Tranfer Report Final 12.11

8/3/2019 Tranfer Report Final 12.11

1/63

DPhil Transfer Report

Allele-specific silencing of proteinsof the neuromuscular junction

Angie BibaOctober 2007

Supervisor: Prof. David Beeson


2/63

Contents

Page

Abbreviations 3

Introduction 4

Aims 10

Results 1 11

Results 2 24

Results 3 34

Discussion 47

Future Experiments 51

Appendix 57

References 61

2


3/63

Abbreviations

ACh Acetylcholine

AChR Acetylcholine receptor AD Autosomal dominantCMS Congenital myasthenic syndromemiRNA Micro RNApri-miRNA Primary micro RNAqRT-PCR Quantitative real-time PCRRISC RNA induced silencing complexRNAi RNA interferenceRT-PCR Reverse transcription PCRSCCMS Slow channel congenital myasthenic syndrome

shRNA Short hairpin RNAsiRNA Small interfering RNA

3


4/63

Introduction

RNA interference (RNAi) is a mechanism of gene regulation mediated

by RNA. In nature, RNAi is initiated with the transcription of relative small non-

coding DNA sequences in the nucleus named primary microRNAs (pri-

miRNAs) (Lee et al. 2002). These are then cleaved in the nucleus by the

nuclear RNase III Drosha to produce ~70 nt long pre-miRNAs (Lee et al.

2003), the secondary structure of which is characterised by bulges and hairpin

forms. Pre-miRNA is exported from the nucleus to the cytoplasm by Exportin 5

(Yi et al. 2003; Bohnsack et al. 2004). Once in the cytoplasm pre-miRNA is

cleaved by the RNase III Dicer to produce 21-22 nt long double stranded

miRNAs (Bernstein et al. 2001; Provost et al. 2002). The antisense strand of

miRNAs is then used as a guide by the cytoplasmic protein RNA-induced

silencing complex (RISC) to identify cognate mRNA (Hammond et al. 2000;

Ameres et al. 2007). Partial complementarity between miRNA and target

mRNA leads to translational suppression while absolute complementarity

results in degradation of the target mRNA by RISC (Figure 1).

It is widely hypothesized that RNAi has evolved as an intracellular

defence mechanism against infections and transposons (Fire 2005). In this

instance, it is the presence of long double stranded RNA (dsRNA) during viral

replication that activates RNAi machinery. Although post-transcriptional gene

silencing (PTGS) has previously been described in plants (Ratcliff et al. 1997),

RNAi was first observed in invertebrate animals in C.elegans (Fire et

al.,1998). In mammalian cells, however, the introduction of long dsRNA

4


5/63

triggers interferon response leading to non-specific mRNA degradation and

cell death (Stark et al. 1998). Interferon response in mammalian cells was

evaded when chemically synthesized 21 nt short interfering RNA duplexes

(siRNAs) were used, without compromising the specificity and the efficiency of

endogenous and heterologous gene silencing (Elbashir et al. 2001). The

effects of siRNas may be short-lived due to their fast degradation in the

cytoplasm. Plasmid or viral vectors expressing short hairpin RNAs (shRNAs)

often under polymerase III (Pol III) promoters, that are then processed by

Dicer, may provide longer term gene silencing (Paddison et al. 2002) (Figure

1).

5


6/63

The specificity and the efficiency of RNAi have enabled it to be used as

6

Figure 1

Figure 1 Graphic representation of the miRNA pathway of gene regulation. At each

stage of RNAi experimental molecules can be introduced and exploit the RNAi

machinery.


7/63

a new tool for studying gene function, especially for genes where knock-outs

produce a lethal phenotype. RNAi also holds a promise as a potential therapy

for human disease. One possible application could be in the treatment of

dominant diseases. RNAi technology can potentially be employed to silence

specifically the pathogenic allele at post-trancriptional level while maintaining

expression from the normal allele. Dominantly inherited diseases such as

Huntingtons disease, familial Alzheimers disease and frontotemporal

dementia caused by tau mutations could potentially be treated with allele-

specific RNAi (Miller et al. 2004). Given that use of RNAi in vivo still faces a

series of limitations including delivery, off target effects and safety, targeting

the CNS is a challenging goal. By contrast, diseases of the neuromuscular

junction, such as congenital myasthenic syndromes, provide a more readily

accessible model for study.

Slow channel congenital myasthenic syndrome (SCCMS) is a primarily

autosomal, dominantly inherited disorder of the neuromuscular transmission

caused by mutations in the acetylcholine receptor (AChR) (Croxen et al.

2002). AChR is a pentameric ligand gated cation channel located in the

post-synaptic muscle cell membrane (Figure 2a). It consists of four

homologous subunits at a ratio of 2 :1 :1 :1 for adult AChR and

2 :1 :1 :1 for foetal AChR (Figure 2b).Each subunit has 4

transmembrane domains; mutations in each of these subunits can cause

prolonged opening of the channel leading to focal endplate myopathy,

prolonged decay of the miniature endplate potentials/currents and clinical

fatiguable muscle weakness (Sine et al. 1995; Engel et al. 1996; Croxen et al.

1997; Shen et al. 2006) (Figure 3). Chemically synthesized siRNAs and in

7


8/63

vitro synthesized shRNAs using the T7 promoter have been successfully used

to silence a point mutation in the -subunit in transiently transfected HEK

293T cells in a sequence specific manner, establishing the proof of principle

for use of RNAi in the disorder (Abdelgany et al. 2003; Shen et al. 2006)

8

Figure 3

Figure 3 Mutations causing slow-channel congenital myasthenic syndrome have been

found in all the AChR subunits. Many of them are located in the M2 transmembrane

domain that lines the channel lumen, but mutations in other domains have also been

described.

Figure 2

Figure 2 a) Simplified representation of the neuromuscular junction. ACh is released in the

synapse cleft by the presynaptic nerve terminal. ACh binding to AChR opens the ion

channel leading to muscle contraction. ACh remaining in the synapse is inactivated by

acetylcholinesterase (AChE). b) Foetal and adult forms of ACh receptor. -bungarotoxin

binds to the interface between the - and - subunits and - and - (adults) or -

subunits (foetal).

A) B)


9/63

Aims

9


10/63

1. Replicate previous findings of allele-specific silencing of a pathogenic

mutation of AChR using a tissue culture model and investigate the

ability of modified siRNA with increased stability to silence the same

mutation.

2. Characterise an animal model of SCCMS using weight and strength

measurements.

3. Investigate the ability of RNAi to silence in an allele-specific way a

previously not targeted pathogenic mutation in a tissue culture model in

vitro.

Results 1

10


11/63

Comparison of down regulation of AChR expression by siRNA

and stabilised siRNA.

At least 22 different mutations have been identified that can cause the slow

channel myasthenic syndrome. Previously, in our laboratory RNAi was used

to demonstrate allele-specific gene silencing of the mutation S226F in

transiently transfected HEK 293T cells (Abdelgany et al. 2003). In the light of

the objective of testing siRNA technology in an in vivo animal model, I first

wanted to establish that allele specificity would be retained by siRNA species

that had been modified to increase in vivo stability.

The S226F slow channel missense mutation is the result of a C to T

transition at nucleotide 677 in the -subunit of AChR, 677C>T. siRNA

19mers were designed that perfectly matched the mutant sequence (si226)

but had a single nucleotide mismatch with the wild-type sequence (Figure 4).

