Triiodothyronine regulates distribution of thyroid hormonereceptors by activating AMP-activated protein kinase in 3T3-L1adipocytes and induces uncoupling protein-1 expression

Cheng-Zhi Wang • Dan Wei • Mei-Ping Guan •

Yao-Ming Xue

Received: 20 December 2013 / Accepted: 12 April 2014

� Springer Science+Business Media New York 2014

Abstract The purposes of this study were to examine

whether thermogenesis in 3T3-L1 adipocytes is related to

variations in thyroid hormone receptors (TRs) that are

differently regulated by triiodothyronine (T3), and the

possible role of AMP-activated protein (AMPK) in ther-

mogenesis after cell differentiation. Differentiated 3T3-L1

adipocytes were maintained under four conditions: normal

control group, T3 treatment group, AMPK agonist (5-amino-

imidazole-4-carboxamide-1-b-D-ribofuranoside) treatment

group, and T3 and AMPK inhibitor (Compound C) treat-

ment group. Real-time polymerase chain reaction was then

performed to evaluate the changes in TRa and TRb mRNA

levels in the cells, as well as marker genes for brown adipose

tissue including uncoupling protein (UCP)-1 and Cidea.

Western blotting was carried out for the cells to detect the

expressions of TRa, TRb, and AMPK protein levels. After

T3 treatment, the mRNA and protein levels of TRadecreased compared with the control group, while TRbmRNA and protein levels increased markedly at the same

time. We also found elevated mRNA levels of UCP-1 and

Cidea after exposure to T3. However, the distribution of TRs

was reversed by Compound C. AMPK protein levels were

clearly activated by T3. Our results suggest that the distri-

bution of TRs is related to thermogenesis, and AMPK may

participate in the alterations.

Keywords Adipocytes � AMP-activated protein kinase �Brown adipose tissue � Thyroid hormone receptor �Triiodothyronine � Uncoupling protein-1

Introduction

Thyroid hormone 3,5,3-triiodothyronine (T3) is required

for the normal function of nearly all tissues. It has been

found to play a significant role in thermogenesis and

maintenance of lipid homeostasis [1, 2], and therefore has

attracted attention for its role in obesity-related diseases.

The effects of T3 are explained by the interaction of thy-

roid hormone receptors (TRs) with thyroid hormone

response elements (TREs) within nuclear genes [3, 4]. TRs

are nuclear receptors encoded by two genes, TRa and TRb[5]. Both of them are expressed in white adipose tissue

(WAT) and brown adipose tissue (BAT). An increasing

number of studies have focused on their roles in metabolic

regulation in adipocytes.

Previous research has shown that both TRa and TRb are

expressed in Ob17 preadipocytes, with a predominance of

TRa. In spite of its low expression level, TRb might

maintain a basal responsiveness to thyroid hormone in

adipocytes [6]. Jiang [7] has clarified that TRa is closely

related to lipid accumulation in 3T3-L1 cells, by regulating

the expression of lipogenic enzymes. In that research, TRaexpression was increased at the time of conversion from

the intermediate to the late stage of differentiation, which is

coincident with the accumulation of lipid droplets. This

suggests a prominent role of TRa isoform in the generation

and maintenance of the adipocyte phenotype. The expres-

sion of uncoupling protein (UCP)-1, which is responsible

for the thermogenic role of BAT, with low expression in

WAT, can be directly induced by T3 [8, 9]. Lee [10] has

demonstrated that the effects of T3 on UCP-1 induction

were dependent on TRb by siRNA interference of the

receptor in human adipocytes. These findings suggest that

the roles of these two TR isoforms may be different, or

even opposite, in adipose tissue.

C.-Z. Wang � D. Wei � M.-P. Guan � Y.-M. Xue (&)

Department of Endocrinology & Metabolism, Nanfang Hospital,

Southern Medical University, Guangzhou 510515, Guangdong,

China

e-mail: xueyaoming999@126.com

123

Mol Cell Biochem

DOI 10.1007/s11010-014-2067-6

AMP-activated protein kinase (AMPK) is a highly

conserved eukaryotic protein that acts as a cellular energy

sensor [11–13]. Recent studies have suggested that it is a

major energy sensor and regulator in adipose tissues [14].

In animal experiments, researchers have found that AMPK

participates in UCP-1 induction in BAT [15].

