wullschleger, A. Lorberg, J. L. Crespo, D. Bonenfant, W. Oppliger, P. Jenoe, and M. N. Hall. 2002. 'Two TOR

complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control', Mol Cell, 10: 457-68.

Logsdon, M. M., P. Y. Ho, K. Papavinasasundaram, K. Richardson, M. Cokol, C. M. Sassetti, A. Amir, and B. B. Aldridge. 2017. 'A Parallel Adder Coordinates Mycobacterial Cell-Cycle Progression and Cell-

Size Homeostasis in the Context of Asymmetric Growth and Organization', Curr Biol, 27: 3367-74 e7.

Lopez-Martinez, R. 2010. 'Candidosis, a new challenge', Clin Dermatol, 28: 178-84.

Lozano, E., A. G. Saez, A. J. Flemming, A. Cunha, and A. M. Leroi. 2006.

'Regulation of growth by ploidy in Caenorhabditis elegans', Curr Biol, 16: 493-8.

Lutkenhaus, J. 2008. 'Min oscillation in bacteria', Adv Exp Med Biol, 641: 49-61.

Ma, X. M., and J. Blenis. 2009. 'Molecular mechanisms of mTOR-mediated translational control', Nat Rev Mol Cell Biol, 10: 307-18.

Magnuson, B., B. Ekim, and D. C. Fingar. 2012. 'Regulation and function

of ribosomal protein S6 kinase (S6K) within mTOR signalling networks', Biochem J, 441: 1-21.

Malavia, D., L. E. Lehtovirta-Morley, O. Alamir, E. Weiss, N. A. R. Gow, B. Hube, and D. Wilson. 2017. 'Zinc Limitation Induces a Hyper-Adherent Goliath Phenotype in Candida albicans', Front Microbiol, 8:

2238. Malinverni, C., M. Cremaschi, F. D'Adda, G. Cassina, and P. Seghizzi.

1985. '[Epidemiology of ischemic cardiopathy in a large iron foundry]', G Ital Med Lav, 7: 81-8.

Mancuso, R., J. Chinnici, C. Tsou, S. Busarajan, R. Munnangi, and A. Maddi. 2018. 'Functions of Candida albicans cell wall glycosidases Dfg5p and Dcw1p in biofilm formation and HOG MAPK pathway',

PeerJ, 6: e5685. Marchetti, O., J. Bille, U. Fluckiger, P. Eggimann, C. Ruef, J. Garbino, T.

Calandra, M. P. Glauser, M. G. Tauber, D. Pittet, and Switzerland Fungal Infection Network of. 2004. 'Epidemiology of candidemia in Swiss tertiary care hospitals: secular trends, 1991-2000', Clin Infect Dis, 38: 311-20.

Marion, R. M., A. Regev, E. Segal, Y. Barash, D. Koller, N. Friedman, and

E. K. O'Shea. 2004. 'Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression', Proc Natl Acad Sci U S A, 101: 14315-22.

203

Marshall, W. F., K. D. Young, M. Swaffer, E. Wood, P. Nurse, A. Kimura, J. Frankel, J. Wallingford, V. Walbot, X. Qu, and A. H. Roeder. 2012.

'What determines cell size?', BMC Biol, 10: 101. Martchenko, M., A. Levitin, H. Hogues, A. Nantel, and M. Whiteway. 2007.

'Transcriptional rewiring of fungal galactose-metabolism circuitry',

Curr Biol, 17: 1007-13. Martin, S. G., and M. Berthelot-Grosjean. 2009. 'Polar gradients of the

DYRK-family kinase Pom1 couple cell length with the cell cycle', Nature, 459: 852-6.

Mazzi, S., L. Lordier, N. Debili, H. Raslova, and W. Vainchenker. 2018. 'Megakaryocyte and polyploidization', Exp Hematol, 57: 1-13.

McCarthy, M. W., D. P. Kontoyiannis, O. A. Cornely, J. R. Perfect, and T. J.

Walsh. 2017. 'Novel Agents and Drug Targets to Meet the Challenges of Resistant Fungi', J Infect Dis, 216: S474-S83.

Miettinen, T. P., and M. Bjorklund. 2016. 'Cellular Allometry of Mitochondrial Functionality Establishes the Optimal Cell Size', Dev Cell, 39: 370-82.

Miettinen, T. P., M. J. Caldez, P. Kaldis, and M. Bjorklund. 2017. 'Cell size control - a mechanism for maintaining fitness and function',

Bioessays, 39. Mikule, K., B. Delaval, P. Kaldis, A. Jurcyzk, P. Hergert, and S. Doxsey.

2007. 'Loss of centrosome integrity induces p38-p53-p21-dependent G1-S arrest', Nat Cell Biol, 9: 160-70.

Miller, M. G., and A. D. Johnson. 2002. 'White-opaque switching in Candida albicans is controlled by mating-type locus homeodomain proteins and allows efficient mating', Cell, 110: 293-302.

Mio, T., M. Adachi-Shimizu, Y. Tachibana, H. Tabuchi, S. B. Inoue, T. Yabe, T. Yamada-Okabe, M. Arisawa, T. Watanabe, and H. Yamada-

Okabe. 1997. 'Cloning of the Candida albicans homolog of Saccharomyces cerevisiae GSC1/FKS1 and its involvement in beta-1,3-glucan synthesis', J Bacteriol, 179: 4096-105.

Miramon, P., and M. C. Lorenz. 2017. 'A feast for Candida: Metabolic plasticity confers an edge for virulence', PLoS Pathog, 13: e1006144.

Monds, R. D., T. K. Lee, A. Colavin, T. Ursell, S. Quan, T. F. Cooper, and K. C. Huang. 2014. 'Systematic perturbation of cytoskeletal function reveals a linear scaling relationship between cell geometry and

fitness', Cell Rep, 9: 1528-37. Montagne, J., M. J. Stewart, H. Stocker, E. Hafen, S. C. Kozma, and G.

Thomas. 1999. 'Drosophila S6 kinase: a regulator of cell size', Science, 285: 2126-9.

Moosa, M. Y., J. D. Sobel, H. Elhalis, W. Du, and R. A. Akins. 2004. 'Fungicidal activity of fluconazole against Candida albicans in a synthetic vagina-simulative medium', Antimicrob Agents Chemother, 48: 161-7.

204

Moseley, J. B., A. Mayeux, A. Paoletti, and P. Nurse. 2009. 'A spatial gradient coordinates cell size and mitotic entry in fission yeast',

Nature, 459: 857-60. Moullan, N., L. Mouchiroud, X. Wang, D. Ryu, E. G. Williams, A. Mottis, V.

Jovaisaite, M. V. Frochaux, P. M. Quiros, B. Deplancke, R. H.

Houtkooper, and J. Auwerx. 2015. 'Tetracyclines Disturb Mitochondrial Function across Eukaryotic Models: A Call for Caution

in Biomedical Research', Cell Rep. Moyes, D. L., M. Runglall, C. Murciano, C. Shen, D. Nayar, S. Thavaraj, A.

Kohli, A. Islam, H. Mora-Montes, S. J. Challacombe, and J. R.

Naglik. 2010. 'A biphasic innate immune MAPK response discriminates between the yeast and hyphal forms of Candida

albicans in epithelial cells', Cell Host Microbe, 8: 225-35. Nash, P., X. Tang, S. Orlicky, Q. Chen, F. B. Gertler, M. D. Mendenhall, F.

Sicheri, T. Pawson, and M. Tyers. 2001. 'Multisite phosphorylation of

a CDK inhibitor sets a threshold for the onset of DNA replication', Nature, 414: 514-21.

Navarro, F. J., and P. Nurse. 2012. 'A systematic screen reveals new elements acting at the G2/M cell cycle control', Genome Biol, 13:

R36. Nobile, C. J., and A. P. Mitchell. 2005. 'Regulation of cell-surface genes

and biofilm formation by the C. albicans transcription factor Bcr1p',

Curr Biol, 15: 1150-5. Noble, S. M., S. French, L. A. Kohn, V. Chen, and A. D. Johnson. 2010.

'Systematic screens of a Candida albicans homozygous deletion library decouple morphogenetic switching and pathogenicity', Nat Genet, 42: 590-8.

Noble, S. M., and A. D. Johnson. 2005. 'Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen

Candida albicans', Eukaryot Cell, 4: 298-309. Nurse, P. 1990. 'Universal control mechanism regulating onset of M-

phase', Nature, 344: 503-8. Odds, F. C., A. J. Brown, and N. A. Gow. 2004. 'Candida albicans genome

sequence: a platform for genomics in the absence of genetics', Genome Biol, 5: 230.

Ofir, A., K. Hofmann, E. Weindling, T. Gildor, K. S. Barker, P. D. Rogers,

and D. Kornitzer. 2012. 'Role of a Candida albicans Nrm1/Whi5 homologue in cell cycle gene expression and DNA replication stress

response', Mol Microbiol, 84: 778-94. Okagaki, L. H., A. K. Strain, J. N. Nielsen, C. Charlier, N. J. Baltes, F.

Chretien, J. Heitman, F. Dromer, and K. Nielsen. 2010.

'Cryptococcal cell morphology affects host cell interactions and pathogenicity', PLoS Pathog, 6: e1000953.

Olaiya, A. F., and S. J. Sogin. 1979. 'Ploidy determination of Canadida albicans', J Bacteriol, 140: 1043-9.

205

Palacios, P., M. Vicente, and M. Sanchez. 1996. 'Dependency of Escherichia coli cell-division size, and independency of nucleoid

segregation on the mode and level of ftsZ expression', Mol Microbiol, 20: 1093-8.

Pan, K. Z., T. E. Saunders, I. Flor-Parra, M. Howard, and F. Chang. 2014.

'Cortical regulation of cell size by a sizer cdr2p', Elife, 3: e02040. Pande, K., C. Chen, and S. M. Noble. 2013. 'Passage through the

mammalian gut triggers a phenotypic switch that promotes Candida albicans commensalism', Nat Genet, 45: 1088-91.

Pappas, P. G. 2006. 'Invasive candidiasis', Infect Dis Clin North Am, 20: 485-506.

Pappas, P. G., C. A. Kauffman, D. R. Andes, C. J. Clancy, K. A. Marr, L.

Ostrosky-Zeichner, A. C. Reboli, M. G. Schuster, J. A. Vazquez, T. J. Walsh, T. E. Zaoutis, and J. D. Sobel. 2016. 'Clinical Practice

Guideline for the Management of Candidiasis: 2016 Update by the Infectious Diseases Society of America', Clin Infect Dis, 62: e1-50.

Perfect, J. R. 2017. 'The antifungal pipeline: a reality check', Nat Rev Drug Discov, 16: 603-16.

Pfaller, M. A., D. J. Diekema, A. L. Colombo, C. Kibbler, K. P. Ng, D. L.

Gibbs, and V. A. Newell. 2006. 'Candida rugosa, an emerging fungal pathogen with resistance to azoles: geographic and temporal trends

from the ARTEMIS DISK antifungal surveillance program', J Clin Microbiol, 44: 3578-82.

Pierce, C. G., T. Vila, J. A. Romo, D. Montelongo-Jauregui, G. Wall, A. Ramasubramanian, and J. L. Lopez-Ribot. 2017. 'The Candida albicans Biofilm Matrix: Composition, Structure and Function', J Fungi (Basel), 3.

Pluta, K., O. Lefebvre, N. C. Martin, W. J. Smagowicz, D. R. Stanford, S. R.

Ellis, A. K. Hopper, A. Sentenac, and M. Boguta. 2001. 'Maf1p, a negative effector of RNA polymerase III in Saccharomyces cerevisiae', Mol Cell Biol, 21: 5031-40.

Popolo, L., M. Vanoni, and L. Alberghina. 1982. 'Control of the yeast cell cycle by protein synthesis', Exp Cell Res, 142: 69-78.

Ramage, G., S. P. Saville, D. P. Thomas, and J. L. Lopez-Ribot. 2005. 'Candida biofilms: an update', Eukaryot Cell, 4: 633-8.

Rathmell, J. C., M. G. Vander Heiden, M. H. Harris, K. A. Frauwirth, and C. B. Thompson. 2000. 'In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size

or viability', Mol Cell, 6: 683-92. Reinke, A., S. Anderson, J. M. McCaffery, J. Yates, 3rd, S. Aronova, S.

Chu, S. Fairclough, C. Iverson, K. P. Wedaman, and T. Powers. 2004. 'TOR complex 1 includes a novel component, Tco89p (YPL180w), and cooperates with Ssd1p to maintain cellular integrity

in Saccharomyces cerevisiae', J Biol Chem, 279: 14752-62. Riggi, M., K. Niewola-Staszkowska, N. Chiaruttini, A. Colom, B. Kusmider,

V. Mercier, S. Soleimanpour, M. Stahl, S. Matile, A. Roux, and R.

206

Loewith. 2018. 'Decrease in plasma membrane tension triggers PtdIns(4,5)P2 phase separation to inactivate TORC2', Nat Cell Biol, 20: 1043-51.

Robert, L. 2015. 'Size sensors in bacteria, cell cycle control, and size control', Front Microbiol, 6: 515.

Roemer, T., B. Jiang, J. Davison, T. Ketela, K. Veillette, A. Breton, F. Tandia, A. Linteau, S. Sillaots, C. Marta, N. Martel, S. Veronneau, S.

Lemieux, S. Kauffman, J. Becker, R. Storms, C. Boone, and H. Bussey. 2003. 'Large-scale essential gene identification in Candida albicans and applications to antifungal drug discovery', Mol Microbiol, 50: 167-81.

Rohde, J. R., R. Bastidas, R. Puria, and M. E. Cardenas. 2008. 'Nutritional

control via Tor signaling in Saccharomyces cerevisiae', Curr Opin Microbiol, 11: 153-60.

Romanov, N., D. M. Hollenstein, M. Janschitz, G. Ammerer, D. Anrather, and W. Reiter. 2017. 'Identifying protein kinase-specific effectors of

the osmostress response in yeast', Sci Signal, 10. Rothfield, L., A. Taghbalout, and Y. L. Shih. 2005. 'Spatial control of

bacterial division-site placement', Nat Rev Microbiol, 3: 959-68.

Russell, P., and P. Nurse. 1987. 'Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog', Cell, 49: 559-67.

Saito, H., and F. Posas. 2012. 'Response to hyperosmotic stress', Genetics, 192: 289-318.

San Jose, C., R. A. Monge, R. Perez-Diaz, J. Pla, and C. Nombela. 1996. 'The mitogen-activated protein kinase homolog HOG1 gene controls glycerol accumulation in the pathogenic fungus Candida albicans', J Bacteriol, 178: 5850-2.

Santos, M. A., T. Ueda, K. Watanabe, and M. F. Tuite. 1997. 'The non-

standard genetic code of Candida spp.: an evolving genetic code or a novel mechanism for adaptation?', Mol Microbiol, 26: 423-31.

Satoh, K., K. Makimura, Y. Hasumi, Y. Nishiyama, K. Uchida, and H. Yamaguchi. 2009. 'Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a

Japanese hospital', Microbiol Immunol, 53: 41-4. Satpati, S., K. Manohar, N. Acharya, and A. Dixit. 2017. 'Comparative

molecular dynamics studies of heterozygous open reading frames of DNA polymerase eta (eta) in pathogenic yeast Candida albicans', Sci Rep, 7: 41087.

Saucedo, L. J., and B. A. Edgar. 2002. 'Why size matters: altering cell size', Curr Opin Genet Dev, 12: 565-71.

Savage-Dunn, C., L. L. Maduzia, C. M. Zimmerman, A. F. Roberts, S. Cohen, R. Tokarz, and R. W. Padgett. 2003. 'Genetic screen for small

body size mutants in C. elegans reveals many TGFbeta pathway components', Genesis, 35: 239-47.

Saville, S. P., A. L. Lazzell, C. Monteagudo, and J. L. Lopez-Ribot. 2003.

'Engineered control of cell morphology in vivo reveals distinct roles

207

for yeast and filamentous forms of Candida albicans during infection', Eukaryot Cell, 2: 1053-60.

Sawant, B., and T. Khan. 2017. 'Recent advances in delivery of antifungal agents for therapeutic management of candidiasis', Biomed Pharmacother, 96: 1478-90.

