Triggering Respirofermentative Metabolism in the Crabtree-NegativeYeast Pichia guilliermondii by Disrupting the CAT8 Gene

Kai Qi,a Jian-Jiang Zhong,a,b Xiao-Xia Xiab

State Key Laboratory of Bioreactor Engineering, School of Biotechnology, East China University of Science and Technology, Shanghai, Chinaa; State Key Laboratory ofMicrobial Metabolism and Laboratory of Molecular Biochemical Engineering, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, Chinab

Pichia guilliermondii is a Crabtree-negative yeast that does not normally exhibit respirofermentative metabolism under aerobicconditions, and methods to trigger this metabolism may have applications for physiological study and industrial applications. Inthe present study, CAT8, which encodes a putative global transcriptional activator, was disrupted in P. guilliermondii. Thisyeast’s ethanol titer increased by >20-fold compared to the wild type (WT) during aerobic fermentation using glucose. A com-parative transcriptional analysis indicated that the expression of genes in the tricarboxylic acid cycle and respiratory chain wasrepressed in the CAT8-disrupted (�CAT8) strain, while the fermentative pathway genes were significantly upregulated. The re-spiratory activities in the �CAT8 strain, indicated by the specific oxygen uptake rate and respiratory state value, decreased toone-half and one-third of the WT values, respectively. In addition, the expression of HAP4, a transcriptional respiratory activa-tor, was significantly repressed in the �CAT8 strain. Through disruption of HAP4, the ethanol production of P. guilliermondiiwas also increased, but the yield and titer were lower than that in the �CAT8 strain. A further transcriptional comparison be-tween �CAT8 and �HAP4 strains suggested a more comprehensive reprogramming function of Cat8 in the central metabolicpathways. These results indicated the important role of CAT8 in regulating the glucose metabolism of P. guilliermondii and thatthe regulation was partially mediated by repressing HAP4. The strategy proposed here might be applicable to improve the aero-bic fermentation capacity of other Crabtree-negative yeasts.

Pichia guilliermondii is a Crabtree-negative yeast that is famousfor the production of a wide variety of products, ranging from

vitamins to biofuels, and is potentially a “new model yeast” (1).The current trend toward white biotechnology appears to favorthe use of P. guilliermondii due to its extraordinary capacity tometabolize both C5 and C6 sugars from lignocellulosic hydroly-sates and tolerate the harsh conditions of nondetoxified hydroly-sate (1–4). Previously, a self-screened P. guilliermondii was used toproduce ethanol from lignocellulosic hydrolysate in our lab; anethanol titer of 56 g liter�1 and productivity higher than 1 g liter�1

h�1 were obtained in this experiment (4). In contrast to Crabtree-positive yeasts, such as Saccharomyces cerevisiae, the onset of fer-mentation in P. guilliermondii does not depend on the sugar con-centration but is regulated by a decrease in the oxygen levels.Under fully aerobic conditions, P. guilliermondii does not prefer toundergo a fermentative metabolism, which may limit its spectra ofproducts (5). Specifically, the production of several important cy-tosolic acetyl-coenzyme A related products in yeast, such as iso-prenoids and polyhydroxyalkanoates, require a respirofermenta-tive metabolism under aerobic conditions (6, 7). Therefore,studying the triggering of the fermentative metabolism of theCrabtree-negative yeast P. guilliermondii under aerobic condi-tions is interesting for both biotechnology and physiology studies(8, 9).

Decreasing oxygen tensions was demonstrated to be useful toinduce the respirofermentative metabolism of P. stipitis, which isanother species of Crabtree-negative yeast (10), but this strategy istechnically difficult to implement in large-scale production. Dis-rupting cox5, which encodes a subunit of the cytochrome c oxidasein the respiratory chain, was recently reported as another strategyto genetically interfere with the respirative metabolism of P. stipi-tis; the fermentative production of ethanol from glucose was en-hanced, but oxygen-limited conditions were still required (11).

Considering the rigid regulation and involvement of multiplemetabolic pathways, the engineering of regulation networksmight be a simple and efficient strategy to reprogram the centralcarbon metabolism as demonstrated in S. cerevisiae (12). The glu-cose-signaling cascade plays important roles in regulating the res-pirative/fermentative balance in sugar metabolism (13, 14). In thisregulatory network, CAT8, a zinc cluster protein, was studied in S.cerevisiae during the diauxic shift and suggested to globally acti-vate respirative metabolism. CAT8 activated more than 200 genesin the central metabolism pathways and several transcriptionalfactors related to respirative metabolism (15, 16). However, thefunction of CAT8 is not yet well understood in P. guilliermondii orother Crabtree-negative yeasts (8).

Interestingly, recent experiments on the aerobic glucose fer-mentation of P. guilliermondii in this laboratory indicated thatputative CAT8 (PGUG_01292), which encodes a protein with ex-actly the same domains as the CAT8p of S. cerevisiae and P. stipitis,was not repressed during fermentation. Thus, the respirative me-tabolism of P. guilliermondii may be activated by CAT8 duringglucose metabolism. The hypothesis of this study is that disrupt-

Received 12 March 2014 Accepted 14 April 2014

Published ahead of print 18 April 2014

Editor: D. Cullen

Address correspondence to Jian-Jiang Zhong, jjzhong@sjtu.edu.cn, or Xiao-XiaXia, xiaoxiaxia@sjtu.edu.cn.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.00854-14.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.00854-14

July 2014 Volume 80 Number 13 Applied and Environmental Microbiology p. 3879 –3887 aem.asm.org 3879

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

ing CAT8 in P. guilliermondii may reduce the cellular respiration,which likely shifts its metabolism toward a fermentative one.

In the present study, CAT8 was disrupted to trigger a respiro-fermentative metabolism in P. guilliermondii. The physiologies ofthe CAT8 mutant and the wild-type strain were compared. Theeffect of CAT8 disruption and its possible role in regulating respi-rative/fermentative metabolism were analyzed and discussed.

MATERIALS AND METHODSStrains and media. The parental P. guilliermondii, which is an inhibitor-tolerant strain isolated and maintained in our laboratory (3), was main-tained as described previously (4). YNB medium was used for the molec-ular biology experiments (17), and 0.05 g of uracil liter�1 and/or 1 g of5-fluoroorotic acid (5-FOA) liter�1 was supplemented for selection pur-poses. The uracil auxotrophic strain was obtained via spontaneous muta-tion and selected on YNB plates supplemented with uracil and 5-FOA(Sigma-Aldrich Co., St. Louis, MO) as reported (17). Nearly 200 colonies,which resisted 5-FOA and could not grow without uracil addition, wereobtained. After these colonies were passaged five times on uracil-supple-mented YNB plates (without 5-FOA), only one mutant maintained theuracil auxotrophic physiology. This stable mutant was further cultivatedin liquid YNB medium supplemented with uracil, and its ura3 gene wasthen cloned and verified by sequencing. A point mutation at bp 314 wasobserved that resulted in the mutation of glutamine to a stop codon (CAGto TAG).