However, the effects of thyroid hormones on TR gene

expression remain elusive. Whether AMPK takes part in

the regulation of TRs and thermogenesis by T3 in adipo-

cytes has not been demonstrated. In the present study, we

detected variations in TRa and TRb isoforms in 3T3-L1

adipocytes after T3 treatment. Our observations suggest

that the two main TR isoforms, TRa and TRb, are

adversely regulated by physiological dose of T3, and the

increased expression of TRb is related to thermogenesis in

adipocytes, accompanied by decreased expression of TRa.

The mechanism of these effects is likely to be via T3-

activated AMPK.

Methods

Cell culture and differentiation

The mouse 3T3-L1 preadipocytes were obtained from the

type culture collection of the Chinese Academy of Sciences

(Shanghai, China), and were grown at 37 �C in Dulbecco’s

Modified Eagle’s Medium (DMEM) supplemented with

10 % fetal bovine serum (FBS; Gibco, Carlsbad, CA,

USA), 100 U/mL penicillin, and 100 lg/mL streptomycin

in 6-well plates. Two days after cell confluence (Day 0),

differentiation was initiated with 10 lg/mL insulin,

0.25 lM dexamethasone (DEX), and 0.5 mM isobutylm-

ethylxanthine (IBMX) in DMEM containing 10 % FBS.

After incubation for 2 days (Day 2), the culture media were

replaced with DMEM supplemented with 10 % FBS and

10 lg/mL insulin, and the cells were fed every 2 days with

DMEM containing 10 % FBS. 3T3-L1 cells were fully

differentiated by Day 8. Subsequently, cells were treated

for 24 h as follows: DMEM (control group), DMEM

containing 5 nM T3 (Sigma, St. Louis, MO, USA), DMEM

containing 1 mM 5-aminoimidazole-4-carboxamide-1b-D-

ribofuranoside (AICAR), DMEM containing both T3

(5 nM), and Compound C (10 lM). After incubation, total

RNA and proteins were extracted from adipocytes as

described below. The inhibitor Compound C was added 2 h

before incubation.

Oil Red O staining

3T3-L1 cells were grown on 6-well plates and induced to

differentiate as described above. After incubation for

8 days (Day 8), plates were washed three times with

phosphate-buffered saline and fixed with 4 % formalde-

hyde for 5 min at room temperature. The medium was

replaced with fresh fixing solution, and the cells were

incubated for at least 1 h. After fixation, cells were stained

with a filtered Oil Red O solution (0.5 g) in 100 mL iso-

propanol for 15 min at room temperature. Cells were

washed twice with distilled water and visualized under a

microscope.

Quantitative real-time polymerase chain reaction (PCR)

Total RNA was extracted from cells using TRIzol reagent

(Takara, Dalian, China) in accordance with the manufac-

turer’s instructions. Reverse transcription reactions were

carried out using 1 lg total RNA and PrimeScript RT

reagent kit (Takara). Quantitative real-time PCR (qPCR)

was performed on the Master cycler ep realplex real-time

PCR system using the SYBR Green qPCR kit (Takara) and

gene-specific primers as follows. Identities of the PCR

products were confirmed using an ABI 7500 sequencer

(Applied Biosystems, Foster City, CA, USA). The mRNA

expression levels are presented as a ratio compared with a

control in each experiment. Relative quantification was

performed according to the comparative 2-DDCt method as

described previously [16]. Primers for real-time PCR are

shown in Table 1.

Western blot analysis

Immunoprecipitated samples were detected by western

blotting. Protein samples were boiled (5 min, 95 �C),

separated on SDS-PAGE, and transferred onto polyvinyli-

dene difluoride membranes. Membranes were blocked for

1 h in 5 % bovine serum albumin (BSA) in TBST (20 mM

Tris–HCl, pH 7.6, 150 mM NaCl, and 0.1 % Tween 20).

Primary antibodies to AMPK (Cell Signaling Technology,

Table 1 Primers for real-time PCR

Gene Primer sequence Association no.