Schaechter, M., O. Maaloe, and N. O. Kjeldgaard. 1958. 'Dependency on medium and temperature of cell size and chemical composition

during balanced grown of Salmonella typhimurium', J Gen Microbiol, 19: 592-606.

Schaefer, J. B., and L. L. Breeden. 2004. 'RB from a bud's eye view', Cell, 117: 849-50.

Schmoller, K. M., J. J. Turner, M. Koivomagi, and J. M. Skotheim. 2015. 'Dilution of the cell cycle inhibitor Whi5 controls budding-yeast cell size', Nature, 526: 268-72.

Schneider, B. L., Q. H. Yang, and A. B. Futcher. 1996. 'Linkage of replication to start by the Cdk inhibitor Sic1', Science, 272: 560-2.

Schneider, B. L., J. Zhang, J. Markwardt, G. Tokiwa, T. Volpe, S. Honey, and B. Futcher. 2004. 'Growth rate and cell size modulate the synthesis of, and requirement for, G1-phase cyclins at start', Mol Cell Biol, 24: 10802-13.

Schonherr, F. A., F. Sparber, F. R. Kirchner, E. Guiducci, K. Trautwein-

Weidner, A. Gladiator, N. Sertour, U. Hetzel, G. T. T. Le, N. Pavelka, C. d'Enfert, M. E. Bougnoux, C. F. Corti, and S. LeibundGut-

Landmann. 2017. 'The intraspecies diversity of C. albicans triggers qualitatively and temporally distinct host responses that determine the balance between commensalism and pathogenicity', Mucosal Immunol, 10: 1335-50.

Schulz, H. N., T. Brinkhoff, T. G. Ferdelman, M. H. Marine, A. Teske, and

B. B. Jorgensen. 1999. 'Dense populations of a giant sulfur bacterium in Namibian shelf sediments', Science, 284: 493-5.

Schulz, H. N., and B. B. Jorgensen. 2001. 'Big bacteria', Annu Rev Microbiol, 55: 105-37.

Schwob, E., T. Bohm, M. D. Mendenhall, and K. Nasmyth. 1994. 'The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae', Cell, 79: 233-44.

Seider, K., A. Heyken, A. Luttich, P. Miramon, and B. Hube. 2010. 'Interaction of pathogenic yeasts with phagocytes: survival,

persistence and escape', Curr Opin Microbiol, 13: 392-400. Sellam, A., T. Al-Niemi, K. McInnerney, S. Brumfield, A. Nantel, and P. A.

Suci. 2009. 'A Candida albicans early stage biofilm detachment

event in rich medium', BMC Microbiol, 9: 25. Sellam, A., C. Askew, E. Epp, F. Tebbji, A. Mullick, M. Whiteway, and A.

Nantel. 2010. 'Role of transcription factor CaNdt80p in cell separation, hyphal growth, and virulence in Candida albicans', Eukaryot Cell, 9: 634-44.

208

Sellam, A., H. Hogues, C. Askew, F. Tebbji, M. van Het Hoog, H. Lavoie, C. A. Kumamoto, M. Whiteway, and A. Nantel. 2010. 'Experimental

annotation of the human pathogen Candida albicans coding and noncoding transcribed regions using high-resolution tiling arrays', Genome Biol, 11: R71.

Sheikh-Hamad, D., and M. C. Gustin. 2004. 'MAP kinases and the adaptive response to hypertonicity: functional preservation from

yeast to mammals', Am J Physiol Renal Physiol, 287: F1102-10. Shevchenko, A., A. Roguev, D. Schaft, L. Buchanan, B. Habermann, C.

Sakalar, H. Thomas, N. J. Krogan, A. Shevchenko, and A. F. Stewart.

2008. 'Chromatin Central: towards the comparative proteome by accurate mapping of the yeast proteomic environment', Genome Biol, 9: R167.

Shubitz, L. F., J. N. Galgiani, Z. Q. Tian, Z. Zhong, P. Timmermans, and L. Katz. 2006. 'Efficacy of ambruticin analogs in a murine model of

coccidioidomycosis', Antimicrob Agents Chemother, 50: 3467-9. Silverman, J. F., W. J. Pories, and J. F. Caro. 1989. 'Liver pathology in

diabetes mellitus and morbid obesity. Clinical, pathological, and biochemical considerations', Pathol Annu, 24 Pt 1: 275-302.

Simon, I., J. Barnett, N. Hannett, C. T. Harbison, N. J. Rinaldi, T. L. Volkert, J. J. Wyrick, J. Zeitlinger, D. K. Gifford, T. S. Jaakkola, and R. A. Young. 2001. 'Serial regulation of transcriptional regulators in

the yeast cell cycle', Cell, 106: 697-708. Skotheim, J. M., S. Di Talia, E. D. Siggia, and F. R. Cross. 2008. 'Positive

feedback of G1 cyclins ensures coherent cell cycle entry', Nature, 454: 291-6.

Slutsky, B., M. Staebell, J. Anderson, L. Risen, M. Pfaller, and D. R. Soll.

1987. '"White-opaque transition": a second high-frequency switching system in Candida albicans', J Bacteriol, 169: 189-97.

Smith, C., A. Pomiankowski, and D. Greig. 2014. 'Size and competitive mating success in the yeast Saccharomyces cerevisiae', Behav Ecol, 25: 320-27.

Smith, D. A., S. Nicholls, B. A. Morgan, A. J. Brown, and J. Quinn. 2004. 'A conserved stress-activated protein kinase regulates a core stress

response in the human pathogen Candida albicans', Mol Biol Cell, 15: 4179-90.

Sobel, J. D. 2007. 'Vulvovaginal candidosis', Lancet, 369: 1961-71. Soifer, I., and N. Barkai. 2014. 'Systematic identification of cell size

regulators in budding yeast', Mol Syst Biol, 10: 761.

Soifer, I., L. Robert, and A. Amir. 2016. 'Single-Cell Analysis of Growth in Budding Yeast and Bacteria Reveals a Common Size Regulation

Strategy', Curr Biol, 26: 356-61. Soll, D. R. 1992. 'High-frequency switching in Candida albicans', Clin

Microbiol Rev, 5: 183-203. Stichternoth, C., A. Fraund, E. Setiadi, L. Giasson, A. Vecchiarelli, and J.

F. Ernst. 2011. 'Sch9 kinase integrates hypoxia and CO2 sensing to

209

suppress hyphal morphogenesis in Candida albicans', Eukaryot Cell, 10: 502-11.

Stuart, D., and C. Wittenberg. 1995. 'CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells', Genes Dev, 9: 2780-94.

Sturgill, T. W., A. Cohen, M. Diefenbacher, M. Trautwein, D. E. Martin, and M. N. Hall. 2008. 'TOR1 and TOR2 have distinct locations in live

cells', Eukaryot Cell, 7: 1819-30. Sudbery, P. E. 2011. 'Growth of Candida albicans hyphae', Nat Rev

Microbiol, 9: 737-48. Sveiczer, A., and A. Horvath. 2017. 'How do fission yeast cells grow and

connect growth to the mitotic cycle?', Curr Genet, 63: 165-73. Taberner, F. J., I. Quilis, and J. C. Igual. 2009. 'Spatial regulation of the

start repressor Whi5', Cell Cycle, 8: 3010-8.

Taheri-Araghi, S., S. Bradde, J. T. Sauls, N. S. Hill, P. A. Levin, J. Paulsson, M. Vergassola, and S. Jun. 2015. 'Cell-size control and

homeostasis in bacteria', Curr Biol, 25: 385-91. Tao, L., H. Du, G. Guan, Y. Dai, C. J. Nobile, W. Liang, C. Cao, Q. Zhang,

J. Zhong, and G. Huang. 2014. 'Discovery of a "white-gray-opaque" tristable phenotypic switching system in candida albicans: roles of non-genetic diversity in host adaptation', PLoS Biol, 12: e1001830.

Thewes, S., M. Kretschmar, H. Park, M. Schaller, S. G. Filler, and B. Hube. 2007. 'In vivo and ex vivo comparative transcriptional profiling of

invasive and non-invasive Candida albicans isolates identifies genes associated with tissue invasion', Mol Microbiol, 63: 1606-28.

Tropini, C., T. K. Lee, J. Hsin, S. M. Desmarais, T. Ursell, R. D. Monds,

and K. C. Huang. 2014. 'Principles of bacterial cell-size determination revealed by cell-wall synthesis perturbations', Cell Rep, 9: 1520-7.

Trueba, F. J., and C. L. Woldringh. 1980. 'Changes in cell diameter during

the division cycle of Escherichia coli', J Bacteriol, 142: 869-78. Tumaneng, K., R. C. Russell, and K. L. Guan. 2012. 'Organ size control by

Hippo and TOR pathways', Curr Biol, 22: R368-79.

Turner, J. J., J. C. Ewald, and J. M. Skotheim. 2012. 'Cell size control in yeast', Curr Biol, 22: R350-9.

Tyers, M. 1996. 'The cyclin-dependent kinase inhibitor p40SIC1 imposes the requirement for Cln G1 cyclin function at Start', Proc Natl Acad Sci U S A, 93: 7772-6.

Tyers, M., G. Tokiwa, and B. Futcher. 1993. 'Comparison of the

Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins', EMBO J, 12: 1955-68.

Urban, J., A. Soulard, A. Huber, S. Lippman, D. Mukhopadhyay, O.

Deloche, V. Wanke, D. Anrather, G. Ammerer, H. Riezman, J. R. Broach, C. De Virgilio, M. N. Hall, and R. Loewith. 2007. 'Sch9 is a

major target of TORC1 in Saccharomyces cerevisiae', Mol Cell, 26: 663-74.

210

van Riggelen, J., A. Yetil, and D. W. Felsher. 2010. 'MYC as a regulator of ribosome biogenesis and protein synthesis', Nat Rev Cancer, 10:

301-9. Vandeputte, P., S. Pradervand, F. Ischer, A. T. Coste, S. Ferrari, K.

Harshman, and D. Sanglard. 2012. 'Identification and functional

characterization of Rca1, a transcription factor involved in both antifungal susceptibility and host response in Candida albicans',

Eukaryot Cell, 11: 916-31. Varsano, G., Y. Wang, and M. Wu. 2017. 'Probing Mammalian Cell Size

Homeostasis by Channel-Assisted Cell Reshaping', Cell Rep, 20: 397-

410. Verges, E., N. Colomina, E. Gari, C. Gallego, and M. Aldea. 2007. 'Cyclin

Cln3 is retained at the ER and released by the J chaperone Ydj1 in late G1 to trigger cell cycle entry', Mol Cell, 26: 649-62.

Verma, R., R. M. Feldman, and R. J. Deshaies. 1997. 'SIC1 is ubiquitinated in vitro by a pathway that requires CDC4, CDC34, and cyclin/CDK activities', Mol Biol Cell, 8: 1427-37.

Vylkova, S., and M. C. Lorenz. 2017. 'Phagosomal Neutralization by the Fungal Pathogen Candida albicans Induces Macrophage Pyroptosis',

Infect Immun, 85. Wade, C. H., M. A. Umbarger, and M. A. McAlear. 2006. 'The budding

yeast rRNA and ribosome biosynthesis (RRB) regulon contains over

200 genes', Yeast, 23: 293-306. Walker, L. A., D. M. Maccallum, G. Bertram, N. A. Gow, F. C. Odds, and A.

J. Brown. 2009. 'Genome-wide analysis of Candida albicans gene expression patterns during infection of the mammalian kidney', Fungal Genet Biol, 46: 210-9.

Wang, H., W. Song, G. Huang, Z. Zhou, Y. Ding, and J. Chen. 2011. 'Candida albicans Zcf37, a zinc finger protein, is required for

stabilization of the white state', FEBS Lett, 585: 797-802. Wang, L., and X. Lin. 2012. 'Morphogenesis in fungal pathogenicity: shape,

size, and surface', PLoS Pathog, 8: e1003027. Wang, R., C. P. Dillon, L. Z. Shi, S. Milasta, R. Carter, D. Finkelstein, L. L.

McCormick, P. Fitzgerald, H. Chi, J. Munger, and D. R. Green. 2011.

'The transcription factor Myc controls metabolic reprogramming upon T lymphocyte activation', Immunity, 35: 871-82.

Warner, J. R. 1999. 'The economics of ribosome biosynthesis in yeast', Trends Biochem Sci, 24: 437-40.

Watanabe, N., T. Ishihara, and Y. Ohshima. 2007. 'Mutants carrying two sma mutations are super small in the nematode C. elegans', Genes Cells, 12: 603-9.

Wedaman, K. P., A. Reinke, S. Anderson, J. Yates, 3rd, J. M. McCaffery, and T. Powers. 2003. 'Tor kinases are in distinct membrane-

associated protein complexes in Saccharomyces cerevisiae', Mol Biol Cell, 14: 1204-20.

Wells, W. A. 2002. 'Does size matter?', J Cell Biol, 158: 1156-9.

211

Wertheimer, N. B., N. Stone, and J. Berman. 2016. 'Ploidy dynamics and evolvability in fungi', Philos Trans R Soc Lond B Biol Sci, 371.

Wijnen, H., and B. Futcher. 1999. 'Genetic analysis of the shared role of CLN3 and BCK2 at the G(1)-S transition in Saccharomyces cerevisiae', Genetics, 153: 1131-43.

Wisplinghoff, H., T. Bischoff, S. M. Tallent, H. Seifert, R. P. Wenzel, and M. B. Edmond. 2004. 'Nosocomial bloodstream infections in US

hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study', Clin Infect Dis, 39: 309-17.

Wong, J. M., and D. J. Jenkins. 2007. 'Carbohydrate digestibility and metabolic effects', J Nutr, 137: 2539S-46S.

Wood, E., and P. Nurse. 2015. 'Sizing up to divide: mitotic cell-size control

in fission yeast', Annu Rev Cell Dev Biol, 31: 11-29. Wu, W., C. Pujol, S. R. Lockhart, and D. R. Soll. 2005. 'Chromosome loss

followed by duplication is the major mechanism of spontaneous mating-type locus homozygosis in Candida albicans', Genetics, 169:

1311-27. Yamamoto, K., V. Gandin, M. Sasaki, S. McCracken, W. Li, J. L. Silvester,

A. J. Elia, F. Wang, Y. Wakutani, R. Alexandrova, Y. D. Oo, P. J.

Mullen, S. Inoue, M. Itsumi, V. Lapin, J. Haight, A. Wakeham, A. Shahinian, M. Ikura, I. Topisirovic, N. Sonenberg, and T. W. Mak. 2014. 'Largen: a molecular regulator of mammalian cell size control',

Mol Cell, 53: 904-15. Yang, X., K. Y. Lau, V. Sevim, and C. Tang. 2013. 'Design principles of the

yeast G1/S switch', PLoS Biol, 11: e1001673. Yee, A. S., E. K. Paulson, M. A. McDevitt, K. Rieger-Christ, I.

Summerhayes, S. P. Berasi, J. Kim, C. Y. Huang, and X. Zhang. 2004. 'The HBP1 transcriptional repressor and the p38 MAP kinase: unlikely partners in G1 regulation and tumor suppression', Gene,

336: 1-13. Young, K. D. 2006. 'The selective value of bacterial shape', Microbiol Mol

Biol Rev, 70: 660-703. Zaragoza, O., R. Garcia-Rodas, J. D. Nosanchuk, M. Cuenca-Estrella, J. L.

Rodriguez-Tudela, and A. Casadevall. 2010. 'Fungal cell gigantism during mammalian infection', PLoS Pathog, 6: e1000945.

Zetterberg, A., O. Larsson, and K. G. Wiman. 1995. 'What is the restriction

point?', Curr Opin Cell Biol, 7: 835-42. Zhang, H., J. P. Stallock, J. C. Ng, C. Reinhard, and T. P. Neufeld. 2000.

'Regulation of cellular growth by the Drosophila target of rapamycin dTOR', Genes Dev, 14: 2712-24.