Modified siRNA (modified si226) is composed of a sense strand containing 2-

fluoro substitutions on all pyrimidine positions, deoxyribose in all purine

positions, with 5 and 3 inverted abasic end caps. The antisense strand

contains 2-fluoro substitutions in all pyrimidine positions, all purines are 2-O-

methyl substituted, and the 3 terminal linkage is a single phosphorothioate

linkage. The above modifications dramatically increased the stability of siRNA

in human serum (Morrissey et al. 2005). Both unmodified and modified siRNA

were provided by SIRNA (Merck & co, NJ, USA). Positive control siRNA

(siGFP), that targets green fluorescence protein (GFP), and negative control

siRNA (siNeg), that has no significant sequence similarity to mouse, rat, or

human gene sequences, were bought from Ambion (Warrington, UK).

11


12/63

Mammalian HEK 293T cells were transiently transfected with 3 ug/well

plasmid DNA expressing either the mutant S226F or WT subunit tagged

with EGFP (WT EGFP, S226FEGFP) and the -, -, and - subunits of

AChR at a ratio 2 :1 :1 :1 using PEI (Sigma). EGFP tagged -subunit

provided visualization of transfection efficiency. Additionally, EGFP was used

as target for siGFP (Figure 5). si226, Mod si226, siGFP or siNeg were co-

transfected with the AChR subunits at a 100 nM concentration using siPORT

(Ambion).

Visualization of EGFP expressing cells 48 h post transfection provided

an initial estimation of -subunit expression. si226 reduced the expression of

12

Figure 4

Figure 4 19nt long double stranded siRNA against the -subunit were designed to

perfectly match the mutated S226F sequence while having a mismatch with the

WT at position 10.

Figure 5

Figure 5 Graphic representation of the -subunit of the AChR transfected into HEK 293T

cells. The S226F mutation is located in the M1 trans-membrane domain. EGFP was

ligated into the intracellular loop between the M3 and M4 trans-membrane domains.


13/63

the mutant allele while rendering the wild-type allele unaffected. Modified

si226 was less efficient in down regulating the expression of the -subunit.

siRNA against GFP most successfully decreased the expression of its target,

whereas negative control siRNA did not have an effect on AChR expression

(Figure 6).

Cell surface 125I- -bungarotoxin (125I- -BuTx) binding measurements

were used to estimate the cell surface AChR expression. 125I- -BuTx binds

specifically and with high affinity to AChR providing a highly sensitive assay

that allows cell surface AChR expression to be quantified. Total 125I- -BuTx

binding to the surface of HEK 293T cells was measured 48 h post-

transfection, with results normalized for125I- -BuTx binding to S226FEGFP

AChR or WT EGFP AChR respectively.

si226 down regulated the expression of S226FEGFP AChR by

approximately 60%, whereas it did not affect the expression of the wild type

receptor. In contrast modified si226 failed to decrease the expression of both

mutant and wild type AChR. The positive and negative controls behaved as

expected in both cases (Figure 7).

Next, the effect of siRNA concentration on the expression of AChR was

examined. HEK293T cells were transiently transfected with either

S226FEGFP mutant or WT EGFP AChR subunits and 12.5 nM, 25 nM, 50

nM or 100 nM of siRNA respectively using PEI and siPORT as before. si221

had a concentration effect on reducing the expression of S226FEGFP

AChR, although it reaches a plateau effect at 25-50 nM. By contrast, it did not

reduce the expression of wild type AChR (Figure 8). Modified si226 did not

affect the expression of WT EGFP in any concentration, whereas it reduced

13


14/63

the expression of the mutant allele by up to approximately 25% at 25 nM.

However, this concentration effect was not linear and higher siRNA amounts

did not decrease mutant AChR expression (Figure 9). siGFP reduced the

expression of both S226FEGFP and WT EGFP AChR in a concentration

dependant way (Figure 10). siNeg did not affect the expression of either

S226FEGFP and WT EGFP AChR in a systematic way (Figure 11).

14


15/63

15

Figure 6

Example fields of HEK 293T cells expressing EGFP-tagged AChR. HEK 293T cells were

transfected with 3 g of either mutant S226FEGFP or WT EGFP AChR subunits at a

2 :1 :1 :1 ratio and 100nM of the appropriate siRNA. Plasmid DNA was transfected

using PEI and siRNAs were transfected using siPORT. 48 h post transfection cells were

visualized with fluorescent microscopy.


16/63

Figure 7

Figure 7 Surface 125 I- -BuTx binding of AChR containing S226F mutant and WT

subunits in HEK 293 cells co-transfected with 100 nM siRNA using PEI and siPORT.

Total 125 I- -BuTx binding to surface of HEK 293 cells was measured 48 h post-

transfection. Results are expressed as a percentage of 125 I- -BuTx binding to

S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3

experiments in triplicate.

No siR si226Mod si siGFP siNeg

0

50

100

150

WTEGFP AChR S226FEGFP AChR

16


17/63

Figure 8

Figure 8 Surface 125 I- -BuTx binding of AChR containing S226F mutant and

WT subunits in HEK 293 cells co-transfected with increasing amounts of si226.

Results are expressed as a percentage of125 I- -BuTx binding to S226F AChR or

WT AChR, respectively. Bars represent mean ( SD) of 3 experiments in

triplicate.

0nM 12.5n 25n 50n 100n

0

50

100

150


17


18/63

Figure 9


WT subunits in HEK 293 cells co-transfected with increasing amounts of modified

si226. Results are expressed as a percentage of 125 I- -BuTx binding to S226F

AChR or WT AChR, respectively. Bars represent mean ( SD) of 3 experiments

in triplicate.

0nM 12.5n 25n 50n 100n0

50

100

150


18


19/63

Figure 10


WT subunits in HEK 293 cells co-transfected with increasing amounts of siGFP.

Results are expressed as a percentage of125 I- -BuTx binding to S226F AChR or

WT AChR, respectively. Bars represent mean ( SD) of 3 experiments in

triplicate.

0nM 12.5n 25n 50n 100n0

50

100

150


19


20/63

Figure 11

Figure 11 Surface 125 I-BuTx binding of AChR containing S226F mutant and WT

subunits in HEK 293 cells co-transfected with increasing amounts of siNeg. Results

are expressed as a percentage of 125 I--BuTx binding to S226F AChR or WT

AChR, respectively. Bars represent mean ( SD) of 3 experiments in triplicate.

0nM 12.5n 25n 50n 100n0

50

100

150


20


21/63

In conclusion with this first set of experiments the modified siRNA

obtained from SIRNA does not appear to reduce the expression of AChR.

SIRNA, the supplier of the siRNA, has been using Lipofectamine 2000

(Invitrogen) as a transfecting reagent, whereas PEI (Sigma) and siPORT

(Ambion) were used in this instance. To test if the transfection reagent and

method were affecting in any way the efficiency of siRNA in silencing AChR

expression, a second set of experiments was conducted.

Both plasmid DNA expressing AChR and siRNAs were transiently

transfected using Lipofectamine 2000 (Invitrogen) according to the

manufacturers instructions. The ratio of AChR subunits and the amounts of

siRNA were the same as in PEI and siPORT transfections (Figure 12).

When transfected with Lipofectamine 2000 si226 equally down regulate

both the WT EGFP AChR and the S226FEGFP AChR, thus abating its

ability to distinguish between wild type and mutant -subunit. In addition,

modified si226 also exhibited some efficiency in reducing the expression of

both the WT EGFP AChR and the S226FEGFP AChR, though less

successfully (Figure 13).

The differences of the silencing efficiency of both si221 and modified

si221 when transfected with different transfection agents, namely siPORT

(Ambion) and Lipofectamine 2000 (Invotrogen), are hard to interpret. Co-

tranfection of plasmid DNA and si226 using PEI (Sigma) and siPORT

respectively resulted in allele specific silencing of the expression of the mutant

S226FEGFP AChR. When si226 and plasmid DNA were co-transfected

using Lipofectamine 2000 the allele specific effect was lost but the silencing

efficiency remained at similar levels. These discrepancies could be due to the

efficiency of the transfection agent to deliver siRNA into the cells. If

Lipofectamine is more efficient in delivering siRNA, flooding of the RNAi

system could decrease the specificity of the system for its target. Modified

siRNA, also, exhibited some silencing efficiency when transfected with

Lipofectamine but not when transfected with siPORT. Chemical modifications

of si221, that increase stability of siRNAs in vivo, could interfere with the

efficiency of PEI but not Lipofectamine to deliver them into cells.