TRa 50CTGACCTCCGCATGATCGG30 NC_000077.6

50GGTGGGGCACTCGACTTTC30

TRb 50CCAGAGGTACACGAAGTGTGC30 NC_000080.6

50AGGTTTCCAGGGTAACTACAGG30

UCP1 50AGGCTTCCAGTACCATTAGGT30 NC_000074.6

50CTGAGTGAGGCAAAGCTGATTT30

AMPK 50GGGATCCATCAGCAACTATCG30 NC_000081.6

50GGGAGGTCACGGATGAGG30

Cidea 50TGACATTCATGGGATTGCAGAC30 NM_007702.2

50GGCCAGTTGTGATGACTAAGAC30

b-actin 50GGCTGTATTCCCCTCCATCG30 NC_000071.6

50CCAGTTGGTAACAATGCCATGT30

Mol Cell Biochem

123

Danvers, MA, USA), p-AMPK, TRa, and TRb (Enogene

Biotech, Nanjing, China) were diluted in TBST containing

5 % BSA, and then applied to the membranes overnight at

4 �C at a dilution of 1:1,000. After being washed three

times with TBST, membranes were incubated with horse-

radish-peroxidase-conjugated secondary antibodies for 1 h.

The membranes were washed three times with TBST. The

membrane blots were developed with Chemiluminescence

ECL Plus-Western Blotting detection reagents (Amersham

Biosciences, Piscataway, NJ, USA).

Statistical analysis

Data given in the text are expressed as mean ± standard

deviation of at least three independent experiments. The

immunoblots were analyzed by measuring the density of

each band using densitometric analysis with the Image J

software from the National Institutes of Health (Bethesda,

MD, USA). Each western blot reproduced here are typical

of at least three separate experiments. Statistical analysis

was performed using one-way analysis of variance

(ANOVA), factorial design ANOVA, and independent-

samples t test. Data analyses were done using SPSS version

13.0. P \ 0.05 was considered statistically significant.

Results

Cell differentiation and Oil Red O staining

Figure 1a shows 3T3-L1 cells prior to differentiation. In

the presence of the differentiation cocktail (insulin, DEX,

and IBMX), cells differentiated from preadipocytes into

adipocytes that had the morphology of mature adipocytes

(Fig. 1b, c). These droplets became more evident with the

Oil Red O staining, and the lipids stained red (Fig. 1c).

UCP-1 expression induced by T3

To determine the effect of T3 on UCP-1 induction, dif-

ferent doses of T3 were given to the mature adipocytes

(Fig. 2). Reverse-transcriptase PCR (RT-PCR) was per-

formed to quantify the mRNA expression of UCP-1. As the

doses ascended, UCP-1 expression increased from 5 nM

and began to fall at 50 nM. The peak value occurred at

5 nM (P \ 0.05, 5 nM vs. 0 nM).

Variation of TRs after T3 treatment

The variations in TR mRNA expression and protein

expression after T3 treatment are shown in Fig. 3. After

8 days differentiation, the mature adipocytes received a dose

of 5 nM T3 for 24 h. Cells that received DMEM without T3

treatment were used as the control group. Figure 3a shows

that TRa mRNA expression decreased after T3 treatment

compared with the control group (P \ 0.05; 5 nM T3 vs.

Fig. 1 Differentiation of 3T3-L1 cells. a Undifferentiated cells. b Cells after 8 days of differentiation. c Cells stained with Oil Red after 8 days

differentiation. (Color figure online)

Fig. 2 UCP-1 induction by T3. Different doses of T3 were given to

the mature adipocytes for 24 h. RT-PCR was then carried out using

RNA from the cells. The relative mRNA expression of UCP-1 was

detected. Differences were examined by one-way ANOVA.

*P \ 0.05

Mol Cell Biochem

123

control group). Figure 3b shows that TRb mRNA expression

increased at the same time (P \ 0.05; 5 nM T3 vs. control

group). The protein expressions are shown in Fig. 3c (TRa)

and Fig. 3d (P \ 0.05; 5 nM T3 vs. control group), and the

variation of TRs is in accordance with the mRNA level.

Effects of thermogenic gene expression after T3

treatment

We also detected mRNA expression for a series of ther-

mogenic genes under the same conditions as above (mature

adipocytes received a dose of 5 nM T3 for 24 h): UCP-1

and Cidea. Figure 4a shows that expression of UCP-1 in

the experimental group was almost twice as high in the

control group (P \ 0.05; 5 nM T3 vs. control group). Ci-

dea expression was higher compared with that in the con-

trol group (Fig. 4b; P \ 0.05).

T3 treatment activates AMPK

To investigate the AMPK protein expression level after T3

treatment, we carried out western blotting using AMPK

Fig. 3 Variation in TRs after

T3 treatment. a TRa mRNA

relative expression. b TRbmRNA relative expression.