212

Annexe 1 - The monoterpene carvacrol generates

endoplasmic reticulum stress in the pathogenic

fungus Candida albicans

Résumé

Le carvacrol, un monoterpène constituant de l’origan et du thym, est

connu pour avoir un fort pouvoir antifongique contre la levure pathogène

Candida albicans. Ce monoterpène a été le sujet d’un grand nombre

d’études sur ses effets pharmacologiques ainsi que sur ses effets

antifongiques et antibactériens. Cependant, son mécanisme d’action n’est

pas encore compris. Dans cette étude, nous avons utilisé une approche de

chemogénomique afin de comprendre le mécanisme d’action du carvacrol

associé à ses propriétés antifongiques. Nos résultats démontrent que les

levures nécessitent la voie UPR (Unfolded Protein Response) pour résister

au carvacrol. Dans notre test de fitness sur le génome complet de

Saccharomyces cerevisiae, les mutants les plus sensibles sont le facteur de

transcription Hac1 et l’endonucléase Ire1. Ire1 est nécessaire pour

l’activation de Hac1 en clivant un intron non conventionnel de la région 3’

de l’ARNm de HAC1.

La microscopie confocale a révélé que le carvacrol affecte la morphologie et

l’intégrité du réticulum endoplasmique. Le profil transcriptionnel de la

levure pathogène C. albicans traité par du carvacrol montre l’activation de

l’UPR. L’activité d’Ire1 est détectée par l’épissage de l’ARNm Hac1 chez C.

albicans traité au carvacrol. De plus, le carvacrol augmente l’activité

antifongique de la caspofongine et des inducteurs de l’UPR (dithiothreitol

et tunicamycine) contre C. albicans. Cette étude démontre que le carvacrol

agit en altérant l’intégrité du réticulum endosplasmique, menant à un

stress du réticulum et l’activation de la voie UPR pour restaurer

l’homéostasie de la conformation des protéines.

213

Article

The monoterpene carvacrol generates endoplasmic reticulum stress in

the pathogenic fungus Candida albicans

Chaillot J1, Tebbji F1, Remmal A2, Boone C3, Brown GW4, Bellaoui M5,

Sellam A6

Antimicrob Agents Chemother. 2015 Aug; 59(8): 4584–4592. Published

online 2015 Jul 16. Prepublished online 2015 May 26. doi:

10.1128/AAC.00551-15

1 Infectious Diseases Research Centre (CRI), CHU de Québec Research

Center (CHUQ), Université Laval, Quebec City, Quebec, Canada.

2 Laboratoire de Biotechnologie, Faculty of Science of Fes, Sidi Mohammed

Ben Abdallah University, Atlas Fes, Morocco.

3 Department of Molecular Genetics, University of Toronto, Toronto,

Ontario, Canada Donnelly Centre, University of Toronto, Toronto, Ontario,

Canada.

4 Donnelly Centre, University of Toronto, Toronto, Ontario, Canada

Department of Biochemistry, University of Toronto, Toronto, Ontario,

Canada.

5 Medical Biology Unit, Faculty of Medicine and Pharmacy of Oujda,

University Mohammed the First, Oujda, Morocco [email protected]

[email protected].

6 Infectious Diseases Research Centre (CRI), CHU de Québec Research

Center (CHUQ), Université Laval, Quebec City, Quebec, Canada

Department of Microbiology, Infectious Disease and Immunology, Faculty

of Medicine, Université Laval, Quebec City, Quebec, Canada

[email protected] [email protected].

J.C. and F.T. contributed equally to this article.

214

Abstract

The monoterpene carvacrol, the major component of oregano and thyme

oils, is known to exert potent antifungal activity against the pathogenic

yeast Candida albicans. This monoterpene has been the subject of a

considerable number of investigations that uncovered extensive

pharmacological properties, including antifungal and antibacterial effects.

However, its mechanism of action remains elusive. Here, we used

integrative chemogenomic approaches, including genome-scale chemical-

genetic and transcriptional profiling, to uncover the mechanism of action

of carvacrol associated with its antifungal property. Our results clearly

demonstrated that fungal cells require the unfolded protein response (UPR)

signaling pathway to resist carvacrol. The mutants most sensitive to

carvacrol in our genome-wide competitive fitness assay in the yeast

Saccharomyces cerevisiae expressed mutations of the transcription factor

Hac1 and the endonuclease Ire1, which is required for Hac1 activation by

removing a nonconventional intron from the 3′ region of HAC1 mRNA.

Confocal fluorescence live-cell imaging revealed that carvacrol affects the

morphology and the integrity of the endoplasmic reticulum (ER).

Transcriptional profiling of pathogenic yeast C. albicans cells treated with

carvacrol demonstrated a bona fide UPR transcriptional signature. Ire1

activity detected by the splicing of HAC1 mRNA in C. albicans was

activated by carvacrol. Furthermore, carvacrol was found to potentiate

antifungal activity of the echinocandin antifungal caspofungin and UPR

inducers dithiothreitol and tunicamycin against C. albicans. This

comprehensive chemogenomic investigation demonstrated that carvacrol

exerts its antifungal activity by altering ER integrity, leading to ER stress

and the activation of the UPR to restore protein-folding homeostasis.

215

Introduction

Fungal pathogens represent a serious risk to the growing population of

immunocompromised individuals resulting from the increasing success of

organ and bone marrow transplantation, immune-suppressive cancer

chemotherapy, premature births, and the AIDS pandemic. Candida

albicans is a diploid ascomycete yeast that is an important commensal and

opportunistic pathogen in humans. Systemic infections resulting from C.

albicans are on the rise and are associated with mortality rates of 50% or

greater despite currently available antifungal therapy (1,–3). Current

therapeutic options are limited to treatment with three longstanding

antifungal classes, the polyenes, azoles, and echinocandins (4). These

compounds target the specific fungal biological process of ergosterol

metabolism (azoles and polyenes) and cell wall β-1,3-glucan synthesis

(echinocandins). However, these drugs have serious side effects such as

nephrotoxicity and/or create complications such as resistance due to their

fungistatic rather than fungicidal characteristics (4,–6). There is, thus, an

urgent need for new strategies to identify novel protein targets and

bioactive molecules for antifungal therapeutic intervention.

Plants are an interesting reservoir of secondary metabolites with an

attractive and broad spectrum of antimicrobial properties. Carvacrol is a

monoterpene phenol and a major component of essential oil extract from

oregano and other plants belonging to the Labiatae family (7). This

monoterpene is considered nontoxic to humans and is commonly used as

a flavoring substance. Carvacrol has been the subject of a considerable

number of investigations that uncovered extensive pharmacological

proprieties, including antifungal and antibacterial effects (8). Previous

investigations demonstrated that carvacrol is one of the potent

monoterpenes against C. albicans, impeding the growth of different

morphological forms, including yeast, hyphae, and the highly drug-

216

resistant biofilm (9,–11). Recent studies have shown that the

monoterpenes carvacrol and eugenol, but not thymol, synergize with the

azole antifungal fluconazole and inhibit planktonic growth and biofilm in

clinical resistant strains (12). Interestingly, carvacrol has been proved to

be an effective treatment against vaginal candidiasis in an

immunosuppressed rat model (13).

Despite the growing interest in using carvacrol in antifungal therapy, the

mechanism of action (MoA) of this phytomolecule and other antimicrobial

monoterpenes or sesquiterpenes remains unclear. Prior investigations

suggested that carvacrol acts as a membrane-disrupting agent by targeting

and binding ergosterol (11, 14, 15). Transcription profiling in the model

yeast Saccharomyces cerevisiae exposed to carvacrol revealed a

transcriptional signature similar to that experienced under calcium stress

(16), suggesting that the antifungal activity of carvacrol is probably the

consequence of the perturbation of Ca+ or H+ ion homeostasis. In the

current study, we have used state-of-the-art chemical genomic

approaches, including chemical-genetic profiling using the complete pool

of bar-coded S. cerevisiae haploid deletion strains, in addition to genome-

wide transcriptional profiling to accurately determine the MoA of carvacrol

that is relevant to its antifungal activity. Similar chemogenomic

approaches have been successfully used to confirm the known MoA of

clinically approved antifungals such as fluconazole and also to uncover the

MoA of novel antifungal compounds (17,–19). We demonstrate that

carvacrol acts as an antifungal by causing endoplasmic reticulum (ER)

stress and by inducing the unfolded protein response (UPR).

217

Materials and methods

Inhibition and synergism assay.

A growth assay of Candida cells treated with carvacrol was performed in a

96-well plate using the Sunrise plate reader (Tecan). C. albicans clinical

strain SC5314 (20) and ire1, mkc1, and bck1 mutants were grown

overnight in yeast extract-peptone-dextrose (YPD) medium at 30°C in a

shaking incubator. Candida cells were then resuspended in fresh YPD at

an optical density at 595 nm (OD595) of 0.05. A total volume of 99 μl of

cells was added to each well in the 96-well plate in addition to 1 μl of the

corresponding stock solution of carvacrol (W224511; Sigma). The plates

were incubated at 30°C under agitation, and OD readings were taken every

10 min over 20 h. Samples were done in triplicate, and the average was

used for analysis. C. albicans ire1/ire1, mkc1/mkc1, and bck1/bck1

mutants were from the kinase collection of A. Mitchell (Carnegie Mellon

University) (21). Carvacrol and other monoterpenes used in this study were

dissolved in dimethyl sulfoxide (DMSO). As a control, an equal volume of

DMSO was added (1% [vol/vol] final concentration). The MIC was

determined by the first well with a growth reduction of 10% as referred to

OD595 values in the presence of the tested compounds compared to

untreated cells.

For the spot serial dilution assay, the S. cerevisiae wild-type (WT) strain

BY4741 and the indicated deletion mutant strains were grown in YPD

overnight at 30°C. Cells were diluted to a concentration of 107 cells/ml,

and then 10-fold serial dilutions of the indicated strains were spotted on

media containing the indicated compounds. Plates were incubated at 30°C

for 2 days.

Carvacrol synergistic interactions with tunicamycin (T7765; Sigma),

dithiothreitol (DTT) (BP172; Fisher), fluconazole (F8929; Sigma),

218

caspofungin (SML0425; Sigma), and amphotericin B (A488; Sigma) were

tested as described by Epp et al. (22). The fractional inhibitory

concentration (FIC) index was determined as follows: (MIC of carvacrol in

combination/MIC of carvacrol alone) plus (MIC of a drug in

combination/MIC of a drug alone). Tunicamycin, amphotericin B, and

fluconazole were dissolved in DMSO and added from stock solutions of 10,

30, and 300 mg/ml, respectively. Caspofungin was dissolved in water to a

stock concentration of 10 mg/ml.

RNA extractions and microarray profiling.

Cultures of C. albicans strain SC5314 were inoculated from a fresh colony

and grown overnight in YPD at 30°C. Cultures were then diluted to an

OD595 of 0.05 in 100 ml of fresh YPD and grown at the same initial

temperature until an OD595 of 0.8. The culture was divided into two

volumes of 50 ml; one sample was maintained as the control where DMSO

was added, and the other treated with 0.2 mM carvacrol or 0.3 mM thymol

(MIC of each monoterpene). Candida cells were exposed to carvacrol for 5

and 30 min and to thymol for 30 min. Cells were then centrifuged 2 min at

3,500 rpm, the supernatants were removed, and the samples were quick-

frozen and stored at −80°C. RNA was extracted using the Qiagen RNeasy

kit as described previously by Sellam et al. (23). RNA quality and integrity

were checked using an Agilent 2100 bioanalyzer. cDNA labeling and

microarray experiments were performed as described by Nantel et al. (24).

Briefly, 18 μg of total RNA was reverse transcribed using 9 ng of

oligo(dT)21 in the presence of Cy3 or Cy5-dCTP (GE Healthcare) and 400 U

of SuperScript III reverse transcriptase (Life Technologies) at 42°C for 3 h.

After cDNA synthesis, template RNA was removed by adding 2.5 units

RNase H (Promega) and 1 mg RNase A (Pharmacia) followed by incubation

for 15 min at 37°C. The labeled cDNAs were purified with a QIAquick PCR

purification kit (Qiagen). DNA microarrays were processed and analyzed as

219

previously described by Nantel et al. (24). Data handling and analysis were

carried out using Genespring v.7.3 (Agilent Technologies, Palo Alto, CA).

Statistical analysis used Welch's t test with a false-discovery rate (FDR) of

5% and 1.5-fold enrichment cutoff. Hierarchical clustering of the

expression profiling data was performed using Genespring v.7.3. Gene

ontology (GO) annotation was performed using the Cytoscape (25) plug-in

BiNGO (26).

Haploid deletion chemical-genetic profiling.

Screens of the haploid deletion pool were performed as described by

Parsons et al. (18) with 0.64 mM carvacrol. Enrichment of GO terms was

performed using Gene Ontology Finder (http://www.yeastgenome.org/cgi-

bin/GO/goTermFinder.pl). The P value was calculated using a

hypergeometric distribution.

HAC1 mRNA splicing assay.

The HAC1 splicing assay was performed by reverse transcription-PCR (RT-

PCR). RNAs were extracted from C. albicans cells challenged with

tunicamycin (4.7 μM), either alone or in combination with carvacrol (0.2

mM) as described for microarray experiments. cDNAs were obtained using

Superscript II reverse transcriptase (Life Technologies) as recommended by

the supplier. The obtained cDNA was used as a template to amplify the

spliced and unspliced forms of HAC1 using the primer pair

TGAGGATGAACACCAAGAAGAA (forward primer) and

TCAAAGTCCAACTGAAATGAT (reverse primer). The PCR products were

resolved on 1.5% agarose gel.

Evaluation of ER integrity by confocal microscopy.

220

The S. cerevisiae Sec61-green fluorescent protein (GFP) strain used for

fluorescence microscopy is from the Yeast-GFP clone collection (27). An

overnight culture was diluted in YPD supplemented with 1 mM carvacrol

to an OD595 of 0.05 and grown for four generations at 30°C under

agitation. Images of fluorescence microscopy were acquired with a 63×,

1.3-numerical-aperture (NA) objective on a Leica DMI6000B inverted

microscope connected to a Hamamatsu C9100-13 camera.

221

Results

Chemogenomic fitness assay identifies key UPR regulators as required

for carvacrol tolerance.

Chemical-genetic profiling is a powerful tool that has been widely used to

uncover the MoA of many bioactive compounds (28). In order to determine

the MoA of the monoterpene carvacrol, we used S. cerevisiae haploid

deletion chemical-genetic profiling (HCGP) to identify gene deletions that

confer sensitivity to carvacrol (Table 1; see also Table S1 in the

supplemental material). GO terms associated with carvacrol-sensitive

strains were determined, and relevant functional categories are

summarized in Fig. 1A. The GO terms ER-mediated UPR and tryptophan

amino acid biosynthesis were significantly enriched in the HCGP profile.

Strains with mutations of the endonuclease Ire1 (ire1; Z-score = 3.03) and

the transcription factor Hac1 (hac1; Z-score = 2.83), which are conserved

components of the eukaryotic UPR signaling (29), were the most sensitive

strains to carvacrol (Table 1). In response to ER stress, the endonuclease

Ire1 mediates the splicing of a nonconventional intron from the 3′ region of

HAC1 mRNA, which in turn activates the UPR transcriptional program to

restore protein-folding homeostasis (30, 31). Strains with mutations of the

cell wall integrity (CWI) signaling pathway, including the mitogen-activated

protein kinase kinase kinase (MAPKKK) Bck1, the MAPK Slt2, and the

transcription factor Swi6, were also hypersensitive to carvacrol. Previous

investigations demonstrated that, in addition to its role in cell wall

maintenance, the CWI pathway is also required for ER stress response and

protein-folding homeostasis (32, 33). These data suggest that the UPR

pathway is required for cells to tolerate carvacrol.

The two mutants of the UPR pathway, the ire1 and hac1 mutants, and the

mutant of tryptophan biosynthesis, the aro2 mutant, were selected, and

their sensitivity to carvacrol was confirmed using serial dilution assay (Fig.

222

1B). The three mutants were also tested for their sensitivity to four other

monoterpenes: eugenol, isopulegol, and the two enantiomers l-(−)-carvone

and d-(+)-carvone (Fig. 1B). As shown in Fig. 1C, the aro2 mutant was

sensitive to the four-tested monoterpenes. However, ire1 and hac1 mutants

were sensitive only to carvacrol, suggesting that tolerance of the other

monoterpenes does not require the UPR pathway (Fig. 1B). Taken together,

these data suggest that UPR pathway signaling is specifically required for

the tolerance of carvacrol.

