Translation initiation factor 5A in Picrorhiza is up-regulated during leaf senescence and in response to abscisic acid

Gene xxx (2014) xxx–xxx

GENE-39544; No. of pages: 7; 4C:

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Translation initiation factor 5A in Picrorhiza is up-regulated during leafsenescence and in response to abscisic acid

Jai Parkash a,b, Tanmay Vaidya b, Shruti Kirti b, Som Dutt a,b,⁎a Academy of Scientific and Innovative Research-IHBT (AcSIR-IHBT), Indiab Biotechnology Division, CSIR-Institute of Himalayan Bioresource Technology (CSIR-IHBT), Palampur, Himachal Pradesh 176061, India

Abbreviations: eIF5A, eukaryotic translation initiationkurrooa translation initiation factor 5A; RACE, rapid amplifiserved domain database; RT-PCR, reverse transcriptioSOPMA, self-optimized prediction method with alignmen⁎ Corresponding author at: Biotechnology Division

Bioresource Technology, Palampur, Himachal Pradesh 176E-mail addresses: [email protected], [email protected]

http://dx.doi.org/10.1016/j.gene.2014.03.0320378-1119/© 2014 Elsevier B.V. All rights reserved.

Please cite this article as: Parkash, J., et al., Trabscisic acid, Gene (2014), http://dx.doi.org/

a b s t r a c t
a r t i c l e i n f o
Article history:Received 19 December 2013Accepted 17 March 2014Available online xxxx

Keywords:Eukaryotic translation initiation factor 5ALeaf senescenceAbscisic acidPicrorhizaTranslation

Translation initiation, the first step of protein synthesis process is the principal regulatory step controlling trans-lation and involves a pool of translation initiation factors. In plants, from recent studies it is becoming evident thatthese translation initiation factors impact various aspects of plant growth and development in addition to theirrole in protein synthesis. Eukaryotic translation initiation factor eIF5A is one such factor which functions instart site selection for the eIF2-GTP-tRNAi ternary complex within the ribosomal-bound preinitiation complexand also stabilizes the binding of GDP to eIF2. In the present study we have cloned and analysed a gene (eIF5a)encoding eIF5A from Picrorhiza (Picrorhiza kurrooa Royle ex Benth.) a medicinal plant of the western Himalayanregion. The full length eIF5a cDNA consisted of 838 bp with an open reading frame of 480 bp, 88 bp 5′ untrans-lated region and 270 bp 3′ untranslated region. The deduced eIF5A protein contained 159 amino acidswith amo-lecular weight of 17.359 kDa and an isoelectric point of 5.59. Secondary structure analysis revealed eIF5A having24.53%α-helices, 8.81%β-turns, 23.27% extended strands and 43.40% random coils. pk-eIF5a transcriptwas foundto be expressing during the active growthphase aswell as during leaf senescence stage, however, highest expres-sion was observed during leaf senescence stage. Further, its expression was up-regulated in response to exoge-nous application of abscisic acid. Both high intensity as well as low intensity light decreased the expression ofpk-eIF5a. The findings suggest eIF5a to be an important candidate to develop genetic engineering based strategiesfor delaying leaf senescence.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

The process of protein synthesis known as translation is universaland essential for all organisms whether eukaryotes, archea or bacteria.Translation is divided into four phases: initiation, elongation, termina-tion and ribosome recycling (Pacheco and Martinez-Salas, 2010). Ofthe four phases, initiation of translation is the most complex, mainrate-limiting and most regulated step. In eukaryotes, initiation of trans-lation involves participation of messenger RNA (mRNA) to be translat-ed, ribosomal subunits, methionine, initiator transfer RNA (tRNAi),enzymes and associated components to activate and charge initiatortRNA with methionine, and a suite of eukaryotic translation initiationfactors (eIFs). Apart from the synthesis of proteins eIFs play various

factor 5A; pk-eIF5a, Picrorhizacation of cDNA ends; CDD, con-n-polymerase chain reaction;t; ABA, abscisic acid., CSIR-Institute of Himalayan061, India.es.in (S. Dutt).

