Triacetin-based acetate supplementation as a chemotherapeutic adjuvant therapy in glioma

Triacetin-based acetate supplementation as a chemotherapeutic

adjuvant therapy in glioma

Andrew R. Tsen1#

, Patrick M. Long2#

, Heather E. Driscoll3, Matthew T. Davies

2, Benjamin A.

Teasdale2, Paul L. Penar

1, William W. Pendlebury

4, Jeffrey L. Spees

5, Sean E. Lawler

6,

Mariano S. Viapiano6, and Diane M. Jaworski*

2.

1University of Vermont (UVM) College of Medicine (COM) Department of Surgery Division

of Neurosurgery, Burlington, VT 05405; 2UVM COM Department of Neurological Sciences;

3Vermont Genetics Network, Norwich University, Northfield, VT 05663;

4UVM COM

Department of Pathology; 5UVM COM Department of Medicine;

6Brigham and Women's

Hospital Department of Neurosurgery, Boston MA, 02215.

# Denotes equal contribution

Running Title: Triacetin induces glioma cytostasis

Keywords: aspartoacylase; epigenetics; glioblastoma; glioma; glyceryl triacetate;

metabolism; oligodendroglioma; Triacetin

*Address all correspondence to:

Dr. Diane M. Jaworski

Department of Neurological Sciences

University of Vermont College of Medicine

149 Beaumont Ave., HSRF 418

Burlington, VT 05405

Phone: (802) 656-0538

Fax: (802) 656-4674

E-Mail: [email protected]

Word count (text body): 3,487

Number of Figures: 6

Number of Tables: 0

Number of Supplementary Figures, Tables: 6, 1

What's new?

Cancer is associated with global hypoacetylation and aerobic glycolysis; yet, studies have not

investigated acetate supplementation as a therapeutic approach. We demonstrate that

aspartoacylase, the enzyme that catabolizes N-acetyl-L-aspartate, the primary storage form of

acetate in the brain, is reduced in glioma tumors. Furthermore, using oligodendroglioma- and

glioblastoma-derived glioma stem-like cells (GSCs), we show that the food additive Triacetin

(glyceryl triacetate) induces GSC growth arrest in vitro and potentiates the chemotherapeutic

effects of temozolomide in orthotopic grafts. These pre-clinical data warrant the further

examination of Triacetin as a chemotherapeutic adjuvant.

International Journal of Cancer

This article has been accepted for publication and undergone full peer review but has not beenthrough the copyediting, typesetting, pagination and proofreading process which may lead todifferences between this version and the Version of Record. Please cite this article as an‘Accepted Article’, doi: 10.1002/ijc.28465

2

Abstract

Cancer is associated with epigenetic (i.e., histone hypoacetylation) and metabolic (i.e.,

aerobic glycolysis) alterations. Levels of N-acetyl-L-aspartate (NAA), the primary storage

form of acetate in the brain, and aspartoacylase (ASPA), the enzyme responsible for NAA

catalysis to generate acetate, are reduced in glioma; yet, few studies have investigated acetate

as a potential therapeutic agent. This preclinical study sought to test the efficacy of the food

additive Triacetin (glyceryl triacetate, GTA) as a novel therapy to increase acetate

bioavailability in glioma cells. The growth-inhibitory effects of GTA, compared to the

histone deacetylase inhibitor Vorinostat (SAHA), were assessed in established human glioma

cell lines (HOG and Hs683 oligodendroglioma, U87 and U251 glioblastoma) and primary

tumor-derived glioma stem-like cells (GSCs), relative to an oligodendrocyte progenitor line

(Oli-Neu), normal astrocytes, and neural stem cells (NSCs) in vitro. GTA was also tested as a

chemotherapeutic adjuvant with temozolomide (TMZ) in orthotopically grafted GSCs. GTA

induced cytostatic growth arrest in vitro comparable to Vorinostat, but, unlike Vorinostat,

GTA did not alter astrocyte growth and promoted NSC expansion. GTA alone increased

survival of mice engrafted with glioblastoma GSCs and potentiated TMZ to extend survival

longer than TMZ alone. GTA was most effective on GSCs with a mesenchymal cell

phenotype. Given that GTA has been chronically administered safely to infants with Canavan

disease, a leukodystrophy due to ASPA mutation, GTA-mediated acetate supplementation

may provide a novel, safe chemotherapeutic adjuvant to reduce the growth of glioma tumors,

most notably the more rapidly proliferating, glycolytic, and hypoacetylated mesenchymal

glioma tumors.

Page 2 of 39

John Wiley & Sons, Inc.


3

Abbreviations: acetyl-CoA - acetyl-coenzyme A, AceCS1 - acetyl-coenzyme A synthetase-1,

AceCS2 - acetyl-coenzyme A synthetase-2, ASPA - aspartoacylase, DM - differentiation

medium, DMEM - Dulbecco’s Modified Eagle Medium, FBS - fetal bovine serum, GBM -

glioblastoma, GFAP - glial fibrillary acidic protein, GSC - glioma stem-like cell, GTA -

glyceryl triacetate, MGMT - O6-methylguanine-methyltransferase, NAA - N-acetyl-L-

aspartate, NSC - neural stem cell, OPC - oligodendrocyte progenitor cell, PCA- principal

component analysis, PCR - polymerase chain reaction, PDGFRα - platelet-derived growth

factor receptor alpha, REMBRANDT - Repository for Molecular Brain Neoplasia Data,

SAHA - suberoylanilide hydroxamic acid, SCM - stem cell medium, SNP - single nucleotide

polymorphism, TMZ - temozolomide

Page 3 of 39



4

Introduction

Median survival for patients with high-grade glioma (i.e., glioblastoma [GBM, WHO

grade IV astrocytoma] and anaplastic oligodendroglioma without loss of heterozygosity of 1p

and 19q) is approximately 14 months.1, 2

Despite multimodal therapeutic approaches, tumor

recurrence is almost inevitable, with post-surgical persistence of chemoradioresistant glioma

stem-like cells (GSCs) being a contributing factor.3 Therapies targeting GSCs, while sparing

normal brain cells, are therefore of considerable interest.

Acetate supplementation may prove to be a novel efficacious therapeutic strategy for

glioma since it acts at the intersection of epigenetics and metabolism, two hallmarks of

aggressive tumor growth. The key component of this system is acetyl-coenzyme A (acetyl-

CoA) which is required for protein acetylation reactions, including histone acetylation, and

mitochondrial bioenergetics. In the human brain, N-acetyl-L-aspartate (NAA) is the most

concentrated source of acetate (~ 10 mM).4 Aspartoacylase (ASPA) catalyzes the breakdown

of NAA, its only known substrate5, to L-aspartate and acetate. L-aspartate is then used in

protein synthesis and the Krebs cycle, while acetate is converted to acetyl-CoA via

cytosolic/nuclear acetyl-CoA synthetase-1 (AceCS1) for lipid biosynthesis and histone/protein

acetylation and mitochondrial AceCS2 for ATP production.6, 7

NAA levels are decreased in

glioma8, thus reducing acetate bioavailability. NAA supplementation using mono-methyl

NAA, which crosses membranes, is one possible approach. However, we recently

demonstrated that treatment with physiological levels of NAA increased GSC proliferation in

vitro 9; thus, another acetate source which freely penetrates the blood-brain barrier is required.

Triacetin (glyceryl triacetate, GTA) is ideal for therapeutic acetate supplementation since

it freely crosses the blood-brain barrier/plasma membrane and is hydrolyzed to glycerol and

Page 4 of 39



5

acetate by non-specific lipases and esterases in all cell types. This preclinical study sought to

compare the in vitro growth effects of GTA on established glioma cells lines and tumor-

derived GSCs relative to neural stem cells (NSCs), astrocytes, and an oligodendrocyte

progenitor cell line (OPC, Oli-Neu).10

Since it has been reported that GTA can increase

histone acetylation11, 12

, its growth effect was compared to the histone deacetylase inhibitor

(HDACi) Vorinostat (suberoylanilide hydroxamic acid, SAHA) which is currently in glioma

clinical trials.13, 14

GTA induced cytostatic growth arrest of glioma cells, but had no effect on

NSCs or astrocytes, whereas SAHA negatively affected growth of all cells. In orthotopic

xenografts, GTA enhanced temozolomide (TMZ) chemotherapeutic efficacy to reduce tumor

volume and prolong survival relative to TMZ alone, suggesting that GTA may be an

efficacious glioma chemotherapeutic adjuvant.

Page 5 of 39



6

Materials and Methods

Detection of ASPA expression

ASPA mRNA expression in glioma relative to normal brain (pathologically normal tissue

from patients undergoing surgery for epilepsy) was assessed by quantitative real-time PCR

(Hs00163703_m1; Applied Biosystems; Carlsbad, CA) using ribosomal RNA control reagents

according to manufacturer’s instructions.

SDS-PAGE (25 µg protein from whole cell lysates) and western blotting15

,

immunohistochemical analysis of human tissue16

, and immunocytochemistry17

were

performed as described. The following antibodies were used: goat anti-human actin (1,000X,

sc-1616 Santa Cruz Biotechnology; Santa Cruz, CA), rabbit anti-human ASPA (500X;

GTX13389 GeneTex; Irvine, CA), rabbit anti-mouse 2',3'-Cyclic-Nucleotide 3'-

Phosphodiesterase (CNPase, 250X; sc-30158 Santa Cruz Biotechnology), mouse anti-porcine

glial fibrillary acidic protein (GFAP, 5,000X; G3893 Sigma; St. Louis, MO), and rat anti-

bovine myelin basic protein (MBP, 25X; ab7349 Abcam). Species-specific Cy3-conjugated

(500X) and Cy2-conjugated (100X) secondary antibodies were obtained from Jackson

ImmunoResearch (West Grove, PA).