Carvacrol disrupts the morphology and the integrity of ER.

The UPR pathway requirement for carvacrol tolerance supports the

hypothesis that carvacrol might act as an ER stressor, perhaps by altering

ER integrity and/or its protein-folding capacity. To check if the UPR

requirement is related to a direct effect of carvacrol on cellular organization

of ER, we have used a Sec61-GFP fusion as an ER marker (34). Sec61 is

an essential ER translocation channel required for protein import to ER

and localizes to nuclear ER (nER) and cortical ER (cER). ER organization

as judged by Sec61-GFP fluorescence was assessed in cells treated with

0.8 mM carvacrol and in untreated cells. The control cells exhibited a clear

and well-defined ER distribution with nER surrounding the nucleus, cER

at the periphery of the cell adjacent to plasma membrane, and few

cytoplasmic ER tubes (Fig. 2A). However, in cells challenged with

carvacrol, the ER became fragmented, and the GFP signal was diffuse in

the cytoplasm. The nER structure was partially or completely disrupted in

some cells (Fig. 2B). Cells treated with carvacrol accumulated cytoplasmic

foci, likely representing collapsed ER (Fig. 2B). Taken together, these

observations indicate that carvacrol disrupts ER organization.

UPR pathway is required for carvacrol tolerance in the pathogenic

yeast C. albicans.

223

Carvacrol has been widely investigated for its antifungal activity mainly

against the pathogenic yeast C. albicans (9,–11). To check whether the

conserved eukaryotic UPR signaling pathway is also required for carvacrol

tolerance in C. albicans, sensitivity of ire1, mkc1 (Mkc1 is the ortholog of

Slt2), and bck1 homozygous mutants to carvacrol was assessed. Our data

revealed that all tested mutants had increased sensitivity to carvacrol

compared to their parental strains (Fig. 3). Consistent with the HCGP

assay in S. cerevisiae, these data demonstrate that C. albicans UPR is also

required for tolerance of carvacrol.

Genome-wide transcriptional profiling reveals that carvacrol induces

the unfolded protein response in C. albicans.

We undertook microarray transcriptional profiling to uncover cellular

responses to carvacrol. The C. albicans clinical strain SC5314 was treated

with 0.2 mM (MIC of carvacrol) carvacrol for 5 or 30 min. Using a

statistical significance analysis with an estimated FDR of 5%, in addition

to a 1.5-fold cutoff, 499 and 317 transcripts were differentially expressed

after 5 min and 30 min exposure to carvacrol, respectively (see Table S2 in

the supplemental material). GO term enrichment analysis of upregulated

transcripts demonstrated that carvacrol activates genes involved in

proteolysis, amino acid metabolism, phospholipid translocation, response

to oxidative stress, and DNA repair mechanisms (Fig. 4A and B; see also

Table S3 in the supplemental material). Transcripts related to GO terms

ribosome biogenesis, glycosylation, sugar transport, drug export, and

nuclear import were repressed. The carvacrol transcriptional signature in

C. albicans was reminiscent of the unfolded protein stress response

expressed in eukaryotic organisms (35, 36). In response to UPR inducers

such as DTT or tunicamycin, C. albicans and other fungi, including S.

cerevisiae, Aspergillus niger, and Aspergillus fumigatus, activate genes

224

involved in vesicle trafficking, protein folding, amino acid metabolism,

proteolysis, glycosylation, lipid metabolism, and cell wall biogenesis (35,

37,–39). All these UPR-associated GO terms are represented in our data

set (Fig. 4 and Table 2; see also Table S3 in the supplemental

material). In agreement with the HCGP assay, our data suggest that

carvacrol generates ER stress and induces UPR response in C. albicans.

In order to assess whether the UPR response uncovered here is specific to

carvacrol, the transcriptional profile of C. albicans cells challenged with

thymol, a monoterpene structurally related to carvacrol, was evaluated.

Thymol is a positional isomer of carvacrol and has a phenolic hydroxyl at a

different position on the phenolic ring. As shown in Fig. 4C, hierarchical

clustering distinguished clearly the transcriptional signature exhibited by

cells treated with carvacrol from that displayed by cells exposed to thymol

(see Table S2 in the supplemental material). We conclude that the

mechanism of action of carvacrol is different from that of thymol.

Carvacrol induces unconventional splicing of the transcription factor

Hac1.

Our data demonstrated that Ire1 and Hac1, key players of UPR signaling,

were required for fungal tolerance of carvacrol. This prompted us to assess

whether the UPR signaling pathway is activated following exposure to

carvacrol. The activation of the UPR was assayed by detecting the splicing

of HAC1 mRNA using RT-PCR (40). As shown in Fig. 5A, Candida cells

treated with carvacrol displayed UPR activation as evidenced by increased

splicing of HAC1 mRNA.

In contrast to what was previously reported with the UPR inducers

tunicamycin and DTT (37), the nonspliced form of HAC1 (nsHAC1)

predominated over the spliced form (sHAC1) following treatment with

225

carvacrol. Since the HAC1 mRNA splicing factor ire1 was one of the most

sensitive mutants to carvacrol, we wanted to check whether carvacrol itself

directly compromised Ire1 activity. Therefore, we assessed the splicing of

HAC1 mRNA in response to tunicamycin, a well-known UPR stressor,

alone or in combination with carvacrol. As shown in Fig. 5B, cells treated

with tunicamycin alone or in combination with carvacrol for 15 min were

able to splice the cryptic intron at the 3′ region of HAC1, suggesting that

Ire1 activity was not compromised by carvacrol. Interestingly, after 60 min,

cells treated with tunicamycin exhibited predominantly the unspliced form

of HAC1, possibly reflecting an adaptive response, while cells treated with

tunicamycin and carvacrol had exclusively the spliced form of HAC1. This

finding suggests that carvacrol exacerbates the effect of tunicamycin on

HAC1 splicing and sustained UPR signaling.

Synergistic interaction of carvacrol with ER stressors and

caspofungin.

Drug combination treatments are powerful strategies that have been used

to increase the efficacy and reduce the toxicity of preexisting single-drug

therapies. Synergistic action can result from complementary action of the

synergized drugs, which target different parts along the same biological

pathway or protein (41). A well-known example in anticancer therapy is

the combination of aplidin and cytarabine, which target the same apoptotic

pathway (42). In C. albicans, combination of the azole fluconazole with

either ketoconazole or terbinafine, each targeting the ergosterol

biosynthesis pathway, led to a synergistic antifungal activity (43). Here, we

wanted to test whether other well-known UPR inducers and ER stressors,

such as the reducing agent DTT and the N-linked glycosylation inhibitor

tunicamycin, potentiate the antifungal activity of carvacrol. As shown in

Table 3, combination of carvacrol with DTT or tunicamycin resulted in a

potent antifungal synergy in the C. albicans clinical strain SC5314, while

226

either compound alone had minor inhibitory effect. We also confirmed the

synergistic interaction of carvacrol with the antifungal fluconazole as

reported previously (12) and uncovered a potent synergism with the

echinocandin caspofungin (Table 3). However, carvacrol did not synergize

with the polyene antifungal amphotericin B.

227

Discussion

In the current investigation, we have used state-of-the-art chemogenomic

approaches to uncover the MoA of the monoterpene carvacrol in the

pathogenic yeast C. albicans. UPR is a cytoprotective response that is

engaged as a consequence of the accumulation of unfolded or misfolded

proteins following stress affecting the ER. Our chemical-genetic profiling

assay, supported by the transcriptional profiling data, led to the

hypothesis that carvacrol might target and compromise ER integrity and

perturb protein-folding capacity, which in turn activates the UPR pathway.

Cellular investigation of the ER demonstrated clearly that carvacrol

affected the integrity and the organization of nER and cER. In accordance

with this result, many S. cerevisiae mutants that exhibited defective ER

morphology or organization express a constitutive UPR response and

depend tightly on it for their survival (34). Thus, our results demonstrated

that carvacrol exerts its antifungal activity by disrupting ER integrity,

which in turn causes ER stress and leads to Ire1-mediated UPR to restore

protein-folding homeostasis in C. albicans. In our HCGP assay, deletion of

genes involved in different trafficking pathways such as ER-to-Golgi

(trs85), Golgi-to-ER (ypt6), and intra-Golgi transport (cog6) were also

required for carvacrol tolerance. This supposes that, in addition to ER,

carvacrol might target other intracellular vesicular trafficking. Another

possible explanation, and taking into consideration that ER is the main

cellular membrane source for many trafficking systems (44, 45), is that

disrupting ER by carvacrol might result in a collapse of the ER-dependent

cellular vesicle trafficking network.

While previous studies suggested that carvacrol exerts its antifungal

activity by disrupting calcium homeostasis (16), ergosterol biosynthesis

(14), and the plasma membrane (15), our HCGP and transcriptional

profiling results were not supportive of such MoAs. These presumed MoAs

228

might be an indirect consequence of ER stress triggered by carvacrol. In

fact, calcium in the cell is stored in the ER, and many studies report that

calcium homeostasis is significantly perturbed under UPR and ER stress

(46,–49). In fungi, the ER is also the site for the synthesis of ergosterol and

lipids as well as cell wall components (50). Thus, ER perturbations might

disturb many aspects of membrane biology, such as permeability and

ergosterol or other lipid content.

Mutants uncovered by the HCGP assay often reflect mechanisms that

buffer the impact of the target compromised by a bioactive compound (17).

Our HCGP assay showed that, in addition to UPR signaling mutants,

deletion of genes involved in tryptophan biosynthesis, including trp1, trp2,

trp3, trp4, aro1, and aro2, resulted in a hypersensitivity to carvacrol.

Interestingly, recent investigations showed that the monoterpene eugenol

interferes with aromatic amino acid uptake, including tryptophan in S.

cerevisiae (51). This suggests that, in addition to targeting ER, carvacrol

might also interfere with tryptophan uptake.

The newly revisited MoA of carvacrol uncovered in this study was exploited

to predict and validate complementary synergistic drug interactions with

other ER stressors and with well-known antifungals. Overall, our data

suggest that pharmacological perturbation of ER function results in

increased sensitivity to fluconazole and caspofungin. In agreement with

this, Epp et al. demonstrated that compromising ER function genetically

(mutation of the ARF protein, Age3) or pharmacologically (by brefeldin A,

an inhibitor of the retrograde Golgi-to-ER transport and UPR inducer)

resulted in a potentiation of the activity of many azoles as well as the

echinocandins against C. albicans and other human fungal pathogens (22).

Interestingly, our HAC1 splicing assay reflected synergistic interaction of

carvacrol and the UPR stressor, tunicamycin. Addition of the two

229

compounds caused complete splicing of the HAC1 mRNA, while treating

cells with each compound separately resulted in incomplete splicing.

Acknowledgments

We are grateful to Aaron Mitchel (Carnegie Mellon University) and

Christian Landry (IBIS, Université Laval) for providing mutants used in

this work. We thank J. C. Lévesque for technical assistance. M.B. is

grateful to A. Azzouzi for helping to set up the Medical Biology Unit at the

Faculty of Medicine and Pharmacy of Oujda.

This work was supported by the Faculty of Medicine, Université Laval, and

CHUQ Startup funding to A.S. J.C. received a Faculty of Medicine Ph.D.

scholarship (Université Laval). A.S. is supported by the Natural Sciences

and Engineering Research Council of Canada (NSERC) Discovery Grant

(06625). A.S. is a recipient of the Fonds de Recherche du Québec-Santé

(FRQS) J1 salary award. G.W.B. is supported by grants from the Canadian

Institutes of Health Research (MOP-84305 and MOP-79368).

230

References

1. Pfaller MA, Diekema DJ. 2007. Epidemiology of invasive candidiasis: a

persistent public health problem. Clin Microbiol Rev 20:133–163. doi:10.1128/CMR.00029-06.

2. Gudlaugsson O, Gillespie S, Lee K, Vande Berg J, Hu J, Messer S, Herwaldt L, Pfaller M, Diekema D. 2003. Attributable mortality of nosocomial candidemia, revisited. Clin Infect Dis 37:1172–1177.

doi:10.1086/378745.

3. Pappas PG, Kauffman CA, Andes D, Benjamin DK Jr, Calandra TF, Edwards JE Jr, Filler SG, Fisher JF, Kullberg BJ, Ostrosky-Zeichner L, Reboli AC, Rex JH, Walsh TJ, Sobel JD., Infectious Diseases Society of

America. 2009. Clinical practice guidelines for the management of candidiasis: 2009 update by the Infectious Diseases Society of America.

Clin Infect Dis 48:503–535. doi:10.1086/596757. 4. Shapiro RS, Robbins N, Cowen LE. 2011. Regulatory circuitry governing

fungal development, drug resistance, and disease. Microbiol Mol Biol Rev 75:213–267. doi:10.1128/MMBR.00045-10.

5. Perlin DS. 2007. Resistance to echinocandin-class antifungal drugs. Drug Resist Updat 10:121–130. doi:10.1016/j.drup.2007.04.002.

6. Akins RA. 2005. An update on antifungal targets and mechanisms of resistance in Candida albicans. Med Mycol 43:285–318.

doi:10.1080/13693780500138971. 7. Buchbauer G, Ilic A. 2013. Biological activities of selected mono- and

sesquiterpenes: possible uses in medicine, p 4109–4159. In Ramawat KG, Ḿerillon J-M. (ed), Natural products. Springer, Berlin, Germany.

8. Baser KH. 2008. Biological and pharmacological activities of carvacrol and carvacrol bearing essential oils. Curr Pharm Des 14:3106–3119.

doi:10.2174/138161208786404227.

9. Raut JS, Shinde RB, Chauhan NM, Karuppayil SM. 2013. Terpenoids of plant origin inhibit morphogenesis, adhesion, and biofilm formation by Candida albicans. Biofouling 29:87–96.

doi:10.1080/08927014.2012.749398. 10. Inouye S, Takahashi M, Abe S. 2009. Inhibitory activity of hydrosols,

herbal teas and related essential oils against filament formation and the

231

growth of Candida albicans. Nihon Ishinkin Gakkai Zasshi 50:243–251. doi:10.3314/jjmm.50.243.

11. Lima IO, de Oliveira Pereira F, de Oliveira WA, de Oliveira Lima E, Menezes EA, Cunha FA, de Fátima Formiga Melo Diniz M. 2013.

Antifungal activity and mode of action of carvacrol against Candida albicans strains. J Essential Oil Res 25:138–142.

doi:10.1080/10412905.2012.754728. 12. Doke SK, Raut JS, Dhawale S, Karuppayil SM. 2014. Sensitization of

Candida albicans biofilms to fluconazole by terpenoids of plant origin. J Gen Appl Microbiol 60:163–168. doi:10.2323/jgam.60.163.

13. Chami F, Chami N, Bennis S, Trouillas J, Remmal A. 2004. Evaluation of carvacrol and eugenol as prophylaxis and treatment of vaginal

candidiasis in an immunosuppressed rat model. J Antimicrob Chemother 54:909–914. doi:10.1093/jac/dkh436.

14. Ahmad A, Khan A, Akhtar F, Yousuf S, Xess I, Khan LA, Manzoor N. 2011. Fungicidal activity of thymol and carvacrol by disrupting ergosterol biosynthesis and membrane integrity against Candida. Eur J Clin

Microbiol Infect Dis 30:41–50. doi:10.1007/s10096-010-1050-8.

15. Chami N, Bennis S, Chami F, Aboussekhra A, Remmal A. 2005. Study of anticandidal activity of carvacrol and eugenol in vitro and in vivo. Oral Microbiol Immunol 20:106–111. doi:10.1111/j.1399-302X.2004.00202.x.

16. Rao A, Zhang Y, Muend S, Rao R. 2010. Mechanism of antifungal

activity of terpenoid phenols resembles calcium stress and inhibition of the TOR pathway. Antimicrob Agents Chemother 54:5062–5069. doi:10.1128/AAC.01050-10.

17. Ho CH, Piotrowski J, Dixon SJ, Baryshnikova A, Costanzo M, Boone C. 2011. Combining functional genomics and chemical biology to identify

targets of bioactive compounds. Curr Opin Chem Biol 15:66–78. doi:10.1016/j.cbpa.2010.10.023.