After 8 days differentiation,

3T3-L1 cells were grown to

mature adipocytes. c TRaprotein expression. d TRbprotein expression. The cells

were given a dose of 5 nM T3

and incubated for 24 h. Relative

expression of TRa and TRbmRNA was detected in both the

control and experimental

groups. Differences were

examined by Student’s t test.

*P \ 0.05. The immunoblots

were analyzed by measuring the

density of each band using

densitometric analysis with the

Image J software (c, d)

Fig. 4 Thermogenic gene

expression after T3 treatment.

Cells were treated as previously.

a Relative mRNA expression of

UCP1. b Relative mRNA of

Cidea. Expression of Cidea in

the experimental group was

almost 1.5 times higher than in

the control group. Differences

were examined by Student’s

t test. *P \ 0.05

Mol Cell Biochem

123

and p-AMPK antibodies. The mature adipocytes were

treated with 5 nM T3, AMPK agonist AICAR, or 5 nM T3

with AMPK inhibitor Compound C for 24 h. The control

group was treated with DMEM alone. Figure 5 shows that

a substantial amount of p-AMPK was detected for cells

treated with T3, while it was hardly detected in cells treated

with T3 and Compound C. Total AMPK level was equal in

the four groups.

Effect of AMPK on alteration of TRs and thermogenic

gene expression

AMPK was activated by T3; therefore, we investigated

mRNA levels for TR and thermogenic gene expression

after activation and suppression of AMPK. Figure 6a

shows that TRa expression was lower when cells were

treated with AICAR compared with 5 nM T3, while its

expression increased when cells were treated with T3 and

Compound C (P \ 0.05 vs. control group; P \ 0.05 vs.

5 nM T3). We also found that TRb mRNA expression was

elevated by T3 and AICAR (Fig. 4b; P \ 0.05 vs. control

group), and the ascending trend was reversed by Com-

pound C (P \ 0.05 vs. 5 nM T3). Figure 6c, d shows that

mRNA expression for UCP-1 and Cidea genes increased

markedly (P \ 0.05 vs. control group). After treatment

with T3 and Compound C, the expression was lower than

in the T3 treatment group; however, it was still higher than

in the control group.

Discussion

The present study provided evidence that T3 alters

expression of TRs, namely decreased expression of TRawith a simultaneous increase in TRb expression. The

opposing trends in the expression of these two main

receptors after T3 stimulation is in line with the changes of

thermogenesis in adipocytes.

It has been reported previously that TRa is the pre-

dominant isoform in adipocytes, while expression of TRbis low [6]. We confirmed that expression of TRb was low

(Ct value [30 in RT-PCR, data not shown). Based on the

previous findings about the close relationship between TRaand energy storage, we hypothesized that TRb may con-

tribute to thermogenesis. By examining the effect of T3 on

the expression of TRa and TRb, we demonstrated that the

physiological dose of T3 lowers the expression of TRa but

promotes expression of TRb. This suggests that the

increase in TRb is of relevance to the thermogenic genes

UCP-1 and Cidea.

UCP-1 is localized to the inner mitochondrial membrane

and acts to uncouple oxidative phosphorylation from ATP

production, thereby releasing energy as heat (termed ther-

mogenesis). It is highly expressed in BAT, while its

expression is comparatively low in WAT [17–19]. Based

on these findings, UCP-1 is regarded as the marker gene of

BAT, and UCP-1 and Cidea function in thermogenesis. In

recent years, many scientists have devoted themselves to

the new strategy of turning WAT into BAT to find a new

target for obesity studies [20]. Hernandez et al. [21] tested

the T3 effect on stimulation of UCP-1 mRNA in primary

cultures of brown adipocytes.

In the present study, we intended to go further to seek

the underlying mechanism of the reverse changes in TR

expression and the related genes. Thus, we detected the

protein levels of p-AMPK and total AMPK. We found

substantial levels of p-AMPK in cells treated with T3 and

AMPK agonist AICAR. For cells treated with both T3 and

AMPK inhibitor Compound C, the p-AMPK level clearly

decreased more than in the control group. The total AMPK

level in the four groups was similar. Based on these find-

ings, we assumed that AMPK may be the downstream

regulator of T3.