Minimum mineral (MM) medium supplemented with 0.05 g of uracilliter�1 was used for the fermentation experiments (4). All media wereadjusted to pH 5.0 before autoclaving at 121°C for 20 min. Glucose (30 gliter�1) was supplemented as a carbon source. Aerobic batch fermenta-tion was carried out in 100-ml Erlenmeyer flasks with 20 ml of MM me-dium under 30°C and 200 rpm.

Plasmid construction. All enzymes used in this section were pur-chased from Fermentas (MBI Fermentas, Vilnius, Lithuania) unless notedotherwise. The pAGU34 plasmid used in this research was kindly pro-vided by Andriy A. Sibirny and Yuriy R. Boretsky of the Institute of CellBiology NAS, Ukraine. Escherichia coli strain DH5� was used for plasmidconstruction and propagation.

First, the ARS sequence in pAGU34 was deleted via SalI digestion to

increase the homologous recombination rate and form plasmidpAGUARS (17). A 2-kb sequence containing a CalI digestion site withinthe CAT8 CDS (bp 872 to 2893) was then cloned using the primers Catsand Catan from the genome of P. guilliermondii (Table 1). The PCR prod-uct was purified using an EZNA Cycle-Pure kit (Omega Bio-Tek,Doraville, GA) and then digested with PstI and SalI restriction endonu-cleases. The resulting fragment was ligated with the plasmid pAGUARSusing T4 ligase to construct pCatIN (Fig. 1A). The pCatIN was then di-gested with ClaI and purified using gel extraction (Omega Bio-Tek). Theresulting fragment was used for electroporation using the same methodreported (17). The fragment from ClaI to SalI in pCatIN exchanged withthe same sequence in genome via homologous recombination and intro-duced the linearized pCatIN to the CAT8 gene. The fragment from PstI toClaI then exchanged with its homologous region in the genome, thusinserting the pCatIN into the open reading frame (ORF) of the gene. Thus,the resultant mRNA cannot express the correct CAT8 protein due to a lackof stop codon, even though the CAT8 gene could start the expression.

Transformants were selected on uracil-deficient (Ura�) YNB plates,and the positive colonies were selected. The selected colonies were platedon new Ura� YNB plates, and the correct insertion was verified by colonyPCR using the primers P1 and P2 (Fig. 1B and C). The insertion correct-ness was further verified by sequencing the PCR product.

Analysis of cell growth and fermentation metabolites. Samples weretaken at the designated time. To analyze the cell concentration, 0.2 ml offermentation broth was taken and diluted 25-fold using deionized water.The optical density at 620 nm (OD620) for each sample was measured(1700PharmaSpec UV spectrophotometer; Shimadzu, Japan) and corre-lated with the dry cell weight (DCW) (4).

To analyze the metabolites, 0.5 ml of fermentation broth was with-drawn and immediately centrifuged (5804R centrifuge; Eppendorf, Ham-burg, Germany) at 10,000 � g for 5 min at 4°C. The supernatants werefiltered through 0.22-�m-pore-size filters and stored at �20°C until high-pressure liquid chromatography (HPLC) analysis. The concentrations ofglucose, glycerol, pyruvate, ethanol, and acetic acid were detected in anAgilent 1200 HPLC system (Agilent, Waldbronn, Germany) with a refrac-tive index detector and a UV (210-nm) detector using an Aminex HPX-87H column (Bio-Rad, Hercules, CA) at 65°C. The mobile phase and itsflow rate were 5 mM H2SO4 and 0.6 ml min�1, respectively.

TABLE 1 Strains, plasmids, and primers used in this study

Strain, plasmid, or primer Description or sequence (5=-3=)a Source or reference

StrainsP. guilliernondii Parental strain 4WT URA� P. guilliermondii This study�CAT8 mutant CAT8-disrupted WT This study�HAP4 mutant HAP4-disrupted WT This study

PlasmidspAGU34 pUC19 with URA3 from S. cerevisiae 17pAGUARS pAGU34 with ARS deleted 17pCATIN pAGUARS ligated with P. guilliermondii CAT8 fragment This studypHAPIN pAGUARS ligated with P. guilliermondii HAP4 fragment This study

PrimersCats AACTGCAGCCAGAGTTTCGGCTACAAATCCA This studyCatin ACGCGTCGACTCCTCCTTTCCGTCCTGAGTGAT This studyP1 GGAAGACTTATCACTATGGCCCA This studyP2 TAATTCCTTGGTGGTACGAACATCC This studyHAPs AACTGCAGCGCATCTTTGTTTCTACGAGTCCG This studyHAPin ACGCGTCGACAATTGTCGCCTCGTCGGGAAC This studyHP1 ACGATGATGTGAGAGTAAGCGACAG This studyHP2 TAATTCCTTGGTGGTACGAACATCC This study

a Underlined sequences indicate the recognition sites of DNA restriction enzymes described in Materials and Methods.

Qi et al.

3880 aem.asm.org Applied and Environmental Microbiology

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

At the designated fermentation time points, a 20-ml portion of culturefrom three independent flasks of each condition was used for mRNAextraction. The fermentation broth was sampled and immediately centri-fuged (3,000 � g, 5 min) at 4°C. The cell pellets were immediately frozenin liquid nitrogen and stored at �80°C until use. For all extracted mRNAsamples, the OD260/OD280 ranged from 1.8 to 2.2.