18. Parsons AB, Lopez A, Givoni IE, Williams DE, Gray CA, Porter J, Chua G, Sopko R, Brost RL, Ho CH, Wang J, Ketela T, Brenner C, Brill JA,

Fernandez GE, Lorenz TC, Payne GS, Ishihara S, Ohya Y, Andrews B, Hughes TR, Frey BJ, Graham TR, Andersen RJ, Boone C. 2006. Exploring

the mode-of-action of bioactive compounds by chemical-genetic profiling in yeast. Cell 126:611–625. doi:10.1016/j.cell.2006.06.040.

19. Hoepfner D, Helliwell SB, Sadlish H, Schuierer S, Filipuzzi I, Brachat S, Bhullar B, Plikat U, Abraham Y, Altorfer M, Aust T, Baeriswyl L, Cerino

232

R, Chang L, Estoppey D, Eichenberger J, Frederiksen M, Hartmann N, Hohendahl A, Knapp B, Krastel P, Melin N, Nigsch F, Oakeley EJ, Petitjean

V, Petersen F, Riedl R, Schmitt EK, Staedtler F, Studer C, Tallarico JA, Wetzel S, Fishman MC, Porter JA, Movva NR. 2014. High-resolution chemical dissection of a model eukaryote reveals targets, pathways and

gene functions. Microbiol Res 169:107–120. doi:10.1016/j.micres.2013.11.004.

20. Gillum AM, Tsay EY, Kirsch DR. 1984. Isolation of the Candida albicans gene for orotidine-5′-phosphate decarboxylase by

complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198:179–182. doi:10.1007/BF00328721.

21. Blankenship JR, Fanning S, Hamaker JJ, Mitchell AP. 2010. An extensive circuitry for cell wall regulation in Candida albicans. PLoS

Pathog 6:e1000752. doi:10.1371/journal.ppat.1000752. 22. Epp E, Vanier G, Harcus D, Lee AY, Jansen G, Hallett M, Sheppard

DC, Thomas DY, Munro CA, Mullick A, Whiteway M. 2010. Reverse genetics in Candida albicans predicts ARF cycling is essential for drug

resistance and virulence. PLoS Pathog 6:e1000753. doi:10.1371/journal.ppat.1000753.

23. Sellam A, Hogues H, Askew C, Tebbji F, van Het Hoog M, Lavoie H, Kumamoto CA, Whiteway M, Nantel A. 2010. Experimental annotation of

the human pathogen Candida albicans coding and noncoding transcribed regions using high-resolution tiling arrays. Genome Biol 11:R71. doi:10.1186/gb-2010-11-7-r71.

24. Nantel A, Rigby T, Hogues H, Whiteway M. 2006. Microarrays for studying pathogenicity in Candida Albicans, p 181–205. In Kavanagh K,

editor. (ed), Medical mycology: cellular and molecular techniques. John Wiley & Sons, Ltd., Chichester, UK.

25. Saito R, Smoot ME, Ono K, Ruscheinski J, Wang PL, Lotia S, Pico AR, Bader GD, Ideker T. 2012. A travel guide to Cytoscape plugins. Nat

Methods 9:1069–1076. doi:10.1038/nmeth.2212. 26. Maere S, Heymans K, Kuiper M. 2005. BiNGO: a Cytoscape plugin to

assess overrepresentation of gene ontology categories in biological networks. Bioinformatics 21:3448–3449.

doi:10.1093/bioinformatics/bti551. 27. Huh WK, Falvo JV, Gerke LC, Carroll AS, Howson RW, Weissman JS,

O'Shea EK. 2003. Global analysis of protein localization in budding yeast. Nature 425:686–691. doi:10.1038/nature02026.

233

28. Smith AM, Ammar R, Nislow C, Giaever G. 2010. A survey of yeast

genomic assays for drug and target discovery. Pharmacol Ther 127:156–164. doi:10.1016/j.pharmthera.2010.04.012.

29. Hetz C. 2012. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol 13:89–102.

doi:10.1038/nrm3270. 30. Chapman RE, Walter P. 1997. Translational attenuation mediated by

an mRNA intron. Curr Biol 7:850–859. doi:10.1016/S0960-9822(06)00373-3.

31. Kaufman RJ. 1999. Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and

translational controls. Genes Dev 13:1211–1233. doi:10.1101/gad.13.10.1211.

32. Chen Y, Feldman DE, Deng C, Brown JA, De Giacomo AF, Gaw AF, Shi G, Le QT, Brown JM, Koong AC. 2005. Identification of mitogen-activated protein kinase signaling pathways that confer resistance to endoplasmic

reticulum stress in Saccharomyces cerevisiae. Mol Cancer Res 3:669–677. doi:10.1158/1541-7786.MCR-05-0181.

33. Levin DE. 2011. Regulation of cell wall biogenesis in Saccharomyces cerevisiae: the cell wall integrity signaling pathway. Genetics 189:1145–

1175. doi:10.1534/genetics.111.128264.

34. Manford AG, Stefan CJ, Yuan HL, Macgurn JA, Emr SD. 2012. ER-to-plasma membrane tethering proteins regulate cell signaling and ER morphology. Dev Cell 23:1129–1140. doi:10.1016/j.devcel.2012.11.004.

35. Back SH, Schroder M, Lee K, Zhang K, Kaufman RJ. 2005. ER stress signaling by regulated splicing: IRE1/HAC1/XBP1. Methods 35:395–416.

doi:10.1016/j.ymeth.2005.03.001.

36. Arensdorf AM, Diedrichs D, Rutkowski DT. 2013. Regulation of the transcriptome by ER stress: non-canonical mechanisms and physiological consequences. Front Genet 4:256. doi:10.3389/fgene.2013.00256.

37. Wimalasena TT, Enjalbert B, Guillemette T, Plumridge A, Budge S, Yin

Z, Brown AJ, Archer DB. 2008. Impact of the unfolded protein response upon genome-wide expression patterns, and the role of Hac1 in the polarized growth, of Candida albicans. Fungal Genet Biol 45:1235–1247.

doi:10.1016/j.fgb.2008.06.001.

234

38. Guillemette T, van Peij N, Goosen T, Lanthaler K, Robson GD, van den Hondel CA, Stam H, Archer DB. 2007. Genomic analysis of the secretion

stress response in the enzyme-producing cell factory Aspergillus niger. BMC Genomics 8:158. doi:10.1186/1471-2164-8-158.

39. Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weissman JS, Walter P. 2000. Functional and genomic analyses reveal an essential coordination

between the unfolded protein response and ER-associated degradation. Cell 101:249–258. doi:10.1016/S0092-8674(00)80835-1.

40. Guillemette T, Ram AF, Carvalho ND, Joubert A, Simoneau P, Archer DB. 2011. Methods for investigating the UPR in filamentous fungi. Methods Enzymol 490:1–29. doi:10.1016/B978-0-12-385114-7.00001-5.

41. Sun X, Vilar S, Tatonetti NP. 2013. High-throughput methods for

combinatorial drug discovery. Sci Transl Med 5:205rv201. doi:10.1126/scitranslmed.3006667.

42. Humeniuk R, Menon LG, Mishra PJ, Saydam G, Longo-Sorbello GS, Elisseyeff Y, Lewis LD, Aracil M, Jimeno J, Bertino JR, Banerjee D. 2007. Aplidin synergizes with cytosine arabinoside: functional relevance of

mitochondria in Aplidin-induced cytotoxicity. Leukemia 21:2399–2405. doi:10.1038/sj.leu.2404911.

43. Spitzer M, Griffiths E, Blakely KM, Wildenhain J, Ejim L, Rossi L, De Pascale G, Curak J, Brown E, Tyers M, Wright GD. 2011. Cross-species

discovery of syncretic drug combinations that potentiate the antifungal fluconazole. Mol Syst Biol 7:499. doi:10.1038/msb.2011.31.

44. Viotti C, Kruger F, Krebs M, Neubert C, Fink F, Lupanga U, Scheuring D, Boutte Y, Frescatada-Rosa M, Wolfenstetter S, Sauer N, Hillmer S,

Grebe M, Schumacher K. 2013. The endoplasmic reticulum is the main membrane source for biogenesis of the lytic vacuole in Arabidopsis. Plant Cell 25:3434–3449. doi:10.1105/tpc.113.114827.

45. Mullins C. 2005. The biogenesis of cellular organelles. Springer, New

York, NY. 46. Zhang K, Kaufman RJ. 2004. Signaling the unfolded protein response

from the endoplasmic reticulum. J Biol Chem 279:25935–25938. doi:10.1074/jbc.R400008200.

47. Tessitore A, del P Martin M, Sano R, Ma Y, Mann L, Ingrassia A, Laywell ED, Steindler DA, Hendershot LM, d'Azzo A. 2004. GM1-

ganglioside-mediated activation of the unfolded protein response causes

235

neuronal death in a neurodegenerative gangliosidosis. Mol Cell 15:753–766. doi:10.1016/j.molcel.2004.08.029.

48. Torres M, Encina G, Soto C, Hetz C. 2011. Abnormal calcium homeostasis and protein folding stress at the ER: a common factor in

familial and infectious prion disorders. Commun Integr Biol 4:258–261. doi:10.4161/cib.4.3.15019.

49. Hoyer-Hansen M, Jaattela M. 2007. Connecting endoplasmic reticulum stress to autophagy by unfolded protein response and calcium. Cell Death

Differ 14:1576–1582. doi:10.1038/sj.cdd.4402200. 50. Parks LW, Casey WM. 1995. Physiological implications of sterol

biosynthesis in yeast. Annu Rev Microbiol 49:95–116. doi:10.1146/annurev.mi.49.100195.000523.

51. Darvishi E, Omidi M, Bushehri AA, Golshani A, Smith ML. 2013. The antifungal eugenol perturbs dual aromatic and branched-chain amino acid

permeases in the cytoplasmic membrane of yeast. PLoS One 8:e76028. doi:10.1371/journal.pone.0076028.

52. Merico D, Isserlin R, Stueker O, Emili A, Bader GD. 2010. Enrichment map: a network-based method for gene-set enrichment visualization and

interpretation. PLoS One 5:e13984. doi:10.1371/journal.pone.0013984.

236

Figures

Figure 1 - Chemical-genetic profiling using HCGP assay identified key

UPR regulators as required for carvacrol tolerance. (A) GO term

enrichment of carvacrol sensitive mutants. The P value was calculated

using the hypergeometric distribution. (B, C) Individual confirmations of

the chemical-genetic screen by spot serial dilution assay. A total of three

deletion mutants, the ire1, hac1, and aro2 mutants, were selected and

spotted on YPD with DMSO (control), YPD containing 0.8 mM or 1 mM

carvacrol (B) or 1.74 mM eugenol, 2.16 mM isopulegol, 2.22 mM l-(−)-

carvone (vol/vol), or 2.22 mM d-(+)-carvone (C). Plates were incubated at

30°C for 2 days.

237

Figure 2 - Carvacrol disrupts the morphology and the integrity of ER.

Sec61-GFP fusion was used as an ER marker. (A) Fluorescence

micrographs of Sec61 localization in control cells treated with DMSO.

Cortical (cER) and nuclear ERs (nER) are labeled. (B) Reorganization of

Sec61 localization in cells treated with 0.8 mM carvacrol. Bars, 4 μm.

238

Figure 3 - The UPR pathway is important for carvacrol tolerance in

the pathogenic yeast C. albicans. Growth assays of C. albicans bck1

(A), ire1 (B), and mkc1 (C) mutants and the WT strain SC5314 challenged

with 1 mM carvacrol. Cells were grown in YPD at 30°C, and OD595

readings were taken every 10 min. MIC values for each mutant and WT

strain are indicated.

239

Figure 4 - Genome-wide transcriptional profiling reveals that the

monoterpene carvacrol induces the UPR in C. albicans. GO analysis of

transcripts differentially regulated in C. albicans cells treated with

carvacrol for 5 min (A) or 30 min (B) using BiNGO software (26). Results

were charted using Cytoscape (25) and the Enrichment Map plug-in (52).

(C) Heat map and two-dimensional hierarchical clustering of the

transcriptional profiles of carvacrol- and thymol-treated cells. Upregulated

and downregulated genes are indicated by red and green, respectively.

Molecular structures of carvacrol and thymol are shown to emphasize the

unique difference, which is the position of the hydroxyl group.

240

Figure 5 - Carvacrol induces splicing of the transcription factor gene

HAC1 mRNA. (A) Effect of carvacrol on HAC1 mRNA splicing in WT C.

albicans. Cells were treated with carvacrol and at the indicated time

samples were harvested and splicing of HAC1 was assessed using RT-PCR.

nsHAC1, nonspliced HAC1; sHAC1, spliced HAC1. (B) Effect of

tunicamycin on HAC1 splicing in the presence or absence of carvacrol.

Cells were treated with tunicamycin (Tm) or with tunicamycin and

carvacrol (Tm + Crv) and sampled at the indicated times to asses HAC1

splicing. As a control, splicing of HAC1 mRNA was also monitored in

nontreated cells (Ctrl).

241

Table 1 - Chemical-genetic profiling of carvacrola

aIdentification by HCGP assay of gene deletion mutants that confer

sensitivity to carvacrol. Fitness defect scores were calculated based on bar

code microarray hybridization, and the top 22 sensitive deletion strains

sorted by Z-score are shown.

242

Table 2 - Different manually curated GO terms related to the unfolded

protein response and their associated transcripts that are activated in

response to carvacrol

243

Table 3 - Synergistic interaction of carvacrol with ER stressors and

the antifungals caspofungin and fluconazole

aCRV, carvacrol; FCZ, fluconazole; TNC, tunicamycin; DTT, dithiothreitol;

CSP, caspofungin; AmpB, amphotericin B.

bThe MIC values for the individual drugs in a combination are separated

by a slash.

244

Annexe 2 - pH-dependant antifungal activity of

valproic acid against the Human fungal pathogen

Candida albicans

Résumé

L’utilisation des antifongiques est limitée par leur toxicité, l’émergence des

résistances et par leur faible activité en milieu acide comme dans les

muqueuses vaginales. Dans cette étude, nous montrons que l’acide

valproïque (VPA), un médicament antipsychotique, a un fort effet

antifongique contre les souches sensibles et résistantes de Candida

albicans dans des conditions de pH similaires à ceux rencontrées dans le

vagin. Le VPA a également un effet sur les biofilms et atténue les

dommages causés aux cellules épithéliales vaginales par C. albicans. Nous

avons également montré une synergie entre le VPA et la terbinafine. Nous

avons réalisé un criblage chemogénomique pour identifier les processus

biologique à la base de la sensibilité au VPA et nous avons trouvé que les

gènes liés aux vacuoles sont requis pour la tolérance au VPA. La

microscopie confocale a révélé une altération des vacuoles, ce qui supporte

le modèle dans lequel les vacuoles contribuent à l’activité antifongique du

VPA. Cette étude suggère que le VPA pourrait être utilisé comme

antifongique contre les candidoses vaginales.

245

Article

pH-dependant antifungal activity of valproic acid against the human

fungal pathogen Candida albicans

Julien Chaillot1, Faiza Tebbji1, Carlos García1, Hugo Wurtele2,3, René

Pelletier4 and Adnane Sellam1,5*

Front Microbiol. 2017 Oct 9;8:1956. doi: 10.3389/fmicb.2017.01956.

eCollection 2017.

1Infectious Diseases Research Centre-CRI, Research Center of the CHU

de Québec, Université Laval, Quebec, QC, Canada

2Maisonneuve-Rosemont Hospital Research Center, Montreal, QC,

Canada

3Department of Medicine, Université de Montréal, Montreal, QC, Canada

4Medical Microbiology and Infectious Diseases, Research Center of the

CHU de Québec, Quebec, QC, Canada

5Department of Microbiology, Infectious Disease and Immunology,

Faculty of Medicine, University Laval, Quebec, QC, Canada

246

Abstract

Current antifungal drugs suffer from limitations including toxicity, the

emergence of resistance and decreased efficacy at low pH that are typical

of human vaginal surfaces. Here, we have shown that the antipsychotic

drug valproic acid (VPA) exhibited a strong antifungal activity against both

sensitive and resistant Candida albicans in pH condition similar to that

encountered in vagina. VPA exerted a strong anti-biofilm activity and

attenuated damage of vaginal epithelial cells caused by C. albicans. We

also showed that VPA synergizes with the allylamine antifungal,

Terbinafine. We undertook a chemogenetic screen to delineate biological

processes that underlies VPA-sensitivity in C. albicans and found that

vacuole-related genes were required to tolerate VPA. Confocal fluorescence

live-cell imaging revealed that VPA alters vacuole integrity and support a

model where alteration of vacuoles contributes to the antifungal activity.