To understand the function of TRs in adipose tissue,

some researchers have performed experiments in adipo-

cytes and have found that adipogenesis is differentially

impaired by TR mutant isoforms [22, 23]. It has been

demonstrated previously that TRa expression is highly

related to adipogenic genes [7]; therefore, the present study

Fig. 5 Western blotting for AMPK expression. Groups from left to

right were as follows: control group, 5 nM T3 group, AICAR group,

T3 and Compound C group. For protein levels, expressions of

p-AMPK, AMPK, and b-actin are from top to bottom. The histogram

shows the analyzed p-AMPK level for at least three separate

experiments. *P \ 0.05 vs. control group, #P \ 0.05 vs. T3 group

Mol Cell Biochem

123

aimed to establish the relationship between TRb and these

thermogenic genes.

It has been found that TH can make changes in thyroid

hormone receptor (TR) expression in the 3T3-L1 adipo-

cytes at the physiological dose [24]. Previous studies sug-

gest that UCP-1 is primarily dependent on TRb, while the

normal sympathetic response of brown adipocytes requires

TRa, and point out that type 2 iodothyronine deiodinase

(D2) is an essential component in the thyroid-sympathetic

synergism required for thermal homeostasis in small

mammals [25]. Recent research came to a conclusion that

T3 increases the adrenergic stimulation of UCP-1 and D2

expression mostly via the TRb1 isoform, and in brown

adipocytes, D2 is protected from degradation by the action

of T3 on TRb1 [26].

AMP-activated protein kinase (AMPK) is a metabolic

fuel gage conserved along the evolutionary scale in

eukaryotes that senses changes in the intracellular AMP/

ATP ratio. In general, activation of AMPK acts to maintain

cellular energy stores, switching on catabolic pathways that

produce ATP, mostly by enhancing oxidative metabolism

and mitochondrial biogenesis, while switching off anabolic

pathways that consume ATP [12, 27]. Previous research

claimed that AMPK participated in the induction of UCP-1

[15]. Based on this, we also tested that whether AMPK

played a role in the process that T3 altered the expression

of TRs. By RT-PCR and western blot, we found that T3

could activate AMPK, and after treatment of AMPK

agonist as well as T3 with AMPK inhibitor, the variation

trend of TRs is more obvious.

Based on the findings of the present study, we suggest

that there is a proportion of TRa and TRb in adipocytes. T3

can regulate the proportion by an increase of TRbexpression to induce thermogenesis via the activation of

AMPK. As the expression of these two isoforms in adi-

pocytes has been known to be distinctly imbalanced,

whether a physiological dose of T3 could sustain the bal-

ance of energy storage and thermogenesis remains elusive.

As obesity has become a significant threat to human

health, many oral drugs such as sibutramine and orlistat

have been introduced for therapy of obesity; however, they

were soon withdrawn because of their cardiovascular and

liver side effects [28, 29]. To date, we still do not have

sufficient data to prove that surgery benefits obese patients

in the long term [30]. There are many AMPK agonists,

such as metformin, and some of these have already been

used to treat diabetes and related diseases [31, 32]. Our

present study gives new insight into the possible mecha-

nism of these drugs in their potential against obesity. T3 is

a traditional hormone in the regulation of lipid and energy,

and may have more therapeutic potential in the near future.

In summary, the present study demonstrated that phys-

iological doses of T3 can lower expression of TRa, and

promote it of TRb. At a physiological dose, T3 decreases

TRa and increases TRb expression, and expression of the

thermogenic genes also increases. Our study provides

Fig. 6 Expression of genes in

3T3-L1 adipocytes after

treatment with AMPK agonist

(AICAR) and inhibitor

(Compound C). After 8 days

differentiation, 3T3-L1 cells

were grown to mature

adipocytes. Cells were treated

with 5 nM T3, AMPK agonist

AICAR (1 mM), or 5 nM T3

and AMPK inhibitor Compound

C (10 lM). Inhibitor was added

2 h before incubation. a TRamRNA expression. b TRbmRNA expression. c UCP-1

mRNA expression. d Cidea

mRNA expression. Differences

were examined by one-way

ANOVA. *P \ 0.05 vs. control

group, #P \ 0.05 vs. T3 group

Mol Cell Biochem

123

evidence that activated AMPK participates in this alter-

ation of TRs.

Acknowledgments The authors thank Prof. W. B. Xie (School of

Basic Medical Sciences, Southern Medical University) for helpful

advice for this study, and we are also grateful to Prof. J. Xu (School of

Foreign Studies, Southern Medical University) for revision of this

manuscript.