anslation initiation factor 5A i10.1016/j.gene.2014.03.032

other important roles in plants. eIFs have been found to be influencingplant growth and development. Also, eIFs have been found to play rolein imparting biotic and abiotic stress tolerance in plants (Duan et al.,2012; Ma et al., 2010; Wang and Krishnaswamy, 2012; Wang et al.,2012; Xu et al., 2011). Thus, these recent studies provide a strong plat-form for engineering translation initiation machinery for improvinggrowth, development and adaptation of plants. Our present work per-tains to translation initiation factor eIF5A from Picrorhiza (Picrorhizakurrooa Royle ex Benth.). Picrorhiza is a small perennial herb (FamilyPlantaginaceae) which grows primarily in the north-western Himalayanregion, at an altitude of 3000–5000 m above mean sea level. Its under-ground parts, rhizomes and roots are widely used in traditional systemof medicine due to its antioxidative, hepatoprotective, antiproliferative,immunomodulatory, antibacterial and antiviral activities (Banerjee et al.,2008). The plant is self-regenerating but unregulated over-harvestinghas caused it to be threatened to near extinction and thus Picrorhiza hasbeen listed in the Red Data Book as an endangered plant species (Kala,2000). Recently, we reported the presence of picrosides, the mainmedic-inally active compounds in the leaves of Picrorhiza (Dutt et al., 2004). Itwas observed that, in addition to rhizome and roots, leaves can also be agood source of picrosides. However, the contents of these picrosides

n Picrorhiza is up-regulated during leaf senescence and in response to

http://dx.doi.org/10.1016/j.gene.2014.03.032

mailto:[email protected]

mailto:[email protected]


http://www.sciencedirect.com/science/journal/03781119


Table 1Oligonucleotide sequences and PCR conditions used in cloning and expression analysis of pk-eIF5a gene.

Name Sequence (5′–3′) PCR condition

Degenerate primers for amplification of the target genepk-eIF5a-dF1 AAGGGCGATGCCGGAGCTTC Initial denaturation at 94 °C for 3 min, followed by 35 cycles of 94 °C, 30 s; 55–60 °C, 40 s; 72 °C, 50 s. Final

extension at 72 °C for 7 minpk-eIF5a-dR2 ATCTGCTCCTCTCCCATGGA(C)AGAC

Primers for RACE PCRpk-eIF5a 3′ RACE F1 GCTGACTGATAATGGCAACACCAAGG Primary PCR

5 cycles of 94 °C, 30 s; 72 °C, 3 min, followed by 5 cycles of 94 °C, 30 s; 70 °C 30 s; and 30 cycles of 94 °C, 30 s;68 °C 30 s 72 °C, 3 minSecondary PCR30 cycles of 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. Final extension at 72 °C for 7 min

pk-eIF5a 3′ N RACE F2 AAGCTTCCAACTGATGACAGTCTGpk-eIF5a 5′ RACE R1 AGGCAGACATGACACTCACCACAAGApk-eIF5a 5′ N RACE R2 TCATCCTTGGTGTTGCCATTATCAGT

Primers for full length cloning of pk-eIF5apk-eIF5a-Fl F1 ATGTCGGATGAGGAGCACCACTTC Initial denaturation at 94 °C for 3 min., followed by 33 cycles of 94 °C, 30 s; 54 °C, 40 s; 72 °C, 40 s. Final extension

at 72 °C for 7 minpk-eIF5a-Fl R2 TTACTTGGGACCAATATCCTTGAGGG

Primers for expression studiespk-eIF5a-expF1 GCACGGTCATGCTAAATGTCAC Initial denaturation at 94 °C for 3 min, followed by 31 cycles of 94 °C, 30 s; 54 °C, 45 s; 72 °C, 20 s. Final extension

at 72 °C for 7 minpk-eIF5a-expR1 CAGACTGTCATCAGTTGGAAGC

Primers name with “F” and “R” represents forward primers and reverse primers, respectively.

2 J. Parkash et al. / Gene xxx (2014) xxx–xxx

decrease sharply during senescence phase (Singh et al., 2011). Thus, un-derstanding on leaf senescence phenomena in Picrorhiza is of vital impor-tance to devise and utilize the molecular strategies for delaying leafsenescence and increasing biomass production, and thereby improvingthe picroside contents. In the present study, we cloned the gene encodingeIF5A from Picrorhiza (hereinafter referred to as pk-eIF5a) and analysedits expression in relation to leaf senescence, abscisic acid and light.

a

Fig. 1. Nucleotide and deduced amino acid sequences of pk-eIF5a cDNA (GenBank accession namino acid sequences were analysed for the location of conserved domain using conservedwrpsb.cgi).