Cell Culture

HOG cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented

with 5% fetal bovine serum (FBS). Hs683, U87, and U251 cells were grown in DMEM with

10% FBS. The Oli-Neu cell line was grown on poly-L-lysine (10 µg/ml) coated dishes in

SATO growth medium.10

Human cerebral cortical astrocytes (HA#1800 ScienCell; Carlsbad,

CA) were cultured in basal medium with 2% FBS and astrocyte growth supplement

Page 6 of 39



7

(AM#1801 ScienCell). Mouse neural stem cells (NSCs) from postnatal day 4 cortex were

prepared as described.18

GSCs were isolated from surgical specimens (detailed in

Supplementary Methods) using previously described methodology.19

NSCs and GSCs were

maintained in stem cell medium (SCM) consisting of DMEM/F12, 1X B27 supplement, 20

ng/ml epidermal growth factor and 20 ng/ml basic fibroblast growth factor on non-adhesive

plastic. GSC differentiation was induced using DMEM with 10% FBS. All media contained

50 U/ml penicillin and 50 µg/ml streptomycin and was replenished every 48 hours. Cells

were grown in the absence or presence of 0.25% GTA or 1 µM SAHA (both from Sigma).

The GTA concentration was selected based on a dose response with GBM12 GSCs

(Supporting Information Fig. S1). The SAHA concentration was selected because it is

associated with increased histone acetylation, but not alterations in adhesion or cytotoxicity.20,

21 Growth dynamics were assessed using unbiased trypan blue exclusion based cytometry.

Growth conditions are presented in greater detail in Supplementary Methods.

DNA Analysis

Cell line validation by STR DNA fingerprinting, single nucleotide polymorphism (SNP)

mapping, reverse transcription PCR to characterize proneural versus mesenchymal antigenic

profile, and methylation specific PCR to assess O6-methylguanine-methyltransferase

(MGMT) promoter status were performed as detailed in Supplementary Methods.

Cell Cycle Analysis

Cell cycle profiles were visualized by propidium iodide (PI) staining as described22

with

minor modifications (106

cells/ml were incubated in low-salt PI at 37°C for 20 minutes, then

an equal volume of high-salt PI was added and incubated at 4°C for 4 hours). Cell cycle

Page 7 of 39



8

profiles were recorded using the BD LSR II Flow Cytometer and analyzed using FACS Diva

7.0 software.

Orthotopic tumor model

GSCs were transduced with a lentiviral construct to express firefly luciferase as detailed in

Supplementary Methods. All procedures were conducted in accordance with institutional

guidelines for the humane care and use of animals. Orthotopic grafting was performed as

described23

and detailed further in Supplementary Methods. GTA (5.0 g/kg with 10% v/v

Ora-Sweet SF) was administered intragastrically once per day starting on the third post-

operative day. TMZ (20 mg/kg) was administered intragastrically in an oral suspension

vehicle containing 2.5 mg/ml Povidone K30, 0.013% citric acid, 50% Ora-Plus, 50% Ora-

Sweet SF (Paddock Labs via Apotheca Inc.; Phoenix, AZ)24

on days 5, 7, 9, 11, and 13. Mice

receiving the "primed" combined GTA/TMZ therapy began GTA treatment on day 3 then

received the TMZ in the morning and GTA in the evening on days 5, 7, 9, 11, and 13 with

GTA alone given on days 6, 8, 10, 12 and day 14 onwards. For "concurrent" combination

therapy, GTA and TMZ were both begun on day 5, while for "salvage" therapy GTA was

administered daily after the completion of TMZ on day 13. Control mice received the oral

suspension alone.

In vivo bioluminescent imaging was performed using the Xenogen IVIS 200 imaging

system as detailed in Supplementary Methods. Mice were euthanized when they displayed

neurological signs (e.g., altered gait, tremors/seizures, lethargy) or weight loss of 20% or

greater of pre-surgical weight. Tumor volumetric measurements were performed using

unbiased stereology as described25

and detailed in Supplementary Methods.

Page 8 of 39



9

Statistical Analysis

Analyses were conducted by individuals blinded to treatment group. Data are expressed

as mean ± standard error of the mean. Significant differences were determined by either one-

way or two-way ANOVA and Bonferroni multiple comparison tests using Prism software

(GraphPad; San Diego, CA). p < 0.05 was considered statistically significant.

Page 9 of 39



10

Results

ASPA expression is decreased in glioma

Previously, we demonstrated that ASPA expression was decreased in neuroblastoma.16

Given the abundant ASPA expression in the central nervous system26

, we sought to assess

whether ASPA expression was dysregulated in glioma. Quantitative PCR revealed decreased

ASPA mRNA in glioma compared with normal brain (Fig. 1a). Microarray data from the

REMBRANDT (Supporting Information Fig. S2a) and TGCA (Supporting Information Fig.

S2b) databases corroborated decreased ASPA mRNA expression, which was independent of

tumor subtype (Supporting Information Fig. S2c) or isocitrate dehydrogenase 1 mutation

status (Supporting Information Fig. S2d). Western blot analysis confirmed decreased ASPA

expression in glioma (Fig. 1b). In the rodent brain, ASPA is most prominently expressed by

oligodendrocytes26

and dual-label immunohistochemistry with CNPase confirmed this pattern

of ASPA expression in normal human cortex (Fig. 1c). In contrast, ASPA expression was

significantly reduced in oligodendroglioma tumors. Similarly, ASPA expression was detected

in GFAP-positive astrocytes in normal human cortex, but not in GBM tumors. The net result

of decreased ASPA and its substrate, NAA, in glioma is reduced acetate bioavailability.

GTA induces growth arrest of glioma-derived stem-like cells, but not neural stem cells

To determine whether differences in GTA responsiveness were correlated with

chromosomal alterations, all cells used in this study, established oligodendroglioma cells

(HOG, Hs683) relative to tumor-derived oligodendroglioma GSCs (grade II OG33, grade III

OG35) and established GBM cells (U87, U251) relative to six tumor-derived GBM GSCs,

were subjected to in-depth DNA analysis. The STR DNA fingerprint for the commercially

available cells matched their known DNA fingerprint, while the profiles of the tumor-derived

Page 10 of 39



11

GSCs did not match known DNA fingerprints (Supporting Information Table S1).

Surprisingly, the STR profiles for HOG, OG33, GBM9, GBM12, and GBM34 were identical

even though each displayed distinct growth characteristics and morphology upon growth

factor withdrawal (Fig. 4). Thus, DNA mapping for chromosomal copy variation using

GeneChip® 250K Nsp arrays was undertaken (Fig. 2a, Supporting Information Figs. S3A-E).

Principal component analysis (PCA) with the SNP raw intensity data grouped OG33, OG35,

and HOG cells together (Fig. 2a) and copy number analysis identified similar, but not

identical, amplifications and deletions for these samples (Fig. S3). Although Hs683 cells

were established from a GBM, they display oligodendroglioma features27

; yet, they failed to

cluster either with oligodendroglioma or astrocytoma cells in the PCA plot. The GBM GSCs

clustered into one group (GBM9, GBM12, GBM34) that expressed antigenic features

indicative of a mesenchymal profile (i.e., BCL2A1, WT1, CD44, and CD44v628

expression)

and a second group (GBM2, GBM8, GBM44) that exhibited a proneural profile (i.e., CD133,

Notch1, SOX2, PDGFR-α, Nestin, and Olig2 expression) (Fig. 2b). U87 and U251 cells were

more similar to proneural GSCs than mesenchymal GSCs. Thus, we propose that STR

profiling and SNP karyotyping can be used to distinguish GSCs with proneural or

mesenchymal GBM features.

First, the growth effects of 0.25% GTA and 1µM SAHA were assessed by flow cytometric

analysis (Fig. 3a). GTA treatment for 24 hours induced cytostatic G0 growth arrest which was

more pronounced in GSCs than established cell lines and within GSCs was more pronounced

in cells with a mesenchymal profile (GBM12, 34, 9). Continuous treatment was associated

with reduced viability of SAHA treated, but not GTA treated cells (e.g., percent viable cells in

Page 11 of 39



12

GBM44 at 5 day: control 93.5 ± 1.89%; GTA 94.17 ± 1.49%, p=0.78; SAHA 78.8 ± 3.86%,

p=0.006) (Fig. 3b).

Next, the long-term growth inhibitory effects of GTA and SAHA were assessed by

unbiased cytometry over 5 days of treatment (Figs. 4a, b). In SCM, prolonged GTA treatment

was associated with reduced growth of all glioma cells except the GBM GSCs with a

proneural phenotype (Fig. 4a). In contrast, GTA had no effect on astrocytes and even

increased NSC proliferation. The apparent GTA-mediated growth reduction of Oli-Neu cells

may be due to decreased cell adhesion (Supporting Information Fig. S4). However, when

treated in differentiation medium (DM), GTA, but not SAHA, reduced the growth of OG33

and OG35 GSCs (Fig. 4b). In addition, GTA more profoundly reduced cell growth than

SAHA of the 3 mesenchymal GSCs and was as effective as SAHA in growth reduction of the

3 proneural GSCs. Interestingly, the growth rate of the 3 mesenchymal GSCs (GBM12,

GBM34, GBM9) increased while the growth rate of the 3 proneural GSCs (GBM8, GBM44,

GBM2) decreased in DM relative to SCM. Thus, the differentiation potential of the

oligodendroglioma- (Fig. 4c) and GBM-derived (Fig. 4d) GSCs were examined after 3 days in

DM. OG33 and OG35 GSCs are NG2-positive and PDGFRα-positive cells in SCM (not

shown) that express a low level of CNPase, but not myelin basic protein in DM. The

proneural GSCs (GBM8, GBM44, GBM2) differentiated into GFAP-positive astrocytes,

strongly immunoreactive CNPase-positive oligodendrocytes (Fig. 4d), and class III β-tubulin-

positive neurons (not shown). In contrast, the mesenchymal GSCs (GBM12, GBM34,

GBM9) failed to express markers of differentiation (Fig. 4d) and were immunoreactive for the

proliferation marker Ki67 (not shown) despite growth in differentiation permissive conditions.

Taken together, these data support the use of GTA as a cytostatic agent for the treatment of

Page 12 of 39



13

the most aggressive mesenchymal GSCs and their differentiated progeny without affecting

normal brain cells.