Taken together, this study suggests that VPA could be used as an effective

antifungal against vulvovaginal candidiasis.

Keywords: Candida albicans, valproic acid, antifungal, vacuole,

vulvovaginal candidiasis

247

Introduction

Candida albicans is the major human fungal pathogens and also a

component of the normal human flora, colonizing primarily mucosal

surfaces, gastrointestinal and genitourinary tracts, and skin (Berman and

Sudbery, 2002). Although many infections involve unpleasant but non-life-

threatening colonization of various surface of mucosal membranes,

immunosuppressed patients can fall prey to serious mucosal infections,

such as oropharyngeal candidiasis in HIV patients and newborns, and

lethal systemic infections (Odds, 1987). C. albicans followed by C. glabrata

are natural components of the vaginal fungal microbiota and,

opportunistically, the leading causative agents of vulvovaginal candidiasis

(VVC). VVC affects 70–75% of childbearing women at least once, and 40–

50% of them will experience recurrence (Sobel, 2007).

Topical azoles-based antifungal formulations (e.g., fluconazole,

clotrimazole, miconazole, or butoconazole) such as vaginal suppositories,

tablets, and cream are widely used to treat VVC. However, their efficiency

is questioned especially for C. glabrata who is intrinsically resistant to

azoles. Furthermore, VVC are often caused by C. albicans azole-resistant

strains (Sobel, 2007; Marchaim et al., 2012). Importantly, antifungals used

for VVC treatments had to fulfill the constraint of remaining effective at

acidic pH (4–4.5), which is the normal pH of human vaginal surfaces.

Recent studies had proven that the acidic pH increases the minimal

inhibitory concentrations (MICs) of several antifungals including azoles,

amphothericin B, ciclopirox olamine, flucytosine, and caspofungin for C.

albicans (Danby et al., 2012). Pai and Jones reported a similar finding in

C. glabrata where MICs of triazoles were increased in pH 6 as compared to

pH 7.4 (Pai and Jones, 2004). Taken together, these data demonstrate that

in addition to the complications related to the acquired or the intrinsic-

resistance to conventional antifungals, reduction of antifungal potency at

248

acidic pH can further complicate the treatments of VVC. Due to the fact

that the antifungal discovery pipelines of pharmaceutical companies are

almost dry, there is an urgent need to identify novel low pH-effective

antifungal molecules for VVC therapeutic intervention.

Valproic acid (VPA), is a branched short-chain fatty acid well-known as a

class I/II histone deacetylase inhibitor (HDACi) (Gottlicher et al., 2001;

Phiel et al., 2001). VPA is widely prescribed as antipsychotic to treat

epilepsy, bipolar disorder, and uncontrolled seizures (Privitera et al.,

2006). The antifungal properties of VPA has been previously reported

against different opportunistic fungi causing infections of the central

nervous system (Galgoczy et al., 2012; Homa et al., 2015). Despite the

growing interest on VPA as antifungal, its precise mechanism of action

remains not clear. Recent investigations in the budding yeast

Saccharomyces cerevisiae have shown that VPA induces apoptosis and

inhibits both cell-cycle at the G1-S transition and the activation of the cell

wall integrity pathway, Stl2 MAP kinase (Mitsui et al., 2005; Desfosses-

Baron et al., 2016). VPA was also shown to cause inositol depletion which

in turn led to vacuolar ATPase perturbation (Ju and Greenberg, 2003;

Deranieh et al., 2015). In Schizosaccharomyce pombe, VPA acts as an

HDACi and disturbs different cellular processes including calcium

homeostasis, cell wall integrity, and membrane trafficking (Miyatake et al.,

2007; Zhang et al., 2013).

We have recently shown that low pH strongly potentiates VPA

antimicrobial activity against the model yeast S. cerevisiae (Desfosses-

Baron et al., 2016). Here, we investigated the in vitro susceptibility of both

planktonic and sessile cells of different sensitive and resistant clinical

isolates of the opportunistic yeast C. albicans to VPA using conditions

mimicking the vaginal environment. The effect of VPA on the ability of C.

albicans to cause damage to vaginal epithelial cells were investigated. Drug

249

synergy between VPA and 11 standard antifungal agents were also

explored. In attempt to gain insight into the mechanism of action

associated with the antifungal activity of VPA a genetic screen was

undertaken to uncover mutations conferring hypersensitivity to VPA.

250

Materials and methods

Fungal strains, media, and chemicals

The fungal clinical and laboratory strains used in this study are listed in

the Tables S1, S2, respectively. C. albicans and other yeast strains were

routinely maintained at 30°C on YPD (1% yeast extract, 2% peptone, 2%

dextrose, with 50 mg/ml uridine) or synthetic complete (SC; 0.67% yeast

nitrogen base with ammonium sulfate, 2.0% glucose, and 0.079%

complete supplement mixture) or RPMI (RPMI-1640 with 0.3 g/L-

glutamine) media. Acidic pHs used for VPA susceptibility were obtained

using hydrochloric acid.

Valproic acid (VPA; Sigma-P4543) was dissolved in sterile water (50

mg/ml). Standard antifungals used for VPA-synergy assessment are:

Fluconazole (FCZ; Sigma-F8929), Caspofungin (CSP; Sigma-SML0425),

Voriconazole (VCZ; Sigma-PZ0005), Amphothericin B (AMB; Sigma-A488),

Itraconazole (ITZ; Sigma-I6657), Clotrimazole (CTZ; Sigma-C6019),

Teroconazole (TCZ; Toronto Research Chemicals-T110600), Miconazole

(MCZ; Sigma-PHR1618), Terbinafine (TRB; Sigma-T8826), Nystatin (NST;

Sigma-N4014), and Micafungin (MCF; McKesson Canada-205666).

Antifungals were prepared using DMSO for Amphothericin B (30 mg/ml),

Fluconazole (300 mg/ml), Terbinafine (10 mg/ml), Clotrimazole (9 mg/ml),

Nystatine (5 mg/ml), Miconazole (30 mg/ml), Terconazole (1 mg/ml); water

for caspofungin (10 mg/ml), Voriconazole (10 mg/ml), Micafungin (10

mg/ml), and chloroform for Itraconazole (50 mg/ml).

VPA susceptibility and time-kill assays

251

The pH-dependant effect of VPA on C. albicans was evaluated as follows:

The reference clinical strain SC5314 was grown overnight in YPD medium

at 30°C in a shaking incubator. Cells were then resuspended in fresh SC

at an optical density at 595 nm (OD595nm) of 0.05. The pHs of SC media

were adjusted using sodium hydroxide or hydrochloric acid for alkaline

and acidic pHs, respectively. A total volume of 99 μl C. albicans cells was

added to each well of a flat-bottom 96-well plate in addition to 1 μl of the

corresponding stock solution of VPA. Plates were incubated in a Sunrise-

Tecan plate reader at 30°C with agitation and OD595nm readings were

taken every 10 min over 24 h. Experiments were performed in triplicate,

and average values were used for analysis. VPA effect on other fungal

species at acidic pH was performed in a similar fashion.

The Minimal Inhibitor Concentration (MIC) was determined following the

CLSI recommendations (CLSI, 2008). Briefly, 50 μl of VPA or standard

antifungals at two-fold the final concentration prepared in RPMI was

serially diluted in flat-bottom 96-well plates (Costar-Corning) and

combined with 50 μl of an-overnight culture of C. albicans and other

yeasts at 104 cell/ml. Plates were incubated at 30°C with shaking and

OD595nm readings were taken after 24 h using the Sunrise-Tecan plate

reader. The MIC was determined as the first well with growth reduction of

>10% based on OD595nm values in the presence of VPA or conventional

antifungals as compared to untreated control cells. Time-kill was

performed as described by Sanglard et al. (2003). Briefly, C. albicans

SC5314 strain cultures were grown in RPMI pH 4.5 at 30°C under shaking

in the presence of different concentration of VPA for defined time periods

(6, 24, and 48 h). Fractions of cultures were removed at each exposition

time and the colony forming units (CFU) counts were ensured by serial

dilution in YPD-agar.

Synergism assay

252

Evaluation of synergistic interactions between VPA and standard

antifungals was performed using RPMI-1640 medium buffered at pH 4.5.

Synergism was assessed by calculating the fractional inhibitory

concentration (FIC) index as described by Epp et al. (2010). The FIC index

was calculated as follows: (MIC of VPA in combination/MIC of VPA alone)

plus (MIC of a standard antifungal in combination/MIC of a standard

antifungal alone).

Biofilm formation and XTT reduction assay

Biofilm formation and XTT (2,3-bis(2-methoxy-4-nitro-5-sulfo- phenyl)-2H-

tetrazolium-5-carboxanilide) assays were carried out as previously

described by Askew et al. (2011). Overnight YPD cultures were washed

three times with PBS and resuspended in fresh RPMI supplemented with

L-glutamine (0.3 g/l) to an OD595nm of 1. C. albicans yeast cells were

allowed to adhere to the surface of 96-well polystyrene plate for 3 h at

37°C in a rocking incubator. Non-attached cells were washed from each

well three times with PBS and fresh RPMI supplemented with VPA was

added for 24 h at 37°C for biofilm formation. The plates were then washed

and fresh RPMI supplemented with 100 μl of XTT-menadione (0.5 mg/ml

XTT in PBS and 1 mM menadione in acetone) was added. After 3 h

incubation on the dark at 37°C, 80 μl of the resulting colored

supernatants were used for colorimetric reading (OD490nm) to assess

metabolic activity of biofilms. A minimum of four replicates were at least

performed.

Vaginal epithelial cell damage assay

Damage of vaginal epithelial cells was assessed using the lactate

dehydrogenase (LDH) cytoxicity detection kit (Sigma) based on the release

253

of LDH in the surrounding medium following the manufacturer's protocol.

VK2/E6E7 (ATCC- CRL-2616) vaginal epithelial cell line was grown on a

keratinocyte-serum free medium (supplemented with 0.1 ng/ml

recombinant epidermal growth factor and 50 μg/ml bovine pituitary

extract) as a monolayer to 95% confluency on a 96-well culture plate and

incubated at 37°C with 5% CO2. VK2/E6E7 cells were infected with 2 ×

104 of C. albicans SC5314 blastospores for 24 h. A total of 100 μl

supernatant was removed from each experiment and LDH activity in this

supernatant was determined by measuring the absorbance at 490 nm

(OD490nm). LDH activity were calculated as the mean of, at least, three

independent biological replicates.

Genetic screen for VPA-sensitive mutants

A total of 2371 mutants from the transcription factors (Homann et al.,

2009) (365 strains), transcriptional regulators (Vandeputte et al., 2012)

(509 strains), kinases (Blankenship et al., 2010) (165 strains), and

generalist collections (Noble et al., 2010) (1,332 strains) were screened for

VPA-sensitivity. These mutant libraries were obtained from the Fungal

Genetics Stock Center (FGSC). With the exception of the kinase collection

where genes were disrupted by transposon insertions, mutants of the other

collections were created through gene deletion of the complete ORF. In

most cases and for each gene, at least two independent transformants

were screened. Mutant strains were grown overnight in SC with pH 4.5 on

flat-bottom 96-well and were plated on SC-agar pH 4.5 medium with or

without VPA (50 μg/ml) using a 96-well blot-replicator. Mutants exhibiting

more than 2-fold growth reduction based on colony diameter were

compiled together in a 96-well plate and their sensitivity were confirmed to

different concentration of VPA (10, 50, and 100 μg/ml) following the same

procedure. Mutant strain with established VPA sensitivity were

individually reconfirmed by serial dilution spot assay. A complete listing of

254

VPA-sensitive mutants is shown in Table S3. The overrepresentation of

specific GO terms associated with the function of gene required for VPA

tolerance was determined with GO Term Finder using a hypergeometric

distribution with multiple hypothesis correction

(http://www.candidagenome.org/cgi-bin/GO/goTermFinder) (Inglis et al.,

2012). Descriptions related to gene function in Table S3 were extracted

from CGD (Candida Genome Database) database (Inglis et al., 2012).

Confocal microscopy and vacuole integrity

C. albicans vacuole integrity was assessed using the lipophilic vacuole

membrane dye MDY-64 (Molecular probes, Fisher Scientific) following the

manufacturer's recommended procedure. Briefly, cells were grown

overnight on RPMI liquid medium with pH 4.5 at 30°C. Cells were pelleted

and washed twice with fresh RPMI pH 4.5 and resuspended in the same

medium at an OD595 of 0.1. VPA was added at different concentrations

(10, 50, and 100 μg/ml). Cells were incubated for 2 h at 30°C under

agitation. Aliquots were taken from VPA-treated and non-treated cultures

and the MDY-64 was added at a final concentration of 10 μM. Cells were

incubated at room temperature for 3 min prior to confocal microscopy

visualization. Images were acquired with a 1.3-numerical-aperture (NA)

63x objective on a Leica DMI6000B inverted microscope connected to a

Hamamatsu C9100-13 camera.

Pan1-green fluorescent protein (GFP), End3-GFP and LIFEACT-GFP (Epp

et al., 2013) were visualized using confocal microscopy as follow: an

overnight culture was diluted in SC supplemented with 10 or 50 μg/ml

VPA to an OD595nm of 0.05 and grown for four generations at 30°C under

agitation. Cells were imaged as described for the vacuole staining

experiments.

255

Results

Antifungal activity of VPA is pH-dependant

Antifungal activity of VPA on C. albicans was evaluated by monitoring

OD595nm of cultures exposed for 24 h to increased concentration of VPA

in SC media at different pHs. VPA exerted an inhibitory effect that was

exaggerated in acidic pH (Figure1A). Antifungal activity of VPA was also

assessed in other clinically relevant Candida species including C. glabrata,

C. tropicalis, C. parapsilosis, and C. krusei in addition to the yeast S.

cerevisiae. The obtained data demonstrates that VPA inhibited the growth

of all tested fungal species, with C. albicans exhibiting higher sensitivity at

elevated VPA concentrations (>216 μg/ml) (Figure1B). Thus, VPA is a

potent antifungal compound against C. albicans at acidic pH.

To test whether VPA had fungistatic or fungicidal activity on C. albicans at

acidic pH, time-kill curve assays were performed. Two high concentrations

of VPA which correspond to 125x (1,000 μg/ml) and 375x (3,000 μg/ml) of

the MIC for the C. albicans reference strain SC5314 (Table1) were tested.

VPA exhibited a concentration-independent fungistatic activity (Figure1C).

Lower VPA concentrations ranging from 7.8 (MIC for the SC5314 strain)

and 500 μg/ml were also tested and the obtained results demonstrates a

similar fungistatic activity (result not shown).

Antifungal activity of VPA against azole- and echinocandin-resistant

strains

Since VPA was highly potent against C. albicans, we wanted to test

whether its antifungal activity can be expanded to other clinically sensitive

and resistant strains of this yeast. Several azole-resistant strains with

different resistant mechanisms, were selected (Table S1) in addition to

256

echinocandin-resistant isolates. A total of four sensitive and 11 resistant

strains (six azole- and five echinocandin-resistant strains) were examined

using broth microdilution assay as specified by CLSI at both neutral or

acidic pHs. The sensitivity of C. albicans isolates to VPA was pH-dependant

and MICs ranged from 3.5 to 15.6 μg/ml for both resistant and susceptible

strains (Table1). The range of MICs was also similar when comparing

azole-resistant and echinocandin-resistant clinical strains separately (3.5–

15.6 μg/ml). Overall, these results demonstrate that VPA may be of use to

tackle therapeutic limitations related to acquired clinical resistance of C.

albicans. Furthermore, comparable VPA-sensitivity in susceptible and

resistant strains indicates that the mechanisms that confer resistance to

azoles and echinocandins are distinct from those that may cause VPA

resistance.