Please cite this article as: Parkash, J., et al., Translation initiation factor 5A iabscisic acid, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.03.032

2. Materials and methods

2.1. Plant material

Picrorhiza (Picrorhiza kurrooa) plants used in the present studywerecollected from its natural habitat at Rohtang Pass (4000 m altitude,32°23′ N, 77°15′ E, India) during December when the plants were in

o. KF019100) (a). Conserved domain of deduced protein pk-eIF5A of Picrorhiza. Deduceddomain database available at NCBI website (http://www.ncbi.nih.gov/structure/ccdd/


http://www.ncbi.nih.gov/structure/ccdd/wrpsb.cgi



3J. Parkash et al. / Gene xxx (2014) xxx–xxx

dormant stage and brought to the institute at Palampur (1300 m alti-tude; 32°06′N, 76°33′E, India). These were transplanted in plastic potsand maintained in the experimental farm of the institute as describedby Kawoosa et al. (2010).

2.2. Cloning of cDNA of pk-eIF5a

RNA was isolated from leaf tissue using PureLink™ RNA Mini Kit(Invitrogen, USA) and digested with DNase I (RNase free) (FermentasInc., USA). Complementary DNA (cDNA) was synthesized from 2 μg ofDNase-treated total RNA as a template in 20 μl reaction volume byusing cDNA synthesis kit (Invitrogen, USA). Degenerate primers(pk-eIF5a-dF1, pk-eIF5a-dR2) for pk-eIF5a were designed from the con-served regions of corresponding gene reported from different plantsources and the partial gene sequence was amplified by PCR as detailedin Table 1. The amplicon was cloned in pGEM-T Easy Vector (Promega,USA), plasmids were isolated using Fermentas GeneJET™ PlasmidMiniprep Kit (Fermentas Inc., USA), and sequencing was performedusing Big Dye terminator cycle sequencing mix (Version 3.1; AppliedBiosystems, USA) using an automated DNA sequencer (ABI 3130 xlGenetic Analyzer, Applied Biosystems, USA). Protocols were followedessentially as described by the respective manufacturer.

Full-length cDNA was cloned by performing rapid amplification ofcDNA ends (RACE; SMARTer™ RACE cDNA Amplification Kit; Clontech,USA) as per the manufacturer's instructions using the gene specificprimers (pk-eIF5a-5′ RACE-R1, pk-eIF5a 5' N RACE R2, pk-eIF5a-3′RACEF1, pk-eIF5a 3′ N RACE F2; Table 1). These primers were designedbased upon the partial sequence of the gene as cloned above. Afteraligning the sequences obtained by 5′ and 3′ RACE, full-length cDNAwas amplified using the end sequences (pk-eIF5a-FlF1, pk-eIF5a-FlR2),

Fig. 2. Multiple sequence alignment of the deduced amino acid sequences of pk-eIF5A with o001066843), Rosa (acc. No. ABM53472), Vitis (acc. No. XP_003634303), Glycine (acc. No. NP_0No. ADG27839), Solanum (acc. No. XP_004238758), respectively. Asterisk marks represent con


cloned in pGEM-T Easy Vector (Promega, USA) and confirmed bysequencing.

2.3. In silico characterization of pk-eIF5A

Aliphatic index and hydropathicity index were calculated using pro-tein analysis toolbox of the Accelrys gene (version 2.5; Accelrys Inc.,USA). Conserved domain was identified by using conserved domain da-tabase (CDD) available at NCBI website (http://www.ncbi.nih.gov/structure/ccdd/wrpsb.cgi). The secondary structure of the deduced pro-tein was analysed using Self-Optimized Prediction Method with Align-ment (SOPMA; http://www.npsa-pbil.ibcp.fr/).