GTA enhances TMZ chemotherapeutic efficacy

Inasmuch as in vitro self-renewal is only one defining feature of GSCs, the tumorigenicity

of the most aggressive GSCs (OG35, GBM12), as well as the growth inhibitory effects of

GTA, was investigated. These GSCs exhibited MGMT promoter methylation (Supporting

Information Fig. S5), suggesting chemosensitivity. Since this represents the first report of

OG33 and OG35 GSC xenografting, OG33 tumorigenicity was also established (Supporting

Information Fig. S6). GTA treatment had no effect on the rate of bioluminescence increase or

survival of mice engrafted with OG33 GSCs.

GTA increased the efficacy of TMZ in mice engrafted with OG35 GSCs (Fig. 5,

previously published as an abstract29

). Because GTA provides metabolizable carbons and

weight loss is a euthanasia criterion, blood glucose levels were monitored, but no differences

were observed among treatment groups (Fig. 5a). GTA alone had no effect on survival or

tumor volume relative to vehicle treated mice (Figs. 5a, c, d). However, when examined by a

neuropathologist, reduced mitotic labeling was present in GTA, TMZ, and GTA/TMZ treated

tumors (Fig. 5b), which was confirmed by Ki67 immunolabeling (not shown). As expected

from the MGMT status, TMZ reduced tumor bioluminescence (Figs. 5a, c) and increased

survival (Figs. 5a, d). The study was negatively biased by assigning mice with the greatest

initial bioluminescence to the GTA/TMZ treatment group (Figs. 5a, c: Initial Flux). Even

though GTA/TMZ treatment did not reduce end-point tumor volume relative to TMZ alone, it

significantly reduced tumor bioluminescence (Fig. 5c) and increased survival (Fig. 5d),

suggesting efficacy as a chemotherapeutic adjuvant. Moreover, survival is underestimated

Page 13 of 39



14

since the study was terminated at 40 days when 3 of 10 GTA/TMZ treated mice failed to

redevelop flux. These mice also showed no histological signs of tumor at study termination.

Based on the hypothesis that GTA acetylates histones to promote an open, euchromatic state11,

12, GTA was administered for two days prior to TMZ (primed therapy). When compared to

concurrent (i.e., GTA and TMZ initiated on day 5) and salvage (i.e., GTA administered after

completion of TMZ) therapy, only the primed treatment regimen was associated with

increased survival relative to TMZ alone (Fig. 5d), supporting the hypothesis that GTA should

be administered prior to TMZ to exert maximal therapeutic effect.

Inasmuch as the mesenchymal GBM subtype is more treatment resistant, the anti-

proliferative effect of GTA was assessed on the most aggressive GBM GSCs, GBM12 (Fig. 6).

GBM12 vehicle treated mice possessed large tumors with invasive foci and hemorrhagic cores

and only survived ~13 days. GTA alone did not alter blood glucose, bioluminescence, or end-

point tumor volume; however, GTA increased survival (Fig. 6c). TMZ reduced

bioluminescence (Fig. 6c) and end-point tumor volume (not shown). GTA did not enhance

TMZ chemotherapeutic effect on tumor volume compared to TMZ alone (Fig. 6c).

Nonetheless, GTA/TMZ significantly increased survival, with 2 of 8 mice never redeveloping

measurable flux or displaying histological signs of tumor at study termination. In sum, GTA

induces cytostatic growth arrest of oligodendroglioma-derived and GBM-derived GSCs in

vitro comparable to that of SAHA, but, unlike SAHA, GTA had little to no effect on normal

cells. More strikingly, when administered prior to TMZ, GTA enhances chemotherapeutic

efficacy on orthotopic tumors and/or increases survival, suggesting efficacy as a

chemotherapeutic adjuvant.

Page 14 of 39



15

Discussion

This represents the first report detailing decreased ASPA expression in glioma tumors.

Inasmuch as ASPA was previously thought to be an oligodendrocyte-restricted enzyme, it

would not be unexpected to be decreased in astrocytoma tumors. However, we detected

ASPA immunoreactivity in human cortical astrocytes and primary cultured human astrocytes.

Moreover, ASPA was also decreased in oligodendroglioma tumors, not increased as would be

expected for an oligodendrocyte mass. We propose that decreased ASPA expression

primarily occurs within the tumor bulk, but is expressed by GSCs to maintain their

undifferentiated state. Inasmuch as acetate serves as a substrate for lipogenesis, which

promotes anabolic growth of tumor cells30

, and as a metabolic substrate for astrocytes, it is

counter-intuitive that acetate supplementation decreases tumor growth.

We propose that GTA exploits the link between histone acetylation and cellular

metabolism in glioma therapy and functions via an epigenetic mechanism. Promoter CpG

hypermethylation is coupled to histone hypoacetylation and poorer clinical outcomes.31

Because AceCS1-dependent acetyl-CoA synthesis is energy-dependent, most nuclear acetyl-

CoA for histone acetylation under normal nutrient conditions is derived from citrate via ATP-

citrate lyase.32

However, in highly proliferative, glycolytically converted tumor cells,

mitochondrial citrate is exported to the cytosol to support biomass accumulation for

proliferation. GTA may permit citrate to remain within the mitochondria and promote

oxidative phosphorylation, while GTA-derived acetate promotes AceCS1-dependent acetyl-

CoA synthesis and histone acetylation. Studies by Rosenberger and colleagues have

demonstrated that GTA promotes histone acetylation.11, 12

Preliminary mass spectrometry

analysis of GTA treated GBM12 GSCs indicates increased H4K16 acetylation as well as

Page 15 of 39



16

acetylation of several other proteins involved in cell cycle regulation (Lam & Jaworski,

unpublished observation). Notably, H4K16 acetylation is an important epigenetic mark of

actively transcribed euchromatin and loss of H4K16 acetylation is a common hallmark of

cancer.33

We believe that GTA exerted the most profound growth inhibitory effects on GSCs

with a mesenchymal phenotype because these cells exhibit the most glycolytic state34

and,

thus, display greater histone hypoacetylation. The superior effectiveness of GTA over

calcium acetate35

suggests that GTA has better absorption and/or GTA acts as an HDACi in

its unhydrolyzed form. Similar to butyrate, GTA may exert both acetyl-CoA/histone

acetyltransferase-dependent acetylation and HDAC inhibition based on the metabolic state of

a cell.36

Short-term GTA treatment (2 and 4 hours) was associated with a two-fold increase in

HDAC activity11

; thus, raising the possibility that GTA acts as an HDACi. Preliminary

studies demonstrate that GTA is more effective at growth inhibition than 36 mM sodium

acetate (equivalent acetate to 0.25% GTA), again supporting the hypothesis that GTA may

exert functions other than as an acetate source (unpublished observation). However, long-

term GTA treatment did not alter HDAC activity12

; thus, further in vitro studies will be

needed to determine whether GTA functions directly as an HDACi. Interestingly, the

mesenchymal GSCs display self-renewal and formation of aggressive orthotopic tumors, but

exhibit reduced differentiation capacity relative to proneural GSCs (Figs. 4c, d). Hence,

unlike SAHA which promotes differentiation, the anti-tumorigenic effect of GTA is likely not

due to the promotion of GSC differentiation. Based on reports of mesenchymal

differentiation of GSCs 37-39

, we tested the adipogenic and osteogenic differentiation ability of

the GBM9, GBM12, and GBM34 GSCs. This, as well as inhibition of PI3K/Akt, mTOR, and

ERK signaling, either singly or in combinations, failed to promote differentiation

Page 16 of 39



17

(unpublished observation). This suggests that mesenchymal tumors may be more treatment

resistant due to a bias toward self-renewal and sustained repression of differentiation genes.40-

42

The simplest explanation for the increased TMZ efficacy in GTA treated mice is that GTA

functions as an excipient (i.e., a "Trojan horse" carrying TMZ). Although our GTA/TMZ

therapy subjects mice to gavaging twice daily, we believe that the morning TMZ has

undergone absorption prior to the evening GTA, reducing the possibility of GTA binding to

TMZ and promoting its transport through the BBB. We acknowledge that GTA likely exerts

pleiotropic effects. In addition to regulating protein acetylation and metabolism, GTA exerts

anti-inflammatory effects12

and increases plasma ketones and resting energy.43

Thus, GTA

may promote a metabolic state that is less conducive to glioma growth. In fact, the ketogenic

diet has shown promising therapeutic results44

and we do not exclude that some of the GTA-

mediated survival is due to less weight loss. Hence, GTA may be an effective therapy for

cancer cachexia.

GTA is an FDA approved food additive with “generally regarded as safe” status that has

been tested for parenteral nutrition in a wide variety of species with no adverse effects.45

It

may be necessary to chronically administer GTA since continuous histone hyperacetylation is

critical for SAHA's effects. 46

Infants with Canavan disease have been chronically treated

with high dose GTA (4.5 g/kg/day, similar to the dose administered in our orthotopic model)

and showed no hepatotoxicity or significant side effects.47

In contrast, SAHA is associated

with cardiotoxicity, anemia, and thrombocytopenia.13, 48

While GTA alone increased survival

of GBM12 mice, it is GTA's ability to enhance TMZ's effects that is most clinically relevant.

Unfortunately, resistance limits the therapeutic benefit of TMZ. Our GSCs exhibit MGMT

Page 17 of 39



18

methylation and, thus, are TMZ responsive. However, DNA methylation does not stably lock

gene expression since continuous histone hyperacetylation potentiates acquired TMZ

resistance via up-regulation of MGMT expression without altering promoter methylation.49, 50

If GTA does not similarly promote TMZ resistance, it may prove more effective than SAHA.

We are highly encouraged that GTA showed growth arrest of the more aggressive

mesenchymal GSCs and that its effects positively correlated with proliferation rate. Moreover,

that the growth inhibitory effect was not dependent of GSC differentiation. Hence, we assert

that further investigations of GTA as a chemotherapeutic adjuvant are warranted.