Measurement of oxygen consumption. The dissolved oxygen (DO)was measured using a dissolved oxygen probe (DO-18; East China Uni-versity of Science and Technology, Shanghai, China) inserted into a100-ml flask with a port at the bottom containing 40 ml of MM medium.The flask was placed on a rotary shaker operating at 150 rpm and 30°C.When analyzing the oxygen uptake rate, the cells were collected from 20ml of medium at designated time points and suspended in 40 ml of freshMM medium with 20 g of glucose liter�1. Pure oxygen was gassed into theliquid through a silicone tube. When the oxygen concentration was closeto air saturation, the flask port was sealed with a rubber stopper. Theoxygen uptake rate was estimated from the DO slope as a function of time.The basal oxygen uptake rate (JO2) was calculated from the oxygen uptakerate divided by the DCW. Triethyltin chloride (TET; Sigma-Aldrich) at 15to 30 �g mg (DCW)�1 and carbonyl cyanide 3-chlorophenylhydrazone(CCCP; Sigma-Aldrich) at 1 to 10 �g mg (DCW)�1 were added directly tothe flask, and the optimal effects were observed at 15 and 1 �g mg(DCW)�1 for TET and CCCP, respectively (18, 19). The DO slope as afunction of time was estimated after adding TET at 15 �g mg (DCW)�1

and divided by DCW to obtain the JTET. A CCCP of 1 �g mg (DCW)�1

was added, and the DO slope as a function of time was then estimated anddivided by DCW to obtain the Jmax. The respiratory state value (RSV) wasthen calculated from these values using the following equation: RSV �(JO2 � JTET)/(Jmax � JTET). For each strain, measurements were carriedout for three independent experiments.

Transcriptional analysis. The total RNA was extracted from 50 mg offrozen cells using glass beads disruption (Sigma-Aldrich) and 1 ml of

TRIzol according to the manufacturer’s instructions (Invitrogen, Carls-bad, CA). The residual genomic DNA was digested using RNase-freeDNase I (MBI Fermentas, Vilnius, Lithuania). The RNA concentrationwas quantified by using a Biophotometer Plus (Eppendorf). A RevertAidM-MuLV reverse transcriptase system (MBI Fermentas) was used to re-verse transcribe the total RNA according to the manufacturer’s protocol.

The transcriptional levels were analyzed via real-time quantitative re-verse transcription-PCR (qRT-PCR) using Maxima SYBR green qPCRmaster mix (MBI Fermentas). The primers used in the present study aresummarized in Table S1 in the supplemental material. The gene expres-sion levels were normalized to the reference gene actin, which was stablyexpressed in our experimental conditions. The relative expressions ofgenes were compared and statistically analyzed using Student t test, and aP value of �0.05 was considered statistically significant.

Calculation. The following equation was used to calculate the ethanolyield from sugar (glucose). The calculations were based on the beginningto the peak (h 32) of ethanol production for the mutant. The ethanolproduction peak of the WT strain occurred at h 34: yield � (Ct2 � Ct1)/(Gt1 � Gt2), where Ct1 and Ct2 represent the ethanol concentrations at thebeginning and end of the calculation period, respectively, and Gt1 and Gt2

represent the glucose concentrations at the beginning and end of the cal-culation period, respectively.

The ethanol productivity and glucose consumption rate were calcu-lated by using the following equation. The calculations were based on thebeginning to the peak (h 32) of ethanol production for the mutant. Theethanol production peak of the wild-type strain occurred at the h 34: P �(Ct2 � Ct1)/(t2 � t1), where Ct1 and Ct2 represent the concentrations ofethanol or glucose at the beginning and end of the calculation period,respectively, and t1 and t2 represent the times for the beginning and end ofthe calculation period, respectively.

Statistical analysis. The data consisted of the average of the measure-ments of three independent experiments. Error bars represent the stan-

FIG 1 (A) Plasmid pCatIN constructed for CAT8 disruption. (B) Outline of the disruption of CAT8. (C) Yeast colony PCR (�Col.) and genome PCR (�Gen.)confirmation of the correct insertion mutant. (D) Verification of the stability of the mutant by PCR using P1 and P2 as primers. Lane B, using deionized wateras a template; lanes �1 to �5, using the genome of mutant from the first to the fifth passage as a template; lane WT, using the genome of the WT (wild-type) strainas the template.

Triggering Respirofermentative Metabolism in Yeast

July 2014 Volume 80 Number 13 aem.asm.org 3881

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

dard deviations from the means of triplicates. Statistical significance wasanalyzed using Student t test, where P � 0.05 indicates significance.

RESULTSDisruption of CAT8 gene in P. guilliermondii. The genome of P.guilliermondii, a haploid yeast, was sequenced and annotated byButler et al. (20), in which the CAT8 gene is identified. In thepresent study, a CAT8-disrupted mutant was obtained via homol-ogous recombination. Six correct homologous recombinantswere identified from nearly 900 transformants, and the remainingtransformants were identified as illegitimate recombinants. Totest the stability, a selected CAT8-disrupted mutant was cultivatedin liquid uracil-supplemented YNB medium for 5 passages. Ura

prototroph and correct PCR products were confirmed in eachpassage (Fig. 1D). To test the possible reversion mutagenesis, adroplet of liquid culture from the fifth passage was plated on aYNB plate to obtain more than 500 colonies. Next, 500 colonieswere selected and replated on five YNB plates with 5-FOA anduracil. After 1 week, no colony was observed in any of the plates,which indicated a low level of reversion mutagenesis rate for theCAT8 mutant. In summary, CAT8 was successfully disrupted, anda stable �CAT8 mutant was obtained.

The transformation cassette used in the present study did notcontain a yeast autonomously replicating sequence; thus, thefunctional expression of URA3 gene can only occur after genomicintegration (21). The homologous recombination rate of P. guil-liermondii could be as low as 1/1,000 (17). In the present study, theinsertion mutagenesis strategy with ends-in vector was used,which was reported to yield higher homologous recombinant ratein yeast (22), and resulted in a homologous integration rate of1/150.

Triggered respirofermentative metabolism in the �CAT8mutant versus the WT. The fermentation performance of thewild type (WT) and the CAT8-disrupted mutant (�CAT8) of P.guilliermondii were compared during aerobic cultivation in min-imum medium with 30 g of glucose liter�1 as a carbon source andammonium as a nitrogen source (Fig. 2). The WT showed typicalrespirative characteristics; glucose was completely consumed in 46h with little ethanol formation. The ethanol production was sig-nificantly enhanced in the �CAT8 mutant for the same aerobiccondition (Fig. 2C). The �CAT8 mutant reached an ethanol titerof 4.32 0.13 g liter�1, which was much higher than that of theWT. Moreover, the ethanol yield, productivity, and glucose con-sumption rate were all significantly increased for the mutant. Ac-etate and pyruvate also accumulated at higher levels in the �CAT8mutant (Fig. 2B), suggesting an increased pyruvate decarboxylase(PDC) flux and a possible pyruvate overflow metabolism (23).The DCW in the �CAT8 mutant was only 70% of that in the WTwhen the glucose was depleted in the medium. Moreover, the titerof glycerol, a major by-product during ethanol production, wasonly 30% of that of WT (Fig. 2C).