References

1. Zhu XG, Cheng SY (2010) New insights into regulation of lipid

metabolism by thyroid hormone. Curr Opin Endocrinol Diabetes

Obes 17:408–413. doi:10.1097/med

2. Laurberg P, Andersen S, Karmisholt J (2005) Cold adaptation and

thyroid hormone metabolism. Horm Metab Res 37:545–549.

doi:10.1055/s-2005-870420

3. Pontikides N, Krassas GE (2007) Basic endocrine products of

adipose tissue in states of thyroid dysfunction. Thyroid

17:421–431. doi:10.1089/thy.2007.0016

4. Yen PM (2001) Physiological and molecular basis of thyroid

hormone action. Physiol Rev 81:1097–1142

5. Viguerie N, Langin D (2003) Effect of thyroid hormone on gene

expression. Curr Opin Clin Nutr Metab Care 6:377–381. doi:10.

1097/01.mco.0000078998.96795.e7

6. Dace A, Sarkissian G, Schneider L, Martin-El Yazidi C, Bonne J,

Margotat A, Planells R, Torresani J (1999) Transient expression

of c-erbA beta 1 messenger ribonucleic acid and beta 1 thyroid

hormone receptor early in adipogenesis of Ob17 cells. Endocri-

nology 140:2983–2990. doi:10.1210/endo.140.7.6860

7. Jiang W, Miyamoto T, Kakizawa T, Sakuma T, Nishio S, Takeda

T, Suzuki S, Hashizume K (2004) Expression of thyroid hormone

receptor alpha in 3T3-L1 adipocytes; triiodothyronine increases

the expression of lipogenic enzyme and triglyceride accumula-

tion. J Endocrinol 182:295–302

8. Silva JE (2001) The multiple contributions of thyroid hormone to

heat production. J Clin Invest 108:35–37. doi:10.1172/JCI13397

9. Lanni A, Moreno M, Lombardi A, Goglia F (2003) Thyroid

hormone and uncoupling proteins. FEBS Lett 543:5–10. doi:10.

1016/s0014-5793(03)00320-x

10. Lee JY, Takahashi N, Yasubuchi M, Kim YI, Hashizaki H, Kim

MJ, Sakamoto T, Goto T, Kawada T (2012) Triiodothyronine

induces UCP-1 expression and mitochondrial biogenesis in

human adipocytes. Am J Physiol Cell Physiol 302:C463–C472.

doi:10.1152/ajpcell.00010.2011

11. Winder WW, Hardie DG (1999) AMP-activated protein kinase, a

metabolic master switch: possible roles in type 2 diabetes. Am J

Physiol 277:E1–10

12. Kahn BB, Alquier T, Carling D, Hardie DG (2005) AMP-acti-

vated protein kinase: ancient energy gauge provides clues to

modern understanding of metabolism. Cell Metab 1:15–25.

doi:10.1016/j.cmet.2004.12.003

13. Kemp BE, Stapleton D, Campbell DJ, Chen ZP, Murthy S,

Walter M, Gupta A, Adams JJ, Katsis F, van Denderen B, Jen-

nings IG, Iseli T, Michell BJ, Witters LA (2003) AMP-activated

protein kinase, super metabolic regulator. Biochem Soc Trans

31:162–168. doi:10.1042/BST0310162

14. An Z, Wang H, Song P, Zhang M, Geng X, Zou MH (2007) Nic-

otine-induced activation of AMP-activated protein kinase inhibits

fatty acid synthase in 3T3L1 adipocytes: a role for oxidant stress.

J Biol Chem 282:26793–26801. doi:10.1074/jbc.M703701200

15. Lopez M, Varela L, Vazquez MJ, Rodriguez-Cuenca S, Gonzalez

CR, Velagapudi VR, Morgan DA, Schoenmakers E, Agassandian

K, Lage R, Martinez de Morentin PB, Tovar S, Nogueiras R,

Carling D, Lelliott C, Gallego R, Oresic M, Chatterjee K, Saha

AK, Rahmouni K, Dieguez C, Vidal-Puig A (2010) Hypotha-

lamic AMPK and fatty acid metabolism mediate thyroid regula-

tion of energy balance. Nat Med 16:1001–1008. doi:10.1038/nm.

2207

16. Pfaffl MW (2001) A new mathematical model for relative

quantitation in real-time RT-PCR. Nucl Acid Res 29:45. doi:10.