Page 18 of 39



19

Acknowledgements

This work was supported by R01NS045225 co-funded by NINDS and NCRR, and Pilot

Project grants from the Vermont Cancer Center/Lake Champlain Cancer Research

Organization, Neuroscience COBRE (NIH NCRR P20 RR016435), and UVM College of

Medicine (DMJ). Facilities and equipment supported by the Neuroscience COBRE Molecular

Core Facility (NIH NCRR P20 RR016435), Vermont Cancer Center DNA Analysis Facility

(NIH P30 CA22435), Vermont Genetics Network Bioinformatics Core and Microarray

Facility (NIH NIGMS 8P20GM103449), and The Penelope and Sam Fund of the Vermont

Cancer Center were instrumental to the completion of the study.

The corresponding author wishes to thank Professor Dylan R. Edwards and Dr. Caroline J.

Pennington (University of East Anglia School of Biological Sciences, Norwich UK) for the

fabulous sabbatical experience performing the TLDA-based degradome profiling that

identified ASPA dysregulation in glioma, Drs. William C. Broaddus and Helen L. Fillmore

(Virginia Commonwealth University Division of Neurosurgery) for providing the necessary

surgical samples, and Dr. John R. Moffett (Uniformed Services University of the Health

Sciences Department of Anatomy, Physiology & Genetics) for insightful discussions

regarding NAA metabolism and therapeutic uses of GTA. We acknowledge Dr. Glyn

Dawson (University of Chicago Department of Pediatrics) for kindly providing the HOG cell

line, Dr. Antonio Chiocca (Brigham and Women's Hospital Department of Neurosurgery) for

kindly providing the GSCs, and Dr. Bin Hu (Ohio State University Department of

Neurological Surgery) for determining the GSC MGMT methylation status.

Conflict of Interest Statement

No conflicts of interest, financial or otherwise, are declared by the authors.

Page 19 of 39



20

References

1. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, Belanger K,

Brandes AA, Marosi C, Bogdahn U, Curschmann J, Janzer RC, et al. Radiotherapy plus

concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352:987-96.

2. Parkinson JF, Afaghi V, Payne CA, Buckland ME, Brewer JM, Biggs MT, Little NS,

Wheeler HR, Cook RJ, McDonald KL. The impact of molecular and clinical factors on

patient outcome in oligodendroglioma from 20 years' experience at a single centre. J Clin

Neurosci 2011;18:329-33.

3. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM,

Cusimano MD, Dirks PB. Identification of human brain tumour initiating cells. Nature

2004;432:396-401.

4. Rigotti DJ, Kirov II, Djavadi B, Perr yN, Babb JS, Gonen O. Longitudinal whole-brain N-

acetylaspartate concentration in healthy adults. AJNR Am J Neuroradiol 2011;32:1011-5.

5. Kaul R, Casanova J, Johnson AB, Tang P, Matalon R. Purification, characterization, and

localization of aspartoacylase from bovine brain. J Neurochem 1991;56:129-35.

6. Goldberg RP, Brunengraber H. Contributions of cytosolic and mitochondrial acetyl-CoA

syntheses to the activation of lipogenic acetate in rat liver. Adv Exp Med Biol

1980;132:413-8.

7. Fujino T, Kondo J, Ishikawa M, Morikawa K, Yamamoto TT. Acetyl-CoA synthetase 2, a

mitochondrial matrix enzyme involved in the oxidation of acetate. J Biol Chem

2001;276:11420-6.

8. Moffett JR, Ross B, Arun P, Madhavarao CN, Namboodiri AM. N-Acetylaspartate in the

CNS: from neurodiagnostics to neurobiology. Prog Neurobiol 2007;81:89-131.

Page 20 of 39



21

9. Long PM, Moffett JR, Namboodiri AMA, Viapiano MS, Lawler SE, Jaworski DM. N-

acetylaspartate (NAA) and N-acetylaspartylglutamate (NAAG) promote growth and

inhibit differentiation of glioma stem-like cells. J Biol Chem 2013;published on-line July

24, 2013 as doi:10.1074/jbc.M113.487553.

10. Trotter J, Bitter-Suermann D, Schachner M. Differentiation-regulated loss of the

polysialylated embryonic form and expression of the different polypeptides of the neural

cell adhesion molecule by cultured oligodendrocytes and myelin. J Neurosci Res

1989;22:369-83.

11. Soliman ML, Rosenberger TA. Acetate supplementation increases brain histone

acetylation and inhibits histone deacetylase activity and expression. Mol Cell Biochem

2011;352:173-80.

12. Soliman ML, Smith MD, Houdek HM, Rosenberger TA. Acetate supplementation

modulates brain histone acetylation and decreases interleukin-1β expression in a rat model

of neuroinflammation. J Neuroinflammation 2012;9:51.

13. Galanis E, Jaeckle KA, Maurer MJ, Reid JM, Ames MM, Hardwick JS, Reilly JF, Loboda

A, Nebozhyn M, Fantin VR, Richon VM, Scheithauer B, et al. Phase II trial of vorinostat

in recurrent glioblastoma multiforme: a north central cancer treatment group study. J Clin

Oncol 2009;27:2052-8.

14. Lee EQ, Puduvalli VK, Reid JM, Kuhn JG, Lamborn KR, Cloughesy TF, Chang SM,

Drappatz J, Yung WK, Gilbert MR, Robins HI, Lieberman FS, et al. Phase I study of

vorinostat in combination with temozolomide in patients with high-grade gliomas: North

American Brain Tumor Consortium Study 04-03. Clin Cancer Res 2012;18:6032-9.

Page 21 of 39



22

15. Lluri G, Langlois GD, Soloway PD, Jaworski DM. Tissue inhibitor of metalloproteinase-2

(TIMP-2) regulates myogenesis and b1 integrin expression in vitro. Exp Cell Res

2008;314:11-24.

16. Long PM, Stradecki HM, Minturn JE, Wesley UV, Jaworski DM. Differential

aminoacylase expression in neuroblastoma. Int J Cancer 2011;129:1322-30.

17. Jaworski DM, Pérez-Martínez L. Tissue inhibitor of metalloproteinase-2 (TIMP-2)

expression is regulated by multiple neural differentiation signals. J Neurochem

2006;98:234-47.

18. Shimada IS, LeComte MD, Granger J, Quinlan NJ, Spees JL. Self-renewal and

differentiation of reactive astrocyte-derived neural stem/progenitor cells isolated from

cortical peri-infarct tissues after stroke. J Neurosci 2012;32:7926-40.

19. Godlewski J, Nowicki MO, Bronisz A, Williams S, Otsuki A, Nuovo G, Raychaudhury A,

Newton HB, Chiocca EA, Lawler S. Targeting of the Bmi-1 oncogene/stem cell renewal

factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res

2008;68:9125-30.

20. An Z, Gluck CB, Choy ML, Kaufman LJ. Suberoylanilide hydroxamic acid limits

migration and invasion of glioma cells in two and three dimensional culture. Cancer Lett

2010;292:215-27.

21. Orzan F, Pellegatta S, Poliani PL, Pisati F, Caldera V, Menghi F, Kapetis D, Marras C,

Schiffer D, Finocchiaro G. Enhancer of Zeste 2 (EZH2) is up-regulated in malignant

gliomas and in glioma stem-like cells. Neuropathol Appl Neurobiol 2011;37:381-94.

22. Pérez-Martínez L, Jaworski DM. Tissue inhibitor of metalloproteinase-2 promotes

neuronal differentiation by acting as an anti-mitogenic signal. J Neurosci 2005;25:4917-29.

Page 22 of 39



23

23. Jaworski DM, Kelly GM, Piepmeier JM, Hockfield S. BEHAB (Brain Enriched

Hyaluronan Binding) is expressed in surgical samples of glioma and in intracranial grafts

of invasive glioma cell lines. Cancer Res 1996;56:2293-8.

24. Trissel LA, Zhang Y, Koontz SE. Temozolomide stability in extemporaneously

compounded oral suspensions. Int J Pharm Compound 2006;10: 396-9.

25. King BJ, Plante MK, Kida M, Mann-Gow TK, Odland R, Zvara P. Comparison of

intraprostatic ethanol diffusion using a microporous hollow fiber catheter versus a

standard needle. J Urol 2012;187:1898-902.

26. Moffett JR, Arun P, Ariyannur PS, Garbern J, Jacobowitz DM, Namboodiri AM.

Extensive aspartoacylase expression in the rat central nervous system. Glia 2011;59:1414-

34.

27. Lamoral-Theys D, Le Mercier M, Le Calvé B, Rynkowski MA, Bruyère C, Decaestecker

C, Haibe-Kains B, Bontempi G, Dubois J, Lefranc F, Kiss R. Long-term temozolomide

treatment induces marked amino metabolism modifications and an increase in TMZ

sensitivity in Hs683 oligodendroglioma cells. Neoplasia 2010;12:69-79.

28. Jijiwa M, Demir H, Gupta S, Leung C, Joshi K, Orozco N, Huang T, Yildiz VO,

Shibahara I, de Jesus JA, Yong WH, Mischel PS, et al. CD44v6 regulates growth of brain

tumor stem cells partially through the AKT-mediated pathway. PLoS One 2011;6:e24217.

29. Long PM, Tsen AR, Moffett JR, Namboodiri AM, Viapiano MS, Jaworski DM. Dietary

acetate supplementation as a means of inducing glioma stem cell growth arrest. Am Assoc

Cancer Res 2012;3481:12.

30. Menendez JA, Lupu R. Fatty acid synthase and the lipogenic phenotype in cancer

pathogenesis. Nat Rev Cancer 2007;7:763-77.

Page 23 of 39



24

31. Seligson DB, Horvath S, McBrian MA, Mah V, Yu H, Tze S, Wang Q, Chia D, Goodglick

L, Kurdistani SK. Global levels of histone modifications predict prognosis in different

cancers. Am J Pathol 2009;174:1619-28.

32. Wellen KE, Hatzivassiliou G, Sachdeva UM, Bui TV, Cross JR, Thompson CB. ATP-

citrate lyase links cellular metabolism to histone acetylation. Science 2009;324:1076-80.

33. Fraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, Schotta G, Bonaldi T,

Haydon C, Ropero S, Petrie K, Iyer N, Pérez-Rosado A, et al. Loss of acetylation at Lys16

and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat

Genet 2005; 37:391-400.