Valproic acid attenuate damage of vaginal epithelial cells caused by C.

albicans

To verify whether VPA exerts protective antifungal activity during host cell

invasion, interaction of C. albicans with the human epithelial vaginal cell

line VK2/E6E7 were performed as described in the method section. C.

albicans-mediated damage of VK2/E6E7 cells were quantified based on the

LDH release. Two different concentrations of VPA (7.8 and 78 μg/ml)

corresponding to the MIC and 10x MIC for C. albicans SC5314 strain were

used. In accordance with our in vitro data, the VPA had no significant

protective effect at pH 7 (Figure 2). At pH 5, 7.8, and 78 μg/ml of VPA

prevented 55 and 100% of VK2/E6E7 damage, respectively, as compared

to the control. Intermediate protective activity was perceived at pH 6 where

28 and 52% damage reduction was obtained with 7.8 and 78 μg/ml of

VPA, respectively. In support of in vitro data, these results demonstrate

that VPA confers a protective antifungal activity during the invasion of

vaginal epithelial cells.

257

VPA acts synergistically with terbinafine in both susceptible and

resistant strains

Different standard antifungals used against C. albicans and other human

fungal pathogens were screened to identify drugs that could potentiate the

anti-Candida activity of VPA. Interactions of VPA with other 11 antifungal

agents including azoles (Fluconazole, Voriconazole, Itraconazole,

clotrimazole, Terconazole, and Miconazole), polyenes (Amphothericin B and

Nystatin), echinocandins (Caspofungin and Micafungin), and the

allylamine, Terbinafine were tested. Based on the appreciation of the FIC

index in the clinical strain SC5314, VPA was found to exhibit an apparent

synergistic interaction with terbinafine (Table2; FIC index < 0.5). VPA-

terbinafine combinations were also synergistic in azole and echinocandin

resistant clinical strains (Table2).

VPA inhibits biofilm formation in both susceptible and resistant

strains

The effect of VPA on biofilm formation was evaluated using the metabolic

colorimetric assay based on the reduction of XTT at acidic and neutral

pHs. At neutral pH, no VPA anti-biofilm activity was noticed of all tested

concentrations for the C. albicans SC5314 reference strain (not shown). In

contrast, at pH 4.5, biofilm inhibition was apparent at 1.44 μg/ml of VPA

with ~5% of inhibition as compared to the control (Figure 3). The MIC of

VPA on the SC5314 strain was evaluated at 7.2 μg/ml. The effect of VPA

on biofilm formation was also tested in two azole-resistant strains (S2 and

F5) with different resistance mechanisms in addition to two echinocandin-

resistant isolates (DPL-1008 and DPL-1010). As for the SC5314 sensitive

strain, the four resistant strains exhibited a clear reduction in metabolic

activity at 1.44 μg/ml of VPA (Figure 3). The MIC values for the azole-

258

resistant strains were similar (2.88 μg/ml VPA) and slightly decreased as

compared to the SC5314 susceptible strain. The two echinocandin-

resistant strains DPL-1008 and DPL-1010 were highly sensitive to VPA as

compared to other strains and their MIC was noticed at 1.44 μg/ml of

VPA. These results demonstrate that, in addition to its antifungal activity

on planktonic cells, VPA is also active on sessile forms of C. albicans at

acidic pH.

Mutants defective in vacuolar functions are hypersensitive to VPA

To gain insight into the mechanism of action of VPA associated with its

antifungal property, a comprehensive regulatory and generalist mutant

collections of C. albicans were screened for their sensitivity to VPA. Among

the 947 unique mutants that were screened, 55 were confirmed to be

hypersensitive to VPA (Table S3). To identify the functional categories that

are associated with mutations affecting VPA susceptibility, we performed

gene ontology (GO) enrichment analysis. Our data demonstrated that VPA

sensitive mutants are defective in genes related primarily to vacuole

transport (p = 1.72e-08) and organization (p = 8.86e-09) (Table 3, Table S4).

This include mutants of vacuolar protein sorting (vps15, vps34, vps64,

and ypt72), proteins associated with the retromer complex (pep7 and

pep8), and proteins required for vacuole inheritance, and organization

(cla4, pep12, vam6, vps41, and pep12). Requirement of vacuolar functions

for VPA tolerance was also reported previously in S. pombe (Zhang et al.,

2013) and S. cerevisiae (Deranieh et al., 2015) where genome-wide screens

demonstrated that retromer complex and vacuolar ATPases, respectively,

were associated with VPA sensitivity. Taken together, our chemogenetic

screen provides a rational for mechanistic investigation into the effect of

VPA on fungal vacuole.

VPA alters vacuole morphology

259

Our chemogenetic screen demonstrated clearly that C. albicans sensitivity

to VPA were exaggerated in mutant of vacuolar transport, organization and

inheritance. The requirement of intact vacuolar pathways for VPA

tolerance suggests that VPA might alters the function and/or the integrity

of the vacuole. To verify this hypothesis, the integrity of C. albicans

vacuoles were assessed using the vacuole membrane marker, MDY-64, in

cells treated or not with different concentrations of VPA at pH 4.5. A

dominant fraction of non-treated cells internalized the MDY-64 dye and

exhibited well-structured vacuoles with two to four compartments

comprising discernable lumens (Figure 4A). However, cells treated with

either 10 or 50 μg/ml of VPA displayed an altered vacuole structure with a

foamy fluorescence pattern and indistinguishable lumens (Figure 4B).

These findings suggest that VPA affect the morphology and the integrity of

vacuoles in C. albicans.

VPA-induced vacuolar phenotypes are not a consequence of

endocytosis, actin filaments perturbations, or inositol depletion

Perturbation of vacuoles by VPA might be either a direct consequence

where VPA act in situ on vacuole or by impacting indirectly other process

required for proper vacuole biogenesis and organization. Indeed, vacuolar

integrity and homeostasis depends on the proper functioning of different

cellular processes including actin filaments organization (Eitzen et al.,

2002), endocytosis (Michaillat and Mayer, 2013), and the

phosphatidylinositol phosphate signaling (Michell et al., 2006). Recent

work by Deranieh et al. (2015) indicated that VPA led to cellular depletion

of inositol, which disrupts the vacuolar phosphoinositide, PI(3,5)P2

(Phosphatidylinositol 3,5-bisphosphate) homeostasis and consequently

compromise vacuole morphology. In this regard, we checked whether VPA-

mediated vacuole alteration can be bypassed by inositol supplementation

260

or deprivation. Our data demonstrate that the altered vacuole phenotype

was not influenced by lack or excess of inositol (data not shown),

suggesting that the probable VPA-induced inositol depletion in C. albicans

is unlikely to account for the toxicity of this compound under our

conditions.

To check whether the vacuole alteration caused by VPA is related to a

defect in endocytosis or actin filament organization, we have used a Pan1-

and End3-GFP fusions as clathrin-coated vesicles markers, and LIFEACT-

GFP (Epp et al., 2013) to monitor actin patches and cables. VPA treatment

did not cause any apparent alteration of the organization of actin filaments

or endocytic vesicles (Figure S1). Taken together, these results support

that the direct alteration of vacuole is the cellular mechanism underlying

the antifungal activity of VPA.

261

Discussion

Candida pathogenic species are adapted to survive in different acidic

environments inside their host such as the vagina, inflammatory foci like

abscesses (Park et al., 2012) and phagolysosomes of neutrophils and

macrophages (Erwig and Gow, 2016). In such acidic condition, several

studies demonstrated that the in vitro activity of standard antifungals is

compromised as evidenced by the increase of their MICs (Marr et al., 1999;

Pai and Jones, 2004; Danby et al., 2012). In the current study, we

demonstrated that the antifungal activity of the VPA, a histone deacetylase

inhibitor and the widely prescribed as antipsychotic, is potentiated at

acidic pH that resemble to that of host niches cited above. We also

demonstrated that VPA potentiates the antifungal activity of the widely

prescribed terbinafine at acidic pH. In this regard, VPA, alone or with

terbinafine, may be useful against fungal vaginosis caused primarily by C.

albicans. VPA was also found to be effective against both echinocandin-

and azole-resistant strains suggesting that this molecule represents an

alternative solution to circumvent VVC or recurrent VVC caused by C.

albicans strains that are resistant to standard antifungals. In the current

study, VPA were also potent against C. albicans biofilm in a similar fashion

as for planktonic cells and for both sensitive and clinical resistant strains.

As for vaginal bacterial pathogens, C. albicans is able to form infective

biotic biofilms on the vaginal mucosal surfaces (Harriott et al., 2010). Due

to the fact that biofilm growth is impervious to all conventional

antifungals, and since efficiency of these drugs is compromised at acidic

pH, VPA may represent thus a promising alternative for antibiofilm

therapy.

Importantly, this work supports a direct clinical repurposing of VPA as an

antifungal against VVC or recurrent VVC due to the fact that its safety

262

profile has been extensively characterized in vivo over the past decades of

its clinical use in systemic forms as anticonvulsant (Lagace et al., 2004) or

anticancer (Gupta et al., 2013). VPA had also a broad therapeutic safety

margin when used topically (Choi et al., 2013). It does not cause skin

irritations such as erythema and edema and had no toxicity to different

human cells including keratinocytes, fibroblasts, and mast cells (Choi et

al., 2013). In the current work, we also find that VPA did not impair the

growth and the integrity of the vaginal epithelial cells VK2/E6E7 as judged

by the LDH cytotoxicity assay (Figure S2). While a whole animal vaginal

model is required to confirm that VPA does not cause vaginal irritations,

the aforementioned studies are supportive of a safe use of VPA topically

against VVC.

It is intriguing that the antifungal activity of VPA was acidic pH-

dependant. This could be explained by the chemical nature of VPA, which

is an eight-carbon branched-chain acid with proprieties of weak acid (pKa

4.8). Low pH is expected to decrease its ionization state and increase its

liposolubility, which in turn may facilitate the passage through the plasma

membrane and its accumulation in the cells. Future structure-guided

medicinal chemistry approach by introducing structural changes in VPA

that can lead to beneficial biological activity in a pH-independent manner

will allow expanding the potential use of this molecules form VVC and

recurrent VVC to treat oral C. albicans infections and even systemic

candidiasis.

In the current study, we undertook a chemogenetic screen to delineated

biological process that underlies VPA-sensitivity in C. albicans. This screen

enables the identification of different vacuole-related functions as being

required to tolerate VPA and provide thus a rational to examine the effect

of this molecule on fungal vacuole. Our data demonstrates clearly that VPA

antifungal activity is a consequence of the impairment of vacuole integrity

263

and illuminate thus a previously unappreciated mechanism of action of

this drug. Recent work in S. cerevisiae indicates that cellular depletion of

inositol by VPA disrupts the vacuolar phosphoinositide, PI3,5P2

homeostasis which compromise the function of V-ATPase activity and

proton pumping (Deranieh et al., 2015). This V-ATPase phenotype was

rescued by supplementing the growth medium by inositol. Despite the

requirement of V-ATPases to tolerate VPA in S. cerevisiae, the authors did

not report any alteration of the vacuolar morphology by VPA as seen in our

investigation. Furthermore, the vacuole defects in C. albicans were not

recovered by adding inositol to the growth medium suggesting that VPA

may act via a different mechanism in this pathogenic yeast. Similarly, in S.

pombe, genetic screens revealed that mutant of genes operating in Golgi-

endosome membrane trafficking and vacuole retromer complex were

hypersensitive to VPA (Miyatake et al., 2007; Ma et al., 2010; Zhang et al.,

2013), however, no apparent alteration of vacuole was seen in this yeast

model.

Regardless of the exact vacuolar process that is targeted by VPA, our study

reinforces the fact that pharmacological perturbation of vacuole leads to

fungal growth inhibition and is protective for host cells. Different C.

albicans vacuolar proteins has been previously characterized and linked to

the ability to infect the host and to control different virulence traits

including biofilm formation, filamentation, and resistance to antifungals.

This include for instance vacuolar membrane and cytosolic V-ATPases

(Vma2, Vma3, and Vph1) (Patenaude et al., 2013; Rane et al., 2013, 2014),

proteins mediating vesicular trafficking to the vacuole (Pep12, Vps11, and

Vps21) (Palmer et al., 2005; Johnston et al., 2009; Palanisamy et al., 2010;

Wachtler et al., 2011) and the vacuolar calcium channel, Yvc1 (Wang et al.,

2011). This makes the vacuole an ideal therapeutic target to manage

fungal infections. However, the functional resemblance of fungal vacuoles

with their human counterpart organelle, lysosomes, raises uncertainty

264

regarding their druggability. Indeed, while the two V-ATPase inhibitors

bafilomycin A1 and concanamycin A from Streptomyces, exhibit a potent

activity against C. albicans they also compromise the activity of the

mammalian V-ATPases (Olsen, 2014). Meanwhile, the fungal vacuoles had

distinctive proteins such as the V0-ATPase subunit with no apparent

human homologs that could be specifically targeted for pharmacological

interventions in the treatment of fungal infections. In this regard, we

demonstrate that VPA had no cytotoxicity on vaginal epithelial cells at

concentrations above 10 times the MIC of C. albicans suggesting that VPA-

mediated vacuole alteration is fungus-specific (Figure S2).

In conclusion, we have shown that VPA is a potent antifungal at acidic pH

and consequently an attractive therapeutic molecule against vulvovaginal

candidiasis. We have also described an unreported effect of VPA on the

structural integrity of fungal vacuoles which might be the main cause of its

cytotoxicity.

265

References

Askew, C., Sellam, A., Epp, E., Mallick, J., Hogues, H., Mullick, A., et al.

(2011). The zinc cluster transcription factor Ahr1p directs Mcm1p regulation of Candida albicans adhesion. Mol. Microbiol. 79, 940–953. doi: 10.1111/j.1365-2958.2010.07504.x

Berman, J., and Sudbery, P. E. (2002). Candida albicans: a molecular

revolution built on lessons from budding yeast. Nat. Rev. Genet. 3, 918–930. doi: 10.1038/nrg948

Blankenship, J. R., Fanning, S., Hamaker, J. J., and Mitchell, A. P. (2010). An extensive circuitry for cell wall regulation in Candida albicans. PLoS Pathog. 6:e1000752. doi: 10.1371/journal.ppat.1000752

Choi, S. Y., Seop, S. Y., Hyun, M. Y., Yoo, K. H., Kim, B. J., Kim, M. N., et

al. (2013). Safety evaluation of topical valproate application. Toxicol. Res. 29, 87–90. doi: 10.5487/TR.2013.29.2.087

Clinical and Laboratory Standards Institute (2008). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts, Approved

Standard M27-A3, 3rd Edn. Approved Standard M27-A3 (Wayne, PA: CLSI).

Danby, C. S., Boikov, D., Rautemaa-Richardson, R., and Sobel, J. D. (2012). Effect of pH on in vitro susceptibility of Candida glabrata and Candida albicans to 11 antifungal agents and implications for clinical use.

Antimicrob. Agents Chemother. 56, 1403–1406. doi: 10.1128/AAC.05025-11

Deranieh, R. M., Shi, Y., Tarsio, M., Chen, Y., McCaffery, J. M., Kane, P. M., et al. (2015). Perturbation of the Vacuolar ATPase: A NOVEL

CONSEQUENCE OF INOSITOL DEPLETION. J. Biol. Chem. 290, 27460–27472. doi: 10.1074/jbc.M115.683706

Desfosses-Baron, K., Hammond-Martel, I., Simoneau, A., Sellam, A., Roberts, S., and Wurtele, H. (2016). Valproate inhibits MAP kinase

signalling and cell cycle progression in S. cerevisiae. Sci. Rep. 6:36013. doi: 10.1038/srep36013

Eitzen, G., Wang, L., Thorngren, N., and Wickner, W. (2002). Remodeling of organelle-bound actin is required for yeast vacuole fusion. J. Cell Biol.