The above findings suggest that the disruption of CAT8 effi-ciently triggered the respirofermentative metabolism of P. guilli-ermondii under aerobic conditions. To further understand the in-fluence of CAT8 disruption, the transcriptional levels of themetabolic pathway genes are analyzed below.

Transcriptional analysis of key genes in glucose metabolismof the WT and the �CAT8 mutant. The glucose consumption andethanol production rates reached and maintained almost constantlevels from the 24th to the 32nd hour for both WT and �CAT8

fermentation (Fig. 2). To elucidate the transcriptional differencesin the central carbon metabolism between the WT and �CAT8strains, the expression levels of marker genes were analyzed byqRT-PCR at 24, 28, and 32 h.

As shown in Table 2, the expression levels of genes in the cen-tral metabolic pathways changed significantly in the WT duringaerobic glucose fermentation. From 24 to 32 h, the expression ofCAT8 gradually increased by �2-fold. The expression of putativeHAP4 (PGUG_03337), a positive respiratory regulator in yeast

FIG 2 Glucose fermentation of wild-type P. guilliermondii (WT, closed sym-bols) and its CAT8-disrupted mutant (�CAT8, open symbols) at 30°C and 200rpm in 100-ml Erlenmeyer flasks with 20 ml of MM medium. (A) Time coursesof medium residual glucose (squares) and DCW (circles). (B) Time courses ofpyruvate (triangles) and acetate (squares) formation. (C) Time courses ofethanol (squares) and glycerol (circles) formation. The values are the averagesof three independent experiments, and the error bars represent the standardderivations. Statistically significant differences (Student t test [paired, twotailed], P � 0.05) were determined by using the Student t test and are indicatedwith an asterisk.

Qi et al.

3882 aem.asm.org Applied and Environmental Microbiology

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

(14, 24, 25), also increased 2.8-fold from 24 to 32 h. Coincidingwith the activation of these two regulators, the tricarboxylic acid(TCA) cycle and respiratory gene expression levels also increasedby 3- to 6-fold, respectively. Possibly due to the activation of TCAcycle, the ethanol titer (at 0.2 g liter�1) was not further increasedafter 24 h in the WT. Meanwhile, the biomass productivity of theWT increased to a higher level and surpassed that of the �CAT8mutant (Fig. 2A). In the �CAT8 mutant, most of the genes (exceptpdc) in the metabolic pathways were expressed at stable levels, andsignificant differences at the transcriptional levels of genes werenot observed between 24 and 28 h. At 32 h, nearly all of the glucosewas completely consumed and the ethanol titer was maximized inthe �CAT8 mutant. Possibly due to the consumption of ethanol,the gene expression levels at 32 h showed a pattern different thanthose at 24 and 28 h in the �CAT8 mutant, where respiratorygenes were upregulated for ethanol metabolism.

When we compared between the WT at 32 h and the �CAT8mutant at 24 h, which were, respectively, in their middle stages ofglucose fermentation, we found the expression of pyruvate decar-boxylase (pdc), alcohol dehydrogenase (adh), and acetaldehydedehydrogenase (aldh) to be 3.9-, 3.2-, and 5.3-fold higher, respec-tively, in the �CAT8 mutant. In the TCA cycle, sdh, fum, and mdh,which encode enzymes that catalyze the reactions from succinateto oxaloacetate, were 2.7-, 3.2-, and 2.0-fold lower, respectively, inthe �CAT8 mutant relative to the WT. The TCA cycle is linked tothe mitochondrial respiratory chain by succinate dehydrogenase(SDH) and cytochrome c reductase via ubiquinone-mediatedelectron transfer. The expression of a gene that encodes a subunitof cytochrome c reductase, qcr, was also 1.8-fold lower in the�CAT8 mutant.

The results of transcriptional analysis indicate that the CAT8disruption led to a repressed respiratory system. In contrast to theWT, the expression level of HAP4 was not activated in the �CAT8mutant during glucose fermentation and was 2.3-fold lower than

in the WT. The activation of HAP4 transcription by CAT8p wasproven by using an electrophoretic mobility shift assay in S. cerevi-siae (26). The Cat8 protein of P. guilliermondii contains a similarGAL4 zinc cluster DNA-binding domain with an identity of 73%compared to S. cerevisiae, possibly indicating similar bindingcharacteristics. In addition, a sequence (CCCAAACACCG) simi-lar to the CAT8-specific binding site (CCNNNNNNCCG) wasfound in the promoter of the P. guilliermondii HAP4 (27). Thesefacts indicate that HAP4 might be regulated by CAT8 in P. guilli-ermondii; thus, CAT8 disruption repressed HAP4. Whether therespirative activity decreased in the �CAT8 mutant and whetherHAP4 can mediate the repression of the respiratory chain weretested in the following experiments.

Fermentation and respiratory activity of WT, CAT8, andHAP4 disruption during aerobic glucose fermentation. To testthe influence of HAP4 on metabolism, a HAP4 disruption mutant(�HAP4) was constructed using the same method used to con-struct the �CAT8 mutant. The primers used to clone the homol-ogous region and verify the correct recombination are listed inTable 1. A correct HAP4 disruption mutant was obtained andverified by sequencing according to the same protocol used for theCAT8 disruption.

The glucose fermentation products were analyzed, and similarpattern were observed in the �CAT8 and �HAP4 mutants (Fig. 3).The cells and glycerol produced from glucose decreased by 20 and60%, respectively, in the �HAP4 strain compared to the WT. Sim-ilar to the �CAT8 mutant, the ethanol productivity and glucoseconsumption rate significantly increased in the �HAP4 mutant.HAP4 disruption also resulted in increased ethanol, pyruvate, andacetate accumulation.