The inherent difficulty of siRNA delivery in these experiments is

21


22/63

additionally complicated by the need for co-transfection of plasmid DNA and

siRNA, two nucleic acid molecules with different properties. In both cases

fluorescein (FITC) conjugated si226 and modified si226 would provide a

useful tool for visualization and comparison of siRNA delivery efficiency.

22


23/63

Figure 12

Example fields of HEK 293T cells expressing EGFP-tagged AChR. HEK 293T cells were

transfected with 3 g of either mutant S226FEGFP or WT EGFP AChR subunits at a

2 :1 :1 :1 ratio and 100nM of the appropriate siRNA. Both plasmid DNA and siRNA

were transfected using Lipofectamine 2000. 48 h post transfection cells were visualized

with fluorescent microscopy.

23


24/63

24

Figure 13

Figure 13 Surface 125 I-BuTx binding of AChR containing S226FEGFP mutant and

WT EGFP subunits in HEK 293 cells co-transfected with 100 nM siRNA using

Lipofectamine 2000. Total125

I- -BuTx binding to the surface of HEK 293 cells was

measured 48 h post-transfection. Results are expressed as a percentage of 125 I- -

BuTx binding to S226F AChR or WT AChR, respectively. Bars represent mean

( SD) of 3 experiments in triplicate.

Figure 13 Surface 125 I-BuTx binding of AChR containing S226F mutant and WT

subunits in HEK 293 cells co-transfected with 100 nM siRNA using Lipofectamine

2000. Total 125 I- -BuTx binding to surface of HEK 293 cells was measured 48 h

post-transfection. Results are expressed as a percentage of125 I- -BuTx binding to

S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3

experiments in triplicate.

No siRN UnM si2 Mod si2 siPos siNeg0

50

100

150



25/63

Results 2

An animal model of slow channel congenital myasthenic

syndrome (SCCMS).

RNAi is widely used as a tool for studying gene function. In addition,

RNAi holds a promise as a potential therapy for human disease, especially

dominantly inherited diseases. Towards such a prospect, the use of diseases

of the neuromuscular junction, such as congenital myasthenic syndromes as

a disease model is highly appealing, because it provides a more readily

accessible model when compared to dominant diseases of the central

nervous system. In consequence, a well established animal model of SCCMS,

a dominantly inherited congenital myasthenia, will provide an appropriate in

vivo animal model for RNAi.

In this second chapter of results, measurements of weight and strength

were used to characterise a mice model expressing a human pathogenic

mutation causing SCCMS, previously generated in the laboratory. The weight

gain is a general marker of growth and well-being of mice, while strength is

used as a marker of fatiguable muscle weakness, a clinical symptom of

SCCMS. Preceding the characterization of SCCMS mice a brief description of

their generation is given.

Generation of L221F miceMice expressing the EGFP-tagged human -subunit of the AChR

harbouring the L221F were generated by Dr J. Cossins. Briefly, the purified

expression cassette (Figure 14) was microinjected into the pronucleus of the

25


26/63

F2 hybrid oocytes from C57BL/6J x CBA/CA parents to generate mice

expressing one (heterozygous) copy of the human -subunit of the AChR

harbouring the L221F mutation along with two copies of the mouse -subunit

(h L221F+/-/m +/+). These mice were crossed with mice heterozygous for the

mouse AChR -subunit (m +/-) kindly provided by Prof. J.Sanes (Harvard

Medical School). Progeny with the genotype h L221F+/- +/- were crossed to

generate litters containing mice that were homozygous for the h L221F

transgene and heterozygous for the mouse AChR -subunit knock-out

mutation (h L221F+/+/m +/-). These were then mated either with siblings of

the same genotype or with m +/- mice, resulting in 6 distinct genotypes: i)

h +/+/m +/+, ii) h +/+/m +/-, iii) h +/+/m -/-, iv) h +/-/m +/+, v) h +/-/m +/-, vi)

h +/-/m -/-.

26

Figure 14

Figure 14. Graphic representation of the expression cassette used to create the

mice expressing human -subunit harbouring the L221F mutation that

causes congenital slow-channel myasthenic syndrome. The human genomic

DNA for -subunit contained the first ten exons and nine introns. EGFP was

inserted between the M3 and M4 membrane spanning domains of the -

subunit, resulting in expression of AChREGFP. Human cDNA encoding the last

two exons of the -subunit were ligated downstream of EGFP. Figure kindly

provided by Dr Judy Cossins.

human (genomic sequence)

EGFP

BGH pA

AChR -subunitpromoter

NheI SfiI SfiI

Expression cassette

human cDNA


27/63

Functional expression of the h L221FEGFP-subunit in mice was

determined by tetramethylrhodamine -BuTx staining by Dr Judy Cossins.

Tetramethylrhodamine -BuTx binds to the interface between the - and

- subunits and - and - subunits and has been used as a highly sensitive

way to visualize AChR at the muscle endplate. Muscles from L221F mice

were incubated with tetramethylrhodamine -BuTx. Excess

tetramethylrhodamine -BuTx was removed and muscle mounted on slides

for fluorescent microscopy. The muscles used were fast-twitch extensor

digitorum longus (EDL), slow-twitch soleus (SOL) were from a he+/-/me-/- 20

week-old male and diaphragm muscle from a he+/+/me+/- 10 week-old female.

Red stained endplates were visualized with fluorescent microscopy to identify

cell surface -expressed AChRs. EGFP was localised to the endplates

confirming expression of h L221F-EGFP. Merge of the images shows

successful incorporation of h L221F-EGFP expressing AChRs in functional

AChRs in the endplates of L221F mice (Figure 15).

27


28/63

28

Figure 15

Figure 15 Fluorescent microscope pictures of L221F mice endplates. Red= AChRs

stained with tetramethylrhodamine -bungarotoxin ( -BuTx) to identify cell surface

-expressed AChRs. Green= endplates expressing h L221F-EGFP (green). Yellow=

merge of red and green shows the incorporation of EGFP expressing AChR in functional

AChRs. Experiments were done by Dr Judy Cossins.

EDL

SOL

Diaphragm

-BuTx L221F-EGFP merge


29/63

Phenotypic assessment of the transgenic mice focused on weight and

strength performance according to the inverted screen test. Data for the male

and female, and homozygous and heterozygous mice was analysed

separately in this preliminary analysis.

Weight

In order to assess the rate of growth and general well-being of L221F

mice, mice were weighted every two weeks up to six months of age. Mice with

no mouse AChR -subunit gained weight more slowly than littermates with

one or two copies of mouse subunit. Although they put on weight they did

not reach the weight of mice with one or two alleles of mouse -subunit. This

was observed for mice with one and with two copies of the transgene (Figures

16, 17). Mice homozygous for h put on more weight than heterozygous

mice. Female mice were lighter than male mice, as expected, but put on

weight in a similar way.