2.4. Semi-quantitative expression analysis by RT-PCR

Semi-quantitative RT-PCR based expression analysis was performedto study the expression level of pk-eIF5a mRNA during active growthstage vis-a-vis senescence stage. Total RNA was extracted from 4thleaf (from the top) of Picrorhiza that were harvested at active growth(12th week of transplantation), early senescence (16th week of trans-plantation), mid senescence (18thweek of transplantation) and late se-nescence stage (20th week of transplantation) and immediately storedat −80 °C. For analysis of diurnal variation of the transcript, 4th leaf(from the top) of Picrorhiza at active growth stage (12 weeks of trans-plantation) was used. Sampling was performed at six hour intervalscontinuously for two days. Leaf tissues (100 mg) were harvested fromplants at different time points [6:00 a.m., 12:00 p.m., 6:00 p.m.,12:00 a.m. (first day), 6:00 a.m., 12:00 p.m., 6:00 p.m., 12:00 a.m.(second day), designated as 6:00, 12:00, 18:00, 24:00, 30:00, 36:00,42:00, and 48:00 h, respectively] for two continuous days. The harvest-ed samples were immediately frozen in liquid nitrogen and stored at

ther eIF5As from nine different plants: Hevea (acc. No. AAQ08191), Oryza (acc. No. NP_01237458), Cicer (acc. No. XP_004508713), Arachis (acc. No. AFR23349), Gossypium (acc.served amino acid residues in all the aligned sequences.




http://www.npsa-pbil.ibcp.fr/


eIF5A

26S rRNA

rRNA

a

b

0

50

100

150

200

250

300

350

IDV

x 1

03

Growth stages

26S rRNA pk-eIF5a

Fig. 3. Expression pattern pk-eIF5amRNA during active growth stage vis-a-vis senescencestage. Total RNA was extracted from leaves of Picrorhiza that were harvested at activegrowth stage (12thweek of transplantation), early senescence (16thweek of transplanta-tion) mid senescence (18th week of transplantation) and late senescence stage (20thweek of transplantation) and subjected to semi-quantitative RT-PCR based expressionanalysis. A constitutive 26S rRNA gene was used as an internal control for equal loading.Panel b shows integrated density value (IDV) of each amplicon as obtained in panel a.


−80 °C. Primers for expression analyses were designed from the se-quence of cloned cDNA and arementioned in Table 1. To analyse the ex-pression level of the cloned gene, total RNAwas isolated from leaf tissue(100 mg) using the PureLink™ RNA Mini Kit (Invitrogen, USA). cDNAwas synthesized from DNA-free RNA using SuperScript® III ReverseTranscriptase (Invitrogen, USA). The cDNA was used as a templatefor Reverse transcription-PCR reaction using gene specific primers(pk-eIF5a-expF1, pk-eIF5a-expR1) as mentioned in Table 1. Cycling con-ditions were optimized to obtain amplification under the exponentialphase. 26S rRNA based primer pair was used as internal control for ex-pression studies (Singh et al., 2004). The amplicons were analysed andquantified using the Alpha Digi Doc Gel Documentation and Image anal-ysis system (Alpha Innotech, USA). Each experiment was repeated atleast twice with three biological replicates each time and the represen-tative figure of one experiment is shown in the manuscript.

2.5. Application of abscisic acid

The effect of exogenous application of abscisic acid (ABA) treatmenton the expression status of pk-eIF5a gene was analysed using leaf discexperimentation. For treatments, fully expanded green leaves were de-tached and leaf discs (diameter 8 mm)were cut with a cork borer, eachfrom different detached green leaves (12 weeks of transplantation) ofPicrorhiza at active growth phase and floated abaxial side up in sterilewater (in Petriplates) containing different concentrations of ABA(Sigma-Aldrich) hormone (50 μM, 100 μM and 500 μM) at differenttime intervals (6, 12, 18 and 24 h). The ABA solutions of different con-centrations were prepared in 0.4% ethyl alcohol (95% v/v) (Asghar andEbrahimzadeh, 2006). Control leaf discs were handled similarly butplaced only in sterile water. All treatments were carried out at roomtemperature for 24 h. The leaf discs were then used for RNA isolation.The isolated RNA was subsequently subjected for semi-quantitativeRT-PCR for the expression analysis of pk-eIF5a. For each treatmentthree biological replicates were used.