The effects of CAT8 or HAP4 disruption on the respirationproperties were characterized by analyzing the specific oxygen up-take rates in the middle phase of glucose fermentation for the WT,�HAP4, and �CAT8 strains at 32, 24, and 24 h of fermentation,

TABLE 2 Different expression levels of marker genes in central metabolism in WT and �CAT8 strains during aerobic glucose fermentationa

Pathway and gene Description

Relative fold expression at various times versus WT at 24 h (mean SD)b

WT strain �CAT8 strain

24 h 28 h 32 h 24 hc 28 h 32 h

Pyruvate metabolismpdh Pyruvate dehydrogenase 1 1.6 0.1* 2.2 0.2* 3.9 1* 2.1 0.3* 2.5 0.2*pyc Pyruvate carboxylase 1 2.2 0.1*† 5.9 0.7* 2.5 0.5*† 2.4 0.3*† 7.0 1.0*pdc Pyruvate decarboxylase 1 3.8 1.1* 1.9 0.1* 9.2 0.2*† 3.8 0.6*† 3.0 0.6*adh Alcohol dehydrogenase 1 1.8 0.1 1.4 0.3 4.3 0.6*† 4.6 0.4*† 3.0 1.8aldh Acetaldehyde dehydrogenase 1 0.8 0.1 0.3 0.1* 1.5 0.0*† 1.3 0.1*† 1.4 0.8

TCA and respiratory chaincit Citrate synthase 1 2.6 0.2* 3.0 0.4* 2.7 0.6* 1.6 0.1*† 2.1 0.2*aco Aconitase 1 1.9 0.2*† 4.0 0.5* 4.0 0.2* 2.6 0.4* 2.9 0.0*†idh Isocitrate dehydrogenase 1 1.4 0.1*† 3.0 0.1* 1.5 0.2*† 1.3 0.2*† 0.9 0.4†sdh Succinate dehydrogenase 1 2.5 0.2*† 6.5 0.9* 2.4 0.6*† 2.0 0.1*† 3.0 1.4†fum Fumarase 1 1.8 0.2*† 5.9 0.7* 1.8 0.3*† 2.4 0.3*† 9.5 2.9mdh Malate dehydrogenase 1 1.5 0.2*† 2.8 0.3* 1.4 0.2*† 1.1 0.2*† 2.4 0.3*qcr Cytochrome c reductase 1 1.8 0.2*† 3.0 0.4* 1.7 0.1*† 1.6 0.3*† 1.5 0.4HAP4 Transcriptional regulator 1 1.7 0.1*† 2.8 0.1* 1.2 0.0*† 1.4 0.1*† 3.3 0.1*†CAT8 Transcription regulator 1 1.6 0.1*† 2.4 0.1* NA NA NA

a Samples were taken from three independent experiments and analyzed at 24, 28, and 32 h in WT and �CAT8 strains during aerobic glucose fermentation.b NA, not analyzed. *, statistically significant difference compared to the value for the WT at 24 h (P � 0.05); †, statistically significant difference compared to the value for the WTat 32 h (P � 0.05).c No significant difference was observed between 24 and 28 h in the �CAT8 mutant.

Triggering Respirofermentative Metabolism in Yeast

July 2014 Volume 80 Number 13 aem.asm.org 3883

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

respectively. As shown in Table 3, the basal and maximum oxygenuptake rate (JO2 and Jmax, respectively) of the �CAT8 mutant de-creased by up to 50% compared to those of the WT. The additionof TET, a lipophilic F0F1-ATPase inhibitor, did not reduce thespecific oxygen uptake rate in the �CAT8 mutant, which indicatedthat the activity of oxidative respiration was very low in this mu-tant. The respiration state value (RSV), which represents the oxi-dative phosphorylation efficiency, was then calculated. The RSVof the �CAT8 mutant was only one-third that in the WT. A re-duction in respiratory activity was also observed in the �HAP4mutant (Table 3). The JO2 and Jmax of the �HAP4 mutant showedlow levels similar to those observed for the �CAT8 mutant, andTET did not affect the oxygen uptake rates. The RSV of the �HAP4mutant was even lower than that of the �CAT8 mutant.

The results described above indicate that HAP4 is an importantrespirative regulator in P. guilliermondii. Considering the 2.8-fold-lower expression of HAP4 in the �CAT8 mutant, it was pos-sible that the effects of CAT8 disruption on the respiratory activitycould be partly attributed to its repression of HAP4.

It is noteworthy that although the respiratory efficiency washigher in the �CAT8 mutant (as indicated by the higher RSV)than in the �HAP4 mutant, the ethanol yield was significantlyhigher and cell yield was lower in the �CAT8 mutant (Table 3).It is quite possible that in the �CAT8 mutant, in addition to therepression of respiration, the influences of other pathways alsocontributed to efficient glucose-ethanol transformation. Thetranscriptional differences in the central metabolic pathwayswere then compared between the �HAP4 and �CAT8 strains todetermine the differences between these two mutants.

Comparison of gene expression in central metabolism path-ways in the �HAP4 and �CAT8 mutants during aerobic glucosefermentation. The expressions of marker genes of the central me-tabolism pathways were analyzed by qRT-PCR and compared be-tween the �HAP4 and �CAT8 mutants in the middle phase ofglucose consumption (i.e., at 24 h). The values were normalized bythe expression levels of WT (at 32 h). Values higher than 1 indi-cated higher expression levels compared to the WT and vice versa.As shown in Fig. 4, the expression levels of the glycolysis pathwaygenes were significantly lower in the �CAT8 mutant than in the�HAP4 mutant, and the expression levels of these genes in bothmutants were lower than that of the WT. The expression levels ofQCR, sco, sdh, and fum, which are closely related to the respiratorypathway, were similar in the �CAT8 and �HAP4 mutants. Theexpression levels of other TCA genes, such as cit, aco, and idh, werelower in the �CAT8 mutant than in the �HAP4 mutant. In par-ticular, the genes in the glyoxylate and anaplerotic pathways, in-cluding mls, mdh, pyc, and pepck, were repressed in the �CAT8mutant but not in the �HAP4 mutant.

FIG 3 Aerobic glucose fermentation of �CAT8 (closed symbols), �HAP4(open symbols), and WT (dash lines with closed gray symbols) strains at 30°Cand 200 rpm in 100-ml Erlenmeyer flasks with 20 ml of MM medium. (A)Time courses of medium residual glucose (squares) and DCW (circles). (B)Time courses of pyruvate (triangles) and acetate (squares) formation. (C)Time courses of ethanol (squares) and glycerol (circles) formation. The valuesare the averages of three independent experiments, and the error bars repre-sent the standard derivation,. Statistically significant differences (Student t test[paired, two tailed], P � 0.05) were determined by using the Student t test andare indicated with an asterisk.