29


30/63

30

Figure 16

h L221F+/+

Figure 16 Mice were weighed every two weeks up to six months of age. Points

represent average weight at each time point ( STD). a) Graph of growth of male

mice homozygous for L221F transgene. b) Graph of growth of female mice

Male

1 1 1 1 1 2 2 2 215

20

25

30

35

40

45

h221+/+/m+/+(n=3) h221+/+/m+/-(n=7) h221+/+/m-/-(n=7)

Age in weeks

Female

1 1 1 1 1 2 2 2 215

20

2530

35

40

45

h221

+/+

/m+/+

(n=3) h221

+/+

/m+/-

(n=7) h221

+/+

/m-/-

(n=7)

Age in weeks

A)

B)


31/63

31

Figure 17

h L221F+/-

Figure 17 Mice were weighed every two weeks up to 6 months of age. Points

represent average weight at each time point ( STD). a) Graph of growth of male

mice heterozygous for L221F transgene. b) Graph of growth of female mice

heterozygous for L221F transgene.

Male

1 1 1 1 1 2 2 2 215

20

25

30

35

40

45

h221+/-/m+/+(n=6) h221+/-/m+/-(n=7) h221+/-/m-/-(n=8)

Age in weeks

A)

Female

1 1 1 1 1 2 2 2 215

20

25

30

35

40

45

h221+/-/m+/+(n=5) h221+/-/m+/-(n=7) h221+/-/m-/-(n=6)

Age in weeks

B)


32/63

Strength

Fatigable muscle weakness, a clinical symptom of SCCMS, was

evaluated in mice using an inverted screen test (Contet, Rawlins and Deacon

2001). The inverted screen was a 50 cm2 screen of wire mesh consisting of

12 mm2 squares of 1 mm diameterwire surrounded by a 4 cm deep wooden

frame. Themouse was placed in the centre of the wire mesh screen and the

screen was rotated to the inverted position over 2 s, with the mouse's head

decliningfirst. The stopwatch was started and the time at which the mouse fell

was recorded, to a maximum of 5 min.

h +/+/m -/- mice were not able to hold onto the inverted screen for 5

minutes at any age tested. In contrast, h+/+

/m+/+

and h+/+

/m+/-

mice

remained on the inverted screen for the full 5 minutes. However, one male

h +/+/m +/+ mouse failed the inverted screen test at 16 weeks of age and

continued deteriorating thereafter (Figure 18a). In general, similar results were

obtained for both male and female mice (Figure 18b).

Both male and female h +/-/m +/+ mice held on to the inverted screen

for the full 5 minutes. The strength of male h +/-/m +/- mice varied highly and

started deteriorating progressively from 14 weeks of age onwards, unlike

female h +/-/m +/- mice that always reached the target of 5 minutes,

suggesting a gender effect. When looked closer, however, the male data

revealed that 3 of the 7 mice deteriorated; therefore the gender difference was

not further pursued. These three male mice are currently been used for

32


33/63

breeding in order to test if their offspring will also be characterised by

fatiguable muscle weakness. Both male and female h +/-/m -/- mice did not

reach the 5 minutes limit at any given age (Figure 19a, b).

33

Figure 18h L221F+/+

Figure 18 Mice were tested on the inverted screen every two weeks up to 6

months of age. The time they hung on the inverted screen was recorded up to 5

minutes a) Graph of male homozygous mice strength. b) Graph of female

homozygous mice strength.

Male

1 1 1 1 1 2 2 2 20

50

100

150

200

250

300

h221+/+/m+/+ (n=3) h221+/+/m+/- (n=7) h221+/+/m-/-(n=7)

Age in weeks

A)

Female

1 1 1 1 1 2 2 2 20

50

100150

200

250

300

h221

+/+

/m+/+

(n=3) h221

+/+

/m+/-

(n=7) h221

+/+

/m-/-

(n=7)

Age in weeks

B)


34/63

34

Figure 19h L221F +/-

Figure 19 Mice were tested on the inverted screen every two weeks up to 6

months of age. The time they hung on the inverted screen was recorded up to

5 minutes a) Graph of male heterozygous mice strength. b) Graph of female

heterozygous mice strength.

Male

1 1 1 1 1 2 2 2 20

50

100

150

200

250

300

h221+/-

/m+/+

(n=6) h221+/-

/m+/-

(n=7) h221+/-

/m-/-

(n=8)

Age in weeks

A)

Female

1 1 1 1 1 2 2 2 20

50

100150

200

250

300

h221+/-/m+/+(n=3) h221+/-/m+/-(n=7) h221+/-/m-/-(n=4)

Age in weeks

B)


35/63

Results 3

Can L221F-EGFP AChR expression be down regulated bysiRNA?

RNAi has been used to successfully down regulate the S226F mutant allele

while preserving the expression of the wild type (WT ) allele in transiently

transfected HEK 293T cells, providing the proof of principal for the use of

RNAi in allele-specific gene silencing (Abdelgany et al. 2003). The aim of this

set of experiments is to apply RNAi for allele-specific silencing of a different

pathogenic mutation of SCCMS, namely L221F, which is present in our

transgenic disease model. L221F is a pathogenic mutation resulting from a

C to T transition at nucleotide position 661 of the -subunit of the AChR,

661C>F. Pathogenicity of the mutation was confirmed by electrophysiology

studies, by Dr R. Webster. HEK 293 cells were transiently transfected with

either wild type AChR cDNA or with wild type and L221F

AChR cDNA. EGFP was also transfected as a marker of transfection. 48 h

after transfection green cells were studied using cell-attached patch

technique. Patch pipette contained 100 nM ACh to produce AChR activations

in bursts. Downward deflections are brief openings of individual channels.

Bursts of openings were separated by a critical closed duration, which defined

them as closures within a burst. Bursts from L221F AChR (lower

35


36/63

trace) were longer than those from wild type transfected cells (Figure 20).

Transient expression of AChR

21mer siRNA against the -subunit of AChR were designed to

perfectly match the mutant sequence L221F (si221), therefore harbouring a

mismatch with the WT protein (Figure 21). Modified siRNA (Mod si221) is

composed of a sense strand containing 2-fluoro substitutions on all pyrimidine

positions, deoxyribose in all purine positions, with 5 and 3 inverted abasic end

caps. The antisense strand contains 2-fluoro substitutions in all pyrimidine

positions, all purines are 2-O-methyl substituted, and the 3 terminal linkage is

a single phosphorothioate linkage. The above modifications dramatically

36

Figure 20

Figure 20 Single-channel activity of HEK 293 cells transfected with either wild-type or

L221F-EGFP AChR. Channel openings, represented by downward deflections,

demonstrate that L221F-EGFP AChR have longer opening times compared to wild type

AChR. Electrophysiology experiments were done by Dr Richard Webster.

Normal

Slow channel( L221F-EGFP)


37/63

increased the stability of siRNA in human serum (Morrissey et al. 2005). Both

unmodified and modified siRNA were provided by SIRNA (Merck & co, NJ,

USA). Positive control siRNA (siGFP), that targets GFP, and negative control

siRNA (siNeg), that has no significant sequence similarity to mouse, rat, or

human gene sequences, were bought from Ambion (Warrington, UK).

HEK 293T cells were transfected with 3 g of AChR and 100 ng of

dsRed expressing vector per well of a 6-well plate. DsRed expressing vector

was used as efficiency of transfection control. Plasmid DNA expressing WT ,

WT and WT subunits was transfected along with either WT or L221F

subunit at a ratio 2 :1 :1 :1 . Plasmid DNA expressing the epsilon

subunit was tagged with EGFP between the M3 and the M4 transmembrane

spanning domains (Figure 22) in order to visualize the AChR in transfected

cells. Expression of similar levels of dsRed in each condition demonstrated

that plasmid DNA transfection was equally successful (Figure 23). Expression

of EGFP was used as an initial estimation of AChR expression. Both

WT EGFP and L221FEGFP expressing AChR were efficiently transfected.

siRNA against the L221F mutation were co-transfected with the plasmid

DNA at 50 nM concentration. si221 and Mod si221 were used. si221 reduced

37

Figure 22

Figure 21 21nt long double stranded siRNA against the -subunit were design to

perfectly match the mutated L221F sequence while having a mismatch with the WT

at position 11.