34. Chinnaiyan P, Kensicki E, Bloom G, Prabhu A, Sarcar B, Kahali S, Eschrich S, Qu X,

Forsyth P, Gillies R. The metabolomic signature of malignant glioma reflects accelerated

anabolic metabolism. Cancer Res 2012;72:5878-88.

35. Mathew R, Arun P, Madhavarao CN, Moffett JR, Namboodiri MA. Progress toward

acetate supplementation therapy for Canavan disease: glyceryl triacetate administration

increases acetate, but not N-acetylaspartate, levels in brain. J Pharmacol Exp Ther

2005;315:297-303.

36. Donohoe DR, Collins LB, Wali A, Bigler R, Sun W, Bultman SJ. The warburg effect

dictates the mechanism of butyrate-mediated histone acetylation and cell proliferation.

Mol Cell 2012;48:612-26.

37. Wolańczyk M, Hułas-Bigoszewska K, Witusik-Perkowska M, Papierz W, Jaskólski D,

Liberski PP, Rieske P. Imperfect oligodendrocytic and neuronal differentiation of

glioblastoma cells. Folia Neuropathol 2010;48:27-34.

Page 24 of 39



25

38. Rieske P, Golanska E, Zakrzewska M, Piaskowski S, Hulas-Bigoszewska K, Wolańczyk

M, Szybka M, Witusik-Perkowska M, Jaskolski DJ, Zakrzewski K, Biernat W, Krynska B,

et al. Arrested neural and advanced mesenchymal differentiation of glioblastoma cells-

comparative study with neural progenitors. BMC Cancer 2009;9:54.

39. Ricci-Vitiani L, Pallini R, Larocca LM, Lombardi DG, Signore M, F. P, Petrucci G,

Montano N, Maira G, De Maria R. Mesenchymal differentiation of glioblastoma stem

cells. Cell Death Differ 2008;15:1491-8.

40. Abdouh M, Facchino S, Chatoo W, Balasingam V, Ferreira J, Bernier G. BMI1 sustains

human glioblastoma multiforme stem cell renewal. J Neurosci 2009;29:8884-96.

41. Suvà ML, Riggi N, Janiszewska M, Radovanovic I, Provero P, Stehle JC, Baumer K, Le

Bitoux MA, Marino D, Cironi L, Marquez VE, Clément V, et al. EZH2 is essential for

glioblastoma cancer stem cell maintenance. Cancer Res 2009;69:9211-8.

42. Natsume A, Ito M, Katsushima K, Ohka F, Hatanaka A, Shinjo K, Sato S, Takahashi S,

Ishikawa Y, Takeuch iI, Shimogawa H, Uesugi M, et al. Chromatin regulator PRC2 is a

key regulator of epigenetic plasticity in glioblastoma. Cancer Res 2013;73:4559-70.

43. Bailey JW, Haymond MW, Miles JM. Triacetin: a potential parenteral nutrient. J Parenter

Enteral Nutr 1991;15:32-6.

44. Stafford P, Abdelwahab MG, Kim DY, Preul MC, Rho JM, Scheck AC. The ketogenic

diet reverses gene expression patterns and reduces reactive oxygen species levels when

used as an adjuvant therapy for glioma. Nutr Metab (Lond) 2010;7:74.

45. Fiume MZ, Panel. CIRE. Final report on the safety assessment of triacetin. Int J Toxicol

2003;22 Suppl 2:1-10.

Page 25 of 39



26

46. Garcia-Manero G, Yang H, Bueso-Ramos C, Ferrajoli A, Cortes J, Wierda WG, Faderl S,

Koller C, Morris G, Rosner G, Loboda A, Fantin VR, et al. Phase 1 study of the histone

deacetylase inhibitor vorinostat (suberoylanilide hydroxamic acid [SAHA]) in patients

with advanced leukemias and myelodysplastic syndromes. Blood 2008;111:1060-6.

47. Segel R, Anikster Y, Zevin S, Steinberg A, Gahl WA, Fisher D, Staretz-Chacham O,

Zimran A, Altarescu G. A safety trial of high dose glyceryl triacetate for Canavan disease.

Mol Genet Metab 2011;103:203-6.

48. Friday BB, Anderson SK, Buckner J, Yu C, Giannini C, Geoffroy F, Schwerkoske J,

Mazurczak M, Gross H, Pajon E, Jaeckle K, Galanis E. Phase II trial of vorinostat in

combination with bortezomib in recurrent glioblastoma: a north central cancer treatment

group study. Neuro Oncol 2012;14:215-21.

49. Kitange GJ, Mladek AC, Carlson BL, Schroeder MA, Pokorny JL, Cen L, Decker PA, Wu

W, Lomberk GA, Gupta SK, Urrutia RA, Sarkaria JN. Inhibition of histone deacetylation

potentiates the evolution of acquired temozolomide resistance linked to MGMT

upregulation in glioblastoma xenografts. Clin Cancer Res 2012;18:4070-9.

50. Raynal NJ, Si J, Taby RF, Gharibyan V, Ahmed S, Jelinek J, Estécio MR, Issa JP. DNA

methylation does not stably lock gene expression but instead serves as a molecular mark

for gene silencing memory. Cancer Res 2012;72:1170-81.

Page 26 of 39



27

Figure Legends

Figure 1. ASPA expression is decreased in glioma tumors. (a) Quantitative real-time PCR

revealed decreased ASPA mRNA expression in recurrent grade III oligodendroglioma,

anaplastic astrocytoma and GBM. n = 4. Refer to Supplementary Fig. 2 for analysis of

REMBRANDT and TCGA datasets. (b) Western blot (25 µg crude protein homogenate,

normalized to actin) densitometric analysis revealed that ASPA expression was decreased in

grade II (OII) and grade III (OIII) oligodendroglioma, anaplastic astrocytoma (AA) and

glioblastoma (GBM) tumors, but similar to ASPA mRNA, ASPA protein was most

significantly decreased in recurrent grade III (ReO) oligodendroglioma relative to normal (N)

brain (pathologically normal tissue from patients undergoing surgery for epilepsy). n = 6

normal, 10 GBM, and 4 all others, with 2 representative protein samples shown. (c) Dual-

label immunohistochemistry using normal human cerebral cortex (i.e., post-mortem brain)

revealed that ASPA was more abundantly expressed in CNPase-positive oligodendrocytes

within the corpus callosum (WM) than the overlying isocortex. ASPA expression was also

detected within the cortical grey matter (GM, arrowheads) by GFAP-positive astrocytes.

Immunohistochemistry using two independent tissue samples confirmed the western blot

results that GBM and grade III (GIII) oligodendroglioma tumors possess significantly fewer

ASPA immunoreactive cells. Scale bar = 100 µm (left panel), 50 µm (right panel). *p < 0.05,

#p≤ 0.001, ##p ≤ 0.0001.

Page 27 of 39



28

Figure 2. Characterization of GSC genetic profile by whole genome cytogenetic analysis and

PCR. (a) Principal component analysis (PCA) of SNP raw intensity data from GeneChip®

Human Mapping 250K Nsp Arrays revealed that the established GBM cell lines U87 and

U251 share similar gene amplifications/deletions to the proneural GSCs (GBM44, GBM8, and

GBM2). The oligodendroglioma-derived cells (grade II OG33 and grade III OG35 GSCs and

the HOG established oligodendroglioma cell line) were more similar to mesenchymal GBM

GSCs (GBM12, GBM9, and GBM34). The Hs683 cell line, which was derived from a GBM

tumor, but shares features of oligodendroglioma tumors, failed to cluster with either tumor

type. (b) PCR was performed with a panel of well-accepted markers of proneural (e.g.,

CD133, Notch1, SOX2, PDGRFα, Nestin, and Olig2) and mesenchymal (e.g., BCL2A1, WT1,

CD44, and CD44v6) glioma phenotypes. Although this analysis is non-quantitative, these

markers display distinct bimodal expression patterns. Similar to STR profiling

(Supplementary Table 1), PCR profiling confirms that GBM12, GBM34, and GBM9 GSCs

exhibit a mesenchymal signature, while GBM8, GBM44, and GBM2 GSCs exhibit a

proneural signature. In keeping with their oligodendroglial origin, OG33 and OG35 GSCs

express PDGFRα and NG2 (not shown), but otherwise exhibit a mesenchymal signature.

Page 28 of 39



29

Figure 3. GTA induces G0 growth arrest of established glioma cell lines and primary tumor-

derived GSCs in vitro. (a) Cell cycle profile of PI-labeled cells in growth/stem cell medium

after 24 hours of 1 µM SAHA or 0.25% GTA treatment. GTA induced G0 growth arrest of all

glioma cells, except U87, U251 and GBM8 GSCs, without affecting Oli-Neu OPCs or

astrocytes and promoted neural stem cell (NSC) expansion. In contrast, SAHA significantly

reduced proliferation of glioma and normal cells equally. (b) GSCs (50,000 cells per well of

24 well plate) were cultured in SCM in the absence or presence of 0.25% GTA or 1 µM

SAHA for 5 days with medium replenished every 48 hours. While GTA-mediated growth

reduction was largely cytostatic, SAHA-mediated growth reduction did not promote

differentiation (except in GBM8 GSCs), but was more cytocidal. *p < 0.05, **p ≤ 0.01, #p ≤

0.001, ##p < 0.0001. n ≥ 3 independent experiments. Scale bar = 200 µm.