3. Results

3.1. Cloning of pk-eIF5a full length cDNA

Degenerate primers (Table 1) were designed using conserved re-gions of the reported eIF5As from other plants. Partial cDNA fragmentcomposed of 418 nucleotides of pk-eIF5a was amplified by RT-PCR.Blast analysis revealed strong homology of the cloned fragment witheIF5as available in the NCBI database. Using the RACE method, fulllength cDNA of pk-eIF5awas cloned and subsequently confirmed by se-quencing. The full length pk-eIF5a cDNA was 838 bp long with an openreading frame (ORF) of 480 bp (Fig. 1a). The ORFwas flanked by a 88 bp5′ untranslated region (UTR) and a 270 bp 3′ UTR. Sequence data fromthis study has been deposited in the GenBank database under the acces-sion number KF019100.

The deduced pk-eIF5A protein contained a total of 159 amino acidswith a molecular weight of 17.359 kDa and an isoelectric point (pI) of5.59. In pk-eIF5A S1-eIF5A domain was detected between amino acid(aa) positions 86 to 156 having an RNA binding site (Fig. 1b). The align-ment of the deduced amino acid sequence of pk-eIF5A revealed morethan 90% identity with eIF5A of various plants (Fig. 2). Analysis of pk-eIF5A using protein analysis toolbox of Accelrys gene software revealedaliphatic index of 79.06 and grand average of hydropathicity (GRAVY)as (−) 0.457. In pk-eIF5A SOPMA analysis revealed 24.53% α-helices,8.81% β-turns, 23.27% extended strands and 43.40% random coils.

3.2. Expression of pk-eIF5a was higher during leaf senescence

To gain deeper insights into the role of pk-eIF5a in regulating leafsenescence, temporal expression of pk-eIF5a was investigated. Semi-quantitative RT-PCR based expression analysis was performed to


study the expression level of pk-eIF5a mRNA during the active growthstage vis-a-vis senescence stage. pk-eIF5a transcript was found to be ex-pressing during active growth phase aswell as during senescence. How-ever, 25.8, 24.9 and 31.6% higher expression of pk-eIF5a was observedduring early senescence, mid senescence and late senescence stage, re-spectively, as compared to that during the active growth phase (Fig. 3).

3.3. ABA induces expression of pk-eIF5a

Exogenous ABA promoted the expression of pk-eIF5a gene in theleaves (Fig. 4). In case of control (without ABA) the level of pk-eIF5a tran-script remained almost unchanged during the overall 24 h duration forwhich the experiment was conducted. In case of 50 μM ABA treatment,84.5 ± 17.1% increase in the transcript level of pk-eIF5awas observed at12 h of the treatment as compared to 0 h control. Also, 17.6 ± 6.0,27.8±0.8 and 44.3±4.1% increase in pk-eIF5a expression as comparedto control, was observed at 6, 18 and 24 h, respectively, of 50 μM ABAtreatment. Likewise, exogenous application of 100 μMABA resulted in in-creasing the expression of pk-eIF5a by 123.8± 5.4, 68.0 ± 4.0, 47.6 ± 7.7and 78.2 ± 13.9% at 6, 12, 18 and 24 h, respectively, of ABA treatment.Also, 75.2 ± 21.1, 111.8 ± 9.9, 16.8 ± 4.3, and 19.7 ± 18.8% increase inexpression level of pk-eIF5a was observed at 6, 12, 18 and 24 h, respec-tively, of 500 μM ABA treatment.

3.4. Low and high light decreased expression of pk-eIF5a

The expression pattern of the cloned gene revealed differentialtranscript levels when analysed for diurnal expression pattern in theleaf. Expression of pk-eIF5a was found to be higher during moderatelight (18:00 and 42:00 h) i.e. during moderate photon flux density as