158, 669–679. doi: 10.1083/jcb.200204089

266

Epp, E., Nazarova, E., Regan, H., Douglas, L. M., Konopka, J. B., Vogel, J., et al. (2013). Clathrin- and Arp2/3-independent endocytosis in the fungal

pathogen Candida albicans. MBio 4:e00476–e00413. doi: 10.1128/mBio.00476-13

Epp, E., Vanier, G., Harcus, D., Lee, A. Y., Jansen, G., Hallett, M., et al. (2010). Reverse genetics in Candida albicans predicts ARF cycling is

essential for drug resistance and virulence. PLoS Pathog. 6:e1000753. doi: 10.1371/journal.ppat.1000753

Erwig, L. P., and Gow, N. A. (2016). Interactions of fungal pathogens with phagocytes. Nat. Rev. Microbiol. 14, 163–176. doi: 10.1038/nrmicro.2015.21

Galgoczy, L., Toth, L., Viragh, M., Papp, T., and Vagvolgyi, C. S. (2012). In

vitro interactions of amantadine hydrochloride, R-(-)-deprenyl hydrochloride and valproic acid sodium salt with antifungal agents against filamentous fungal species causing central nervous system infection. Acta

Biol. Hung. 63, 490–500. doi: 10.1556/ABiol.63.2012.4.8 Gottlicher, M., Minucci, S., Zhu, P., Kramer, O. H., Schimpf, A., Giavara,

S., et al. (2001). Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. EMBO J. 20, 6969–6978. doi:

10.1093/emboj/20.24.6969 Gupta, S. C., Sung, B., Prasad, S., Webb, L. J., and Aggarwal, B. B. (2013).

Cancer drug discovery by repurposing: teaching new tricks to old dogs. Trends Pharmacol. Sci. 34, 508–517. doi: 10.1016/j.tips.2013.06.005

Harriott, M. M., Lilly, E. A., Rodriguez, T. E., Fidel, P. L. Jr., and Noverr, M. C. (2010). Candida albicans forms biofilms on the vaginal mucosa.

Microbiology 156, 3635–3644. doi: 10.1099/mic.0.039354-0 Homa, M., Galgoczy, L., Toth, E., Toth, L., Papp, T., Chandrasekaran, M.,

et al. (2015). In vitro antifungal activity of antipsychotic drugs and their combinations with conventional antifungals against Scedosporium and

Pseudallescheria isolates. Med. Mycol. 53, 890–895. doi: 10.1093/mmy/myv064

Homann, O. R., Dea, J., Noble, S. M., and Johnson, A. D. (2009). A phenotypic profile of the Candida albicans regulatory network. PLoS

Genet. 5:e1000783. doi: 10.1371/journal.pgen.1000783 Inglis, D. O., Arnaud, M. B., Binkley, J., Shah, P., Skrzypek, M. S.,

Wymore, F., et al. (2012). The Candida genome database incorporates multiple Candida species: multispecies search and analysis tools with

267

curated gene and protein information for Candida albicans and Candida glabrata. Nucleic Acids Res. 40, D667–D674. doi: 10.1093/nar/gkr945

Johnston, D. A., Eberle, K. E., Sturtevant, J. E., and Palmer, G. E. (2009). Role for endosomal and vacuolar GTPases in Candida albicans

pathogenesis. Infect. Immun. 77, 2343–2355. doi: 10.1128/IAI.01458-08

Ju, S., and Greenberg, M. L. (2003). Valproate disrupts regulation of inositol responsive genes and alters regulation of phospholipid biosynthesis. Mol. Microbiol. 49, 1595–1603. doi: 10.1046/j.1365-

2958.2003.03641.x Lagace, D. C., O'brien, W. T., Gurvich, N., Nachtigal, M. W., and Klein, P.

S. (2004). Valproic acid: how it works. Or not. Clin. Neurosci. Res. 4, 215–225. doi: 10.1016/j.cnr.2004.09.013

Ma, Y., Sugiura, R., Zhang, L., Zhou, X., Takeuchi, M., He, Y., et al. (2010). Isolation of a fission yeast mutant that is sensitive to valproic acid and

defective in the gene encoding Ric1, a putative component of Ypt/Rab-specific GEF for Ryh1 GTPase. Mol. Genet. Genomics 284, 161–171. doi: 10.1007/s00438-010-0550-7

Marchaim, D., Lemanek, L., Bheemreddy, S., Kaye, K. S., and Sobel, J. D.

(2012). Fluconazole-resistant Candida albicans vulvovaginitis. Obstet. Gynecol. 120, 1407–1414. doi: 10.1097/AOG.0b013e31827307b2

Marr, K. A., Rustad, T. R., Rex, J. H., and White, T. C. (1999). The trailing end point phenotype in antifungal susceptibility testing is pH dependent.

Antimicrob. Agents Chemother. 43, 1383–1386. Michaillat, L., and Mayer, A. (2013). Identification of genes affecting

vacuole membrane fragmentation in Saccharomyces cerevisiae. PLoS ONE 8:e54160. doi: 10.1371/journal.pone.0054160

Michell, R. H., Heath, V. L., Lemmon, M. A., and Dove, S. K. (2006). Phosphatidylinositol 3,5-bisphosphate: metabolism and cellular functions.

Trends Biochem. Sci. 31, 52–63. doi: 10.1016/j.tibs.2005.11.013 Mitsui, K., Nakagawa, D., Nakamura, M., Okamoto, T., and Tsurugi, K.

(2005). Valproic acid induces apoptosis dependent of Yca1p at concentrations that mildly affect the proliferation of yeast. FEBS Lett. 579,

723–727. doi: 10.1016/j.febslet.2004.12.051 Miyatake, M., Kuno, T., Kita, A., Katsura, K., Takegawa, K., Uno, S., et al.

(2007). Valproic acid affects membrane trafficking and cell-wall integrity in fission yeast. Genetics 175, 1695–1705. doi: 10.1534/genetics.107.070946

268

Noble, S. M., French, S., Kohn, L. A., Chen, V., and Johnson, A. D. (2010).

Systematic screens of a Candida albicans homozygous deletion library decouple morphogenetic switching and pathogenicity. Nat. Genet. 42, 590–598. doi: 10.1038/ng.605

Odds, F. C. (1987). Candida infections: an overview. Crit. Rev. Microbiol.

15, 1–5. doi: 10.3109/10408418709104444 Olsen, I. (2014). Attenuation of Candida albicans virulence with focus on

disruption of its vacuole functions. J. Oral Microbiol. 6:10.3402/jom.v6.23898. doi: 10.3402/jom.v6.23898

Pai, M. P., and Jones, A. L. (2004). Altered susceptibility of Candida glabrata bloodstream isolates to triazoles at clinically relevant pH values:

comparison of the NCCLS M27-A2, sensititre yeastone, and etest methods. Antimicrob. Agents Chemother. 48, 4441–4443. doi: 10.1128/AAC.48.11.4441-4443.2004

Palanisamy, S. K., Ramirez, M. A., Lorenz, M., and Lee, S. A. (2010). Candida albicans PEP12 is required for biofilm integrity and in vivo

virulence. Eukaryot. Cell 9, 266–277. doi: 10.1128/EC.00295-09

Palmer, G. E., Kelly, M. N., and Sturtevant, J. E. (2005). The Candida albicans vacuole is required for differentiation and efficient macrophage killing. Eukaryot. Cell 4, 1677–1686. doi: 10.1128/EC.4.10.1677-

1686.2005

Park, S. Y., Bae, D. J., Kim, M. J., Piao, M. L., and Kim, I. S. (2012). Extracellular low pH modulates phosphatidylserine-dependent phagocytosis in macrophages by increasing stabilin-1 expression. J. Biol.

Chem. 287, 11261–11271. doi: 10.1074/jbc.M111.310953 Patenaude, C., Zhang, Y., Cormack, B., Kohler, J., and Rao, R. (2013).

Essential role for vacuolar acidification in Candida albicans virulence. J. Biol. Chem. 288, 26256–26264. doi: 10.1074/jbc.M113.494815

Phiel, C. J., Zhang, F., Huang, E. Y., Guenther, M. G., Lazar, M. A., and Klein, P. S. (2001). Histone deacetylase is a direct target of valproic acid, a

potent anticonvulsant, mood stabilizer, and teratogen. J. Biol. Chem. 276, 36734–36741. doi: 10.1074/jbc.M101287200

Privitera, M. D., Welty, T. E., Ficker, D. M., Kaplan, M. J., Szaflarski, J. P., and Cavitt, J. (2006). Clinician's Guide to Antiepileptic Drug Use.

Philadelphia, PA: Lippincott Williams & Wilkins.

269

Rane, H. S., Bernardo, S. M., Hayek, S. R., Binder, J. L., Parra, K. J., and Lee, S. A. (2014). The contribution of Candida albicans vacuolar ATPase

subunit V(1)B, encoded by VMA2, to stress response, autophagy, and virulence is independent of environmental pH. Eukaryot. Cell 13, 1207–1221. doi: 10.1128/EC.00135-14

Rane, H. S., Bernardo, S. M., Raines, S. M., Binder, J. L., Parra, K. J., and

Lee, S. A. (2013). Candida albicans VMA3 is necessary for V-ATPase assembly and function and contributes to secretion and filamentation. Eukaryot. Cell 12, 1369–1382. doi: 10.1128/EC.00118-13

Sanglard, D., Ischer, F., Marchetti, O., Entenza, J., and Bille, J. (2003). Calcineurin A of Candida albicans: involvement in antifungal tolerance,

cell morphogenesis and virulence. Mol. Microbiol. 48, 959–976. doi: 10.1046/j.1365-2958.2003.03495.x

Sobel, J. D. (2007). Vulvovaginal candidosis. Lancet 369, 1961–1971. doi: 10.1016/S0140-6736(07)60917-9

Vandeputte, P., Pradervand, S., Ischer, F., Coste, A. T., Ferrari, S., Harshman, K., et al. (2012). Identification and functional characterization

of Rca1, a transcription factor involved in both antifungal susceptibility and host response in Candida albicans. Eukaryot. Cell 11, 916–931. doi:

10.1128/EC.00134-12 Wachtler, B., Wilson, D., Haedicke, K., Dalle, F., and Hube, B. (2011).

From attachment to damage: defined genes of Candida albicans mediate adhesion, invasion and damage during interaction with oral epithelial

cells. PLoS ONE 6:e17046. doi: 10.1371/journal.pone.0017046 Wang, H., Liang, Y., Zhang, B., Zheng, W., Xing, L., and Li, M. (2011).

Alkaline stress triggers an immediate calcium fluctuation in Candida albicans mediated by Rim101p and Crz1p transcription factors. FEMS Yeast Res. 11, 430–439. doi: 10.1111/j.1567-1364.2011.00730.x

Zhang, L., Ma, N., Liu, Q., and Ma, Y. (2013). Genome-wide screening for

genes associated with valproic acid sensitivity in fission yeast. PLoS ONE 8:e68738. doi: 10.1371/journal.pone.0068738

270

Figures

Figure 1 - In vitro antifungal activity of valproic acid is pH-

dependant. (A) Effect of different pHs on antifungal activity of VPA. The C.

albicans SC5314 strain was grown in SC medium with different pH (4.5–8)

supplemented with different concentration of VPA. SC5314 strain was

grown at 30°C and OD595nm reading was taken after 24 h of incubation.

ODs measurement for each VPA concentration is the mean of triplicate. (B)

VPA inhibit the growth of non-albicans Candida species. C. glabrata, C.

parapsilosis, C. tropicalis, C. krusei in addition to S. cerevisiae were grown

in SC medium pH 4.5 with different concentration of VPA. OD595nm

reading was taken after 24 h of incubation at 30°C under agitation. (C)

Time-kill curve demonstrating the fungistatic activity of VPA. C. albicans

SC5314 strain was exposed to two different concentrations (1,000 and

3,000 μg/ml) at different times (6, 24, and 48). CFUs were calculated as

described in the method section.

271

Figure 2 - Valproic acid attenuate damage of vaginal epithelial cells

caused by C. albicans. Damage of human epithelial vaginal cell line

VK2/E6E7 infected by C. albicans SC5314 strain was assessed using LDH

release assay. For each pH, cell damage was calculated as percentage of

LDH activity of VPA-treated experiment relatively to that of the control

experiment (C. albicans invading VK2/E6E7 cells in the absence of VPA).

Results are the mean of three independent replicates.

272

Figure 3 - Anti-biofilm activity of valproic acid. The effect of VPA on

biofilm formation was evaluated using the metabolic colorimetric assay

based on the reduction of XTT at pH4. Sensitive (SC5314) and azole- (S2

and F5), and echinocandin-resistant (DPL-1008 and DPL-1010) C. albicans

strains were tested. Results represent growth inhibition (%) and are the

mean of at least three independent replicates.

273

Figure 4 - Valproic acid alters vacuolar morphology. C. albicans

SC5314 strains was grown in RPMI pH 4.5 in the absence (A) or presence

of 50 μg/ml of VPA (B) and stained for 3 min with the vacuole membrane

marker, MDY-64. Cells were visualized using confocal microscopy. The

white arrows indicate representatively intact vacuole lumens. Fluorescence

PMT gain were increased five times for VPA-treated cells due to low

incorporation of MDY-64. Bars, 8 μm.

274

Table 1 - In vitro activity of valproic acid (MIC) on C. albicans

antifungal sensitive and resistant strains.

275

Table 2 - Synergistic interaction of valproic acid with the allylamine

antifungal, terbinafine on sensitive, and azole- and echinocandin-

resistant strains.

276

Table 3 - Gene function and biological process associated with VPA-

sensitivity.

Gene ontology analysis was performed using GO Term Finder.

aThe p-value was calculated using hypergeometric distribution, as

described on the GO Term Finder website (Inglis et al., 2012).

277

References

Brachmann, C.B., Davies, A., Cost, G.J., Caputo, E., Li, J., Hieter, P., and

Boeke, J.D.(1998). Designer deletion strains derived from Saccharomyces

cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated

gene disruption and other applications. Yeast 14, 115-132.

Dunkel, N., Blass, J., Rogers, P.D., and Morschhauser, J. (2008a).

Mutations in the multi-drug resistance regulator MRR1, followed by loss of

heterozygosity, are the main cause of MDR1 overexpression in fluconazole-

resistant Candida albicans strains. Mol Microbiol 69, 827-840.

Dunkel, N., Liu, T.T., Barker, K.S., Homayouni, R., Morschhauser, J., and

Rogers, P.D. (2008b). A gain-of-function mutation in the transcription

factor Upc2p causes upregulation of ergosterol biosynthesis genes and

increased fluconazole resistance in a clinical Candida albicans isolate.

Eukaryot Cell 7, 1180-1190.

Espinel-Ingroff, A., Kish, C.W., Jr., Kerkering, T.M., Fromtling, R.A.,

Bartizal, K., Galgiani, J.N., Villareal, K., Pfaller, M.A., Gerarden, T.,

Rinaldi, M.G., and Et Al. (1992). Collaborative comparison of broth

macrodilution and microdilution antifungal susceptibility tests. J Clin

Microbiol 30, 3138-3145.

Fonzi, W.A., and Irwin, M.Y. (1993). Isogenic strain construction and gene

mapping in Candida albicans. Genetics 134, 717-728.

Franz, R., Kelly, S.L., Lamb, D.C., Kelly, D.E., Ruhnke, M., and

Morschhauser, J. (1998). Multiple molecular mechanisms contribute to a

stepwise development of fluconazole resistance in clinical Candida albicans

strains. Antimicrob Agents Chemother 42, 3065-3072.

278

Franz, R., Ruhnke, M., and Morschhauser, J. (1999). Molecular aspects of

fluconazole resistance development in Candida albicans. Mycoses 42, 453-

458.

Jimenez-Ortigosa, C., Paderu, P., Motyl, M.R., and Perlin, D.S. (2014).

Enfumafungin derivative MK-3118 shows increased in vitro potency

against clinical echinocandin-resistant Candida Species and Aspergillus

species isolates. Antimicrob Agents Chemother 58, 1248-1251.

Morschhauser, J., Barker, K.S., Liu, T.T., Bla, B.W.J., Homayouni, R., and

Rogers, P.D. (2007). The transcription factor Mrr1p controls expression of

the MDR1 efflux pump and mediates multidrug resistance in Candida

albicans. PLoSPathog 3, e164.

Rudek, W. (1978). Esterase activity in Candida species. J Clin Microbiol 8,

756-759.

Saidane, S., Weber, S., De Deken, X., St-Germain, G., and Raymond, M.

(2006). PDR16-

mediated azole resistance in Candida albicans. Mol Microbiol 60, 1546-

1562.

Documents

Étude de l'homéostasie de la taille chez la levure opportuniste … · 2019-07-12 · Figure 18 - Expression de RNR1 e t PCL2 en fo nction de la taille 1 59 Figure 19 - Intéraction