Page 29 of 39



30

Figure 4. GTA-mediated growth reduction of established glioma cell lines and primary

tumor-derived GSCs in vitro is not due to the promotion of differentiation. GSCs were

dissociated and plated (10,000 cells per well of 24 well dish) in the absence or presence of

0.25% GTA or 1 µM SAHA in SCM (a) or DM (b). Growth dynamics were assessed using

unbiased trypan blue exclusion based cytometry over 5 days, with medium replenished every

48 hours. (a) GTA reduced cell growth dynamics comparable to that of SAHA, except that

proneural GBM GSCs (GBM8, GBM44, GBM2) were unresponsive in SCM. (b) When

treated in DM, GTA was as or more effective than SAHA, particularly on oligodendroglioma-

derived GSCs. (c, d) GSCs were cultured in DM for 3 days, fixed, and stained for markers of

mature oligodendrocytes (CNPase, myelin basic protein [MBP]) and astrocytes (GFAP). Oli-

Neu cells were used as a positive control. (c) OG33 and OG35 cells expressed CNPase, but

failed to express MBP. (d) The proneural GSCs (GBM8, GBM44, GBM2) differentiated into

GFAP-positive astrocytes, CNPase-positive oligodendrocytes, and Tuj1-positive neurons (not

shown). In contrast, the mesenchymal GSCs (GBM12, GBM34, GBM9) failed to express

GFAP, CNPase, or TuJ1 even when cultured for up to 7 days. *p < 0.05, **p ≤ 0.01, #p ≤

0.001, ##

p ≤ 0.0001. Scale bar = 100 µm.

Page 30 of 39



31

Figure 5. GTA enhances TMZ chemotherapeutic efficacy on orthotopically engrafted

oligodendroglioma-derived GSCs. (a) Images and photon flux (p/cm2/s/sr) of representative

mice imaged longitudinally throughout the study. OG35 GSCs (2,500 cells) expressing

luciferase were engrafted in the striatum of athymic mice. After 3 days, mice were injected

with luciferin (150 mg/kg, i.p.), imaged using the Xenogen imaging system, and randomized

to a treatment group: 1) vehicle treated mice received daily oral suspension, 2) daily GTA (5.0

g/kg) with 10% Ora-Sweet to mask GTA's bitterness, 3) TMZ (20mg/kg) on days 5, 7, 9, 11,

13 with oral suspension on alternate days, 4) GTA/TMZ with GTA administered daily starting

at day 3 (2 days prior to TMZ) and TMZ on days 5, 7, 9, 11, 13. Treatment was administered

by oral gavage until mice displayed neurological signs or weight loss of 20% the pre-surgical

weight. Days when imaging failed to detect photon flux are indicated by a negative sign (e.g.,

10-). Mean glucose levels were not different between the treatment groups. (b) Low and

high magnification hematoxylin and eosin (H & E) stained sections of representative

orthotopic tumors from each treatment group failed to reveal oligodendroglioma histological

features, rather a preponderance of undifferentiated cells was observed. Immunohistochemical

analysis of tumors failed to detect discernible differences in ASPA expression in the four

treatment groups (not shown). Scale bar = 1 mm (low mag), 100 µm (high mag). (c) The

study was negatively biased by assigning mice with the greatest flux on day 3 to the

GTA/TMZ group (Initial Flux). Although GTA/TMZ treated mice started with greater flux,

the rate of bioluminescence increase was reduced in GTA/TMZ treated mice relative to TMZ

alone treated mice (Flux Slope). Terminal tumor volume (i.e., day of euthanasia), determined

by unbiased stereology was only reduced in GTA/TMZ treated mice relative to vehicle treated

mice (left bar graph). However, when taking into account the increased survival of TMZ and

Page 31 of 39



32

GTA/TMZ treated mice (i.e., tumor volume/survival day), the tumor volume of TMZ alone

treated mice was reduced relative to vehicle treated mice and the tumor volume of GTA/TMZ

treated mice was reduced relative to GTA alone treated mice (right bar graph). GTA/TMZ

tumor volume did not differ from TMZ alone tumor volume (p = 0.068). (d) Kaplan-Meier

analysis showed that GTA alone did not increase survival, but TMZ increased survival

relative to vehicle and GTA/TMZ survival was greater than TMZ alone (upper panel).

Survival of mice administered GTA for 2 days prior to TMZ (i.e., primed, Figs. 5a-c) was

compared to GTA and TMZ both starting on day 5 (i.e., concurrent) and GTA administered

after termination of TMZ (i.e., salvage). Only the primed therapy was associated with

increased survival relative to TMZ alone, suggesting that GTA should be presented prior to

TMZ to exert its maximal therapeutic effect (lower panel). *p < 0.05, **p ≤ 0.01, #p ≤ 0.001

unless otherwise indicated symbols represent significance relative to vehicle treated mice. n =

6 vehicle, 6 GTA, 10 TMZ, 10 GTA/TMZ.

Page 32 of 39



33

Figure 6. GTA alone increases survival of mice orthotopically engrafted with GBM-derived

GSCs. (a) Images and photon flux (p/cm2/s/sr) of representative mice engrafted with GBM12

GSCs (2,500 cells) imaged longitudinally throughout the study. Mice were treated with the

"primed" combination GTA/TMZ therapy where GTA was started on post-surgical day 3 and

TMZ started on post-surgical day 5. Days when imaging failed to detect photon flux are

indicated by a negative sign (e.g., 10-). (b) Low and high magnification H & E stained

sections of representative orthotopic tumors from each treatment group.

Immunohistochemical analysis of tumors failed to detect discernible differences in ASPA

expression among the four treatment groups (not shown). Scale bar = 1 mm (low mag), 200

µm (high mag). (c) Mean glucose levels were not different between the treatment groups.

Bioluminescent flux and end tumor volume (not shown) of TMZ and GTA/TMZ treated mice

were reduced relative to vehicle and GTA treated mice. Although GTA/TMZ did not reduce

bioluminescent flux or end tumor volume greater than TMZ alone, GTA alone increased

survival relative to vehicle treated mice and, in conjunction with TMZ, increased survival

greater than TMZ alone. ##p ≤ 0.0001. n = 7 vehicle, 7 GTA, 6 TMZ, 8 GTA/TMZ.

Page 33 of 39



132x74mm (300 x 300 DPI)

Page 34 of 39



61x25mm (300 x 300 DPI)

Page 35 of 39



153x93mm (300 x 300 DPI)

Page 36 of 39



152x170mm (300 x 300 DPI)

Page 37 of 39



152x97mm (300 x 300 DPI)

Page 38 of 39



114x77mm (300 x 300 DPI)

Page 39 of 39



1

Supplementary Methods Cell Culture

Established oligodendroglioma cell lines, HOG (courtesy of Dr. Glyn Dawson, Univ. of

Chicago Dept. of Pediatrics) and Hs683 (HTB-138; American Type Culture Collection [ATCC];

Manassas, VA), were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Mediatech;

Herndon, VA) supplemented with 5% or 10% fetal bovine serum (FBS; Hyclone; Logan, UT),

respectively, on untreated cell culture dishes. HOG cells were derived from an oligodendrogli-

oma (1). The Hs683 line was derived from an explant culture of a glioma taken from the left

temporal lobe of a 76-year-old male (2). The Oli-Neu cell line, derived from murine OPCs

immortalized by stable constitutive expression of the ErbB2 receptor (3), was grown on poly-L-

lysine (PLL; 10 μg/ml) coated dishes in SATO growth medium (DMEM containing 0.1 mg/ml

apotransferrin, 0.01 mg/ml insulin, 400 nM triiodothyronine, 2 mM glutamine, 200 nM

progesterone, 100 μM putrescine, 220 nM sodium selenite, 500 nM thyroxine, 1% horse serum,

and 25 µg/ml G418) (4).

Established astrocytoma cell lines, U87 and U251, were maintained in DMEM supplemented

with 10% FBS. GSCs were maintained as free-floating spheres in stem cell medium (SCM)

consisting of DMEM/F12 supplemented with 1X B27 supplement (Invitrogen; Carlsbad, CA), 20

ng/ml EGF and 20 ng/ml bFGF (PeproTech; Rocky Hill, NJ) on non-adhesive plastic (Falcon

petri dish). GSC differentiation was induced by culturing in DMEM with 10% FBS. Human

cerebral cortical astrocytes (HA#1800 ScienCell; Carlsbad, CA) were cultured in basal medium

with 2% FBS and astrocyte growth supplement (AM#1801 ScienCell). Mouse neural stem cells

(NSCs) from postnatal day 4 cortex were prepared as described (5). All media contained 50

U/ml penicillin and 50 μg/ml streptomycin (Invitrogen). All GBM GSCs were derived from

frontal lobe tumors: GBM2 from a 47-year-old male, GBM8 from a 70-year-old female, GBM34

from a 78-year-old female, GBM44 from a 44-year -old male, while GBM12 was derived from a

2

recurrent tumor in a 64-year-old female from which GBM9 was originally established. OG33

GSCs were derived from a WHO grade II oligodendroglioma taken from the left frontal lobe of a

45 year old male while OG35 GSCs were derived from a grade III oligodendroglioma taken from

the right frontal lobe of a 34 year old female.

GTA dose response was determined using two cell viability assays, MTT (30-1010K; ATCC)

and calcein AM (C3099; Invitrogen). In the well-accepted MTT assay, the yellow tetrazolium

MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) is reduced by

dehydrogenase enzymes in metabolically active cells and the resulting intracellular purple

formazan is solubilized and quantified spectrophotometrically. Because GTA might alter

mitochondrial metabolism, via the generation of acetyl-CoA, results were compared to a non-

mitochondrial based assay. After acetoxymethyl ester hydrolysis by intracellular esterases in

live cells, the nonfluorescent calcein AM is converted to a green-fluorescent calcein that is

quantified spectrophotometrically. GBM12 GSCs (75,000 cells for MTT, 10,000 cells for

calcein AM; greater cell number required for chromogenic MTT assay than fluorescent calcein

AM assay) were plated in stem cell medium, on PLL coated wells, or differentiation medium in

the absence or presence of GTA. The MTT and calcein AM assays were performed according to

the manufacturer's instructions after 2 and 3 days GTA incubation, respectively.

Growth dynamics were assessed using unbiased trypan blue exclusion based cytometry.