eIF5A

26SrRNA rRNA

0h 6h 12h 18h 24h

500 μM

eIF5A26SrRNA

rRNA

0h 6h 12h 18h 24h

100 μM

eIF5A

26S rRNA

rRNA

0h 6h 12h 18h 24h

50 μM

eIF5A

26S rRNA

rRNA

0h 6h 12h 18h 24h

control

a b

0.0

50.0

100.0

150.0

200.0

250.0

300.0

26S rRNA eIF5a

IDV

x 1

03

Gene

0h6h12h18h24h

0.0

50.0

100.0

150.0

200.0

250.0

300.0

26S rRNA eIF5a

IDV

x 1

03

Gene

0h6h12h18h24h

0.0

50.0

100.0

150.0

200.0

250.0

300.0

26S rRNA eIF5a

IDV

x 1

03

Gene

0h6h12h18h24h

0.0

50.0

100.0

150.0

200.0

250.0

300.0

26S rRNA eIF5a

IDV

x 1

03

Gene

0h6h12h18h24h

control

50 μM

100 μM

500 μM

Fig. 4. Analysis of pk-eIF5a expression in response to ABA treatment. (a) Leaf discs were treated with appropriate conc. of ABA 50 μM, 100 μM and 500 μM for the indicated time intervals.Total RNA was isolated from leaf discs treated with different concentrations of ABA and subjected to semi-quantitative RT-PCR analysis. A constitutive 26S rRNA gene was used as an in-ternal control to normalize differences in template concentrations. Panel b shows integrated density value (IDV) of each amplicon as obtained in panel a.


compared to low light (6:00 and 30:00 h) (Fig. 5). Lowest expressionwas detected at low/nil light intensity.

4. Discussion

In the present study we have cloned complete cDNA of eIF5a fromPicrorhiza. The cloned pk-eIF5a showed a high degree of identity witheIF5a's which were previously reported from various other plants likeArabidopsis (Feng et al., 2007), rice (Oryza sativa; Chou et al., 2004), to-mato (Solanum lycopersicom; Wang et al., 2005), Tamarix (Tamarixandrossowii; Wang et al., 2012), wheat (Triticum aestivum; Zhou et al.,2009) etc. eIF5a has been found to be highly conserved among eukary-otes (Henderson and Hershey, 2011) with molecular weight in therange of 16–18 kDa. The estimated molecular weight of pk-eIF5A was


17.359 kDa and thus, is in agreement with that reported for othereIF5As. Semi-quantitative expression analysis revealed the presence ofpk-eIF5a transcript during active growth stage as well as during leaf se-nescence stage, however, higher expression during leaf senescence re-vealed its up-regulation during leaf senescence. Previously, the role ofeIF5a in regulating leaf senescence has been documented (Wang et al.,2001, 2003). eIF5a expressionwas upregulated in leaves undergoing se-nescence in tomato (Wang et al., 2001), and also during carnation petalsenescence mRNA abundance of eIF5A was increased (Wang et al.,2003).

Further, exogenous application of ABA resulted in increased level ofpk-eIF5a expression suggesting the role of ABA in modulating the pk-eIF5a expression during leaf senescence. Similar observation has beenreported by Oh et al. (1996). They observed a marked increase in the



a

b

rRNA

26SrRNA

eIF5A

6:00 12:00 18:00 24:00 30:00 36:00 42:00 48:00

0

50

100

150

200

250

300

350

6:00 12:00 18:00 24:00 30:00 36:00 42:00 48:00

IDV

x 1

03

Time (hours)

26S rRNA pk-eIF5a

Fig. 5. Diurnal expression pattern of pk-eIF5a in Picrorhiza. Total RNA was isolated fromleaves at different time points (6, 12, 18, 24, 30, 36, 42, 48 h) and subjected to semi-quantitative RT-PCR analysis. A constitutive 26S rRNA genewas used as an internal controlfor equal loading. Panel b shows integrated density value (IDV) of each amplicon as ob-tained in panel a.


mRNA level of a senescence associated gene, sen1 in Arabidopsis uponexogenous application of 0.1 mM ABA. Similarly, Zhang and Gan(2012) reported induced expression of senescence associated geneSAG113 in response to 1 h and 3 h treatment of ABA in Arabidopsis.Also, Yap et al. (2003) have reported ABA mediated over-expressionof senescence associated gene SPA15 in sweet potato. ABA inducedover-expression of a range of senescence associated genes have beenreported in other plants (Woo et al., 2001). All these results seem tosuggest that eIF5a may play an important role in ABA-mediated leafsenescence.

Lower expression of pk-eIF5a during low light intensity is as expect-ed as it is the case with most of the plant genes due to the low influx ofthe requisite precursors because of low photosynthetic activity. Howev-er, comparatively low expression of pk-eIF5a at high light intensity ascompared to that during medium light intensity may be attributed tothe adaptive behaviour of Picrorhiza. In its natural habitat Picrorhizagrows in shady areas and thus suggests its preference of habitat withlesser light intensity.