38/63

the expression of both the wild type and the mutant allele. Modified si221 was

less efficient in down regulating the expression of the -subunit. siRNA

against GFP most successfully decreased the expression of its target,

whereas negative control siRNA did not have an effect on AChR expression

(Figure 24).

38

Figure 22

Figure 22. AChR -subunit was tagged with EGFP expressed in the intracellular

loop between the M3 and M4 trans-membrane domains. The L221F mutation is

located at the M1 trans-membrane domain.


39/63

Figure 23

HEK 293T cells were transfected with 3 g of AChR subunits at a 2 :1 :1 :1 , 10ng

of dsRed expressing plasmid and 50 nM of the appropriate siRNA. 48 h after transfection

cells were visualized with fluorescent microscopy. dsRed expressing cells suggests

successful transfection for each condition.

39


40/63

Figure 24

HEK 293T cells were transfected with 3 g of AChR subunits at a 2 :1 :1 :1 , 10

ng of dsRed expressing plasmid and 50nM of the appropriate siRNA. 48 h after

transfection cells were visualized with fluorescent microscopy. Down regulation of EGFP

expressing cells shows successful knock down of WT EGFP and L221FEGFP

AChR.

40


41/63

Previously, quantitative analysis of the silencing of the S226F mutant

subunit was based on surface binding 125I-BuTx assays. Given that the -

subunit, unlike the -subunit, is not essential for surface expression of AChR

in transiently transfected HEK cells, this assay would not provide an accurate

measurement of -subunit silencing. Thus, fluorescence of whole protein cell

extract and western blots were used for the evaluation of silencing at protein

level and qRT-PCR for evaluation at mRNA level. Fluorescence of whole

protein extract was measured as an initial quantitative estimation of -subunit

down regulation by siRNA. si221 reduced the expression of the mutant -

subunit by approximately 50 percent, while reducing wild type expression

by 30 percent. Modified si221 did not affect the expression of the either

WT EGFP or L221FEGFP AChR. Positive and negative control siRNA

affected the expression of both WT and 221 as expected (Figure 25).

No siRNA si221 Mod si221 siGFP siNeg0

50

100

150

WTEGFP AChR L221FEGFP AChR

Figure 25

Figure 25 Graph of fluorescence of whole cell protein extract measured in a fluorescent

plate reader. Results are expressed as a percentage of fluorescence of 221FEGFP

AChR or WT EGFP AChR, respectively. Bars represent mean ( SD) of 7 experiments in

tri licate.41


42/63

In order to estimate the subunit down-regulation by siRNA at protein

level more accurately, western blots of whole cell protein were performed.

Antibodies against both the epsilon AChR subunit and the fluorescent marker

EGFP were used. anti-GFP (ab6556, Abcam, Cambridge, UK) antibody

successfully identified the AChR -subunit EGFP fusion at the correct

molecular weight of ~82kDa , although there was also high unspecific binding

of the antibody. si221 reduced the density of the band for both WT and

L221F, while modified si221 appears to not have a major effect on protein

band density. Positive control siRNA minimized the protein expression of

EGFP-subunit and negative control siRNA did not affect the expression of

EGFP subunit (Figure 26a). For quantification of protein bands both

proteins ware normalized against the amount of -tubulin. Quantification of

the band densities shows that si221 reduced that expression of 221EGFP

by ~60% and the expression of WT EGFP by ~35%. Modified si221 does

not appear to affect the expression of WT EGFP (though its effect varies

highly from experiment to experiment as indicated by the SD bar) and reduces

the expression of 221EGFP by ~25% (Figures 26b).

42


43/63

Figure 26

Figure 26 a) Western blots with antibody against GFP. GFP antibody recognised the -

EGFP fusion protein for both WT EGFP and 221EGFP. When HEK 293T cells are

transfected with the AChR subunits, a band appears at ~81.5 kDa (arrow) (epsilon subunit

54.697 Da, GFP 26.886 Da). b) Graph of density quantification of western blot bands

recognised by anti-GFP antibody. Results were normalized against the density of -tubulin

bands. Bars represent the mean ( SD) of 3 experiments.

GFP antibody

No siRN UnM siR Mod siR siPos siNeg0

50

100

150

WTEGFP AChR

221EGFP AChR

B)

A)

43


44/63

Anti- antibody (goat polyclonal, Santa Cruz, CA, USA), with an

epitope within the last 50 amino acids of the C-terminus of AChR -subunit

of human origin, also identified the AChR -subunit EGFP fusion at ~82kDa

(Figure 27a). si221 noticeably reduced the density of the band for both WT

and 221, while modified si221 had a weaker effect on protein band density.

Positive control siRNA minimized the protein expression of EGFP-subunit

and negative control siRNA did not affect the expression of EGFP subunit.

Quantification of the band densities shows that unmodified si221 reduced that

expression of both WT EGFP and 221EGFP by ~50 %. Modified si221

down regulated the expression of WT EGFP by ~20% (though its effect

varies highly from experiment to experiment as indicated by the SD bar) and

reduced the expression of 221EGFP by ~40% (Figure 27b).

44


45/63

Figure 27

Figure 27 a) Antibody against the -subunit recognised the -EGFP fusion protein for both

WT EGFP and 221EGFP. When HEK 293T cells were transfected with the AChR subunits,

a band appeared at ~81.5 kDa (arrow) (epsilon subunit 54.697 Da, GFP 26.886 Da). b) Graph

of density quantification of western blot bands recognised by anti- antibody. Results were

normalized against the density of -tubulin bands. Bars represent the mean ( SD) of 3

experiments.

A)

anti- antibody

No siRN UnM siR Mod siR siPos siNeg0

50

100

150

WTEGFP AChR221EGFP AChR

B)

45


46/63

Quantitative estimations for the effect of siRNA on the expression of

-subunit on mRNA level were provided from real-time quantitative PCR (RT-

qPCR). Both probes against EGFP (Figure 28) and the -subunit (Figure 29)

were used to quantify the expression of -subunit EGFP fusion. GAPDH

expression was the reference gene used to normalize the EGFP and -

subunit data.

Figure 28

Figure 28 si221 reduced the expression of L221F by ~65%, but modified

si221 did not affect the expression of L221F. In contrast, both si221 and

modified si221 reduced expression of WT by ~40 %.

Real Time PCR

EGFP

0

20

40

60

80

100

120

no siRNA si221 UnM si221 Mod siPos siNeg

WTeEGFP AChR

e221EGFP AChR

46


47/63

In general unmodified si221 appears to be more successful in reducing

the expression of -subunit than modified si221, although it does not appear

to strongly differentiate between WT and 221 alleles.

Figure 28

Figure 29 Unmodified si221 reduced the expression of 221 by ~65%, but

modified si221 did not affect the expression of 221. In contrast, both

unmodified and modified si221 reduced expression of WT by ~ 50% and~60% respectively.

Real Time PCR

Human Epsilon

0

20

40

60

80

100

120

140

no siRNA si221 UnM si221 Mod siPos siNeg

WTeEGFP AChR

e221EGFP AChR

47


48/63

Discussion

The aim of this project is to use RNAi in an allele-specific way to

silence dominantly inherited mutations of the AChR causing SCCMS.

Previously, proof of principal for the use of RNAi has been provided by the

allele-specific down regulation of the S226F mutant allele while preserving

the expression of the wild type (WT) allele in transiently transfected HEK

293T cells (Abdelgany et al. 2003).

In this project we first replicated the above result and further tested the

ability of an siRNA, which has been modified in order to increase its stability to

allele specifically silence S226F. Modified siRNA did not silence either

WT or S226F expressing AChR when tranfected using PEI and siPORT.