Cells were plated (at 10,000 cells per well of a 24-well plate) directly in the absence or presence

of 0.25% GTA or 1 μM SAHA. After 1, 3, and 5 days of treatment, cells were typsinized,

collected via centrifugation, and counted according to the manufacturer’s instructions (Countess

Automated Cell Counter; Invitrogen). In contrast to oligodendroglioma cell adhesion, which was

not affected by GTA, Oli-Neu adhesion appeared reduced even though the cells were grown on

PLL-coated wells. To assess the anti-adhesive effect of GTA on Oli-Neu cells, cells were plated

at a density of 20,000 cells per well of a 24-well plate and incubated for 2, 4, or 8 hours. Cells

3

were fixed in situ for 15 minutes at room temperature by addition of 4% paraformaldehyde

(equal to media volume) and stained with trypan blue. Images from 10 randomly selected 20X

fields were captured and cells manually counted.

Cell Line Validation

Cell lines were validated at the Vermont Cancer Center DNA Analysis Facility by STR DNA

fingerprinting (6) using the CELL IDTM System according to the manufacturer's instructions

(#G9500, Promega; Madison, WI). The STR profiles were compared to known ATCC finger-

prints (www.ATCC.org) and to the Cell Line Integrated Molecular Authentication database

(CLIMA) version 0.1.200808 (http://bioinformatics.istge.it/clima/).

DNA Mapping

DNA mapping was performed using the GeneChip® Human Mapping 250K Nsp Array

(Affymetrix; Santa Clara, CA). Genomic DNA (gDNA, 250 ng) was processed according to the

manufacturer's protocol. Briefly, gDNA was cut with Nsp restriction enzyme followed by

ligation with Nsp adaptors that included a known sequence used for amplification by PCR.

Thirty cycles of PCR were used to amplify the entire genome followed by cleaning and

fragmentation using DNase I. Fragmented DNA was end labeled with biotin using a standard

terminal deoxynucleotidyl transferase reaction and confirmed with a gel shift assay. Samples

were hybridized to the Affymetrix 250K Nsp Array for 16 hours at 49°C followed by a double

streptavidin-phycoerytherin staining and scanned on a GS3000-7G scanner. CEL files produced

by Affymetrix GeneChip® Operating Software with a QC call rate of 92.5 or greater were

imported into Partek Genomic Suite 6.6 and analyzed for gross copy number alterations using

the Copy Number Analysis workflow. All CEL files were corrected for probe GC content and

fragment length. PCA plots were generated using raw probe intensities and copy number was

estimated by comparing raw probe intensities to Partek’s distributed baseline from the

4

International HapMap Project (NCBI). Genomic regions with shared copy number variation

were determined using the Hidden Markov Model algorithm implemented in Partek set to detect

copy number (CN) states of 0.1, 1, 3, 4, 5 (a CN state of 2 was ignored), with the minimum

number of probe sets contained in a region for it to be considered set to 3. Karyotype plots are

used to visualize genomic regions shared across samples, with amplified regions shown in red,

deleted regions in blue, and the regions with no copy number change depicted in white.

MGMT Analysis

Promoter hypermethylation of the MGMT gene was determined via methylation specific

PCR of bisulfite converted DNA (7). Genomic DNA was isolated using Trizol reagent

(Invitrogen) and bisulfite conversion reaction was performed with a total of 200 - 500 ng DNA

using the EZ DNA Methylation Kit (Zymo Research; Irvine, CA). Two sets of primer pairs,

each specific for either the methylated (Forward: 5'-TTTCGACGTTCGTAGGTTTTCGC-3';

Reverse: 5'-GCACTCTTCCGAAAACGAAACG-3'; length of expected product = 81 bp) or

unmethylated (Forward: 5'-TTTGTGTTTTGATGTTTGTAGGTTTTTGT-3'; Reverse: 5'-

AACTCCACACTCTTCCAAAAACAAAACA-3'; length of expected product = 93 bp) MGMT

promoter region, were used. The MSP reactions were routinely prepared in a total volume of 25

μl using HotStarTaq Master Mix Kit (Qiagen; Valencia, CA). For PCR, 1.8 μl of bisulfite-

modified DNA were added and subjected to 36 PCR cycles with of 94°C for 30 sec, 59°C for 40

sec, 72°C for 2 min and a final 72°C extension for 10 min. PCR products (10 µl) were resolved

via agarose gel electrophoresis and amplicons visualized using ethidium bromide staining using

Chemidoc gel imaging system (Bio-Rad Laboratories; Hercules, CA).

RT-PCR

Cells (2.5 x 106) were cultured in growth medium for 4 days and total RNA extracted with 1

ml Stat-60 (Tel-Test B; Friendswood, TX) according to manufacturer's instruction. RNA (1 μg)

5

was reverse transcribed using Super Script II reverse transcriptase (Invitrogen) with random

hexamers. Human glioblastoma and anaplastic oligodendroglioma tumors served as positive

controls. The cDNA (1 μl) was amplified using HotStarTaq master mix (Qiagen) in a 20 μl

reaction volume. After a 10 min 98°C activation step, cycling parameters of 95°C for 30 sec,

58°C for 30 sec and 72°C for 30 sec were repeated 32 times followed by a 1 min final extension

at 72°C. PCR products (10 μl) were resolved via agarose gel electrophoresis and visualized with

ethidium bromide using a Chemidoc gel imaging system (Bio-Rad Laboratories).

Gene Primer Sequence Melting temp GC content Product size CD133 Forward: 5' ACTCCCATAAAGCTGGACCC 3' 62.4 °C 55.0% Reverse: 5' TCAATTTTG GATTCATATGCCTT 3' 55.6 °C 30.4% 133 bp Notch1 Forward: 5' AGTGTGAAGCGGCCAATG 3' 59.9 °C 55.6% Reverse: 5' ATAG TCTGCCACGCCTCTG 3' 62.3 °C 57.9% 149 bp SOX2 Forward: 5' ACCGGCGGCAACCAGAAGAACAG 3' 68.1 °C 60.9% Reverse: 5' GCGCCGCGGCCG GTATTTAT 3' 66.6 °C 65.0% 255 bp PDGFRα Forward: 5' CTCCTGAGAGCATCTTTGAC 3' 60.4 °C 50.0% Reverse: 5' GTAGAATCCACCATCATGCC 3' 60.4 °C 50.0% 124 bp Nestin Forward: 5' CAGCGTTGGAACAGAGGTTG 3' 62.4 °C 55.0% Reverse: 5' GACATCTTGAGGTGCGCCAG 3' 64.5 °C 60.0% 163 bp Olig2 Forward: 5' CTCCTCAAATCGCATCCAGA 3' 60.4 °C 50.0% Reverse: 5' AGAAAAAGGTCATCGGGCTC 3' 60.4 °C 50.0% 147 bp BCL2A1 Forward: 5' ATGGATAAGGCAAAACGGAG 3' 58.4 °C 45.5% Reverse: 5' TGGAGTGTCCTTTCTGGTCA 3' 60.4 °C 50.0% 150 bp WT1 Forward: 5' TTAAAGGGAGTTGCTGCTGG 3' 60.4 °C 50.0% Reverse: 5' GACACCGTGCGTGTGTATTC 3' 62.4 °C 55.0% 141 bp CD44 Forward: 5' CCCAGATGGAGAAAGCTCTG 3' 62.4 °C 55.0% Reverse: 5' ACTTGGCTTTCTGTCCTCCA 3' 60.4 °C 50.0% 138 bp CD44v6 Forward: 5' GAAGAAACAGCTACCCAGAAGGAACAG 3' 66.1 °C 48.1% Reverse: 5' GCCAAGAGGGATGCCAAGATG 3' 64.5 °C 57.1% 797 bp GAPDH Forward: 5' GAAGGTGAAGGTCGGAGTCA 3' 62.4 °C 55.0% Reverse: 5' TTGAGGTCAATGAAGGGGTC 3' 60.4 °C 50.0% 117 bp

6

Orthotopic tumor model

GSCs were transduced with a lentiviral construct based on pHRs-UkFG in which firefly

luciferase is driven under the poly-Ubiquitin promoter. Freshly dissociated cells (0.5 x 106 cells)

in SCM were incubated with concentrated lentivirus for 24 hours, the viral containing medium

was removed, and cells washed twice with fresh medium. After one week, GFP-positive clones

were handpicked and expanded for an additional week, then dissociated via trypsinization to

isolate individual GFP-positive cells with viral integration via fluorescent activated cell sorting.

The growth rate of lentivirally transduced cells were compared to parental cells in the absence

and presence of GTA. No differences in growth rates or GTA responsiveness were observed

(unpublished observation).

All procedures were conducted in accordance with institutional guidelines for the humane

care and use of animals. Adult (8 week, 24 - 28g) male athymic mice (nu/nu, Charles Rivers;

Sherbrooke, QC, Canada) were acclimated in the vivarium for one week prior to surgery. After

providing bupivacaine (0.05 ml, subcutaneous) as a local anesthetic and washing the scalp with

chlorohexidine gluconate and 70% isopropyl alcohol, the mouse was affixed to a mouse stereo-

taxic device (Stoelting; Kiel, WI). A dorsal midline scalp incision (approximately 5 mm long)

was made and a small hole was bored in the skull overlying the right striatum (1 mm anterior, 1.5

mm lateral to bregma). GSC spheres were dissociated via mechanical disruption after brief (~2

min, 37°C) incubation in 0.025% trypsin/EDTA, centrifuged, and washed twice with sterile

Dulbecco’s phosphate buffered saline. Cells (2,500 cells in 4 μl DPBS) were aspirated into a 10

µl Hamilton syringe, which was lowered into the brain to a depth of 3.5 mm. Cells were

implanted into the striatum over 1 minute. To prevent effusion of cells, the needle was held in

place for an additional 2 minutes. Following injection, the borehole was closed with sterile bone

wax and the scalp incision closed with Vetbond. Post-operative analgesia (e.g., 0.1 mg/kg

7

buprenorphine, s.c.) was administered upon closure and twice per day for 3 days. Prior to

bioluminescent imaging, glucose levels in the fed state were monitored on blood from a small

nick in the tail vein using a standard glucometer (LifeScan One Touch Ultra).

For in vivo bioluminescent imaging, mice were injected i.p. with 150 mg/kg D-luciferin

potassium salt (at 20 mg/ml; Gold Biotechnology; St. Louis, MO) and allowed to freely ambulate

for 3 - 4 minutes prior to being anesthetized under 1.5% inhaled isoflurane during imaging.