TABLE 3 Yields and respiratory parameters of �CAT8, �HAP4, and WT strains during aerobic glucose fermentationa

Strain

Avg SDb

Cell yield (g g�1) Ethanol yield (g g�1) JO2 JTET Jmax RSV

WT 0.54 0.01 0.07 0.02 1.11 0.10 0.87 0.18 1.45 0.06 0.42 0.09�HAP4 mutant 0.35 0.05* 0.21 0.02* 0.57 0.08* 0.56 0.08* 0.75 0.01* 0.07 0.03*�CAT8 mutant 0.23 0.02*† 0.26 0.01*† 0.50 0.06* 0.47 0.07* 0.67 0.04* 0.13 0.01*†a In the WT strain, the yields were calculated from 16 to 50 h, and respiratory activity was analyzed at 32 h during fermentation. In the �HAP4 and �CAT8 mutant strains, theyields were calculated from 16 to 26 h, and respiratory activity was analyzed at 24 h during fermentation.b The averages of three independent experiments are shown. *, statistically significant difference (Student t test [paired, two tailed], P � 0.05) compared to the value for the WT; †,statistically significant difference (Student t test [paired, two tailed], P � 0.05) between the values for the �HAP4 and �CAT8 mutants.

Qi et al.

3884 aem.asm.org Applied and Environmental Microbiology

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

In conclusion, compared to the WT, the expression levels ofrespiratory- and ethanol fermentation-related genes generallyshowed similar patterns in the �HAP4 and �CAT8 mutants,which favored the fermentative metabolism in both mutants.However, due to the role of CAT8p as a global regulator and themore comprehensive regulatory responses related to TCA cycle,

glyoxylate and anaplerotic pathways were observed in the �CAT8mutant, which might provide better fermentative characteristicsthan for the �HAP4 mutant.

DISCUSSION

Engineering the respirative metabolism in Crabtree-negativeyeasts will broaden the current knowledge of the respiratory ma-chinery and assist the construction of these yeasts as potentialindustrial organisms to produce ethanol and other valuable fer-mentative products (9). Little is known of the regulation of aero-bic glucose metabolism in Pichia (28), possibly because the ge-nome of Pichia strain was only sequenced and annotated recently(20). The results presented here demonstrated that the engineer-ing of a putative global regulator was effective in shifting the cen-tral carbon flux in the P. guilliermondii, which is an importantbiochemical producer. Furthermore, our findings indicated thatthe respirofermentative metabolism during aerobic glucose fer-mentation could be triggered by engineering the glucose repres-sion signaling cascade.

By disrupting CAT8, the glucose metabolism was systemati-cally shifted toward a fermentative metabolism at both the meta-bolic and the transcriptional levels. The expression levels of genesin the TCA cycle and respiratory chain were lower in the mutantthan in the WT. Moreover, the oxygen uptake rate and respiratoryefficiency were significantly reduced. In yeast, the mitochondrialcontent was strictly adjusted and linearly correlated with the oxy-gen uptake rate (29); thus, the disruption might also affect thephysiology of mitochondria. These results suggested that the dis-ruption of CAT8 affected the activity of the TCA cycle and respi-ratory chain. One possible explanation was that the HAP4 gene,which encodes a transcriptional activator for the TCA cycle andrespiratory chain (14, 24, 25), was repressed in the �CAT8 mu-tant.

When HAP4 was disrupted, the expression levels of respirato-ry-related genes were severely reduced compared to the WT dur-ing aerobic glucose fermentation. Meanwhile, the expression ofethanol production-related genes, such as pdc and adh, increasedin the �HAP4 mutant. As indicated by the RSV, the respiratoryefficiency was reduced to even lower levels in the �HAP4 mutantcompared to the �CAT8 mutant (16). As a result, the fermentativemetabolism was greatly enhanced in the �HAP4 mutant, whichproved the importance of HAP4 in regulating the glucose metab-olism of P. guilliermondii. Based on these results, it is quite possi-ble that the repression of HAP4 could be one of the reasons for theenhanced fermentative metabolism in the �CAT8 mutant.

Interestingly, the ethanol yield and productivity of the �CAT8mutant were higher than those of the �HAP4 mutant. CAT8 dis-ruption was noted to lead to a more comprehensive reprogram-ming of the central metabolism pathways than HAP4 disruption.A comparison between the expression profiles of the �CAT8 and�HAP4 mutants showed that the gene expression levels of theglyoxylate and anaplerotic pathways were lower in the �CAT8mutant. These two pathways are important for replenishing theTCA cycle flux and providing building blocks for cell formation.Their repression may further promote the fermentative metabo-lism in the �CAT8 mutant. This fact hinted at the possibility offurther improving the ethanol fermentation of P. guilliermondii.In a preliminary test in our lab, the inhibition of pyruvate carbox-ylase increased the ethanol yield and productivity of the �CAT8strain (data not shown). Reducing the expression of the related

FIG 4 Expression of genes in central metabolism pathways during aerobicglucose fermentation of the �CAT8 and �HAP4 mutants at 30°C and 200rpm in 100-ml Erlenmeyer flasks with 20 ml of MM medium. The data wererelative value to that of the WT. The upper values indicate the relative valueof the �HAP4 mutant to the WT; the lower value indicates the relativevalue of the �CAT8 mutant to the WT. The values are the averages of threeindependent experiments, and the standard derivations are indicated. Sta-tistically significant differences (Student t test [paired, two tailed], P �0.05) were determined by using the Student t test and are indicated with anasterisk.

Triggering Respirofermentative Metabolism in Yeast

July 2014 Volume 80 Number 13 aem.asm.org 3885

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

genes by substituting their promoters with weaker ones would beimportant to clarify the significance of the glyoxylate and/oranaplerotic pathways and further improve the ethanol productionin future work. Because the TCA cycle is one of the most impor-tant pathways for cell metabolism, the direct deletion of individualenzymes in this pathway could be detrimental to yeast (30). For-tunately, the TCA cycle genes in the �CAT8 mutant were re-pressed �2-fold compared to the WT, which was not detrimentalbut possibly sufficient to improve the fermentative metabolism.

Because the repression of the TCA cycle and respiratory chain mayalso result in an NAD(P)H imbalance, a new redox related reactionshould be activated to maintain a balanced metabolism. The activatedfermentative pathway redirected the flux from the TCA cycle and alsopossibly fulfilled the function of balancing the redox. Compared to S.cerevisiae, respiratory yeasts always showed a higher TCA cycleflux and lower glycolytic flux (31). A study of S. cerevisiae showedthat the repression of the TCA cycle resulted in a loss of ATPproduction. To meet the ATP demand, glycolysis was accelerated(32). In the present study, the glucose consumption rate was sig-nificantly enhanced in the �CAT8 mutant, which was a majorreason for the increased ethanol productivity. Interestingly, theexpression levels of glycolytic genes were much higher in the WTthan the mutants despite the lower glucose consumption rate. Asimilar phenomenon was observed in a comparison of S. cerevisiaeand its respiratory mutant; the expression levels of glycolytic geneswere higher in the respiratory strain with a lower glucose uptakerate (33). Also, the expression levels of glycolytic genes were muchhigher during respirative glucose metabolism than during the fer-mentative process of S. cerevisiae (28). A faster glucose uptake mayhave increased the intracellular glucose flux level, which repressedseveral glycolytic genes, as reported in S. cerevisiae (28, 33).