However, it down regulated the expression of both WT and S226F AChR,

albeit moderately, when transfected using Lipofectamine 2000. Chemical

modifications of the siRNA molecule, which enable it to resist degradation in

vivo, appear to interfere with the transfection method and efficiency. These

modifications highly increase the stability of siRNA, which is essential for their

use in vivo. Further studies using different transfection agents will be essential

to test their efficient transfection and silencing capacities.

In vivo application of RNAi in dominantly inherited diseases requires a

robust animal model. As discussed above, RNAi still faces a series of

limitations related to effective delivery, off-target effects and specificity.

Therefore dominantly inherited disorders of the neuromuscular junction

48


49/63

provide a more readily accessible model for allele-specific silencing when

compared with CNS dominantly inherited disorders. The second result

chapter of this project introduced a transgenic animal model of SCCMS,

previously generated in our lab. In addition a set of experiments was

performed to characterise the model at the level of general growth and well-

being and at the level of strength. Mice expressing the human L221F

transgene in a KO mouse -subunit grow more slowly and weigh noticeably

less than littermates expressing both the human transgene and the WT

subunit. However, mice survive and have normal life expectancy.

The strength of L221F transgenic mice was also monitored.

Fatiguable muscle weakness is a prominent clinical symptom of SCCMS.

General mice strength, as measured by the inverted screen test, was

employed as a marker of fatiguable muscle weakness. Mice expressing the

human L221F transgene in a KO mouse -subunit were significantly

weaker than littermates expressing both the human transgene and the WT

subunit. Additionally, a group of h L221F+/-/m +/- also exhibited weakness at

around 14 weeks and continued deteriorating thereafter, possibly mirroring

the dominantly inherited nature of the human disease. Our results suggest

that our model is in general a useful model for in vivo application of allele-

specific RNAi; human L221F is expressed and functionally integrated in

mouse AChR at the neuromuscular junction and mice exhibit a major

characteristic of the clinical picture of the disease while preserving their

general health.

The third part of this report focuses on in vitro silencing of the L221F

mutation. si221 against L221F down regulated L221F AChR by ~50% but

49


50/63

also down regulated WT AChR by ~25%. Designing siRNAs with more than

one mutation against the WT appears to improve the discriminative ability of

siRNA and it will be used in the future to increase the specificity of si221. The

results from the modified siRNA are again more difficult to interpret. It appears

that the modified siRNA might act more slowly because it did not noticeably

decrease the expression -subunit at protein level but appeared to decrease

mRNA levels. However, no conclusions can be drawn from this set of

experiments for the effectiveness of modified siRNA against L221F.

Replication of qRT-PCR and transfections using PEI and siPORT are

essential before any conclusions can be made.

This project report is an account of three sets of experiments towards

RNAi use for allele-specific silencing of mutant AChR subunits causing

SCCMS. The future goal of this project will be to improve the effectiveness

and specificity of allele-specific silencing of L221F mutation in vitro and next

use optimized siRNA molecules in order to induce RNAi in vivo, using our

animal model of SCCMS.

50


51/63

51


52/63

Future Plans

S226F

Repeat dose response for si226 and mod si226 to obtain definitive

results on allele-specific silencing of S226F. In vitro transient

transfection of HEK cells using PEI and siPORT will approximately

require 2 weeks. Results will be assessed by surface binding of125I- -

BuTx.

The above experiments will further secure the finding that the S226Fmutation can be silenced in an allele specific way and that modified siRNA

does not produce silencing in vitro.

L221F

Transient co-transfection of HEK cells of plasmid DNA expressing

WT EGFP or L221FEGFP AChR and siRNA against L221F. Sofar si221 does not provide allele specific silencing of L221FEGFP

AChR. In order to increase both the specificity and silencing ability of

si221 an siRNA with an extra mismatch between the wild-type and

siRNA will be designed. The extra mismatches will be introduced either

at the 3-prime end/ or the 5-prime end of the anti-sense strand of

si221. The results will be assessed qualitatively using microscopy and

quantitatively using western blots (assessment at protein level) andqRT-PCR (assessment at mRNA level). These experiments should

approximately take a week and will be repeated three times (therefore

3 weeks total).

The siRNA species that will have the best allele-specific silencing

ability will be modified using the locked nucleic acid technology (LNA)

in order to improve its stability. Transient co-transfection of HEK cells

of plasmid DNA expressing WT EGFP or L221FEGFP AChR andLNA will demonstrate if the LNA modification interferes with the allele-

52


53/63

specific silencing. The results will be assessed qualitatively using

microscopy and quantitatively using western blots (assessment at

protein level) and qRT-PCR (assessment at mRNA level). These

experiments should approximately take a week and will be repeated

three times (therefore 3 weeks total).

The above experiments will determine the most effective and allele specific

siRNA sequence that will then be used in further in vitro and in vivo

experiments.

L221F transgenic mice

In vitro:

1. Establish primary muscle cell culture from L221F+/+/m -/- mice.

Mouse muscle will be trypsinized and mechanically triturated. Muscle

cells and fibroblasts are initially grown together. After 5-6 divisions

muscle cells are separated using N-CAM antibody. This procedure is

easy but the establishment of the primary cells culture depends

primarily on the growth rate of the cells. However, 4 weeks is an

estimation based on the general experience of lab members with

primary muscle cell lines. Establishing a primary muscle cell line will

allow me to work on a cell model that most accurately mirrors the in

vivo condition of the L221F mouse.

2. The above cell model will be used to optimize the transfection method

for delivering siRNA molecules and shRNA expressing vectors into

primary muscle cells. A Cy3 conjugated siRNA and a dsRed

expressing vector will be used to monitor the efficiency of transfection

agents. These experiments should take approximately a week and will

pinpoint the most effective method for transfecting primary muscle

cells.

3. Transient transfection of L221F+/+/m -/-cells with siRNA against

GFP, and L221F. This experiment will show us if siGFP and si221

can effectively knock down the expression of L221FEGFP. The

53


54/63

results will be assessed qualitatively using microscopy and

quantitatively using western blots (assessment at protein level) and

qRT-PCR (assessment at mRNA level). These experiments should

approximately take a week and will be repeated three times (therefore

3 weeks total).

4. Transient transfection of L221F+/+/m -/-cells with vectors expressing

shRNA against GFP and L221F. These experiments will show us if the

vectors are as efficient as the siRNA in silencing the mutant

L221FEGFP and the results will be assessed qualitatively using

microscopy and quantitatively using western blots (for protein knock

down) and qRT-PCR (for mRNA knock down). These experiments

should take a week and will be repeated three times (therefore 3 weeks

total).

5. Time course transient transfection of L221F+/+/m -/-cells with vectors

expressing shRNA against GFP and L221F. These experiments will

show us if the vectors provide more long lasting silencing of the mutant

L221FEGFP and the results will be assessed qualitatively using

microscopy and quantitatively using western blots (for protein knock

down) and qRT-PCR (for mRNA knock down). These experiments

should require a week and will be repeated three times (therefore 3

weeks total).

6. Establish immortal muscle cell culture from L221F+/+/m -/-. Primary

mouse muscle cells will be immortalized by infection with a

temperature-sensitive mutant of SV40, which will allow the cells to

grow undifferentiated at 33C and differentiate when grown at 40C.

These cells are easier to maintain than primary cell lines, therefore

once establish they will be preferably used. This kind of immortalization

has not been done in our lab before therefore, estimating time required

for this experiment is precarious. However, the time required should be

similar to the time required for the establishment of a stably transfected

cell line, that depends primarily on the growth rate of the cells.

7. Immortal L221F+/+/m -/- cells will be used to optimize the

transfection method for delivering siRNA molecules and shRNA

54


55/63

expressing vectors into primary muscle cells. A Cy3 conjugated siRNA

and a dsRed expressing vector will be used to monitor the efficiency of

transfection agents. These experiments should take approximately a

week and will pinpoint the most effective method for transfecting

immortalized muscle cells.