5. Conclusions

A full length cDNA encoding eIF5A was cloned from Picrorhizaand was found to have a high degree of identity with other eIF5As.The cloned pk-eIF5a was over-expressed during leaf senescence aswell as in response to exogenous application of ABA, suggestingthe role of eIF5a in leaf senescence which might be mediatedthrough ABA. Thus, eIF5a may be an important candidate to knockout or suppress for delaying leaf senescence in Picrorhiza.

Conflict of interest

The authors declare no conflicts of interest.


Acknowledgements

We greatly acknowledge Dr. Paramvir S. Ahuja, Director, CSIR-IHBT,for providing overall guidance and infrastructural support to carry outthe work. We thank the Council of Scientific and Industrial Research(CSIR), New Delhi, India, for funding the projects entitled “Increasingbiomass potential of plants: exploring light-independent mechanisms:sanctioned vide sanction order number 41/3/EMPOWER/2012-PPDunder EMPOWER scheme”, and “Integrated NextGen approaches inhealth, disease and environmental toxicity (INDEPTH): sanctionedvide sanction order number 31-2(230)/BSC0111/IITR(1)/2012-13/Bud-get”. J.P thanks the University Grant Commission (UGC), India, foraward of junior research fellowship under reference no. CSIR HRDG/20-06/2010(i) EU-IV. Technical help provided by Mr. Anil Kumar forgene sequencing is acknowledged. The manuscript represents IHBTpublication number 3545.

References

Asghar, R., Ebrahimzadeh, H., 2006. Drought stress increases the expression of wheat leafribulose-1, 5-bisphosphate carboxylase/oxygenase protein. Iranian Journal of Science& Technology, Transaction A 30, A1.

Banerjee, D., Maity, B., Nag, S.K., Bandyopadhyay, S.K., Chattopadhyay, S., 2008. Healingpotential of Picrorhiza kurrooa (Scrofulariaceae) rhizomes against indomethacin-induced gastric ulceration: a mechanistic exploration. BMC Complementary and Al-ternative Medicine 8, 3.

Chou, W.C., Huang, Y.W., Tsay, W.S., Chiang, T.Y., Huang, D.D., Huang, H.J., 2004. Expres-sion of genes encoding the rice translation initiation factor, eIF5A, is involved indevelopmental and environmental responses. Physiologia Plantarum 121, 50–57.

Duan, H., Richael, C., Rommens, C.M., 2012. Overexpression of the wild potato eIF4E-1variant Eva1 elicits Potato virus Y resistance in plants silenced for native eIF4E-1.Transgenic Research 21, 929–938.

Dutt, S., Kiddle, G., Singh, B., Khambay, B., Foyer, C.H., 2004. Differential accumulationof picrosides in Picrorhiza kurrooa Royle ex Benth plants. http://www.rothamsted-international.org/files/posters/Posters/sondutt.pdf.

Feng, H., Chen, Q., Feng, J., Zhang, J., Yang, X., Zuo, J., 2007. Functional characterization ofthe Arabidopsis eukaryotic translation initiation factor 5A-2 that plays a crucial rolein plant growth and development by regulating cell division, cell growth, and celldeath. Plant Physiology 144, 1531–1545.

Henderson, A., Hershey, J.W., 2011. Eukaryotic translation initiation factor (eIF) 5A stim-ulates protein synthesis in Saccharomyces cerevisiae. Proceedings of the NationalAcademy of Sciences of the United States of America 108, 6415–6419.

Kala, C.P., 2000. Status and conservation of rare and endangered medicinal plants in theIndian trans Himalaya. Biological Conservation 93, 371–379.

Kawoosa, T., Singh, H., Kumar, A., Sharma, S.K., Devi, K., Dutt, S., Vats, S.K., Sharma, M.,Ahuja, P.S., Kumar, S., 2010. Light and temperature regulated terpene biosynthesis:hepatoprotective monoterpene picroside accumation in Picrorhiza kurrooa. Function-al & Integrative Genomics 10, 393–404.