In conclusion, we successfully triggered a respirofermentativemetabolism in P. guilliermondii by disrupting CAT8. The resultsdemonstrated the importance of the glucose signaling cascade inthe Crabtree effect of P. guilliermondii and its improved perfor-mance as a biorefinery platform. Moreover, due to its simplicity,this strategy may be applied to other respirative yeasts to improvetheir fermentation efficiency and induce respirofermentative me-tabolism.

ACKNOWLEDGMENTS

Chao Fan assisted in the selection of uracil auxotrophic strains.This study was supported by Open Funding Project of the State Key

Laboratory of Bioreactor Engineering, East China University of Scienceand Technology (Shanghai, China). X.-X.X. acknowledges financial sup-port from the National Basic Research Program of China (973 program2013CB733902) and the Program for Professor of Special Appointment(Eastern Scholar) at the Shanghai Institutions of Higher Learning(ZXDF080005).

REFERENCES1. Papon N, Savini V, Lanoue A, Simkin AJ, Crèche J, Giglioli-Guivanc’h

N, Clastre M, Courdavanult V, Sibirny AA. 2013. Candida guilliermon-dii: biotechnological applications, perspectives for biological control,emerging clinical importance and recent advances in genetics. Curr.Genet. 59:73–90. http://dx.doi.org/10.1007/s00294-013-0391-0.

2. Sibirny AA, Boretsky YR. 2009. Pichia guilliermondii, p 113–134. InSatyanarayana T, Kunze G (ed), Yeast biotechnology: diversity and appli-cations. Springer, New York, NY.

3. Zou Y, Qi K, Chen X, Miao X, Zhong JJ. 2010. Favorable effect of verylow initial KLa value on xylitol production from xylose by a self-isolatedstrain of Pichia guilliermondii. J. Biosci. Bioeng. 109:149 –152. http://dx.doi.org/10.1016/j.jbiosc.2009.07.013.

4. Fan C, Qi K, Xia XX, Zhong JJ. 2013. Efficient ethanol production fromcorncob residues by repeated fermentation of an adapted yeast. Bioresour.Technol. 136:309 –315. http://dx.doi.org/10.1016/j.biortech.2013.03.028.

5. Santos MM, Raghevendran V, Kotter P, Olsson L, Nielsen J. 2004.Manipulation of malic enzyme in Saccharomyces cerevisiae for increasingNADPH production capacity aerobically in different cellular compart-ments. Metab. Eng. 6:352–363. http://dx.doi.org/10.1016/j.ymben.2004.06.002.

6. Shiba Y, Paradise EM, Kirby J, Ro DK, Keasling JD. 2007. Engineeringof the pyruvate dehydrogenase bypass in Saccharomyces cerevisiae forhigh-level production of isoprenoids. Metab. Eng. 9:160 –168. http://dx.doi.org/10.1016/j.ymben.2006.10.005.

7. Kocharin K, Chen Y, Sievers V, Nielsen J. 2012. Engineering of acetyl-CoA metabolism for the improved production of polyhydroxybutyrate inSaccharomyces cerevisiae. AMB Express 2:52. http://dx.doi.org/10.1186/2191-0855-2-52.

8. Charbon G, Breunig KD, Wattiez R, Vandenhaute J, Noel-Georis I.2004. Key role of Ser562/661 in Snf1-dependent regulation of Cat8p inSaccharomyces cerevisiae and Kluyveromyces lactis. Mol. Cell. Biol. 24:4083– 4091. http://dx.doi.org/10.1128/MCB.24.10.4083-4091.2004.

9. Shi NQ, Davis B, Sherman F, Cruz J, Jeffries TW. 1999. Disruptionof the cytochrome c gene in xylose-utilizing yeast Pichia stipitis leads tohigher ethanol production. Yeast 15:1021–1030. http://dx.doi.org/10.1002/(SICI)1097-0061(199908)15:11�1021::AID-YEA429�3.0.CO;2-V.

10. Klinner U, Fluthgraf S, Freese S, Passoth V. 2005. Aerobic induction ofrespiro-fermentative growth by decreasing oxygen tensions in the respi-ratory yeast Pichia stipitis. Appl. Microbiol. Biotechnol. 67:247–253. http://dx.doi.org/10.1007/s00253-004-1746-8.

11. Freese S, Passoth V, Klinner U. 2011. A mutation in the COX5 gene of theyeast Scheffersomyces stipitis alters utilization of amino acids as carbonsource, ethanol formation and activity of cyanide insensitive respiration.Yeast 28:309 –320. http://dx.doi.org/10.1002/yea.1840.

12. Ostergaard S, Olsson L, Johnston M, Nielsen J. 2000. Increasing galac-tose consumption by Saccharomyces cerevisiae through metabolic engi-neering of the GAL gene regulatory network. Nat. Biotechnol. 18:1283–1286. http://dx.doi.org/10.1038/82400.

13. Van Dam K. 1996. Role of glucose signaling in yeast metabolism. Bio-technol. Bioeng. 52:161–165.

14. Raab AM, Hlavacek V, Bolotina N, Lang C. 2011. Shifting the fermen-tative/oxidative balance in Saccharomyces cerevisiae by transcriptional de-regulation of Snf1 via overexpression of the upstream activating kinaseSak1p. Appl. Environ. Microbiol. 77:1981–1989. http://dx.doi.org/10.1128/AEM.02219-10.

15. Tachibana C, Yoo JY, Tanne JB, Kacherovsky N, Lee TI, Young ET.2005. Combined global localization analysis and transcriptome data iden-tify genes that are directly regulated by Adr1 and Cat8. Mol. Cell. Biol.25:2138 –2146. http://dx.doi.org/10.1128/MCB.25.6.2138-2146.2005.

16. Young ET, Dombek KM, Tachibana C, Ideker T. 2003. Multiple path-ways are coregulated by the protein kinase Snf1 and the transcriptionfactors Adr1 and Cat8. J. Biol. Chem. 278:26146 –26158. http://dx.doi.org/10.1074/jbc.M301981200.