8. Transfection of immortalized L221F+/+/m -/- cells with siRNA against

GFP, and L221F. This experiment will show us if siGFP and si221

can effectively knock down the expression of L221FEGFP. The

results will be assessed qualitatively using microscopy and

quantitatively using western blots (assessment at protein level) and

qRT-PCR (assessment at mRNA level). These experiments shouldapproximately take a week and will be repeated three times (therefore

3 weeks total).

9. Transfection of immortalized L221F+/+/m -/- cells with vectors

expressing shRNA against GFP and L221F. These experiments will

show us if the vectors are as efficient as the siRNA in silencing the

mutant L221FEGFP and the results will be assessed qualitatively

using microscopy and quantitatively using western blots (for protein

knock down) and qRT-PCR (for mRNA knock down). These

experiments should take a week and will be repeated three times

(therefore 3 weeks total).

10. Time course transfection of immortalized L221F+/+/m -/- cells with

vectors expressing shRNA against GFP and L221F. These

experiments will show us if the vectors provide more long lasting

silencing of the mutant L221FEGFP and the results will be assessed

qualitatively using microscopy and quantitatively using western blots

(for protein knock down) and qRT-PCR (for mRNA knock down). These

experiments should require a week and will be repeated three times

(therefore 3 weeks total).

The above experiments are planned for primary and immortalized mouse

muscle cell lines. We do not expect to see differences between the results

from primary and immortalized cell lines of the same genotype. The

55


56/63

reason for designing the same experiments on two different cell line

models depends on the success of immortalizing the primary muscle cells

and the amount of time it might require, which is unknown to me as this

way of immortalizing cells has not been used in our lab before.

In vivo:

1. Optimize the delivery of siRNAs and shRNA expressing vectors into

tibialis anterior (TA) muscle of transgenic mice. First inject TA with

negative control siRNA labelled with Cy3 or dsRed expressing vector.

Repeat the above with electroporation. The results will tell us if siRNA

and vectors can be delivered into the cells without electroporation and

if electroporation improves the delivery of nucleic acid into muscle

cells. The contra-lateral TA muscle in each mouse will be used as

control and will be injected with saline. Results will be assessed 24

hours post tranfection for siRNA and 48 hours post tranfection by

microscopy.

2. Demonstrate knock down of expression of EGFP expressed at the

neuromuscular junction by L221FEGFP AchR. Using the optimal

method as defined by the delivery optimization experiment, siGFP and

pRS-shGFP (commercial vector expressing a short hairpin against

GFP) will be delivered to the TA of L221F+/+/m -/- mice. The results

will be assessed 2 weeks post injection. The results of the first

experiment will be assessed by microscopy. If the first experiment is

successful protein and mRNA extracts from subsequent experiment will

be used to assess the knock down of EGFP at protein (with western

blots) and mRNA (qRT-PCR) levels. These experiments should take

approximately 6 weeks.

3. Demonstrate knock down of expression of L221F expressed at the

neuromuscular junction by L221FEGFP AchR. Using the optimal

method as defined by the delivery optimization experiment, si221 will

be delivered to the TA of L221F+/+/m -/- mice. The results will be

assessed 2 weeks post injection. The results of the first experiment will

be assessed by microscopy. If the first experiment is successful protein

56


57/63

and mRNA extracts from subsequent experiment will be used to

assess the knock down of EGFP at protein (with western blots) and

mRNA (qRT-PCR) levels. These experiments should take

approximately 6 weeks.

57


58/63

AppendixMaterials and Methods

Cell culture

Human embryonic kidney (HEK 293T) cells were grown in DulbeccosModified Eagle Medium (DMEM) without Phenol Red (GIBCO), supplemented

with 20mM L-Glutamine, 110 g/mL Sodium Pyruvate, 10% foetal calf serum(FCS), antibiotics (penicillin G 100 units/mL, streptomycin sulfate 0.1 mg/mL)

and an antimycotic (amphotericin 0.25 g/mL). Cells were incubated at 37 Cin 5% CO2.

siRNA design.

21mer siRNA against the -subunit of AChR were design to perfectly

match the mutant sequence L221F, therefore harbouring a mismatch withthe WT protein (Figure 1). Both unmodified and modified siRNA wereprovided by siRNA. siRNA against GFP and negative control siRNA werebought from Ambion.

Figure 2

Figure 1 21nt long double stranded siRNA against the -subunit were design to perfectly

match the mutated sequence while having a mismatch with the WT at position 11.

Figure 1

Figure 4 19nt long double stranded siRNA against the -subunit were design to

perfectly match the mutated S226F sequence while having a mismatch with the

WT at position 10.

58


59/63

Transient Cell Transfection

24 h prior to transfection cells were plated in poly-l-lycine coated 6-wellplates at a concentration 4 x 105 per well. Cells were transiently transfected

with 3 g plasmid DNA and the desired amount of siRNA with Lipofectamine2000 (Invitrogen) per well according to the manufacturers instructions.Alternative plasmid DNA was transfected using PEI. 3ug of pDNA at aconcentration 0.8 ug/ul was mixed with 1.25ul/well 20% glucose and 1.5ul/well PEI. The mix was then added to 1mL of growing medium. siRNA wastranfected using siPORT (Ambion) according to manufacturers instructions.Plasmid and siRNA transfection mixes were combined before aliquoted toreplicate well.

Whole Cell Protein Extraction

48 h after transfection media was removed from the cells and 400 Lof extraction buffer (10mM Tris, 100mM NaCl, 1mM EDTA, 1% Triton-X, pH8.0) was added to each well of a 6-well plate. Proteolytic activity wasprevented by the addition of Protease Inhibitor Cocktail (Sigma-Aldrich) to the

protein extract (1:100 dilution), which was then incubated at 4C for 1 h withgentle rotation. The resulting homogenate was spun, the supernatant

removed and stored at -20C. A bicinchoninic acid (BCA) protein kit (Pierce)was used to measure whole cell protein concentration.

RNA extraction and cDNA preparation

RNA was extracted from HEK 293T cells using RNAeasy (Qiagen)according to the manufacturers instructions. Possible plasmid DNAcontamination of cell extracted RNA was removed by DNase treatment as

follows. 17 L RNA, 2 L 10 x DNAse Buffer (Ambion) and 1 L DNAse

(Ambion) were incubated at 37C for 30 min. The reaction was stopped with

addition of 2 L DNAse inactivation reagent (Ambion) and incubation at RTfor 15 min while flicking every couple of minutes to increase the DNAseinactivation reagent activity. After centrifugation at 13 krpm the supernatantcontaining the DNA-free RNA was removed in an RNAse-free tube. RNA wasthen quantified by OD assessment (Ultrospec 2100 pro, Amersham

Biosciences) and diluted to 1 g/ l. Reverse transcription of RNA was donewith RETROscript (Ambion) according to the manufacturers instructions. In

short, 1 g of RNA was mixed with 2 L 50uM OligodT and 9 L RNAse-

free water. The mix was heated at 80C for 3 min and then immediately

placed on ice for 2 min. After addition of 2 L 10 x RT Buffer, 4 L dNTPs

Mix (2.5 mM each dNTP), 1 L RNase Inhibitor (10 units/L) and 1 L

MMLV-RT (100 units/L), the reaction was incubated at 50C for 1 h and then

at 92C for 10 min. cDNA was stored at -20C.

59


60/63

Plate Readings

Typically 300 g of protein was made up to 200 l with proteinextraction buffer. Fluorescence was measured on Molecular Devices MaxGemini XS plate reader. The wavelengths used were as follows: EGFP

excitation: 472, emission: 512, dsRed excitation: 556, emission: 583. Eachexperiment was run in duplicate or triplicate.