Ma, F., Liu, Z., Wang, T.W., Hopkins, M.T., Peterson, C.A., Thompson, J.E., 2010. ArabidopsiseIF5A3 influences growth and the response to osmotic and nutrient stress. Plant, Cell& Environment 33, 1682–1696.

Oh, S.A., Lee, S.Y., Chung, I.K., Lee, C.H., Nam, H.G., 1996. A senescence-associated gene ofArabidopsis thaliana is distinctively regulated during natural and artificially inducedleaf senescence. Plant Molecular Biology 30, 739–754.

Pacheco, A., Martinez-Salas, E., 2010. Insights into the biology of IRES elements throughriboproteomic approaches. Journal of Biomedicine and Biotechnology 2010, 458927.

Singh, K., Raizada, J., Bhardwaj, P., Ghawana, S., Rani, A., Singh, H., Kaul, K., Kumar, S., 2004.26S rRNA-based internal control gene primer pair for reverse transcription-polymerase chain reaction-based quantitative expression studies in diverse plantspecies. Analytical Biochemistry 335, 330–333.

Singh, H., Gahlan, P., Dutt, S., Ahuja, P.S., Kumar, S., 2011. Why uproot Picrorhiza kurrooa,an endangered medicinal herb? Current Science 100, 1055–1059.

Wang, A., Krishnaswamy, S., 2012. Eukaryotic translation initiation factor 4E-mediatedrecessive resistance to plant viruses and its utility in crop improvement. MolecularPlant Pathology 13, 795–803.

Wang, T.W., Lu, L., Wang, D., Thompson, J.E., 2001. Isolation and characterization ofsenescence-induced cDNAs encoding deoxyhypusine synthase and eucaryotic trans-lation initiation factor 5A from tomato. The Journal of Biological Chemistry 276,17541–17549.

Wang, T.W., Zhang, C.G., Wu, W., Taylor, C., Thompson, J.E., 2003. Pleiotropic effects ofsuppressing deoxyhyposine synthase expression in Arabidopsis thaliana. Plant Molec-ular Biology 52, 1223–1235.

Wang, T.W., Zhang, C.G., Wu,W., Nowack, L.M., Madey, E., Thompson, J.E., 2005. Antisensesuppression of deoxyhypusine synthase in tomato delays fruit softening and altersgrowth and development. Plant Physiology 138, 1372–1382.

Wang, L., Xu, C., Wang, C., Wang, Y., 2012. Characterization of a eukaryotic translation ini-tiation factor 5A homolog from Tamarix androssowii involved in plant abiotic stresstolerance. BMC Plant Biology 12, 118.

Woo, H.R., Chung, K.M., Park, J.H., Oh, S.A., Ahn, T., Hong, S.H., Jang, S.K., Nam, H.G., 2001.ORE9, an F-box protein that regulates leaf senescence in Arabidopsis. Plant Cell 13,1779–1790.


http://refhub.elsevier.com/S0378-1119(14)00326-6/rf0005













http://www.rothamsted-international.org/files/posters/Posters/sondutt.pdf

http://www.rothamsted-international.org/files/posters/Posters/sondutt.pdf














































Xu, J., Zhang, B., Jiang, C., Ming, F., 2011. RceIF5A, encoding an eukaryotic translation ini-tiation factor 5A in Rosa chinenis, can enhance thermotolerance, oxidative and osmot-ic stress resistance of Arabidopsis thaliana. Plant Molecular Biology 75, 167–178.

Yap, M.N., Lee, R.H., Huang, Y.J., Liao, C.J., Chen, S.C., 2003. Molecular characterization of anovel senescence-associated gene SPA15 induced during leaf senescence in sweetpotato. Plant Molecular Biology 51, 471–481.


Zhang, K., Gan, S.S., 2012. An abscisic acid-AtNAP transcription factor-SAG113proteinphosphatase 2C regulatory chain for controlling dehydration in senescingArabidopsis leaves. Plant Physiology 158, 961–969.

Zhou, J., Yang, Z., Li, G., Zhang, Y., Zeng, Z., Ren, Z., 2009. Eukaryotic translation initiationfactor 5A of wheat: identification, phylogeny and expression. African Journal of Bio-technology 8, 2109–2117.















Documents

Translation initiation factor 5A in Picrorhiza is up-regulated during leaf senescence and in response to abscisic acid