1093/nar/29.9.e45

17. Azzu V, Jastroch M, Divakaruni AS, Brand MD (2010) The

regulation and turnover of mitochondrial uncoupling proteins.

Biochim Biophysm Acta 1797:785–791. doi:10.1016/j.bbabio.

2010.02.035

18. Jia JJ, Tian YB, Cao ZH, Tao LL, Zhang X, Gao SZ, Ge CR, Lin

QY, Jois M (2010) The polymorphisms of UCP1 genes associated

with fat metabolism, obesity and diabetes. Mol Biol Rep

37:1513–1522. doi:10.1007/s11033-009-9550-2

19. Townsend KL, Tseng YH (2012) Brown adipose tissue recent

insights into development, metabolic function and therapeutic

potential. Adipocytes 1:1–12. doi:10.4161/adip.18951

20. Hernandez A, Obregon MJ (2000) Triiodothyronine amplifies the

adrenergic stimulation of uncoupling protein expression in rat

brown adipocytes. Am J Physiol Endocrinol Metab 278:769–777

21. Hernandez A, Martinez-de-Mena R, Martin E, Obregon MJ

(2011) Differences in the Response of UCP1 mRNA to hormonal

stimulation between rat and mouse primary cultures of brown

adipocytes. Cell Physiol Biochem 28:969–980. doi:10.1159/

000335810

22. Mishra A, Zhu XG, Ge K, Cheng SY (2010) Adipogenesis is

differentially impaired by thyroid hormone receptor mutant iso-

forms. J Mol Endocrinol 44:247–255. doi:10.1677/JME-09-0137

23. Zhu XG, Kim DW, Goodson ML, Privalsky ML, Cheng SY

(2011) NCoR1 regulates thyroid hormone receptor isoform-

dependent adipogenesis. J Mol Endocrinol 46:233–244. doi:10.

1530/JME-10-0163

24. de Oliveira M, Luvizotto Rde A, Olimpio RM, de Sibio MT,

Silva CB, Conde SJ, Padovani CR, Nogueira CR (2013) Modu-

lation of thyroid hormone receptors, TRa and TRb, by using

different doses of triiodothyronine (T3) at different times. Arq

Bras Endocrinol Metab 57:368–374. doi:10.1590/S0004-

27302013000500006

25. de Jesus LA, Carvalho SD, Ribeiro MO, Schneider M, Kim SW,Harney JW, Larsen PR, Bianco AC (2001) The type 2 iodo-

thyronine deiodinase is essential for adaptive thermogenesis in

brown adipose tissue. J Clin Invest 108:1379–1385. doi:10.1172/

JCI13803

26. Martinez de Mena R, Scanlan TS, Obregon MJ (2010) The T3

receptor beta1 isoform regulates UCP1 and D2 deiodinase in rat

brown adipocytes. Endocrinology 151:5074–5083. doi:10.1210/

en.2010-0533

27. Hardie DG (2007) AMP-activated/SNF1 protein kinases: con-

served guardians of cellular energy. Nature Rev Mol Cell Biol

8:774–785. doi:10.1038/nrm2249

28. Curfman GD, Morrissey S, Drazen JM (2010) Sibutramine—

another flawed diet pill. N Engl J Med 363:972–974. doi:10.1056/

NEJMe1007993

29. Baretic M (2013) Obesity drug therapy. Minerva Endocrinol

38:245–254

30. Carlsson LM, Peltonen M, Ahlin S, Anveden A, Bouchard C,

Carlsson B, Jacobson P, Lonroth H, Maglio C, Naslund I, Pirazzi

C, Romeo S, Sjoholm K, Sjostrom E, Wedel H, Svensson PA,

Sjostrom L (2012) Bariatric surgery and prevention of type 2

diabetes in Swedish obese subjects. N Engl J Med 367:695–704.

doi:10.1056/NEJMoa1112082

31. Schultze SM, Hemmings BA, Niessen M, Tschopp O (2012)

PI3K/AKT, MAPK and AMPK signalling: protein kinases in

Mol Cell Biochem

123

glucose homeostasis. Expert Rev Mol Med 14:21. doi:10.1017/

S1462399411002109

32. Zhang Y, Guan M, Zheng Z, Zhang Q, Gao F, Xue Y (2013)

Effects of metformin on CD133? colorectal cancer cells in

diabetic patients. PLoS ONE 8:e81264. doi:10.1371/journal.pone.

0081264

Mol Cell Biochem

123