17. Boretsky YR, Pynyaha YV, Boretsky VY, Kutsyaba VI, Protchenko OV,Philpott CC, Sibirny AA. 2007. Development of a transformation systemfor gene knockout in the flavinogenic yeast Pichia guilliermondii. J. Micro-biol. Methods 70:13–19. http://dx.doi.org/10.1016/j.mimet.2007.03.004.

18. Aguilaniu H, Gustafsson L, Rigoulet M, Nyström T. 2001. Proteinoxidation in G0 cells of Saccharomyces cerevisiae depends on the staterather than rate of respiration and is enhanced in pos9 but not yap1 mu-tants. J. Biol. Chem. 276:35396 –35404. http://dx.doi.org/10.1074/jbc.M101796200.

19. Agrimi G, Brambilla L, Frascotti G, Pisana I, Porro D, Vai M, PalmieriL. 2011. Deletion or overexpression of mitochondrial NAD carriers inSaccharomyces cerevisiae alters cellular NAD and ATP contents and affectsmitochondrial metabolism and the rate of glycolysis. Appl. Environ. Mi-crobiol. 77:2239 –2246. http://dx.doi.org/10.1128/AEM.01703-10.

20. Butler G, Rasmussen MD, Lin MF, Santos MA, Sakthikumar S, MunroCA, Rheinbay E, Grabherr M, Forche A, Reedy JL, Agrafioti I, ArnaudMB, Bates S, Brown AJ, Brunke S, Costanzo MC, Fitzpatrick DA, deGroot PW, Harris D, Hoyer LL, Hube B, Klis FM, Kodira C, LennardN, Logue ME, Martin R, Neiman AM, Nikolaou E, Quail MA, Quinn J,Santos MC, Schmitzberger FF, Sherlock G, Shah P, Silverstein KA,Skrzypek MS, Soll D, Staggs R, Stansfield I, Stumpf MP, Sudbery PE,Srikantha T, Zeng Q, Berman J, Berriman M, Heitman J, Gow NA,

Qi et al.

3886 aem.asm.org Applied and Environmental Microbiology

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Lorenz MC, Birren BW, Kellis M, Cuomo CA. 2009. Evolution ofpathogenicity and sexual reproduction in eight Candida genomes. Nature459:657– 662. http://dx.doi.org/10.1038/nature08064.

21. Van Bogaert INA, De Maeseneire SL, Develter D, Soetaert W. 2008.Development of a transformation and selection system for the glycolipid-producing yeast Candida bombicola. Yeast 25:273–278. http://dx.doi.org/10.1002/yea.1586.

22. Klinner U, Schäfer B. 2004. Genetic aspects of targeted insertion mu-tagenesis in yeasts. FEMS Microbiol. Rev. 28:201–223. http://dx.doi.org/10.1016/j.femsre.2003.10.002.

23. Pronk JT, Steensma HY, Dijken JPV. 1996. Pyruvate metabolism inSaccharomyces cerevisiae. Yeast 12:1607–1633. http://dx.doi.org/10.1002/(SICI)1097-0061(199612)12:16�1607::AID-YEA70�3.0.CO;2-4.

24. Jeffries TW, Grigoriev IV, Grimwood J, Laplaza JM, Aerts A, SalamovA, Schmutz J, Lindquist E, Dehal P, Shapiro H, Jin YS, Passoth V,Richardson PM. 2007. Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis. Nat. Biotechnol.25:319 –326. http://dx.doi.org/10.1038/nbt1290.

25. Sybirna K, Guiard B, Li YF, Bao WG, Bolotin-Fukuhara Delahodde A.2005. A new Hansenula polymorpha HAP4 homologue which containsonly the N-terminal conserved domain of the protein is fully functional inSaccharomyces cerevisiae. Curr. Genet. 47:172–181. http://dx.doi.org/10.1007/s00294-004-0556-y.

26. Brons JF, de Jong M, Valens M, Grivell LA, Bolotin-Fukuhara M, BlomJ. 2002. Dissection of the promoter of the HAP4 gene in Saccharomycescerevisiae unveils a complex regulatory framework of transcriptional reg-ulation. Yeast 19:923–932. http://dx.doi.org/10.1002/yea.886.

27. Roth S, Kumme J, Schüller HJ. 2004. Transcriptional activators Cat8 andSip4 discriminate between sequence variants of the carbon source-

responsive promoter element in the yeast Saccharomyces cerevisiae. Curr.Genet. 45:121–128. http://dx.doi.org/10.1007/s00294-003-0476-2.

28. Papini M, Nookaew I, Uhlén M, Nielsen J. 2012. Scheffersomyces stipitis:a comparative systems biology study with the Crabtree positive yeast Sac-charomyces cerevisiae. Microb. Cell Fact. 11:136. http://dx.doi.org/10.1186/1475-2859-11-136.

29. Devin A, Dejean L, Beauvoit B, Chevtzoff C, Avéret N, Bunoust O,Rigoulet M. 2006. Growth yield homeostasis in respiring yeast is due to astrict mitochondrial content adjustment. J. Biol. Chem. 281:26779 –26784. http://dx.doi.org/10.1074/jbc.M604800200.

30. Raab AM, Gebhardt G, Bolotina N, Weuster-Botz D, Lang C. 2010.Metabolic engineering of Saccharomyces cerevisiae for the biotechnologicalproduction of succinic acid. Metab. Eng. 12:518 –525. http://dx.doi.org/10.1016/j.ymben.2010.08.005.

31. Christen S, Sauer U. 2011. Intracellular characterization of aerobic glu-cose metabolism in seven yeast species by 13C flux analysis and metabolo-mics. FEMS Yeast Res. 11:263–272. http://dx.doi.org/10.1111/j.1567-1364.2010.00713.x.

32. Vemuri GV, Eiteman MA, McEwen JE, Olsson L, Nielsen J. 2007.Increasing NADH oxidation reduced overflow metabolism in Saccharo-myces cerevisiae. Proc. Natl. Acad. Sci. U. S. A. 104:2402–2407. http://dx.doi.org/10.1073/pnas.0607469104.

33. Bonander N, Ferndahl C, Mostad P, Wilks MD, Chang C, Showe L,Gustafsson L, Larsson C, Bill RM. 2008. Transcriptome analysis of arespiratory Saccharomyces cerevisiae strain suggests the expression of itsphenotype is glucose insensitive and predominantly controlled by Hap4,Cat8, and Mig1. BMC Genomics 9:365. http://dx.doi.org/10.1186/1471-2164-9-365.

Triggering Respirofermentative Metabolism in Yeast

July 2014 Volume 80 Number 13 aem.asm.org 3887

on August 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from