Imaging was performed with the highly sensitive, optical CCD camera of the Xenogen IVIS 200

imaging system (Caliper LifeSciences; Hopkinton, MA). To confirm that peak photon emission

was recorded, peak efflux was determined from an average of 15 kinetic bioluminescent

acquisitions, with 1 min inter-acquisition intervals, using the auto-exposure setting. To measure

the intensity of emitted light, total photon efflux was determined by drawing regions of interest

over the emitted region and setting thresholds for each mouse to maximize the number of pixels

encircled using Living Image acquisition and analysis software (Version 3.0.3.5; Caliper

LifeSciences). Bioluminescent signals are expressed in flux units of photons per cm2 per second

per steradian (p/cm2/s/sr). Because we negatively biased the study by assigning mice with the

greater initial flux to the GTA/TMZ treatment group and GTA/TMZ treated mice survived

longer, we calculated the flux slope using inverse log flux values.

When mice displayed neurological signs, they were anesthetized with 50 mg/kg sodium

pentobarbital and perfused transcardially with 0.1 M phosphate buffer (PB), pH 7.4, with 0.15 M

NaCl, followed by 4% paraformaldehyde (PFA) in PB. Brains were dissected and post-fixed in

4% PFA overnight at 4°C, then equilibrated in 15% then 30% sucrose in PB. Free-floating

coronal cryostat sections were cut at 40µm, collected in PB, and stained with hematoxylin &

eosin (H & E) using standard histological methods. For tumor volumetric measurements,

contours of all tumor foci were traced in 7-14 H & E stained sections evenly spaced along the

rostrocaudal extent of the brain and stacked images were reconstructed for volumetric analysis

8

using the Cavalieri estimator probe (Stereo Investigator 9.14.5; Microbrightfield Bioscience;

Williston, VT). Because TMZ and GTA/TMZ treated mice survived longer, both total

volumetric data and tumor volume corrected for survival duration are presented.

References

1. Post GR, Dawson G. Characterization of a cell line derived from a human oligodendroglioma.

Mol Chem Neuropathol 1992;16:303-17.

2. Pontén J, Macintyre EH. Long term culture of normal and neoplastic human glia. Acta Pathol

Microbiol Scand 1968;74:465-86.

3. Jung M, Kramer E, Grzenkowski M, Tang K, Blakemore W, Aguzzi A, et al. Lines of murine

oligodendroglial precursor cells immortalized by an activated neu tyrosine kinase show

distinct degrees of interaction with axons in vitro and in vivo. Eur J Neurosci 1995;7:1245-65.

4. Trotter J, Bitter-Suermann D, Schachner M. Differentiation-regulated loss of the

polysialylated embryonic form and expression of the different polypeptides of the neural cell

adhesion molecule by cultured oligodendrocytes and myelin. J Neurosci Res 1989;22:369-83.

5. Shimada IS, LeComte MD, Granger J, Quinlan NJ, Spees JL. Self-renewal and

differentiation of reactive astrocyte-derived neural stem/progenitor cells isolated from

cortical peri-infarct tissues after stroke. J Neurosci 2012;32:7926-40.

6. Romano P, Manniello A, Aresu O, Armento M, Cesaro M, Parodi B. Cell Line Data Base:

structure and recent improvements towards molecular authentication of human cell lines.

Nucleic Acids Res 2009; 37:D925-32.

7. Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N, Weller M, et al. MGMT gene

silencing and benefit from temozolomide in glioblastoma. N Engl J Med 2005;352:997-1003.

9

Supplementary Data

Supplementary Figure 1 GTA Dose Response

GBM12 GSCs (75,000 cells for MTT, 10,000 cells for calcein AM) were plated in stem cell

medium (SCM), on PLL-coated wells, or in differentiation medium (DM) with increasing

concentrations of GTA. The cells were subjected to MTT (a) and calcein AM (b) assays after 2

and 3 days, respectively. Both the MTT and calcein AM assays showed a dose-dependent

decrease in cell viability in SCM. Since 0.25% GTA was the lowest concentration that also

reduced growth in DM and is above the LD50, this concentration was selected for further studies.

10

Supplementary Figure 2 Analysis of REMBRANDT and TCGA datasets confirmed

decreased ASPA mRNA expression in glioma

REMBRANDT (a) and TCGA (b-d) datasets were analyzed to characterize mRNA expression in

glioma. (a) The REMBRANDT dataset revealed decreased ASPA mRNA expression in both

astrocytoma and oligodendroglioma tumors. (b) Seventy-eight percent of the GBM tumors in the

TCGA dataset showed a greater than two-fold reduction in ASPA mRNA relative to control. (c)

ASPA mRNA was comparably decreased in all four GBM subtypes. (d) ASPA down-regulation

was not correlated with isocitrate dehydrogenase 1 (IDH1) mutation. *p < 0.05, #p < 0.001

11

CSF1PO D13S317 D16S539 D121S11 D5S818 D7S820 TH01 TPOX yWA Amelogenin U87 10, 11 8, 11 12 28, 32.2 11, 12 8, 9 9.3 8 15, 17 X

U251 12 10, 11 12 29 11 10, 12 9.3 8 16, 18 X, Y GBM12 12 12 9 29, 30 12, 13 10 9 9 15 X GBM34 12 12 9 29, 30 12, 13 10 9 9 15 X*

GMB9 12 12 9 29, 30 12, 13 10 9 9 15 X GBM8 11, 12 8, 12 10, 11 29, 31 10, 11 9, 12 7, 8 11 17 X

GBM44 11, 12 12, 13 8, 14 30 12, 13 10, 12 6, 8 8, 11 16, 18 X, Y GBM2 10, 12 11 9, 13 29, 33.2 11 8, 9 7, 9 8, 12 18 X, Y Hs683 9, 13 8, 12 9, 10 27, 33.2 11, 12 11 6, 8 8, 11 18, 20 X, Y HOG 12 12 9 30 12, 13 10 9 9 15 X OG33 12 12 9 30 12, 13 10 9 9 15 X* OG35 12 12 9 29, 30 12, 13 10 9 9 15 X

Astrocyte 10 8, 13 11, 12 28, 33.2 12, 13 10, 12 6, 9.3 8, 9 14, 17 X, Y

Supplementary Table 1 Cell Line Validation

The STR profiles for the commercially available cells, Hs683, U87, U251, matched previously

reported signatures. Not surprisingly, the STR profiles of the non-commercial cells derived from

primary human tumor specimens failed to correspond to known fingerprints in the CLIMA database

(http://bioinformatics.istge.it/clima/). Because GBM12 GSCs were derived from a recurrent tumor

in the patient from whom GBM9 GSCs were derived, they would be expected to display identical

STR profiles. However, GBM34, OG33, and OG35 GSCs showed identical STR profiles.

Moreover, GBM34 and OG33 GSCs were derived from tumors in male patients, yet STR profiling

failed to detect the Y chromosome form of amelogenin. Interestingly, the lines displaying identical

STR profiles also exhibit a mesenchymal antigenic profile (Fig. 2b), suggesting the existence of a

mesenchymal STR signature.

12

Supplementary Figure 3A Oligodendroglioma Karyotypes

13

Supplementary Figure 3B Glioblastoma Karyotypes Chromosomes 1-6

Supplementary Figure 3C Glioblastoma Karyotypes Chromosomes 7-12

14

Supplementary Figure 3D Glioblastoma Karyotypes Chromosomes 13-18

Supplementary Figure 3E Glioblastoma Karyotypes Chromosomes 19-X

15

Supplementary Figure 4 GTA decreases Oli-Neu cell adhesion

In contrast to all other cells used in the study, the small soma and thin process of Oli-Neu cells

necessitates culturing on PLL coated dishes. Given that GTA did not affect astrocyte or NSC

growth but did reduce Oli-Neu growth (Fig. 4a), the effect of GTA on Oli-Neu adhesion was

assessed by culturing cells for 2 hours, fixing, staining with trypan blue, and counting the

number of adherent cells in 10 randomly selected 20X fields. Data are presented as a fold

change relative to untreated cells. SAHA significantly affected growth as early as 24 hours (Fig.

3A), but this is likely not due to decreased adhesion. In contrast, as a lipophilic molecule, GTA

significantly reduced Oli-Neu adhesion within 2 hours. Data were similar at 4 and 8 hours after

plating (not shown). #p ≤ 0.001.

16

Supplementary Figure 5 MGMT promoter methylation status of GSCs orthotopically

grafted

Genomic DNA was isolated from OG33, OG35, and GBM12 GSCs in SCM and bisulfite

converted. The DNA sample was then subjected to PCR with two different PCR primer sets -

one that recognizes methylated (Me +) and one that recognizes unmethylated (Me-) MGMT

promoter. Thus, the DNA sample will either generate an 81 bp (methylated) or 93 bp

(unmethylated) amplicon. Thus, the use of methylation specific PCR primers determines

MGMT methylation status and potential chemotherapeutic responsiveness. All three GSCs lines

exhibit hypermethylation of the MGMT promoter, suggesting responsiveness to chemotherapy.

17

Supplementary Figure 6 GTA alone does not increase survival of mice engrafted with

OG33 GSCs

OG33 GSCs (5,000 cells) expressing luciferase were engrafted in the striatum of athymic mice.

After 3 days, mice were injected with luciferin (150 mg/kg, i.p.), imaged using the Xenogen

imaging system, and randomized to a treatment group. GTA (5.0 g/kg) was administered daily

by oral gavage until mice display neurological signs or weight loss of 20% the pre-surgical

weight. (a) Images and photon flux (p/cm2/s/sr) of two representative vehicle and GTA treated

mice. (b) Kaplan-Meier analysis showed no increased survival of GTA treated mice. (c) The

rate of bioluminescent flux increase was not significantly reduced in GTA treated mice. (d) H &

E stained sections of two representative vehicle and GTA treated mice. n = 5 vehicle, 6 GTA.

18

Documents

Triacetin-based acetate supplementation as a chemotherapeutic adjuvant therapy in glioma