Western blotting

20 g of protein from each sample was typically loaded in a pre-cast4-12% Bis-Tris NUPAGE gel and run in 1 x MES SDS running buffer for ~45min at 200V. The protein was transferred to Nitrocellulose (Protran)membrane for ~2 h at 30V. Successful transfer of protein was visualized withPonceau Red (0.1% in 5% acetic acid). Membranes were then blocked inPBS with 0.1 % Tween and 5% milk powder (Marvel) with agitation at RT for 1

h. The primary antibody (Table 1) was applied overnight at 4 C in PBS with0.1% Tween and 2% milk powder (Marvel). The membrane was washed (3 x5 min) in PBS with 0.1% Tween and the secondary antibody (Table 1) appliedfor 1 h at RT in PBS with 0.1% Tween and 2% milk powder (Marvel). ECLPlus Western Blotting Detection Reagents (Amersham) were used to detectHRP conjugated secondary antibodies. Pictures were taken with GDS-8000System (UVP Bioimaging Systems) and band optical density was quantifiedwith Labworks Analysis Software (UVP).

Table 1

Antibodies used in western blotting

Primary Antibodies Animalraised/clonality

Dilution

GFP antibody (ab6556, Abcam) Rabbit polyclonal 1:2,000

AChR antibody (sc-1454, Santa Cruz) Goat polyclonal 1:1,000

anti- -tubulin antibody (T-5168, Sigma) Mouse monoclonal 1:100,000

Secondary Antibodies Animalraised/clonality

Dilution

Anti-rabbit IgG-HRP (P0448, Dako) Goat polyclonal 1:2,000Anti-mouse IgG-HRP (P0447, Dako) Goat monoclonal 1:1,000Anti-goat IgG-HRP (P0449, Dako) Rabbit monoclonal 1:1,000

60


61/63

Real-Time quantitative PCR (RT-qPCR)

RT-qPCR was used to quantify the mRNA levels of AChR -subunit.

Both EGFP and AChR -subunit were used as probe targets. Sequences for

primers and probes for EGFP and AChR -subunits are listed in table 2. For

both targets the TaqMan-based probe system was used with TAMRAquencher at the 5 and FAM dye at the 3 prime end of the probe. RT-qPCRreactions were run in the GeneAmp 5700 system (Applied Biosystems) andthe baseline and threshold were set manually. Human GAPDH(primers/probes from Applied Biosystems) was used as a reference gene forrelative quantification. Equal amounts of each sample were combined tocreate a standard curve for each probe/primer set (named pooled standardcurve).

Table 2Primers and Probes for Real-Time PCR

EGFP

Forward Primer 5 GGGCACAAGCTGGAGTACAACT 3Reverse Primer 5 CACCTTGATGCCGTTCTTCTG 3Probe 5 CCACAACGTCTATATCATGGCCGA 3

AChR -subunitForward Primer 5 CTTCGATTGGCAGAACTGTT 3Reverse Primer 5 TGTGTCGATGTCGATCTTGT 3Probe 5 CTCTCAGACGTACAATGCCGAAG 3

61


62/63

References

Abdelgany A, Wood M, Beeson D (2003) Allele-specific silencing of apathogenic mutant acetylcholine receptor subunit by RNA interference.Human Molecular Genetics 12: 2637-2644

Ameres SL, Martinez J, Schroeder R (2007) Molecular basis for target RNArecognition and cleavage by human RISC. Cell 130: 101-112

Bernstein E, Caudy A, Hammond S, Hannon G (2001) Role for a bidentateribonuclease in the initiation step of RNA interference. Nature 409:363-366

Bohnsack M, Czaplinski K, Gorlich D (2004) Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10: 185-191

Contet, C., J. N. P. Rawlins & R. M. J. Deacon (2001) A comparison of129S2/SvHsd and C57BL/6JOlaHsd mice on a test battery assessingsensorimotor, affective and cognitive behaviours: implications for the

study of genetically modified mice. Behavioural Brain Research, 124,33-46.

Croxen R, Hatton C, Shelley C, Brydson M, Chauplannaz G, Oosterhuis H,Vincent A, Newsom-Davis J, Colquhoun D, Beeson D (2002)Recessive inheritance and variable penetrance of slow-channelcongenital myasthenic syndromes. Neurology 59: 162-168

Croxen R, Newland C, Beeson D, Oosterhuis H, Chauplannaz G, Vincent A,NewsomDavis J (1997) Mutations in different functional domains of thehuman muscle acetylcholine receptor alpha subunit in patients with theslow-channel congenital myasthenic syndrome. Human MolecularGenetics 6: 767-774

Elbashir S, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001)Duplexes of 21-nucleotide RNAs mediate RNA interference in culturedmammalian cells. Nature 411: 494-498

Engel AG, Ohno K, Milone M, Wang HL, Nakano S, Bouzat C, Pruitt JN,Hutchinson DO, Brengman JM, Bren N, Sieb JP, Sine SM (1996) Newmutations in acetylcholine receptor subunit genes reveal heterogeneityin the slow-channel congenital myasthenic syndrome. HumanMolecular Genetics 5: 1217-1227

Fire A (2005) Nucleic acid structure and intracellular immunity: some recentideas from the world of RNAi. Q Rev Biophys 38: 303-309

Fire A, Xu S, Montgomery M, Kostas S, Driver S, Mello C (1998) Potent andspecific genetic interference by double-stranded RNA inCaenorhabditis elegans. Nature 391: 806-811

Hammond S, Bernstein E, Beach D, Hannon G (2000) An RNA-directednuclease mediates post-transcriptional gene silencing in Drosophilacells. Nature 404: 293-296

Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Rdmark O,Kim S, Kim V (2003) The nuclear RNase III Drosha initiates microRNAprocessing. Nature 425: 415-419

Lee Y, Jeon K, Lee J, Kim S, Kim V (2002) MicroRNA maturation: stepwiseprocessing and subcellular localization. EMBO J 21: 4663-4670

Miller V, Gouvion C, Davidson B, Paulson H (2004) Targeting Alzheimer'sdisease genes with RNA interference: an efficient strategy for silencing

62


63/63

mutant alleles. Nucleic Acids Res 32: 661-668Paddison P, Caudy A, Bernstein E, Hannon G, Conklin D (2002) Short hairpin

RNAs (shRNAs) induce sequence-specific silencing in mammaliancells. Genes Dev 16: 948-958

Provost P, Dishart D, Doucet J, Frendewey D, Samuelsson B, Rdmark O

(2002) Ribonuclease activity and RNA binding of recombinant humanDicer. EMBO J 21: 5864-5874

Ratcliff F, Harrison BD, Baulcombe DC (1997) A similarity between viraldefense and gene silencing in plants. Science 276: 1558-1560

Shen XM, Deymeer F, Sine SM, Engel AG (2006) Slow-channel mutation inacetylcholine receptor alpha M4 domain and its efficient knockdown.Annals of Neurology 60: 128-136

Sine SM, Ohno K, Bouzat C, Auerbach A, Milone M, Pruitt JN, Engel AG(1995) Mutation of the acetylcholine-receptor alpha-subunit causes aslow-channel myasthenic syndrome by enhancing agonist binding-affinity. Neuron 15: 229-239

Stark G, Kerr I, Williams B, Silverman R, Schreiber R (1998) How cellsrespond to interferons. Annu Rev Biochem 67: 227-264

Yi R, Qin Y, Macara I, Cullen B (2003) Exportin-5 mediates the nuclear exportof pre-microRNAs and short hairpin RNAs. Genes Dev 17: 3011-3016

Documents

Tranfer Report Final 12.11